Papillary thyroid microcarcinoma with fatal outcome: evidence of tumor progression in lymph node metastases

Human Pathology (2013) 44, 556–565

www.elsevier.com/locate/humpath

Original contribution

Papillary thyroid microcarcinoma with fatal outcome: evidence of tumor progression in lymph node metastases Report of 3 cases, with morphological and molecular analysis Simonetta Piana MD a,⁎,1 , Moira Ragazzi MD a,1 , Giovanni Tallini MD b,1 , Dario de Biase PhD b , Alessia Ciarrocchi PhD c , Andrea Frasoldati MD d , Juan Rosai MD e,f a

Pathology Unit, IRCCS-Arcispedale Santa Maria Nuova, 42123 Reggio Emilia, Italy Department of Pathology, University of Bologna Medical School, 40139 Bologna, Italy c Molecular Biology Laboratory, IRCCS-Arcispedale Santa Maria Nuova, 42123 Reggio Emilia, Italy d Endocrinology Unit, IRCCS-Arcispedale Santa Maria Nuova, 42123 Reggio Emilia, Italy e International Center for Oncologic Pathology Consultations, Centro Diagnostico Italiano, 20147 Milan, Italy f Integrated Oncology, New York, NY 10019 b

Received 25 May 2012; revised 28 June 2012; accepted 29 June 2012

Keywords: Microcarcinoma; Papillary thyroid carcinoma; Tall cell variant; BRAF; Fatal outcome

Summary Papillary thyroid microcarcinoma generally carries an excellent prognosis, and fatal cases are becoming increasingly rare. Their pathologic and molecular features, however, remain largely unknown. We describe 3 cases of papillary thyroid microcarcinoma that, despite surgical and radioiodine treatment, recurred, metastasized, and eventually caused the death of the patients. In addition to morphology, immunohistochemical (cyclin D1 and p53) and molecular analyses (BRAF [v-raf Murine sarcoma viral oncogene homolog B1], KRAS [V-Ki-ras2 Kirsten rat sarcoma viral oncogene homolog], HRAS [v-Ha-ras Harvey rat sarcoma viral oncogene homolog], NRAS [neuroblastoma RAS viral oncogene homolog], and PIK3CA [phosphoinositide-3-kinase, catalytic, alpha polypeptide]) were performed. Interestingly, all 3 cases presented with massive lymph node metastases that showed morphological evidence of “tumor progression” (tall cell features, poorly differentiated areas, and high-grade cytologic features). Cyclin D1 was consistently immunoreactive in both primary and metastatic site, whereas p53 was negative. BRAF V600E was absent in both sites, and KRAS, HRAS, NRAS, and PIK3CA were consistently wild type. These data suggest that, in cases of metastatic papillary thyroid microcarcinoma, an accurate morphologic analysis of the metastatic deposits could contribute to a more accurate prediction of tumor behavior. © 2013 Elsevier Inc. All rights reserved.

1. Introduction ☆ Disclosure/conflict of interest: The authors declare no conflict of interest. ⁎ Corresponding author. E-mail address: [email protected] (S. Piana). 1 These authors share the first authorship.

0046-8177/$ – see front matter © 2013 Elsevier Inc. All rights reserved. http://dx.doi.org/10.1016/j.humpath.2012.06.019

Papillary thyroid microcarcinoma (PTMC) is defined by the World Health Organization as an incidental papillary thyroid carcinoma (PTC) measuring less than or equal to 1 cm in

Fatal papillary thyroid microcarcinoma maximum diameter [1]. Because of the widespread use of thyroid ultrasound screening and ultrasound-guided fine needle aspiration biopsy (FNAB), its incidence is increasing. In the United States, in fact, it has been estimated to be the most commonly found thyroid tumor in patients older than 45 years [2]. Generally associated with an excellent prognosis, PTMC is usually considered of little clinical significance, to the point that a proposal has been made to rename it papillary thyroid microtumor [3]. Although PTMC is sometimes associated with lymph node metastases and, much less frequently, to distant metastases, the tumor responds to radioactive iodine therapy, and fatal cases of PTMC are increasingly rare [4], with an incidence ranging from 0.3% [5] to 0.5% [6]. Because of their extreme rarity, the pathologic and molecular genetic features of fatal cases of PTMC are largely unknown [6-9]. In this work, we describe 3 cases of PTMC with a fatal outcome. Interestingly, all 3 cases were characterized by massive lymph node metastases at clinical presentation, and histologic examination of the resected lymph nodes showed morphologic evidence of “tumor progression.” We hypothesize that this development into lymph node metastases was responsible for the fatal outcome.

2. Material and methods The files of the Pathology Unit of the IRCCS-(Istituto di Ricovero e Cura a Carattere Scientifico-Arcispedale Santa Maria Nuova) Arcispedale Santa Maria Nuova, Reggio Emilia, Italy, were searched for all cases diagnosed as PTMC from January 1979 to December 2006 having a minimum of 5 years of follow-up. Of a total of 441 PTMCs found, the death of 3 patients (0.68%) was due to their thyroid carcinoma, according to their clinical medical records and death certificates. All the histologic slides from these 3 cases (including the lymph node metastases) were reviewed by the authors and reclassified according to the seventh edition of the TNM-based staging system by the American Joint Commission on Cancer. Any divergent characteristics between the primary thyroid neoplasm and the lymph node metastases were recorded. Paraffin blocks were available for all the primary tumors and the corresponding lymph node metastases. The mutation V600E of the BRAF (v-raf Murine sarcoma viral oncogene homolog B1) gene and hot spot RAS and PIK3CA (phosphoinositide-3kinase, catalytic, alpha polypeptide) mutations were assessed by DNA sequencing on selected areas to ensure greater than 90% content of neoplastic cells. Genomic DNA was extracted using the Biostic formalin-fixed and paraffin-embedded tissue DNA isolation kit (Mobio Laboratories, Inc, Carlsbad, CA) according to manufacturer instructions. Polymerase chain reactions (PCRs) for exon 15 of the BRAF gene; exons 2 and 3 of HRAS (v-Ha-ras Harvey rat sarcoma viral oncogene homolog), NRAS (neuroblastoma RAS viral oncogene homolog), and KRAS (V-Ki-ras2 Kirsten rat sarcoma viral oncogene homolog)

557 Table 1

Primers used for molecular analysis

Gene and Primer sequence (5′-3′) exon BRAF Ex15Fw BRAF Ex15Rv KRAS Ex2Fw KRAS Ex2Rv KRAS Ex3Fw KRAS Ex3Rv HRAS Ex2Fw HRAS Ex2Rv HRAS Ex3Fw HRAS Ex3Rv NRAS Ex2Fw NRAS Ex2Rv NRAS Ex3Fw NRAS Ex3Rv PIK3CA Ex9Fw PIK3CA Ex9Rv PIK3CA Ex20Fw PIK3CA Ex20Rv

TCATAATGCTTGCTCTGATAGGA GGCCAAAAATTTAATCAGTGGA AAGGTGAGTTTGTATTAAAAGGTACTGG TGGTCCTGCACCAGTAATATGC TCCAGACTGTGTTTCTCCCTTCTC AAAACTATAATTACTCCTTAATGTCAGCTT CAGGAGACCCTGTAGGAGGA CTCCCTGGTACCTCTCATGC TCCTGCAGGATTCCTACCGG GGTTCACCTGTACTGGTGGA GATGTGGCTCGCCAATTAAC TGGGTAAAGATGATCCGACAA GGTGAAACCTGTTTGTTGGA TCAATGTCAAACAACCTAAAACCAA TCTGTGAATCCAGAGGGGAAA CTCCATTTTAGCACTTACCTG TCGACAGCATGCCAATCTCT TGGAATCCAGAGTGAGCTTTC

Abbreviations: Ex, exon; Fw, Forward; Rv, Reverse.

genes; and exon 9 and 20 of the PIK3CA gene were performed using the primers described in Table 1. The PCR products were purified using the PCR purification kit (Qiagen, Milan, Italy) and sequenced using the Genome Lab DTCS-quick start kit (Beckman Coulter, Galway, Ireland) according to manufacturer instructions. The DNA sequence was performed using a CEQ 8000 Genetic Analysis Systems (Beckman Coulter, Inc, Brea, CA). Immunohistochemical stains were performed both on the primaries and on the lymph node metastases with the antibodies cyclin D1 (SP4; Ventana) and p53 (DO-7; Dako).

3. Results The clinical and pathologic features of these cases are summarized in Table 2, whereas the results of BRAF, RAS,

558

S. Piana et al.

Table 2

Clinicopathologic features

Features

Case 1

Case 2

Case 3

Sex/age Surgery

M/64 y Lymph node dissection + total thyroidectomy Right lobe

M/47 y Total thyroidectomy + lymph node dissection Left lobe

F/74 y Total thyroidectomy + lymph node dissection Left, pyramidal, and right lobes

0.3

0.4 0.6

Follicular IVa (pT1a, N1b, M0) 1/8

Papillary, follicular IVa (pT1a, N1b, M0) 11/49

0.35 LL 0.4 0.35 RL 0.1 Follicular IVa (pT1a, N1b, M0) 5/5

6

3

4

Papillary, tall cell Brain

Papillary, tall cell Bones (vertebra, femur, iliac bone) and skin 28

Papillary, tall cell Lung and pleura

PTMC site PTMC size (cm) Tumor 1 Tumor 2 Tumor 3 Tumor 4 PTMC growth pattern Stage at diagnosis (pTNM) No. of metastatic lymph nodes (positive/total) Size of largest metastatic deposit (cm) Metastasis growth pattern Site of the distant metastases Survival time from diagnosis (mo)

68

131

Abbreviations: M, Male; F, Female; LL, left lobe; RL, right lobe.

and PIK3CA sequencing and of cyclin D1 and p53 immunohistochemistry are listed in Table 3.

3.1. Clinical findings 3.1.1. Case 1 A 64-year-old man presented in September 1987 with a right laterocervical mass, 6 cm in greatest diameter, consistent with lymphadenopathy of the upper portion of

Table 3 Features BRAF

a

DNA sequencing and immunohistochemical results Case 1

Case 2

Case 3

PTMC: WT

PTMC (0.6 cm): WT PTMC (0.4 cm): WT LN: WT LN: WT LN: WT LN: WT LN: WT T: POS LN: POS T: NEG LN: NEG

PTMC (0.35 cm LL): WT PTMC (0.4 cm): WT LN: WT LN: WT LN: WT LN: WT LN: WT T: POS LN: POS T: NEG LN: NEG

LN: WT

KRAS b HRAS b NRAS b PIK3CA c Cyclin D1 p53

LN: WT LN: WT LN: WT LN: WT T: POS LN: POS T: NEG LN: NEG

Abbreviations: WT, wild type; LN, lymph node metastasis; T, tumor; POS, positive immunoreactivity in more than 20% of neoplastic cells; NEG, immunoreactivity in less than 20% of neoplastic cells. a Exon 15. b Exons 2 and 3. c Exons 9 and 20.

the internal jugular chain. A right laterocervical lymph node dissection revealed metastatic involvement of lymph nodes by PTC, and a total thyroidectomy was performed. Surgery was followed by radioiodine (131I) ablation treatment at an undefined dose. The patient refused any further test or treatment other than basal blood sampling and suppressive therapy with L-thyroxine (L-T4). Five years later, a whole body scintigraphy (WBS) showed a suprajugular pathologic uptake, for which he received 131I ablation therapy with 103.5 mCi. The chest x-ray was negative. The patient died 6 years after the initial diagnosis with multiple cystic brain metastases evident on computed tomographic (CT) scan. 3.1.2. Case 2 In August 1993, a 47-year-old man presented with a left laterocervical lymphadenopathy clinically suspicious for lymphoproliferative disorder. After an FNAB diagnosis of PTC lymph node metastasis, he underwent a total thyroidectomy with left cervical neck dissection, followed by 131I treatment (200 mCi). Posttreatment WBS showed only a median neck uptake, consistent with thyroid remnants. Serum thyroglobulin (Tg) levels, measured after a 4-week period of L-T4 withdrawal, were 55 ng/mL. Six months later, a diagnostic WBS was completely negative, whereas serum Tg levels had risen to 114 ng/mL. Computed tomographic scan and bone scintigraphy revealed bone metastases at multiple sites (femur, vertebrae, and iliac bone). The clinical history and the imaging data ruled out any primaries other than thyroid. The patient received chemotherapy (bleomycin-cisplatin-adriamycin, 5 cycles) plus external radiotherapy without apparent clinical

Fatal papillary thyroid microcarcinoma

559

Fig. 1 A, A subcapsular well-defined PTMC measuring 0.3 cm in greatest diameter with focal osseous metaplasia (hematoxylin and eosin, ×20). B, At high power, neoplastic follicles lined by typical PTC nuclei (hematoxylin and eosin, ×400). C, Immunohistochemical positivity for cyclin D1 in neoplastic follicular cells (×400). D, Massive lymph node metastasis with papillary architecture (hematoxylin and eosin, ×40). E, At higher magnification, the cells show features of the tall cell variant of PTC (hematoxylin and eosin, ×200). F, Diffuse reactivity with cyclin D1 in metastatic papillae (×200).

560

S. Piana et al.

Fatal papillary thyroid microcarcinoma benefit. The patient died of disseminated intravascular coagulopathy 2 years after the initial diagnosis, with multiple bone metastases and a subcutaneous recurrence of PTC in the presternal skin. 3.1.3. Case 3 A 74-year-old woman presented in 1996 with a right laterocervical mass measuring 4 × 3 × 2.5 cm. A diagnosis of metastatic PTC was rendered on FNAB. The patient underwent total thyroidectomy plus central and right lateral neck dissection followed by 131I ablation therapy. Posttreatment WBS did not reveal any pathologic uptake, and serum Tg levels, measured after L-T4 withdrawal, were 5 ng/mL. Over the following years, serum Tg levels progressively increased, whereas WBS performed after administration of therapeutic 131I doses (150 and 200 mCi) was negative. In 2003, an 18fluorodeoxyglucose positron emission tomography showed increased uptake in the lung, corresponding to a mass associated with pleural thickening on CT scan. The patient died 10 years after the initial diagnosis due to disseminated pleuropulmonary metastases of PTC, documented by examination of pleural fluid cytology.

3.2. Pathologic findings 3.2.1. Case 1 The PTMC was located in the upper portion of the right thyroid lobe and measured 0.3 cm in greatest diameter. It was located in the subcapsular region and did not extend beyond the thyroid gland. It consisted of tiny neoplastic foci with a follicular pattern of growth, embedded in a well-defined area of osseous metaplasia (Fig. 1A and B). There were no tall cells or poorly differentiated features. Vascular invasion and mitoses were absent. The surrounding thyroid tissue showed a few hyperplastic nodules. The specimen from the laterocervical dissection revealed a single massive lymph node metastasis (6 cm in greatest diameter) and 7 reactive lymph nodes. The metastasis had a papillary architecture and was composed of cells with the nuclear features of PTC whose height were at least 3 times their width, thus fulfilling the criteria for the tall cell variant of PTC (Fig. 1D and E). There was no evidence of extranodal extension or necrosis. Two mitoses per 10 high-power fields (×400) were observed. Analysis of BRAF V600E mutations was negative both in the thyroid tumor and in the lymph node metastasis.

561 KRAS, HRAS, NRAS, and PIK3CA were not mutated in the lymph node metastasis. No additional material was available for testing these genes in the primary thyroid tumor. Nuclear cyclin D1 expression was detected immunohistochemically in the PTMC (Fig. 1C) and in most metastatic cells in the lymph node (Fig. 1F). p53 immunostaining was negative (Table 3). 3.2.2. Case 2 Within a hyperplastic goiter, 2 PTMCs measuring 0.4 and 0.6 cm, respectively, were found in the left thyroid lobe. One was a subcapsular nodule with a pure papillary welldifferentiated architecture surrounded by a thin fibrous capsule and without signs of infiltration (Fig. 2A and B). The second lesion consisted of small foci of follicular structures situated at the periphery of a hyperplastic nodule with regressive changes, including fibrosis and multiple calcifications, which grossly measured 1.5 cm. Both PTCs lacked tall cells or poorly differentiated features, and no mitoses were detected. Of the 49 lymph nodes found in the laterocervical dissection, 11 contained metastatic tumor. The largest metastatic deposit was 3 cm in greatest diameter, and it had extended to the perinodal soft tissue. Microscopic examination showed a tall cell variant of papillary carcinoma (Fig. 2D) with poorly differentiated oncocytic areas (Fig. 2E) and foci of necrosis. There were 5 mitoses per 10 high-power fields (×400). No vascular invasion was noted. The presternal skin metastasis consisted of neoplastic papillae (Fig. 2G), lined by tall cells with nuclear groves and pseudoinclusions (Fig. 2H), infiltrating the deep dermis. The BRAF V600E mutation, searched for both in the PTMCs and in the greatest lymph node deposit, was negative. KRAS, HRAS, NRAS, and PIK3CA were not mutated in the lymph node metastasis. No additional material was available for testing these genes in the primary thyroid tumor. Immunohistochemical stains were performed both on the subcapsular thyroidal neoplastic focus and on the lymph node metastases, and the results were similar to case 1, that is, nuclear cyclin D1 was positive in the primary (Fig. 2C) and in the metastases (Fig. 2F), whereas p53 staining was negative (Table 3). 3.2.3. Case 3 Four foci of PTMC were found, measuring, respectively, 0.35 (left lobe), 0.4 (pyramidal lobe), 0.35 (right lobe), and 0.1 cm (right lobe). All showed a follicular pattern of growth and did not extend beyond the thyroid capsule (Fig. 3A and B). The 0.35-cm focus in the right lobe was limited to a few neoplastic follicles entrapped in an ossified nodule. The 0.1-

Fig. 2 A, Subcapsular PTMC focus with a pure papillary well-differentiated architecture, surrounded by a thin fibrous capsule and without signs of infiltration (hematoxylin and eosin, ×20). B, At high power, typical clear nuclei are evident (hematoxylin and eosin, ×400). C, Focal nuclear immunoreactivity for cyclin D1 in neoplastic cells (×400). D, Large metastatic lymph node deposit with a papillary growth pattern (hematoxylin and eosin, ×100). E, At high power, tightly packed papillae with tall cell features (hematoxylin and eosin, ×200). F, Diffuse reactivity with cyclin D1 in metastatic papillae (×400). G, Subcutaneous metastasis with a papillary growth pattern (hematoxylin and eosin, ×40). H, At high power, tall cell features and a nuclear pseudoinclusion are evident (hematoxylin and eosin, ×400).

562

S. Piana et al.

Fatal papillary thyroid microcarcinoma cm focus, also in the right lobe, was surrounded by a thick fibrous capsule. None of the foci showed tall cell or poorly differentiated areas. There was neither mitotic activity nor vascular invasion. All 5 lymph nodes examined microscopically showed involvement by a tall cell variant PTC (Fig. 3D and E) associated with extranodal extension. Five mitoses per 10 high-power field (×400) were counted. The pleural fluid cytology documented clusters of neoplastic cells with occasional nuclear pseudoinclusions and psammomabodies on a background of mesothelial cells and inflammatory cells, mostly granulocytes (Fig. 3G and H). The BRAF status was investigated in 2 of the thyroid foci of PTMC (located, respectively, in the pyramidal and left lobe) and in the largest lymph node metastasis and was found to be wild type. KRAS, HRAS, NRAS, and PIK3CA were not mutated in the lymph node metastasis. No additional material was available to test these genes in the primary thyroid tumors. Immunoreactivity for cyclin D1 was detected in most neoplastic cells in the largest PTMC focus (Fig. 3C) and in the neoplastic cells of the largest lymph node metastasis (Fig. 3F). p53 stain was negative (Table 3).

4. Discussion Papillary thyroid microcarcinoma is characterized by an extremely good prognosis even when lymph node metastases are present. Our series consists of 2 men and 1 woman with PTMCs ranging in size from 0.3 to 0.6 cm without extrathyroidal extension or distant metastases at the time of diagnosis. Despite surgical and radioiodine treatment, these tumors recurred, metastasized, and eventually caused the death of the patients after a period ranging from 28 to 131 months. The metastases were located in the brain, bones/ skin, and lungs in cases 1, 2, and 3, respectively. In cases 1 and 2, the CT scans confirmed the metastatic origin of the brain and bone lesions, whereas in case 3, a cytologic examination of the pleural fluid showed neoplastic cells with typical nuclear pseudoinclusions. In 2 of the cases (cases 2 and 3), the PTMCs were multifocal. Multifocality is a frequent feature of PTMC, occurring in 30% to 40% of all cases in the larger series [10,11], and is defined as the independent clonal origin of the neoplastic foci, which could reasonably cause either a different phenotype or different biological behavior [12]. Multifocality has consistently been related with an increased risk of distant metastases [13], and multifocality, together with a superficial location—present in all our cases—has been associated with PTMCs aggressive behavior by risk stratification models [14]. Interestingly, in all 3 of our

563 patients, the cervical lymph node metastases were diagnosed before the primary carcinomas. This is in agreement with the findings reported by other authors [15,16] who pointed out that PTMCs with bulky lymph node metastases at presentation—defined as “symptomatic”—represented a high-risk subtype and were associated with aggressive biological behavior. In contrast, nodal metastases that are detected only at the microscopic level do not seem to affect the prognosis of patients with PTMC [15]. In all 3 of our cases, there was a morphologic discrepancy between the primary tumors and the nodal metastases. The latter were large, ranging from 3 to 6 cm, and in 2 cases (cases 2 and 3), there was widespread tumor extension beyond the nodes. In all cases, metastatic deposits showed histologic features consistent with the tall cell variant of papillary carcinoma. In addition, the metastases in case 2 contained some poorly differentiated and necrotic areas. No clear-cut hobnail features were noted in any of the cases. Conversely, all 7 foci of primary PTMC appeared well differentiated and confined to the thyroid gland. As a matter of fact, 2 of the nodules were surrounded by an intact capsule (case 2, 0.4-cm tumor; case 3, 0.1-cm tumor). Recently, Marcy et al reported a case of an occult 0.4-cm PTMC with a fulminant lethal outcome, showing well-differentiated features in the thyroid and undifferentiated oncocytic areas in the largest lymph node deposit [4]. These findings are at variance with those of Tickoo et al, who found the bone metastases of thyroid carcinomas to be equally or even better differentiated than the primary tumor in almost all their cases [17]. Morphologic and quantitative discordances between a primary tumor and its metastases are well-known phenomena. In the testis, for instance, metastases of germ cell tumors often differ from the residual viable tumor, which is sometimes scarce or unidentifiable (so-called burned out germ cell neoplasia) [18]. Although testicular germ cell tumors usually regress with a scar, in our cases, the primary PTMC was partially replaced by sclerosis and calcification (case 2, nodule of 0.6 cm) and by osseous metaplasia (cases 1 and 3, nodule of 0.35 cm in the right lobe), a well-described occurrence in the thyroid particularly in benign nodules [19]. In the thyroid, histologic evidence of regression of the primary carcinoma has been reported by Simpson and Albores-Saavedra. The authors described 2 cases of PTMC presenting with massive lymph node metastases and with the primary PTMCs measuring less than 1.5 mm and showing morphologic changes suggestive of partial regression [20]. It is also noteworthy that 2 of our 3 cases showed intratumoral metaplastic ossification; one of us has observed that this feature, when present in clinically apparent PTC, seems to be

Fig. 3 A, A 0.4-cm subcapsular PTMC focus with a follicular pattern of growth (hematoxylin and eosin, ×20). B, At high power, cytologic details of the neoplastic focus (hematoxylin and eosin, ×400). C, Nuclear positivity for cyclin D1 in the neoplastic cells (×400). D, Lymph node involvement by a tall cell variant PTC (hematoxylin and eosin, ×40). E, Typical pattern of growth in tall cell PTC (hematoxylin and eosin, ×400). F, Diffuse reactivity for cyclin D1 in metastatic papillae (×400). G, Pleural fluid cytology; clusters of neoplastic cells with a psammoma body (Papanicolaou stain, ×200). H, At higher magnification, a nuclear pseudoinclusion is evident (Papanicolaou stain, ×600).

564 associated with a greater degree of tumor aggressiveness, manifested by an increased frequency of multifocality, extrathyroid extension, lymph node metastases, and distant metastases (J.R., personal observation). It is reasonable to assume that the morphology of the metastases will influence survival, even if the literature data are controversial on this point [17,21-24]. In our small series, the metastatic carcinoma in all 3 cases belonged to the tall cell variant, regarded by most as a biologically and clinically aggressive type of PTC [25]. Furthermore, one of the cases (case 2) showed poorly differentiated features. Our data lead us to favor the interpretation that the tumor that led to death developed from the lymph node metastases rather than in the thyroid itself, a hypothesis that seems supported on the one hand by unfavorable features in the former (tall cell features, poorly differentiated areas, and high-grade cytologic features) and on the other by regressive changes in the latter. This observation is consistent with the concept of progression in thyroid cancer, which comprises many genetic events [26]. An important and practical consequence of this putative progression in lymph node is that the assessment of the histologic grade on the primary neoplasm could underestimate the real aggressiveness of the tumor. It follows that, in cases of PTMC with lymph node metastases, an accurate morphologic evaluation of the metastatic deposits should be performed to accurately predict tumor behavior. Interestingly, the search for oncogene mutations in the most commonly altered hot spots in thyroid carcinomas did not reveal any alterations. This implies that other genetic alterations still to be defined may play a crucial function in driving progression toward a more aggressive phenotype of these lesions. The lack of a BRAF V600E mutation in all of our cases, either at the primary site or in the metastatic lesions, is disappointing but not completely unexpected. Although an association of the BRAF V600E mutation with both the tall cell variant histotype [27] and with invasiveness of small thyroid tumors [28] has been described and although claims have been made by some authors that this mutation is associated with an increased risk of tumor recurrence and metastases [8], other works have questioned the functional importance of this molecular genetic aberration in driving the metastatic spread of PTC [29] or its role as a prognostic marker of aggressive thyroid disease [30]. Our experience—and that of others—supports the opinion that BRAF mutation is not always a prognostic factor independent of other clinicopathologic parameters such as PTC size and patients' age [31,32]. This is corroborated by a recent study of our group that found that the frequency of the BRAF mutation was lower in welldifferentiated PTCs with distant metastases than in a series of “clinically” cured PTCs [33]. Similarly, neither hot spot RAS and PIK3CA mutations nor nuclear accumulation of p53, described in aggressive and poorly differentiated forms of thyroid cancer [34], were detected in our cases. Interestingly, cyclin D1 was expressed

S. Piana et al. in the nucleus of most of both primary PTMC and metastatic tumor cells. Cyclin D1 is commonly overexpressed in PTMC with metastatic potential, although the basis of its upregulation is unclear [35]. Findings in our 3 cases suggest that cell cycle deregulation has an important role in the progression of PTC and support its potential use as a prognostic marker [32].

Acknowledgment Alessia Ciarrocchi is supported by AIRC (Italian Association for Cancer Research grant number MFAG 10745) and by the Guido Berlucchi Foundation.

References [1] DeLellis RA, Lloyd RV, Heitz PU, Eng C. World Health Organization classification of tumours. Lyon, France: Pathology and Genetics of Endocrine Organs; 2004. [2] Hughes DT, Haymart MR, Miller BS, Gauger PG, Doherty GM. The most commonly occurring papillary thyroid cancer in the United States is now a microcarcinoma in a patient older than 45 years. Thyroid 2011;21:231-6. [3] Rosai J, LiVolsi VA, Sobrinho-Simoes M, Williams ED. Renaming papillary microcarcinoma of the thyroid gland: the Porto proposal. Int J Surg Pathol 2003;11:249-51. [4] Marcy PY, Thariat J, Peyrottes I, et al. Fulminant lethal spread of occult papillary microcarcinoma of the thyroid. Thyroid 2010;20: 445-8. [5] Hay ID, Hutchinson ME, Gonzalez-Losada T, et al. Papillary thyroid microcarcinoma: a study of 900 cases observed in a 60-year period. Surgery 2008;144:980-7 [discussion 987-988]. [6] Yu XM, Wan Y, Sippel RS, Chen H. Should all papillary thyroid microcarcinomas be aggressively treated? An analysis of 18,445 cases. Ann Surg 2011;254:653-60. [7] Mercante G, Frasoldati A, Pedroni C, et al. Prognostic factors affecting neck lymph node recurrence and distant metastasis in papillary microcarcinoma of the thyroid: results of a study in 445 patients. Thyroid 2009;19:707-16. [8] Chow SM, Law SC, Chan JK, Au SK, Yau S, Lau WH. Papillary microcarcinoma of the thyroid—prognostic significance of lymph node metastasis and multifocality. Cancer 2003;98:31-40. [9] Lin KL, Wang OC, Zhang XH, Dai XX, Hu XQ, Qu JM. The BRAF mutation is predictive of aggressive clinicopathological characteristics in papillary thyroid microcarcinoma. Ann Surg Oncol 2010;17: 3294-300. [10] Dunki-Jacobs E, Grannan K, McDonough S, Engel AM. Clinically unsuspected papillary microcarcinomas of the thyroid: a common finding with favorable biology? Am J Surg 2012;203:140-4. [11] Mazzaferri EL. Management of low-risk differentiated thyroid cancer. Endocr Pract 2007;13:498-512. [12] Kuhn E, Teller L, Piana S, Rosai J, Merino MJ. Different clonal origin of bilateral papillary thyroid carcinoma, with a review of the literature. Endocrine Pathology 2012;23:101-7. [13] Carcangiu ML, Zampi G, Pupi A, Castagnoli A, Rosai J. Papillary carcinoma of the thyroid. A clinicopathologic study of 241 cases treated at the University of Florence, Italy. Cancer 1985;55:805-28. [14] Niemeier LA, Kuffner Akatsu H, Song C, et al. A combined molecular-pathologic score improves risk stratification of thyroid papillary microcarcinoma. Cancer 2012;118:2069-77.

Fatal papillary thyroid microcarcinoma [15] Sugitani I, Toda K, Yamada K, Yamamoto N, Ikenaga M, Fujimoto Y. Three distinctly different kinds of papillary thyroid microcarcinoma should be recognized: our treatment strategies and outcomes. World J Surg 2010;34:1222-31. [16] Ito Y, Tomoda C, Uruno T, et al. Preoperative ultrasonographic examination for lymph node metastasis: usefulness when designing lymph node dissection for papillary microcarcinoma of the thyroid. World J Surg 2004;28:498-501. [17] Tickoo SK, Pittas AG, Adler M, et al. Bone metastases from thyroid carcinoma: a histopathologic study with clinical correlates. Arch Pathol Lab Med 2000;124:1440-7. [18] Bar W, Hedinger C. Comparison of histologic types of primary testicular germ cell tumors with their metastases: consequences for the WHO and the British nomenclatures? Virchows Arch A Pathol Anat Histol 1976;370:41-54. [19] Ardito G, Fadda G, Revelli L, et al. Follicular adenoma of the thyroid gland with extensive bone metaplasia. J Exp Clin Cancer Res 2001;20: 443-5. [20] Simpson KW, Albores-Saavedra J. Unusual findings in papillary thyroid microcarcinoma suggesting partial regression: a study of two cases. Ann Diagn Pathol 2007;11:97-102. [21] Lin JD, Huang MJ, Juang JH, et al. Factors related to the survival of papillary and follicular thyroid carcinoma patients with distant metastases. Thyroid 1999;9:1227-35. [22] Mizukami Y, Michigishi T, Nonomura A, et al. Distant metastases in differentiated thyroid carcinomas: a clinical and pathologic study. HUM PATHOL 1990;21:283-90. [23] Ruegemer JJ, Hay ID, Bergstralh EJ, Ryan JJ, Offord KP, Gorman CA. Distant metastases in differentiated thyroid carcinoma: a multivariate analysis of prognostic variables. J Clin Endocrinol Metab 1988;67: 501-8. [24] Schlumberger M, Tubiana M, De Vathaire F, et al. Long-term results of treatment of 283 patients with lung and bone metastases from differentiated thyroid carcinoma. J Clin Endocrinol Metab 1986;63: 960-7. [25] Ghossein R, Livolsi VA. Papillary thyroid carcinoma tall cell variant. Thyroid 2008;18:1179-81.

565 [26] Kondo T, Ezzat S, Asa SL. Pathogenetic mechanisms in thyroid follicular-cell neoplasia. Nature reviews Cancer 2006;6:292-306. [27] Adeniran AJ, Zhu Z, Gandhi M, et al. Correlation between genetic alterations and microscopic features, clinical manifestations, and prognostic characteristics of thyroid papillary carcinomas. Am J Surg Pathol 2006;30:216-22. [28] Basolo F, Torregrossa L, Giannini R, et al. Correlation between the BRAF V600E mutation and tumor invasiveness in papillary thyroid carcinomas smaller than 20 millimeters: analysis of 1060 cases. J Clin Endocrinol Metab 2010;95:4197-205. [29] Ito Y, Yoshida H, Maruo R, et al. BRAF mutation in papillary thyroid carcinoma in a Japanese population: its lack of correlation with highrisk clinicopathological features and disease-free survival of patients. Endocr J 2009;56:89-97. [30] Liu RT, Chen YJ, Chou FF, et al. No correlation between BRAFV600E mutation and clinicopathological features of papillary thyroid carcinomas in Taiwan. Clin Endocrinol (Oxf) 2005;63: 461-6. [31] Trovisco V, Soares P, Preto A, et al. Type and prevalence of BRAF mutations are closely associated with papillary thyroid carcinoma histotype and patients' age but not with tumour aggressiveness. Virchows Archiv: Int J Pathol 2005;446:589-95. [32] Eloy C, Santos J, Soares P, Sobrinho-Simoes M. The preeminence of growth pattern and invasiveness and the limited influence of BRAF and RAS mutations in the occurrence of papillary thyroid carcinoma lymph node metastases. Virchows Archiv 2011;459:265-76. [33] Sancisi V, Nicoli D, Ragazzi M, Piana S, Ciarrocchi A. Brafv600e mutation does not mean distant metastasis in thyroid papillary carcinomas. J Clin Endocrinol Metab 2012 [in press]. [34] Ricarte-Filho JC, Ryder M, Chitale DA, et al. Mutational profile of advanced primary and metastatic radioactive iodine-refractory thyroid cancers reveals distinct pathogenetic roles for BRAF, PIK3CA, and AKT1. Cancer Res 2009;69:4885-93. [35] Khoo ML, Ezzat S, Freeman JL, Asa SL. Cyclin D1 protein expression predicts metastatic behavior in thyroid papillary microcarcinomas but is not associated with gene amplification. J Clin Endocrinol Metab 2002;87:1810-3.