Par-4-mediated recruitment of Amida to the actin cytoskeleton leads to the induction of apoptosis

Experimental Cell Research 311 (2005) 177 – 191 www.elsevier.com/locate/yexcr

Research Article

Par-4-mediated recruitment of Amida to the actin cytoskeleton leads to the induction of apoptosis Meike Boosena, Susanne Vetterkinda, Ansgar Koplina, Susanne Illenbergerb, Ute Preussa,* b

a Institute of Genetics, University of Bonn, Ro¨merstr. 164, D-53117 Bonn, Germany Cell Biology, Zoological Institute, Technical University of Braunschweig, D-38092 Braunschweig, Germany

Received 15 April 2005, revised version received 26 August 2005, accepted 8 September 2005 Available online 14 October 2005

Abstract Par-4 (prostate apoptosis response-4) sensitizes cells to apoptotic stimuli, but the exact mechanisms are still poorly understood. Using Par4 as bait in a yeast two-hybrid screen, we identified Amida as a novel interaction partner, a ubiquitously expressed protein which has been suggested to be involved in apoptotic processes. Complex formation of Par-4 and Amida occurs in vitro and in vivo and is mediated via the C-termini of both proteins, involving the leucine zipper of Par-4. Amida resides mainly in the nucleus but displays nucleo-cytoplasmic shuttling in heterokaryons. Upon coexpression with Par-4 in REF52.2 cells, Amida translocates to the cytoplasm and is recruited to actin filaments by Par-4, resulting in enhanced induction of apoptosis. The synergistic effect of Amida/Par-4 complexes on the induction of apoptosis is abrogated when either Amida/Par-4 complex formation or association of these complexes with the actin cytoskeleton is impaired, indicating that the Par-4-mediated relocation of Amida to the actin cytoskeleton is crucial for the pro-apoptotic function of Par-4/Amida complexes in REF52.2 cells. The latter results in enhanced phosphorylation of the regulatory light chain of myosin II (MLC) as has previously been shown for Par-4-mediated recruitment of DAP-like kinase (Dlk), suggesting that the recruitment of nuclear proteins involved in the regulation of apoptotic processes to the actin filament system by Par-4 represents a potent mechanism how Par-4 can trigger apoptosis. D 2005 Elsevier Inc. All rights reserved. Keywords: Par-4; Amida; Protein interaction; Actin cytoskeleton; Apoptosis

Introduction Apoptosis is a morphologically and biochemically distinct form of programmed cell death that is widely observed in nature. This process is required for development, maintenance and survival of multicellular organisms [1,2]. Programmed cell death can be triggered by a variety of physiological and pathological stimuli, including radiation, drugs, growth factor deprivation, hormones and stress [2– 4]. Aberrations in this process can lead to the pathogenesis of many human diseases. For example, uncontrolled apoptosis can contribute to neurodegenerative disorders such as Alzheimer’s and Parkinson’s diseases [5,6]. In

* Corresponding author. Fax: +49 228 734263. E-mail address: [email protected] (U. Preuss). 0014-4827/$ - see front matter D 2005 Elsevier Inc. All rights reserved. doi:10.1016/j.yexcr.2005.09.010

contrast, impaired apoptosis is a prerequisite for tumorigenesis, and resistance towards apoptosis is a hallmark of most types of cancer [7,8]. In many cases, it is not clear whether disturbances in cell death pathways are causal or a mere consequence of the disease process. Nonetheless, understanding apoptotic mechanisms at the molecular level will clearly help to develop new therapeutic approaches for cancer and neuronal diseases. Many apoptosis-related genes and their products have been identified which take part in the regulation of the apoptotic processes [9]. One example is prostate apoptosis response-4 (Par-4), a pro-apoptotic protein that sensitizes cells to the action of various apoptotic insults. Par-4 is a 38 kDa protein originally identified as a gene upregulated in prostate cancer cells undergoing ionomycin-induced apoptosis [10 – 13]. At the carboxy-terminus, Par-4 comprises both a leucine zipper domain and a partially overlapping

178

M. Boosen et al. / Experimental Cell Research 311 (2005) 177 – 191

death domain similar to that found in other apoptotic proteins [14,15]. Although Par-4 contains two putative nuclear localization signals, the bulk protein resides in the cytoplasm in most tissues and cell types [10]. Recently, we could show that cytoplasmic Par-4 is directly associated with the actin cytoskeleton in rat fibroblasts [16]. In normal prostate cells and prostate carcinoma cells, Par-4 is distributed in the cytoplasm and the nucleus [17], and it has been demonstrated that the bipartite NLS2 of Par-4 is essential for its nuclear localization [18]. Previous studies have shown a deregulated expression of Par-4 in several types of tumors including neoplastic lymphocytes [19], renal cell carcinoma [20], melanoma [21], prostate cancer [22], as well as in cell lines derived from primary neural tumors [23]. In fact, it has been reported that downregulation of Par-4 is essential for rasinduced tumor progression [24,25]. All data available to date suggest that Par-4 is engaged in different apoptotic pathways. One mechanism of apoptosis induction by Par-4 involves blocking of the atypical protein kinase C (aPKC) and NF-nB signaling cascade. Par-4 inhibits aPKC isoforms, particularly protein kinase C~ (PKC~) [26]. The aPKCs are essential for activation of the anti-apoptotic transcription factor NF-nB [27] which has an important regulative role in apoptosis [28] and cell proliferation [29]. NF-nB antagonizes apoptosis by inducing anti-apoptotic genes including inhibitors of apoptosis proteins (IAPs), Bcl-2-like factors and TNF-receptor-associated factors (TRAF1, TRAF2) [28] and affects proliferation by enhancing the transcription of genes like c-myc and cyclin-D1 [30]. In addition, Par-4 may act directly on gene expression by affecting Wilms’ tumor protein 1 (WT1) function [13,31]. The WT1 gene encodes a tumor suppressor whose loss is associated with Wilms’ tumor formation [31,32]. Par-4 binds to two different regions of WT1 and regulates the transcriptional activation and the repression potential of WT1 [31,33]. Interestingly, Par-4 directly inhibits the expression of the anti-apoptotic protein Bcl-2 by binding to the Bcl-2 promoter via WT1 [34]. Overexpression of Par-4 resulted in downregulation of Bcl2 in PC12 cells, in NIH3T3 fibroblasts and in human prostate cancer cells [17,35]. Replenishment of Bcl-2 protein levels in cells overexpressing Par-4 demonstrated that Bcl-2 was able to protect these cells against apoptosis without affecting the Par-4 levels. Moreover, a number of tumor samples showed mutually exclusive expression of Bcl-2 or Par-4 [17,19,36]. Although the general pro-apoptotic function of Par-4 is well documented, the exact molecular mechanisms how Par-4 contributes to the induction of programmed cell death are still under debate. On one hand, deletion of the leucine zipper domain resulted in the loss of the proapoptotic function of Par-4, and, conversely, overexpression of the leucine zipper domain had a dominantnegative effect by abrogating the pro-apoptotic function of full-length Par-4 [13]. On the other hand, it has also

recently been shown that the 137– 195 amino acid core domain of rat Par-4 (designated SAC domain) that included NLS2 but lacked the leucine zipper domain was sufficient to induce apoptosis at least in cancer cells [18]. These data suggest that Par-4 may be involved in different apoptotic pathways possibly depending on celltype-specific variations which may influence the proapoptotic function of the protein. Given the differences in subcellular distribution of Par-4 in fibroblasts and cancer cells [16,17,37], it is also conceivable that Par-4 may be involved in both nuclear and cytoplasmic apoptotic events. Recently, we could show that the cytoplasmic association of Par-4 with the actin cytoskeleton plays a crucial role for the pro-apoptotic function of Par-4 in rat fibroblasts and that disruption of the microfilament system by cytochalasin D treatment resulted in significant decrease of the Par-4mediated apoptosis [16]. Coexpression of Par-4 and its interaction partner DAP-like kinase (Dlk) leads to relocation of the kinase from the nucleus to the cytoplasm, particularly to actin filaments and to the induction of apoptosis [16,38]. Dlk (also termed ZIP kinase) is a serine/threonine-specific protein kinase [39,40], which belongs to the novel subfamily of DAP kinases (death-associated protein kinases) involved in the regulation of apoptosis [41]. Par4-mediated recruitment of Dlk leads to enhanced phosphorylation of the regulatory light chain of myosin II (MLC) at residue Ser19, causing dramatic cytoskeletal rearrangements [16]. In search for new interaction partners of Par-4 that might serve as regulators or targets in Par-4-mediated apoptosis, we identified the protein Amida in a yeast two-hybrid screen. Amida was previously identified as an interaction partner of Arc (activity-regulated cytoskeleton-associated protein) [42]. Coexpression of Par-4 and Amida resulted in relocation of Amida from the nucleus to cytoplasmic actin filaments and led to an increased MLC phosphorylation at Ser19 and enhanced induction of apoptosis. Thus, recruitment of specific regulatory nuclear proteins to the actin filament system by Par-4 as shown for Amida (this report) and also for Dlk [16] may represent a potential mechanism to trigger apoptotic processes.

Materials and methods Cell culture Rat embryo fibroblasts (line REF52.2), HeLa cells, murine C2C12 cells, NIH3T3 cells and rat fetal brain cell line E14-2 were maintained in DMEM (Invitrogen GmbH, Karlsruhe, Germany) supplemented with 10% FCS (PAA Laboratories, Vienna, Austria). CHO cells were grown in Nutrient Mixture F12 (Sigma, Deisenhofen, Germany) with 10% FCS. All cell culture media were supplemented with 100 units/ml penicillin and 100 Ag/ml streptomycin.

M. Boosen et al. / Experimental Cell Research 311 (2005) 177 – 191

179

Two-hybrid screening For the yeast two-hybrid screening, the HybriZAPi version (Stratagene, La Jolla, CA, USA) was employed. For this purpose, a 1425 bp EcoRI fragment of the Par-4 cDNA from pCB6+/Par-4 [13] was cloned in frame with the DNA-binding domain of the two-hybrid pBD-GAL4 vector. The cDNA library (kindly provided by A. Gockel) was generated from SV52 cells by the method of [43], using the cDNA cloning kit and HybriZAPi vector [44]. The yeast two-hybrid screening was performed essentially as described by [38]. The cDNA inserts from positive clones were isolated according to the manufacturer’s instructions (Stratagene) and further analyzed by sequencing. Plasmid construction The generation of the constructs Par-4-GFP, Par-4-CFP and FLAG-Par-4 and the FLAG-tagged mutants Par4DN41 –332, Par-4DC1 – 233 and Par-4D1– 266 has been described previously [16]. The FLAG-Par-4 deletion mutants were digested with EcoRI and SalI and subcloned into the yeast vector pBD-GAL4 (see Fig. 1A). For the construction of a leucine zipper point mutant of Par-4, three leucine residues were exchanged by alanines in the coiled coil interface of the leucine zipper domain (L294A/L316A/ L330A, denoted Par-4 L3). For this purpose, the Par-4 cDNA was used as template and amplified with the primer pairs (5V-GCAGTACAAAGCCACAATCAGTGC) and (5VAATCTCTTCGTTGGCTTTACCAATCATTTC), (5VGAAATGATTGGAAAAGCCAAGGAAGAGATT) and (5V-CTGCTTTGCTTGCTCGTTTTC) as well as (5V-GAAAACGAGCAAGCAAAGCAG) and (5V-CCACCGGTCCCCTTGTGCACTGCCC). The three PCR fragments were then ligated by assembly PCR, digested with AccI and AgeI and subsequently exchanged by the AccI and AgeI digested fragment from Par-4-GFP. The EcoRI and AgeI digested fragment from the Par-4 3L-GFP vector was blunted and then inserted into the yeast vector pGAD424 (Clontech). To construct an in frame Amida fusion protein with EGFP or YFP, a 805 bp cDNA Amida product was generated by PCR with oligonucleotides 5V-GAAGATCTGAATTCGGCACGAGG containing a BglII restriction site and 5V-CGGGATCCTTAGTCAAAGGGTGG containing a BamHI restriction site. The PCR product was digested with BglII and BamHI, and the Amida cDNA was then subcloned into the pEGFP-C1 or YFP-C1 expression vector (Clontech) (denoted GFP-Amida and YFP-Amida). To generate the FLAG-Amida construct, the cDNA insert from the pADGAL4 vector was digested with EcoRI and XhoI and then subcloned into the pCMV-Tag 2B vector (Stratagene). The C-terminal Amida deletion mutant DC1 – 110 (consisting of residues 1– 110) and the N-terminal Amida deletion mutant DN113– 259 (comprising residues 113– 259) were gener-

Fig. 1. Mapping of the interaction domains of Amida and Par-4. (A) Schematic representation of Amida and Par-4 constructs employed in yeast two-hybrid analyses. Constructs were fused to the GAL4 activation (AD) or binding domain (BD) as indicated in panel (B). Full-length Amida (Amida wt, 259 residues) contains two nuclear localization sequences (NLS1 and NLS2) and a predicted coiled coil region (CC). The C-terminally truncated Amida deletion mutant DC1 – 110 consists of residues 1 – 110. Conversely, Amida deletion mutant DN113 – 259 comprises residues 113 – 259. Fulllength Par-4 (Par-4 wt, 332 residues) contains two nuclear localization signals (NLS1 and NLS2) and a leucine zipper motive (LZ) located within the death domain (DD) at the carboxy-terminus (shaded boxes). The mutant Par-4 3L contains three exchanges of leucines to alanines in the leucine zipper domain of Par-4 (L294A/L316A/L330A) marked by asterisks. The C-terminal truncated mutants DC1 – 233 and DC1 – 266 consist of residues 1 – 233 and 1 – 266, respectively. (B) Yeast cells were cotransformed with the respective partners as indicated schematically in each sector in the right panel. Cells were grown on selective medium for the histidine reporter gene indicative of a positive interaction as shown in the left panel.

ated by PCR using full-length Amida as template and the following primer pairs: for Amida DC1 –110 (5V-GAAGATCTGAATTCGGCACGAGG- and 5V-CGGGATCCAGTTATCCTTTGCACC-3V) and for Amida DN113 – 259 (5V-CGGAATTCAGACTCCAGCAGGAGC-3V and 5V-CGGGATCCTTAGTCAAAGGGTGG-3V). Both primer pairs contained an EcoRI and a BamHI restriction site, respectively. After digestion, the Amida PCR products were cloned into the yeast vector pGAD424 and further subcloned into the yeast vector pBD-GAL4 (Stratagene) (see Fig. 1A). The His-tagged Amida construct was generated by PCR using full-length Amida as template and the following amplification primers designed to introduce an N-terminal His-tag sequence: 5V-GGGGATCCATATGCACCATCACCATCACCATGAGTTGGAACAGAGAGA AGGG containing an NdeI restriction site and 5V-

180

M. Boosen et al. / Experimental Cell Research 311 (2005) 177 – 191

GGAAGCTTAGTCAAAGGGTGGGCTAGCTAGTGG containing a HindIII restriction site. The PCR product was digested with NdeI and HindIII, and the Amida cDNA was cloned into the vector pET23a+ (Novagen, Schwalbach, Germany). In vitro translation In-vitro-translated Amida was generated with the TNTT7/T3 Coupled Reticulocyte Translation System (Promega, Madison, WI, USA) using pCMV-FLAG 2B/Amida vector as template according to the manufacturer’s protocol. GST pull-down assay To generate a plasmid expressing the Par-4 cDNA in fusion with glutathione S-transferase, the EcoRI fragment of the Par-4 cDNA from pCB6+/Par-4 was inserted into the pGEX 6T-vector. GST fusion proteins were expressed and purified from Escherichia coli BL21 (DE3) by affinity chromatography with glutathione sepharose as described [45,46]. The GST pull-down assay was performed with purified GST-Par-4 fusion protein or control GST protein essentially as described by [38]. Actin-binding assays The actin-binding properties of Amida and the influence of Par-4 and Amida recombinant proteins on actin filament organization were essentially analyzed as described [16]. In brief, recombinant His-tagged or Strep-tagged proteins were added to pre-polymerized actin filaments (3 AM) at a final concentration of 1 AM each and incubated for 1 h at 37-C. In low-speed cosedimentation analyses, the samples were centrifuged at 12,000  g for 15 min, and pellets and supernatants were analyzed separately by SDS-PAGE using 12.5% polyacrylamide gels. The organization of actin filaments in solution was visualized using TRITC-conjugated phalloidin (Sigma). Transfection and immunofluorescence analyses For transfection experiments, cells were seeded at 2  105/60 mm culture dish or at 2  104/coverslip and transiently transfected using the jetPEI transfection reagent (PolyPlus, Illkirch, France) and LipofectamineTM (Life Technologies, Inc.) according to the manufacturers’ protocols. For the generation of stable Amida-expressing cell lines, CHO cells were transfected with GFP-Amida expression plasmid and selected in the presence of 1 mg/ml Geneticin (G418) (Life Technologies, Inc, Karlsruhe, Germany). After 3 weeks, surviving colonies were isolated, and cells expressing GFP-Amida were screened by fluorescence microscopy and further subjected to single cell cloning. In some experiments, cells were treated after transfection with leptomycin B (LMB) at 1 – 20 ng/ml (LC Laboratories,

Woburn, MA, USA), cytochalasin D at 0.5 Ag/ml for 16 h or with nocodazole at 0.1 Ag/ml for 16 h (Sigma). For immunofluorescence analysis, cells were fixed after transfection with 3% paraformaldehyde in PBS for 20 min at room temperature and permeabilized with 0.1% Triton-X 100 in PBS for 5 min. The cells were treated with 5% nonfat dry milk for 1 h and stained with the mouse monoclonal anti-FLAG M2 antibody (Stratagene) at 1:10,000 dilution, the rabbit polyclonal anti-Par-4 antibody (Santa Cruz Biotechnology Inc., Heidelberg, Germany) at 1:4000 dilution and with rabbit polyclonal anti-Phospho-Myosin Light Chain 2 (Ser19) (MLC(P)Ser19) antibody (Cell Signaling Technology, NEB GmbH, Frankfurt, Germany) at 1:1000 dilution. As secondary antibodies, Cy3-conjugated goat anti-mouse and Cy3-conjugated goat anti-rabbit IgG (Dianova, Hamburg, Germany) were used at 1:2000 dilutions and incubated for 30 min. Nuclei were stained with 4,6-diamidino-2-phenylindole (DAPI, 1.0 Ag/ml) or propidium iodide and actin filaments with fluorescein isothiocyanate (FITC)-labeled phalloidin (Sigma) for 15 min and subsequent washing with PBS. Cells were examined with an Axiophot fluorescence microscope (Carl Zeiss GmbH, Oberkochen, Germany) equipped with a CCD camera using filters optimized for double label experiments and a 63 oil immersion objective. Confocal microscopy was performed with a Zeiss Axioplan fluorescence microscope coupled with a ZEISS LSM510. Images were processed with Adobe Photoshop 7.0 software. Apoptosis assay REF52.2 cells were transfected either with GFP, GFPAmida or FLAG-Par-4 alone or cotransfected with GFPAmida/FLAG-Par-4, GFP-Amida/FLAG-Par-4DN41 – 332 and FLAG-Amida/GFP-Par-4 L3. At 48 h post-transfection, cells were fixed with paraformaldehyde, incubated with the monoclonal anti-FLAG M2 antibody and with Cy3-conjugated goat anti-mouse IgG and stained by DAPI to visualize nuclei. The percentage of apoptotic cells that showed fragmented nuclei, condensed chromatin and membrane blebbing was determined among the transfected cells by fluorescence microscopy, counting 100 to 200 positive cells in each experiment. Data were collected from at least three independent experiments. Interspecies heterokaryon assay Nucleo-cytoplasmic shuttling was assayed using the heterokaryon assay, essentially as described in [47]. Briefly, human HeLa cells grown on coverslips were cotransfected with the GFP-Amida expression vector and with the pcDNA3 vector encoding the non-shuttling protein hnRNP-C2 [48] bearing an N-terminal FLAG tag. Twenty hours post-transfection, an equal number of murine C2C12 cells incubated in the presence of cycloheximide (Sigma) was seeded onto the same coverslip. After

M. Boosen et al. / Experimental Cell Research 311 (2005) 177 – 191

coculturing, heterokaryons were formed by incubating cells with polyethylene glycol. Formation of heterokaryons was assessed using a combination of phase contrast analysis and DAPI staining to verify the presence of murine and human nuclei in a multinucleate cell. When LMB (LC Laboratories) was used, it was added to the cells 1 h before fusion and for the remainder of the experiment at a concentration of 20 ng/ml. Immunoprecipitation, SDS-PAGE and Western blotting The GFP-Amida and FLAG-Par-4 transfected cells were washed with ice-cold PBS and lysed in isotonic lysis buffer (PLB: 10 mM NaPO4, pH 8.0, 140 mM NaCl, 3 mM MgCl2, 10 mM h-mercaptoethanol, 0.5% Nonidet P-40, PMSF and 50 AM leupeptin). The lysates were cleared by centrifugation and subjected to immunoprecipitation with the rabbit polyclonal anti-GFP antibody (BD Clontech, Heidelberg, Germany) or with anti-FLAG M2 monoclonal antibody (Stratagene) at 4-C overnight. The antigen –antibody complexes were adsorbed to Protein A – or G – Sepharose (Sigma), and the immunoprecipitates were washed three times with lysis buffer. The samples were analyzed by Western blot analysis essentially as described by [16] with the monoclonal anti-GFP antibody at 1:1000 dilution or with the polyclonal anti-Par-4 antibody (Santa Cruz) at 1:5000 dilution. For the immunoprecipitation of the endogenous Amida protein, a rabbit polyclonal anti-Amida antibody was generated using purified recombinant His-tagged Amida protein (Pineda Antibody Service, Berlin, Germany). For this purpose, the His-tagged full-length Amida construct was transformed in E. coli strain BL-21 Codonplus DE3 (Stratagene). Bacteria were harvested 3 h after induction with 1 mM isopropyl-1-thio-h-D-galactopyranoside (IPTG) and solubilized in buffer containing 50 mM Tris pH 7.2 and 100 mM NaCl2 by ultrasonic disruption. Lysates were cleared from cell debris by centrifugation, and the recombinant Amida protein was purified from the cell lysates using Ni-NTA-Sepharose (Qiagen, Hilden, Germany) essentially according to the manufacturer’s instructions and a Sephacryl S200 gel-filtration column (Amersham Bioscience, Freiburg, Germany).

Results Amida is a novel interaction partner of Par-4 In order to identify new interaction partners of the proapoptotic protein Par-4, we used Par-4 as bait to screen a cDNA library from SV52 rat fibroblasts. Seven positive clones were identified from histidine negative plates which were also positive for h-galactosidase expression. Sequence analysis revealed one clone coding for Par-4, showing the ability of the protein to self-associate, a

181

cDNA clone that coded for a polypeptide of unknown function and five clones coding for Amida, a protein that had been previously identified as an interaction partner of Arc [42], an immediate early gene, encoding an effector protein, proposed to mediate cytoskeletal changes [49]. A schematic representation of Amida is shown in Fig. 1A. The rat Amida protein consists of 780 nucleotides encoding a protein of 259 amino acids. It has an apparent molecular weight of about 40 kDa on SDS-PAGE. The protein contains two novel nuclear localization sequences (NLS1 and NLS2), which are rich in arginine residues instead of lysine residues [42]. Sequence analysis of the Amida protein revealed a putative a-helical coiled coil (CC) that spans the region between amino acids 79 and 108 possibly facilitating homo- or heterodimerization. Mapping of the interaction domains in Par-4 and Amida The interaction between Par-4 and Amida was first confirmed by retransformation of yeast cells with plasmids coding for pAD-Amida and pBD-Par-4 including the appropriate controls (Fig. 1B). To further determine the interaction domains within Par-4, we also constructed two Par-4 deletion mutants with progressive deletion of the Cterminal region of Par-4 (mutant DC1 –233 comprising residues 1 –233 and mutant DC1 – 266 containing residues 1 –266) (Fig. 1A) since most interaction partners of Par-4 identified so far bind to the C-terminal region of the molecule [50]. In addition, a leucine zipper point mutant of Par-4 (Par-4 L3) was generated, which contained three exchanges of leucine residues to alanines in the coiled coil interface. All constructs were employed as pBDGAL4 fusion proteins in the two-hybrid system. A positive interaction was indicated by growth on histidine selective medium (Fig. 1B) and a blue color on a hgalactosidase filter lift assay (data not shown). Amida interacted only with full-length Par-4, but not with the mutant DC1 – 233 and DC1 – 266 lacking the leucine zipper domain and the partially overlapping death domain. Interestingly, Amida also failed to interact with the leucine zipper point mutant Par-4 L3, suggesting that the interaction of Amida and Par-4 was mediated by the leucine zipper of Par-4. Dlk, a well-known interaction partner of Par-4 [38], served as positive control (Fig. 1B). We further generated Amida deletion constructs in fusion with the Gal-4 DNA-binding domain (AmidaDC1 –110, consisting of residues 1 –110 and AmidaDN113 – 259, comprising residues 113 – 259) and tested for their interaction with full-length Par-4. This analysis revealed that deletion of the C-terminus of Amida completely abolished binding to full-length Par-4. Amida binds to Par-4 in vitro and in vivo We next tested for complex formation of both proteins in an independent in vitro binding assay. For this purpose,

182

M. Boosen et al. / Experimental Cell Research 311 (2005) 177 – 191

Par-4 was expressed as a GST-tagged fusion protein in E. coli, immobilized on glutathione sepharose beads and used as affinity matrix to bind 35S-methionine-labeled invitro-translated Amida. As shown in Fig. 2, Amida interacted with GST-Par-4 (Fig. 2A, lane 3), but not with GST alone which served as negative control (Fig. 2A, lane 2). To verify the interaction of Amida and Par-4 in vivo, we established a CHO cell line stably expressing a GFPAmida fusion protein (denoted GFP-Amida). We then transfected the GFP-Amida-expressing CHO cells with a FLAG-Par-4 expression vector or with empty vector as control. Forty eight hours post-transfection, the cells were harvested, and the cell lysates were subjected to immunoprecipitation with polyclonal anti-GFP- or monoclonal anti-FLAG M2 antibodies, respectively. The immunopre-

cipitated proteins were separated on SDS-PAGE and analyzed by subsequent Western blotting (Fig. 2B). Immunoprecipitation of GFP-Amida with an anti-GFP antibody specifically coprecipitated a protein of about 48 kDa representing the FLAG-Par-4 fusion protein (Fig. 2B, lane 2), which could not be detected in mock-transfected cells (Fig. 2B, lane 1). Likewise, when employing antiFLAG specific antibodies, a protein of about 68 kDa corresponding to the GFP-Amida fusion protein (Fig. 2B, lane 4) was only present in the precipitate from FLAGPar-4-expressing cells but not from mock-transfected cells (Fig. 2B, lane 3). In order to analyze complex formation between endogenous proteins, we generated a polyclonal anti-Amida antibody. As seen in Fig. 2C (lane 2), this antibody specifically precipitated the GFP-Amida fusion protein from the stably transfected CHO cell line in contrast to the control IgG (Fig. 2C, lane 1). The specificity of the anti-Amida antibody was further demonstrated by the competitive inhibition of the antibody in the presence of purified Amida protein, which completely abolished GFP-Amida immunoprecipitation (Fig. 2C, lane 3). Next, REF52.2 cell lysates were subjected to immunoprecipitation with this antibody and a control IgG. The precipitated proteins were analyzed by Western blotting with the polyclonal anti-Par-4 antibody. By employing the anti-Amida antibody, we could coprecipitate endogenous Par-4 protein (Fig. 2C, lane 7) in contrast to the control IgG (Fig. 2C, lane 6). The interaction of endogenous Par-4 and Amida was further corroborated in mouse fibroblasts and epithelial cells, demonstrating that the interaction of the proteins is not restricted to rat cells or fibroblasts (data not shown). In summary, our data provide strong evidence that Amida associates with Par-4 both in vitro and in vivo. Fig. 2. In vitro and in vivo binding of Amida and Par-4. (A) Pull-down experiment using recombinant GST-Par-4 fusion protein and in-vitrotranslated 35S-methionine-labeled Amida. GST served as negative control. Samples were further processed and analyzed by SDS-PAGE and subsequent fluorography (left panel). The input (lane 1) represents 1/10 of the material used in the binding reactions. Equal protein load of GST and GST-Par-4 was confirmed by SDS-PAGE (right panel). (B) Coimmunoprecipitation of Amida and Par-4. CHO cells stably expressing a GFPAmida fusion protein were transfected with FLAG-Par-4 expression vector (lanes 2 and 4) or with empty vector as control (lanes 1 and 3). Forty eight hours after transfection, cell lysates were prepared and subjected to immunoprecipitation with the polyclonal anti-GFP-antibody (lanes 1 and 2) or the monoclonal anti-FLAG M2 antibody (lanes 3 and 4). The proteins were separated by SDS-PAGE and immunoblotted with polyclonal anti-Par4 antibodies (lanes 1 and 2) or with monoclonal anti-GFP antibodies in lanes 3 and 4. Arrows indicate the positions of the 48 kDa FLAG-Par-4 or the 68 kDa GFP-Amida. (C) Cell lysates prepared from CHO cells stably expressing a GFP-Amida fusion protein (lanes 1 – 4) and REF52.2 cells (lanes 5 – 7) were employed for immunoprecipitation experiments with the polyclonal anti-Amida antibody (lanes 2, 3 and 7) or with control IgG (lanes 1 and 6) followed by Western blotting with the monoclonal anti-GFP antibody (lanes 1 – 4) or anti-Par-4 antibody (lanes 5 – 7) as indicated. The input (lanes 4 and 5) represents 20 Ag of whole-cell lysate. Adding purified recombinant Amida protein to the sample (lane 3) completely abolished binding to GFP-Amida, demonstrating the specificity of the antibody.

M. Boosen et al. / Experimental Cell Research 311 (2005) 177 – 191

Amida displays nucleo-cytoplasmic translocation To investigate the subcellular localization of Amida, we used the GFP-tagged Amida fusion protein and examined its subcellular localization in REF52.2 cells 24 h and 48 h after transfection by fluorescence microscopy. GFP-Amida was localized in the nuclei of most transfected cells (see Fig. 3A), which is in good agreement with a previous report [42]. However, we also noticed a diffuse nuclear/cytoplasmic distribution in 19.9% and 37.7% of the GFP-Amida-expressing cells after 24 h and 48 h post-transfection, respectively, suggesting nucleo-cytoplasmic shuttling of the Amida protein. Hence, the nuclear export of Amida was analyzed in an interspecies heterokaryon assay [51]. Human HeLa cells were cotransfected with GFP-Amida and FLAGtagged heterogeneous nuclear ribonucleoprotein hnRNPC2, which is a non-shuttling nuclear protein [48]. Twenty four hours post-transfection, the cells were fused with murine C2C12 cells in the presence of cycloheximide to prevent de novo protein synthesis. Heterokaryons were analyzed by phase contrast and fluorescence microscopy (Fig. 3B). Human and murine nuclei were distinguished by DAPI staining. While human nuclei (marked ‘‘h’’) displayed a rather diffuse staining, murine nuclei (marked ‘‘m’’) appeared spotted. In 98% of all heterokaryons analyzed, GFP-Amida that had originally been transfected into human HeLa cells was also detected in the murine C2C12 nuclei (Fig. 3Ba), indicating that Amida indeed shuttles between the nuclear and cytoplasmic compartment. In contrast, in the same heterokaryon, the non-

183

shuttling FLAG-tagged hnRNP-C2 protein strictly remained in the human nucleus (Fig. 3Bb). Coexpression of Amida and Par-4 results in colocalization of both proteins with microfilaments So far, we demonstrated a nuclear-cytoplasmic translocation of Amida and a direct interaction with Par-4 in vitro and in vivo in different assays. However, in contrast to Amida, Par-4 localizes to the cytoplasm in most cell types investigated, and both ectopically expressed and endogenous Par-4 associate with the microfilament system in REF52.2 cells [16]. Furthermore, coexpression of Par-4 and its known interaction partner Dlk leads to relocation of the kinase from the nucleus to the cytoplasm, particularly to actin filaments [16,38]. Hence, we investigated whether Par-4 could recruit Amida to actin filaments in a similar fashion. REF52.2 cells were transfected with GFP-Amida and FLAG-Par-4 and analyzed for the subcellular distribution of both proteins. Only in the Par-4/Amida coexpressing cells we noticed a strong accumulation of GFP-Amida in the cytoplasm. Twenty four hours post-transfection, 39.8% of the cotransfected cells exhibited a nuclear/cytoplasmic localization of GFP-Amida (Figs. 4a – c). Forty eight hours after transfection, the percentage of nuclear/cytoplasmic localized GFP-Amida even increased to 62.2% (Figs. 4d –f). Furthermore, GFPAmida was no longer diffusely distributed in the cytoplasm but clearly colocalized with Par-4 at actin filaments in the coexpressing cells (compare Fig. 3Aa and overlay in Figs. 4c and f). Immunoblot analyses revealed equal expression levels of ectopic Par-4 and Amida 24 and 48 h after transfection with

Fig. 3. Nucleo-cytoplasmic shuttling of Amida. (A) REF52.2 cells were transiently transfected with a GFP-Amida construct and counterstained with propidium iodide (PI) to visualize nuclei. The percentages of cells with strictly nuclear (N) and with nuclear/cytoplasmic (N/C) localization of GFP-Amida are indicated. (B) Interspecies heterokaryon assay. HeLa cells were transiently transfected with GFP-Amida and FLAG-hnRNP-C2. Twenty four hours post-transfection, the cells were mixed with and subsequently fused to murine C2C12 cells and incubated for another 3 h in the presence of cycloheximide. Fixed and stained samples were analyzed for GFP-Amida (a) and FLAG-hnRNP-C2 (b). DAPI staining allowed distinction of human (h) from murine (m) nuclei (c). The corresponding phase contrast image is shown in (d). Note that GFP-Amida is also present in the murine nucleus in the heterokaryon, while the non-shuttling FLAG-hnRNP-C2 protein strictly remains in the human nucleus. Scale bars represent 10 Am.

184

M. Boosen et al. / Experimental Cell Research 311 (2005) 177 – 191

Fig. 4. Coexpression and subcellular localization of Amida and Par-4. REF52.2 cells were transiently transfected with GFP-Amida and FLAG-Par-4. 24 H hours and 48 h post-transfection, the cells were fixed and stained for indirect immunofluorescence microscopy with the monoclonal anti-FLAG M2 antibody and with Cy3-labeled secondary antibodies. The percentages of cells with strictly nuclear (N) and with nuclear/cytoplasmic (N/C) localization of GFP-Amida are indicated next to the panels. The yellow signals in the merged images indicate colocalization. Note the prominent change in subcellular localization of GFPAmida after coexpression with Par-4 after 48 h (d and merged image in f). Scale bar, 10 Am. (For interpretation of the references to colour in this figure legend, the reader is referred to the web version of this article.)

signal intensities equivalent to endogenous Par-4 (data not shown). Taken together, these results show that Amida is specifically recruited to the microfilament system via Par-4. Unfortunately, we were not able to analyze the subcellular distribution of the endogenous Amida protein since our polyclonal anti-Amida antibody did not detect endogenous Amida in fixed cells after immunofluorescence staining. Amida associates with actin filaments via binding to Par-4 In order to examine whether Amida binds directly to actin filaments or if recruitment of Amida to the actin cytoskeleton is mediated via Par-4, we first performed low-speed cosedimentation analyses at 12,000  g, where actin filaments are only sedimented when crosslinked into higher suprastructures by actin-binding proteins as has previously been demonstrated for Par-4 [16]. After low-speed centrifugation, actin filaments alone remained in the supernatant (Fig. 5A, lane 2) and were also not pelleted in the presence of Amida (Fig. 5A, lane 4), suggesting that Amida did not directly associate with F-actin. In contrast, the addition of Par-4 leads to the sedimentation of a significant fraction of actin filaments (Fig. 5A, lane 5), demonstrating the crosslinking capacity of Par-4. Upon addition of Par-4 and Amida to actin filaments (Fig. 5A, lane 7), equivalent amounts of Amida with respect to Par-4 were cosedimented with actin filaments, suggesting that Amida was recruited to actin filaments by Par-4 and that Par-4/Amida complex formation did not interfere with actin binding of Par-4. The interaction of both recombinant proteins was demonstrated by the controls where Par-4 alone was already found in the pellet fraction (Fig. 5A, lane 11). While this phenomenon with respect to the actin-binding properties of Par-4 has been discussed in detail elsewhere [16], it helped to demonstrate

the interaction between Amida and Par-4 since equivalent amounts of Par-4 and Amida were recovered in the pellet fraction (Fig. 5A, lane 13). To show that binding to Amida did not interfere with the actin-binding and bundling properties of Par-4, in vitro filament assays were performed (Fig. 5B). Three micromolars of pre-polymerized actin was incubated either without or with 1 AM recombinant Par-4 wt, Amida and Par-4/Amida, respectively. Actin filaments were stained with TRITC-labeled phalloidin and directly analyzed by fluorescence microscopy. As shown recently [16], Par-4 induced the formation of actin filament bundles (Fig. 5B, upper right). In contrast, Amida (Fig. 5B, lower left) showed no actin bundling activity, and the appearance of actin filaments was therefore rather unorganized and indistinguishable from the actin control (Fig. 5B, upper left). A similar actin bundling activity as seen for Par-4 was observed after coincubation of Par-4 and Amida (Fig. 5B, lower right). In conclusion, these data reveal that Amida may only be indirectly recruited to actin filaments by binding to Par-4. Coexpression of Amida and Par-4 leads to enhanced induction of apoptosis in REF52.2 cells Since it has been shown that Par-4 sensitizes cells to apoptotic stimuli [13,31,38,] and we have shown that binding of Par-4 to the actin cytoskeleton is essential for its pro-apoptotic function [16], we next wanted to determine whether coexpression of Par-4 and Amida leads to the induction of apoptosis. Therefore, we transfected REF52.2 cells with GFP-Amida and FLAG-Par-4 and stained the cells 48 h after transfection with the monoclonal anti-FLAG M2 antibody and with DAPI to visualize nuclei. Coexpression of GFP-Amida and FLAG-Par-4 resulted in a clear colocalization of both proteins at actin filaments (Figs. 6Aa

M. Boosen et al. / Experimental Cell Research 311 (2005) 177 – 191

185

cells showed basal levels of 6% apoptotic cells after the equivalent expression time. Next, we examined whether microfilament association was crucial for Amida/Par-4-induced apoptosis. Therefore, we treated the GFP-Amida and FLAG-Par-4 coexpressing REF52.2 cells with cytochalasin D, an inhibitor of actin polymerization that leads to the disruption of the microfila-

Fig. 5. In vitro analysis of Amida and Par-4 actin-binding properties. Prepolymerized actin (3 AM final concentration) was incubated in the absence or presence of 1 AM recombinant Par-4, Amida or Par-4/Amida, respectively. (A) Low-speed cosedimentation analysis. Samples were centrifuged at 12,000  g, and pellet (P) and supernatant (S) fractions were analyzed by SDS-PAGE. Proteins present in each sample are indicated. Note that actin is only sedimented in the presence of Par-4 (lane 5) but not Amida (lane 3) and that Amida is recruited to actin filaments via Par-4 (lane 7). Lanes 9 – 14 represent controls without actin. (B) Actin filament organization. Actin filaments were stained with TRITC-labeled phalloidin and directly analyzed by fluorescence microscopy. While Par-4 induces actin bundle formation (upper right), Amida has no influence on filament organization (lower left), and the filaments appear similar to the actin control (upper left). Coincubation of Par-4 and Amida also allows the formation of actin bundles (lower right). Scale bar, 25 Am.

and b, compare Fig. 4). Furthermore, the Amida/Par-4 coexpressing cells displayed condensed and fragmented nuclei, a typical feature of apoptosis (Fig. 6Ac). We then determined the percentage of apoptotic cells after transfection of GFP, GFP-Amida or FLAG-Par-4 alone or after cotransfection with GFP-Amida and FLAG-Par-4 (Fig. 6B). Forty eight hours post-transfection, 53% of the Amida and Par-4 coexpressing cells were undergoing apoptosis, while expression of either protein alone resulted in only 19% (Par4) and 9% (Amida) apoptotic cells, respectively, suggesting a functional synergistic relationship of Amida and Par-4 in the apoptotic signaling pathway. Mock-transfected control

Fig. 6. (A) Apoptosis induction in REF52.2 cells upon coexpression of GFP-Amida and FLAG-Par-4. REF52.2 cells were cotransfected with GFPAmida and FLAG-Par-4. Forty eight hours post-transfection, cells were fixed, stained with the monoclonal anti-FLAG M2 antibody (b) and with DAPI to visualize nuclei (c). Scale bar, 10 Am. (B) Quantitative analysis of apoptosis induction upon coexpression of GFP-Amida and FLAG-Par-4. REF52.2 cells were transfected either with GFP, GFP-Amida or FLAG-Par4 alone or cotransfected with GFP-Amida and FLAG-Par-4. At 48 h posttransfection, cells were fixed, stained with the monoclonal anti-FLAG M2 antibody and with DAPI. The percentage of cells that showed apoptotic morphology (i.e. fragmented nuclei, condensed chromatin and membrane blebbing) was determined among the total number of transfected cells by fluorescence microscopy, counting 100 to 200 positive cells in each experiment. The graph represents the mean value from at least three independent experiments, error bars indicate standard deviation. (C) Disruption of the actin cytoskeleton affects the Par-4/Amida-mediated apoptosis. REF52.2 cells coexpressing GFP-Amida and FLAG-Par-4 were treated 24 h post-transfection with 0.5 Ag/ml cytochalasin D or with 0.1 Ag/ ml nocodazole or left untreated as a control. The percentage of cotransfected cells with apoptotic morphology was determined by fluorescence microscopy. The graph represents the mean values and standard deviations from three independent experiments.

186

M. Boosen et al. / Experimental Cell Research 311 (2005) 177 – 191

ment system. For comparison, a different set of cells was treated with nocodazole to examine the effect of microtubule loss on apoptosis induction. After fixation, the cells were stained as described above and analyzed by fluorescence microscopy. Fig. 6C shows the quantitative data of the cotransfected cells with apoptotic morphology. Coexpression of GFP-Amida and FLAG-Par-4 resulted in clear induction of apoptosis 48 h after transfection (about 53%), whereas the disruption of the actin filament system by cytochalasin D significantly decreased the percentage of apoptotic cells to 14%. In contrast, treatment of the GFPAmida and FLAG-Par-4 coexpressing cells with nocodazole had no effect on the number of apoptotic cells. Under our experimental conditions, treatment of REF52.2 cells with cytochalasin D alone did not induce apoptosis to a significant extent (data not shown). In conclusion, our data suggest that the actin cytoskeleton is involved in Amida/ Par-4-induced apoptosis. Recruitment of Amida to the actin cytoskeleton is essential for Par-4/Amida-mediated apoptosis Direct binding of Par-4 to the actin filament system requires the N-terminal 266 amino acids of the protein [16]. Furthermore, the integrity of the N-terminal region of Par-4 seems to be important for the pro-apoptotic function since deletion of the first 40 amino acids (Par-4DN41 –332) not only significantly impaired the association of Par-4 with the cellular microfilament system, but also caused reduced apoptosis induction by Par-4/Dlk [16]. In analogy to these findings, we assayed the ability of the FLAG-tagged Par-4 deletion mutant DN41 – 332 and GFP-Amida to induce apoptosis. Forty eight hours post-transfection, we examined the subcellular distribution of Amida and Par-4DN41 – 332. As expected, Par-4DN41 – 332 showed impaired association with stress fibers and displayed a mainly diffuse cytoplasmic fluorescent staining (Fig. 7Ab). Concomitantly, Amida also failed to bind to the actin cytoskeleton (Fig. 7Aa), revealing that Amida recruitment to microfilaments is indeed mediated via Par-4 (compare Fig. 4). Coexpression of Par-4DN41 – 332 and Amida (Fig. 7B) resulted in a decreased number (39%) of apoptotic cells, as compared to coexpression of Par-4 wild type and Amida (51%) but did not reduce apoptosis induction to a similar extent as compared to complete disruption of microfilaments by cytochalasin D treatment (compare Fig. 6C). This may either reflect that Par-4DN41 – 332 bears residual actin binding thus still inducing apoptosis albeit to a lesser extent or that Par-4/Amida complexes may induce apoptosis by cytoplasmic mechanisms that are both dependent and independent of their association with the microfilament system. To further corroborate the synergistic effect of the Amida/Par-4 interaction for the induction of apoptosis, we coexpressed Amida with the leucine zipper point mutant Par-4 L3, which failed to interact with Amida (compare Fig.

Fig. 7. The role of microfilament association in apoptosis induction by Par4/Amida in rat fibroblasts. (A) REF52.2 cells were transiently cotransfected with expression vectors encoding FLAG-Par-4DN41 – 332 and GFPAmida. Forty eight hours after transfection, the cells were fixed and stained with the anti-FLAG M2 antibody and with DAPI. While both proteins are present in the cytoplasm, neither construct associates with actin filaments. Scale bar, 10 Am. (B) Percentages of apoptotic cells coexpressing GFP-Amida with either FLAG-Par-4 or FLAG-Par-4DN41 – 332 as determined by fluorescence microscopy counting 100 to 200 positive cells in each experiment. The results represent the mean value from at least three independent experiments, error bars indicate standard deviation. (C) Coexpression of the leucine zipper point mutant Par-4 L3 and Amida. REF52.2 cells were transiently transfected with GFP-Par-4 and GFP-Par-4 L3 or cotransfected with GFP-Par-4/FLAG-Amida and GFP-Par-4 L3/ FLAG-Amida. Forty eight hours post-transfection, the cells were fixed and stained with the anti-FLAG M2 antibody and with DAPI. The percentages of apoptotic cells were determined by fluorescence microscopy counting 100 to 200 positive cells in each experiment. The results are presented as mean values with standard errors indicated from three independent experiments. Note the dramatic decrease in apoptotic cells after coexpression of Amida and the leucine zipper point mutant Par-4 L3.

1). After fixation, the cells were stained as described above and analyzed by fluorescence microscopy. The percentage of GFP-Par-4, GFP-Par-4 L3, GFP-Par-4/FLAG-Amida and

M. Boosen et al. / Experimental Cell Research 311 (2005) 177 – 191

GFP-Par-4 L3/FLAG-Amida-expressing cells with apoptotic morphology is depicted in the bar diagram in Fig. 7C. Again, coexpression of GFP-Par-4 and FLAG-Amida resulted in strong induction of apoptosis after 48 h (about 58%, Fig. 7C), whereas after coexpression of GFP-Par-4 L3 and FLAG-Amida, the percentage of apoptotic cells decreased to a level of approximately 21%, comparable to the apoptotic rate of cells transfected with either GFP-Par-4 or GFP-Par-4 L3 alone. Together, these data sustained that the Amida/Par-4-mediated apoptosis is enhanced by binding of Par-4 to the actin cytoskeleton as well as the proper recruitment of Amida to microfilaments. Enhanced MLC phosphorylation after Par-4/Amida-induced apoptosis We have shown previously that enhanced phosphorylation of myosin light chain (MLC) at residue Ser19 might contribute to Par-4/Dlk-mediated apoptosis by enhancing contractile forces, leading to cytoskeletal alterations that occur during cell death [16]. Hence, we wanted to know whether enhanced phosphorylation of MLC might also contribute to Par-4/Amida-mediated apoptosis. Therefore, we coexpressed YFP-Amida and Par-4-CFP in REF52.2 cells and examined the MLC phosphorylation status at Ser19 with an anti-MLC(P)Ser19 antibody after treating the cells with the Rho kinase (ROCK) inhibitor Y-27632 to rule out that MLC becomes phosphorylated by other MLC kinases. As seen in Fig. 8, at early stages of apoptosis, the Amida/Par-4 coexpressing cells displayed faint staining of phosphorylated MLC (Fig. 8c). At later stages of apoptosis, the phosphorylation of MLC at Ser19 further increased in the apoptotic Par-4/Amida coexpressing cells (Fig. 8f), suggesting that enhanced MLC phosphorylation also contributes to the Par-4/Amidamediated apoptosis.

187

Discussion The pro-apoptotic protein Par-4 has been implicated to sensitize cells to apoptotic stimuli via different pathways. While the regulatory action of Par-4 on gene expression through transcription factors implies a nuclear function of the protein, recent evidence suggests that Par-4 may also induce apoptosis in the cytoplasm by binding to and acting on the microfilament system [16]. To further elucidate Par-4 action at the molecular level, we searched for novel interaction partners that might serve as regulators or downstream effectors in the apoptotic pathway. We identified the protein Amida as a new binding partner of Par-4 in a yeast two-hybrid screen. Complex formation of Par-4 and Amida was further confirmed by different in vitro binding assays as well as in coexpression and immunoprecipitation experiments in vivo. Amida was first identified in a yeast two-hybrid screen as a novel binding partner of Arc, a brain-specific nontranscriptional immediate early gene thought to mediate cytoskeletal changes during activity-dependent neuronal plasticity [49]. In contrast to Arc, Amida is ubiquitously expressed and has been suggested to be involved in apoptotic processes. Overexpression of Amida in COS-7 cells revealed a predominantly nuclear localization and a significant induction of apoptosis after 72 h [42]. Besides promoting apoptosis, however, Amida might have quite different functions depending on its subcellular localization and its interaction partners since it has been shown that the pro-apoptotic effect of Amida can be counteracted by overexpression of Arc, which may affect Amida function in the brain [49]. Moreover, recent findings suggest that Amida may also participate in cell cycle control [52]. At present, the available data allow no integration of all findings into a single model for the precise cellular function of Amida. The involvement of

Fig. 8. MLC phosphorylation at Ser19 upon coexpression of Amida and Par-4. REF52.2 cells were cotransfected with expression vectors for YFP-Amida and Par-4-CFP fusion proteins in the presence of the ROCK inhibitor Y-27632. Forty eight hours after transfection, the cells were fixed and visualized directly for YFP-Amida (a and d) and Par-4-CFP (b and e) or by indirect immunofluorescence staining for phosphorylated myosin light chain 2 with the polyclonal antiMLC(P)Ser19 antibody at early (c) and later apoptotic stages (f). Scale bar, 20 Am.

188

M. Boosen et al. / Experimental Cell Research 311 (2005) 177 – 191

both Amida and Par-4 in apoptosis prompted us to investigate the association of the two proteins in more detail and to analyze the influence of Amida on Par-4mediated apoptosis. The interaction of Par-4 and Amida is mediated via their C-terminal portions Most interaction partners of Par-4 identified to date bind to the C-terminal portion of the molecule. Likewise, the interaction with Amida is abrogated upon deletion of the C-terminus of Par-4, which contains the leucine zipper motif and the partially overlapping death domain. Amida also failed to interact with the Par-4 mutant L3, which contained three exchanges of leucine residues to alanines in the leucine zipper domain, suggesting that the interaction of Amida and Par-4 requires a functional leucine zipper of Par-4. Surprisingly, the interaction domain within Amida was also mapped to the C-terminus of the molecule, although the deduced amino acid sequence of Amida predicts a coiled coil region in the N-terminal part of the protein which may facilitate homo- or heterodimerization of two proteins. However, it has been shown that leucine zippers can interact with other structural domains, too [26,38]. In the yeast two-hybrid screen, we also identified Par-4 itself as an interaction partner, which is in good agreement with previous reports, showing that the C-terminal region of Par-4 can homodimerize [13,53]. Deletion of the C-terminal region completely abrogates homodimerization, as well as the interaction with the binding partners identified so far [26,31,38,50,54]. It is tempting to speculate that dimerization of Par-4 is required for or at least enhances its proapoptotic function. Amida displays nucleo-cytoplasmic shuttling When overexpressed in COS-7 cells, GFP-Amida exclusively localized to the nucleus [42]. In our study using transfected rat fibroblasts, however, we not only observed a prominent nuclear localization, but also noticed that some of the GFP-Amida-expressing cells showed a diffuse cytoplasmic distribution. Based on these observations, we examined whether Amida displayed nucleocytoplasmic shuttling activity in an interspecies heterokaryon assay. Our data demonstrated that Amida can indeed actively be exported from the nucleus and that the protein shuttles between the nuclear and cytoplasmic compartment. The nuclear localization of Amida depends on two NLSs, and a nuclear residency of the protein seems to be required for apoptosis induction in COS-7 cells [42]. In addition, Amida may harbor a Rev-like nuclear export signal (NES) in its N-terminus that could account for nuclear export. However, the latter is not inhibited by leptomycin B (LMB) treatment, suggesting a CRM1receptor-independent export mechanism (data not shown).

Clearly, the exact mechanism for the nuclear export of Amida remains to be elucidated. Amida translocates to cytoplasmic actin filaments upon coexpression with Par-4, and both proteins cooperate in the induction of apoptosis While the percentage of REF52.2 cells with cytoplasmic Amida was relatively low in single transfectants, a strong cytoplasmic accumulation of Amida with a preferential localization at microfilaments was observed upon coexpression with Par-4. All experimental evidences presented here suggest that Par-4 specifically recruits Amida to the actin cytoskeleton in rat fibroblasts: Amida does not directly interact with F-actin but cosediments with Par-4-crosslinked actin filaments in vitro. In transfected REF52.2 cells, the microfilament association of Amida is abolished by either cotransfecting a Par-4 deletion construct impaired in actin binding (Fig. 7A) or by coexpression of the leucine zipper mutant Par-4 L3, which still associates with the microfilament system (data not shown) but does not bind to Amida (Figs. 1B and 7C). The formation of Par-4/Amida complexes and subsequent recruitment to the microfilament system lead to enhanced induction of apoptosis. In contrast to a previous report showing that the overexpression of GFP-Amida alone was sufficient to induce apoptosis in COS-7 cells 3 days after transfection [42], no significant apoptosis induction was observed in REF52.2 cells after expression of Amida alone (this study). This may reflect cell-type-specific variations that have also been reported for Par-4 [18,23, 55]. However, upon coexpression of Amida and Par-4, we observed a dramatic increase in apoptotic REF52.2 cells. Two days after transfection, about 53% percent of the cells showed clear signs of apoptosis as judged by DAPI staining (Fig. 6B) or Annexin V staining (data not shown), which was higher than for either Par-4 (19%) or Amida (9%). This synergistic pro-apoptotic effect of the proteins requires both Par-4/Amida complex formation and recruitment to the microfilament system. If either binding of Amida to Par-4 was prevented by coexpressing the leucine zipper point mutant Par-4 L3 (Fig. 7C) or the association of Par-4/Amida complexes was impaired due to reduced actin binding of Par-4 (deletion construct Par4DN41 – 332), the percentage of cells undergoing apoptosis after 48 h was significantly reduced. In addition, disruption of the microfilament system but not the microtubular network abolished the pro-apoptotic effect of Par-4/Amida complexes. Proposed mode of apoptosis induction by Par-4/Amida complexes Apoptosis induction by Par-4/Amida complexes bears significant resemblance to Par-4/Dlk-mediated apoptosis [16]. Dlk/ZIP kinase is a well-characterized interaction

M. Boosen et al. / Experimental Cell Research 311 (2005) 177 – 191

partner of Par-4 [38] that also translocates from the nucleus to cellular stress fibers upon coexpression with Par-4 [38]. We recently showed that Par-4/Dlk-mediated apoptosis could be a consequence of enhanced MLC phosphorylation, thus producing contractile forces, leading to cell detachment and apoptosis induction [16]. Our present data suggest that enhanced MLC phosphorylation may also contribute to Par-4/Amida-induced apoptosis. Increased MLC phosphorylation might be accomplished by binding of Dlk to the Par-4/Amida complex. Upon recruitment to the microfilament system, Dlk can phosphorylate its substrate MLC, which leads to the induction of apoptotic processes. While the true effectors of Amida/ Par-4 complexes remain to be identified, we propose that cytoplasmic recruitment of nuclear proteins involved in apoptotic processes represents a general mechanism how Par-4 can trigger apoptotic pathways. Although our data clearly show the synergistic effect of the Amida/Par-4 interaction for the induction of apoptosis and the dependency of the association with the actin cytoskeleton, we cannot rule out the possibility that Par-4/ Amida complexes may be involved in other cytoplasmic or even nuclear apoptotic mechanisms that are independent of Par-4 binding to actin. In a significant number of REF52.2 cells, we observed that nuclear GFP-Amida often accumulated in dot-like structures, which we identified as PML (promyelocytic leukemia) nuclear bodies (data not shown). PML bodies also called PODs (PML oncogenic domains), ND10 (nuclear domain 10) and Kr bodies are multiprotein complexes consisting of PML and a large number of proteins involved in apoptosis, cell proliferation and senescence [56,57]. Recent studies suggest that PML may act by recruiting pro-apoptotic proteins into PML bodies, including Par-4 and Dlk/ZIP kinase [54,58]. Whether these structures act as storage centers or actively participate in the apoptotic process remains to be shown. Finally, the role of the cytoskeleton for the induction of apoptosis is unclear at present. Previous studies have revealed that disruption of the actin cytoskeleton by cytochalasins induces apoptosis [59]. Moreover, a link between death receptor clustering and actin rearrangement has been proposed since treatment of cells with cytochalasin B induced CD95 (Fas/Apo-1) clustering and the CD95 clusters colocalized with disrupted actin filaments [60]. On the other hand, it has been reported that Fas-mediated apoptosis can be inhibited by disruption of actin fibers [61]. In this context, it is important to note that Par-4 is able to translocate Fas and FasL to the cell membrane [22]. The precise mechanisms, however, are unclear at present and will be a matter for future studies. Recently, we could show that the Par-4-mediated apoptosis is only partially dependent on the translocation of Fas/CD95 to the cell membrane and that cell-type-specific factors may influence the Par-4mediated apoptosis [23]. In REF52.2 cells, Par-4 seems to act mainly via recruitment of nuclear pro-apoptotic proteins to the microfilament system.

189

Acknowledgments We thank Reinhild Brinker and Tania Messerschmidt for excellent technical assistance, A. Gockel for the SV52 HybriZAP cDNA library, V. Rangnekar for kindly providing us with the rat Par-4 cDNA, Jan Kubicek for the purified Amida protein and K.H. Scheidtmann for helpful discussions. This study was supported by the Deutsche Krebshilfe, Dr. Mildred Scheel Stiftung (106365) to UP.

References [1] M.D. Jacobson, M. Weil, M.C. Raff, Programmed cell death in animal development, Cell 88 (1997) 347 – 354. [2] P. Meier, A. Finch, G. Evan, Apoptosis in development, Nature 407 (2000) 796 – 801. [3] W.C. Earnshaw, L.M. Martins, S.H. Kaufmann, Mammalian caspases: structure, activation, substrates, and functions during apoptosis, Annu. Rev. Biochem. 68 (1999) 383 – 424. [4] J. Yuan, B.A. Yankner, Apoptosis in the nervous system, Nature 407 (2000) 802 – 809. [5] C. Benoist, D. Mathis, Selection for survival? Science 276 (1997) 2000 – 2001. [6] C.B. Thompson, Apoptosis in the pathogenesis and treatment of disease, Science 267 (1995) 1456 – 1462. [7] F.H. Igney, P.H. Krammer, Death and anti-death: tumour resistance to apoptosis, Nat. Rev., Cancer 2 (2002) 277 – 288. [8] M. Zo¨rnig, A. Hueber, W. Baum, G. Evan, Apoptosis regulators and their role in tumorigenesis, Biochim. Biophys. Acta 1551 (2001) 1 – 37. [9] G. Evan, T. Littlewood, A matter of life and cell death, Science 281 (1998) 1317 – 1322. [10] E.R. Boghaert, S.F. Sells, A.J. Walid, P. Malone, N.M. Williams, M.H. Weinstein, R. Strange, V.M. Rangnekar, Immunohistochemical analysis of the proapoptotic protein Par-4 in normal rat tissues, Cell Growth Differ. 8 (1997) 881 – 890. [11] V.M. Rangnekar, Apoptosis mediated by a novel leucine zipper protein Par-4, Apoptosis 3 (1998) 61 – 66. [12] S.F. Sells, D.P. Wood Jr., S.S. Joshi-Barve, S. Muthukumar, R.J. Jacob, S.A. Crist, S. Humphreys, V.M. Rangnekar, Commonality of the gene programs induced by effectors of apoptosis in androgendependent and -independent prostate cells, Cell Growth Differ. 5 (1994) 457 – 466. [13] S.F. Sells, S.S. Han, S. Muthukkumar, N. Maddiwar, R. Johnstone, E. Boghaert, D. Gillis, G. Liu, P. Nair, S. Monnig, et al., Expression and function of the leucine zipper protein Par-4 in apoptosis, Mol. Cell. Biol. 17 (1997) 3823 – 3832. [14] S. Bang, E.J. Jeong, I.K. Kim, Y.K. Jung, K.S. Kim, Fas- and tumor necrosis factor-mediated apoptosis uses the same binding surface of FADD to trigger signal transduction. A typical model for convergent signal transduction, J. Biol. Chem. 275 (2000) 36217 – 36222. [15] C.H. Weber, C. Vincenz, The death domain superfamily: a tale of two interfaces? Trends Biochem. Sci. 26 (2001) 475 – 481. [16] S. Vetterkind, S. Illenberger, J. Kubicek, M. Boosen, K.H. Scheidtmann, U. Preuss, Binding of Par-4 to the actin cytoskeleton is essential for its proapoptotic function, Exp. Cell Res. 305 (2005) 392 – 408. [17] G. Qiu, M. Ahmed, S.F. Sells, M. Mohiuddin, M.H. Weinstein, V.M. Rangnekar, Mutually exclusive expression patterns of Bcl-2 and Par-4 in human prostate tumors consistent with down-regulation of Bcl-2 by Par-4, Oncogene 18 (1999) 623 – 631. [18] N. El Guendy, Y. Zhao, S. Gurumurthy, R. Burikhanov, V.M. Rangnekar, Identification of a unique core domain of par-4 sufficient

190

[19]

[20]

[21]

[22]

[23]

[24]

[25]

[26]

[27]

[28] [29] [30] [31]

[32] [33]

[34]

[35]

[36]

[37]

M. Boosen et al. / Experimental Cell Research 311 (2005) 177 – 191 for selective apoptosis induction in cancer cells, Mol. Cell. Biol. 23 (2003) 5516 – 5525. S. Boehrer, K.U. Chow, E. Puccetti, M. Ruthardt, S. Godzisard, A. Krapohl, B. Schneider, D. Hoelzer, P.S. Mitrou, V.M. Rangnekar et al., Deregulated expression of prostate apoptosis response gene4 in less differentiated lymphocytes and inverse expressional patterns of par-4 and bcl-2 in acute lymphocytic leukemia, 2 (2001) 103 – 107. J. Cook, S. Krishnan, S. Ananth, S.F. Sells, Y. Shi, M.M. Walther, W.M. Linehan, V.P. Sukhatme, M.H. Weinstein, V.M. Rangnekar, Decreased expression of the pro-apoptotic protein Par-4 in renal cell carcinoma, Oncogene 18 (1999) 1205 – 1208. T. Lucas, B. Pratscher, S. Krishnan, D. Fink, P. Gunsberg, M. Wolschek, V. Wacheck, T. Muster, I. Romirer, K. Wolff, et al., Differential expression levels of Par-4 in melanoma, Melanoma Res. 11 (2001) 379 – 383. M. Chakraborty, S.G. Qiu, K.M. Vasudevan, V.M. Rangnekar, Par-4 drives trafficking and activation of Fas and Fasl to induce prostate cancer cell apoptosis and tumor regression, Cancer Res. 61 (2001) 7255 – 7263. S. Vetterkind, M. Boosen, K.H. Scheidtmann, U. Preuss, Ectopic expression of Par-4 leads to induction of apoptosis in CNS tumor cell lines, Int. J. Oncol. 26 (2005) 159 – 167. M. Barradas, A. Monjas, M.T. Diaz-Meco, M. Serrano, J. Moscat, The downregulation of the pro-apoptotic protein Par-4 is critical for Ras-induced survival and tumor progression, EMBO J. 18 (1999) 6362 – 6369. S.G. Qiu, S. Krishnan, N. El Guendy, V.M. Rangnekar, Negative regulation of Par-4 by oncogenic Ras is essential for cellular transformation, Oncogene 18 (1999) 7115 – 7123. M.T. Diaz-Meco, M.M. Municio, S. Frutos, P. Sanchez, J. Lozano, L. Sanz, J. Moscat, The product of par-4, a gene induced during apoptosis, interacts selectively with the atypical isoforms of protein kinase C, Cell 86 (1996) 777 – 786. J. Moscat, M.T. Diaz-Meco, The atypical protein kinase Cs. Functional specificity mediated by specific protein adapters, EMBO Rep. 1 (2000) 399 – 403. M. Barkett, T.D. Gilmore, Control of apoptosis by Rel/NF-kappaB transcription factors, Oncogene 18 (1999) 6910 – 6924. N.D. Perkins, The Rel/NF-kappa B family: friend and foe, Trends Biochem. Sci. 25 (2000) 434 – 440. B. Rayet, C. Gelinas, Aberrant rel/nfkb genes and activity in human cancer, Oncogene 18 (1999) 6938 – 6947. R.W. Johnstone, R.H. See, S.F. Sells, J. Wang, S. Muthukkumar, C. Englert, D.A. Haber, J.D. Licht, S.P. Sugrue, T. Roberts, et al., A novel repressor, par-4, modulates transcription and growth suppression functions of the Wilms’ tumor suppressor WT1, Mol. Cell. Biol. 16 (1996) 6945 – 6956. V. Scharnhorst, A.J. van der Eb, A.G. Jochemsen, WT1 proteins: functions in growth and differentiation, Gene 273 (2001) 141 – 161. D.J. Richard, V. Schumacher, B. Royer-Pokora, S.G. Roberts, Par4 is a coactivator for a splice isoform-specific transcriptional activation domain in WT1, Genes Dev. 15 (2001) 328 – 339. S.K. Cheema, S.K. Mishra, V.M. Rangnekar, A.M. Tari, R. Kumar, G. Lopez-Berestein, Par-4 transcriptionally regulates Bcl-2 through a WT1-binding site on the bcl-2 promoter, J. Biol. Chem. 278 (2003) 19995 – 20005. S. Camandola, M.P. Mattson, Pro-apoptotic action of PAR-4 involves inhibition of NF-kappaB activity and suppression of BCL-2 expression, J. Neurosci. Res. 61 (2000) 134 – 139. S. Boehrer, K.U. Chow, F. Beske, N. Kukoc-Zivojnov, E. Puccetti, M. Ruthardt, C. Baum, V.M. Rangnekar, D. Hoelzer, P.S. Mitrou, et al., In lymphatic cells par-4 sensitizes to apoptosis by down-regulating bcl-2 and promoting disruption of mitochondrial membrane potential and caspase activation, Cancer Res. 62 (2002) 1768 – 1775. M.T. Diaz-Meco, M.J. Lallena, A. Monjas, S. Frutos, J. Moscat, Inactivation of the inhibitory kappaB protein kinase/nuclear factor

[38]

[39]

[40]

[41]

[42]

[43]

[44]

[45]

[46]

[47]

[48]

[49]

[50]

[51] [52]

[53]

[54]

[55]

kappaB pathway by Par-4 expression potentiates tumor necrosis factor alpha-induced apoptosis, J. Biol. Chem. 274 (1999) 19606 – 19612. G. Page, D. Ko¨gel, V. Rangnekar, K.H. Scheidtmann, Interaction partners of Dlk/ZIP kinase: co-expression of Dlk/ZIP kinase and Par-4 results in cytoplasmic retention and apoptosis, Oncogene 18 (1999) 7265 – 7273. T. Kawai, M. Matsumoto, K. Takeda, H. Sanjo, S. Akira, ZIP kinase, a novel serine/threonine kinase which mediates apoptosis, Mol. Cell. Biol. 18 (1998) 1642 – 1651. D. Ko¨gel, O. Plo¨ttner, G. Landsberg, S. Christian, K.H. Scheidtmann, Cloning and characterization of Dlk, a novel serine/threonine kinase that is tightly associated with chromatin and phosphorylates core histones, Oncogene 17 (1998) 2645 – 2654. G. Shohat, G. Shani, M. Eisenstein, A. Kimchi, The DAP-kinase family of proteins: study of a novel group of calcium-regulated death-promoting kinases, Biochim. Biophys. Acta 1600 (2002) 45 – 50. Y. Irie, K. Yamagata, Y. Gan, K. Miyamoto, E. Do, C.H. Kuo, E. Taira, N. Miki, Molecular cloning and characterization of Amida, a novel protein which interacts with a neuron-specific immediate early gene product arc, contains novel nuclear localization signals, and causes cell death in cultured cells, J. Biol. Chem. 275 (2000) 2647 – 2653. P. Chomczynski, N. Sacchi, Single-step method of RNA isolation by acid guanidinium thiocyanate-phenol-chloroform extraction, Anal. Biochem. 162 (1987) 156 – 159. J.M. Short, J.M. Fernandez, J.A. Sorge, W.D. Huse, Lambda ZAP: a bacteriophage lambda expression vector with in vivo excision properties, Nucleic Acids Res. 16 (1988) 7583 – 7600. E. Mu¨ller, K.H. Scheidtmann, Purification and characterization of a protein kinase which is activated by SV40 large T-antigen and phosphorylates the tumor suppressor protein p53, Oncogene 10 (1995) 1175 – 1185. D.B. Smith, K.S. Johnson, Single-step purification of polypeptides expressed in Escherichia coli as fusions with glutathione S-transferase, Gene 67 (1988) 31 – 40. S. Hu¨ttelmaier, S. Illenberger, I. Grosheva, M. Rudiger, R.H. Singer, B.M. Jockusch, Raver1, a dual compartment protein, is a ligand for PTB/hnRNPI and microfilament attachment proteins, J. Cell Biol. 155 (2001) 775 – 786. S. Nakielny, G. Dreyfuss, The hnRNP C proteins contain a nuclear retention sequence that can override nuclear export signals, J. Cell Biol. 134 (1996) 1365 – 1373. G.L. Lyford, K. Yamagata, W.E. Kaufmann, C.A. Barnes, L.K. Sanders, N.G. Copeland, D.J. Gilbert, N.A. Jenkins, A.A. Lanahan, P.F. Worley, Arc, a growth factor and activity-regulated gene, encodes a novel cytoskeleton-associated protein that is enriched in neuronal dendrites, Neuron 14 (1995) 433 – 445. S. Chang, J.H. Kim, J. Shin, p62 forms a ternary complex with PKCzeta and PAR-4 and antagonizes PAR-4-induced PKCzeta inhibition, FEBS Lett. 510 (2002) 57 – 61. S. Pinol-Roma, G. Dreyfuss, Shuttling of pre-mRNA binding proteins between nucleus and cytoplasm, Nature 355 (1992) 730 – 732. Y. Gan, E. Taira, Y. Irie, T. Fujimoto, N. Miki, Arrest of cell cycle by amida which is phosphorylated by Cdc2 kinase, Mol. Cell. Biochem. 246 (2003) 179 – 185. E. Berra, M.M. Municio, L. Sanz, S. Frutos, M.T. Diaz-Meco, J. Moscat, Positioning atypical protein kinase C isoforms in the UVinduced apoptotic signaling cascade, Mol. Cell. Biol. 17 (1997) 4346 – 4354. M. Roussigne, C. Cayrol, T. Clouaire, F. Amalric, J.P. Girard, THAP1 is a nuclear proapoptotic factor that links prostate-apoptosisresponse-4 (Par-4) to PML nuclear bodies, Oncogene 22 (2003) 2432 – 2442. S. Boehrer, A. Brieger, S. Schaaf, N. Kukoc-Zivojnov, D. Nowak, M. Ruthardt, D. Hoelzer, P.S. Mitrou, E. Weidmann, K.U. Chow, In the erythroleukemic cell line HEL Prostate-apoptosis-response-gene-4

M. Boosen et al. / Experimental Cell Research 311 (2005) 177 – 191

[56] [57] [58]

[59]

(par-4) fails to down-regulate Bcl-2 and to promote apoptosis, Leuk. Lymphoma 45 (2004) 1445 – 1451. P. Salomoni, P.P. Pandolfi, The role of PML in tumor suppression, Cell 108 (2002) 165 – 170. J.S. Seeler, A. Dejean, The PML nuclear bodies: actors or extras? Curr. Opin. Genet. Dev. 9 (1999) 362 – 367. T. Kawai, S. Akira, J.C. Reed, ZIP kinase triggers apoptosis from nuclear PML oncogenic domains, Mol. Cell. Biol. 23 (2003) 6174 – 6186. H. Suria, L.A. Chau, E. Negrou, D.J. Kelvin, J. Madrenas, Cyto-

191

skeletal disruption induces T cell apoptosis by a caspase-3 mediated mechanism, Life Sci. 65 (1999) 2697 – 2707. [60] D. Kulms, H. Du¨hmann, B. Po¨ppelmann, S. Sta¨nder, A. Schwarz, T. Schwarz, Apoptosis induced by disruption of the actin cytoskeleton is mediated via activation of CD95 (Fas/APO-1), Cell Death Differ. 9 (2002) 598 – 608. [61] M. Bando, Y. Miyake, M. Shiina, M. Wachi, K. Nagai, T. Kataoka, Actin cytoskeleton is required for early apoptosis signaling induced by anti-Fas antibody but not Fas ligand in murine B lymphoma A20 cells, Biochem. Biophys. Res. Commun. 290 (2002) 268 – 274.