Partial characterization of an atypical family I inorganic pyrophosphatase from cattle tick Rhipicephalus (Boophilus) microplus

Veterinary Parasitology 184 (2012) 238–247

Contents lists available at SciVerse ScienceDirect

Veterinary Parasitology journal homepage: www.elsevier.com/locate/vetpar

Partial characterization of an atypical family I inorganic pyrophosphatase from cattle tick Rhipicephalus (Boophilus) microplus Evenilton P. Costa a , Eldo Campos e , Caroline P. de Andrade c , Arnoldo R. Fac¸anha b , Luiz Saramago e , Aoi Masuda d , Itabajara da Silva Vaz Jr. c , Jorge H. Fernandez a , Jorge Moraes e , Carlos Logullo a,∗ a Laboratório de Química e Func¸ão de Proteínas e Peptídeos and Unidade de Experimentac¸ão Animal – CBB/UENF, 28013-602, Campos dos Goytacazes, RJ, Brazil b Laboratório de Biologia Celular e Tecidual – CBB/UENF, 28013-602, Campos dos Goytacazes, RJ, Brazil c Faculdade de Veterinária and Centro de Biotecnologia do Estado do Rio Grande do Sul, Universidade Federal do Rio Grande do Sul, Av. Bento Gonc¸alves 9500, C.P. 15005, 91501-970, Porto Alegre, RS, Brazil d Departamento de Biologia Molecular e Biotecnologia, Universidade Federal do Rio Grande do Sul, Av. Bento Gonc¸alves 9500, C.P. 15005, 91501-970, Porto Alegre, RS, Brazil e Laboratório Integrado de Bioquímica Hatisaburo Masuda, Instituto de Bioquímica Médica – IBqM and Núcleo em Ecologia e Desenvolvimento Sócio-Ambiental de Macaé – NUPEM/UFRJ, Av. São José do Barreto s/n, CEP 27971-550, São José do Barreto, Macaé, RJ, Brazil

a r t i c l e

i n f o

Article history: Received 17 May 2011 Received in revised form 18 August 2011 Accepted 5 September 2011 Keywords: Disulfide bonds Soluble inorganic pyrophosphatase Tick Rhipicephalus (Boophilus) microplus

a b s t r a c t The present paper presents the partial characterization of a family I inorganic pyrophosphatase from the hard tick Rhipicephalus (Boophilus) microplus (BmPPase). The BmPPase gene was cloned from the tick embryo and sequenced. The deduced amino acid sequence shared high similarity with other eukaryotic PPases, on the other hand, BmPPase presented some cysteine residues non-conserved in other groups. This pyrophosphatase is inhibited by Ca2+ , and the inhibition is antagonized by Mg2+ , suggesting that the balance between free Ca2+ and free Mg2+ in the eggs could be involved in BmPPase activity control. We observed that the BmPPase transcripts are present in the fat body, midgut and ovary of ticks, in two developmental stages (partially and fully engorged females). However, higher transcription amounts were found in ovary from fully engorged females. BmPPase activity was considerably abolished by the thiol reagent dithionitrobenzoic acid (DTNB), suggesting that cysteine residues are exposed in its structure. Therefore, these cysteine residues play a critical role in the structural stability of BmPPase. Molecular dynamics simulation analysis indicates that BmPPase is the first Family I PPase that could promote disulfide bonds between cysteine residues 138–339 and 167–295. Finally, we believe that these cysteine residues exposed in the BmPPase structure can play an important controlling role regarding enzyme activity, which would be an interesting mechanism of redox control. The results presented here also indicate that this enzyme can be involved in embryogenesis of this arthropod, and may be useful as a target in the development of new tick control strategies. Published by Elsevier B.V.

1. Introduction

∗ Corresponding author. Tel.: +55 22 2739 7134. E-mail address: [email protected] (C. Logullo). 0304-4017/$ – see front matter. Published by Elsevier B.V. doi:10.1016/j.vetpar.2011.09.005

Rhipicephalus (Boophilus) microplus is a one-host tick that causes major losses to bovine herds, especially in tropical regions. In this scenario, major efforts have been directed toward developing immunoprophylactic tick control tools (Guerrero et al., 2006; Parizi et al., 2009). Ticks

E.P. Costa et al. / Veterinary Parasitology 184 (2012) 238–247

are vectors of parasites that cause hemoparasitic diseases, endemic in many cattle production areas (Sonenshine et al., 2006). R. microplus takes one host only throughout its three life stages, typically a bovine, with a long feeding period (approximately 21 days). Tick females, after engorgement, drop off the host and initiate oviposition around three days later. Due to the fact that the tick is an oviparous animal, embryogenesis occurs in the absence of exogenous nutrients, and maternal nutrients are packaged in oocytes and stored mostly as yolk granules. Hatching occurs around 21 days after oviposition, and the emerging larvae can survive several weeks before finding a host, using the remaining yolk as the only source of energy (Fagotto, 1990; Logullo et al., 2002). Soluble inorganic pyrophosphatases (PPases, EC 3.6.1.1) catalyze the hydrolysis of inorganic pyrophosphate (PPi ), which is formed mainly as a byproduct of the many biosynthetic reactions that utilize ATP, and thus play an important role in cell anabolism (Kornberg, 1962). Pyrophosphatase falls into two major classes, soluble (PPase) and membrane-bound (H+ -PPase) pyrophosphatases (Baykov et al., 1990). PPases play several roles, like participation in steroid biosynthetic pathways, regulation of cell motility, nucleotide metabolism – as well as nuclear participation in the regulation of the transcription of some genes (Westfall et al., 1997; Gdula et al., 1998; Guranowski, 2000). In addition, Herbomel and Ninio (1980) discussed the importance of this enzyme in the light of the effect it exerts on the accuracy of DNA replication processes, suggesting an important role in evolutionary events. These enzymes form two non-homologous families that are distributed among living organisms, which typically produce either one or the other enzyme family, a clear example of the convergent evolution of an essential catalytic activity (Shintani et al., 1998; Young et al., 1998; Sivula et al., 1999). Family I pyrophosphatases have been described as either homohexamers (Avaeva et al., 2000; Vainonen et al., 2002), homotetramers in prokaryotes (Jeon and Ishikawa, 2005) and/or as homodimers in eukaryotes (Kuranova et al., 2003). They require a divalent metal cation as cofactor, with Mg2+ being the most efficient one in physiological conditions (Belogurov et al., 2000) and have a strikingly conserved active site formed by 13 functionally important polar residues (Vainonen et al., 2002). Additionally, PPases from diverse organisms (bacteria, yeast and animal) have been described to be strongly inhibited by Ca2+ at physiological concentrations (Mitchell and Minnick, 1997). In Escherichia coli, this inhibitory effect has been described to be possibly related to a replacement of Mg2+ by catalytically incompetent Ca2+ at the M2 metal binding site of the enzyme and/or a competition between MgPPi and non-hydrolysable CaPPi for the active site (Avaeva et al., 2000; Samygina et al., 2001). Family II pyrophosphatases are homodimers and are more effectively activated by Mn2+ than Mg2+ , a characteristic attributed to the presence of histidine residues in the active site (Merckel et al., 2001; Parfenyev et al., 2001). In the current study, we investigated some biochemical and structural features of the Family I PPase from R. microplus, especially the peculiarities of its amino acid sequence and, therefore, the non-conserved cysteine

239

residues. A modulation by divalent cations is described and a physiological role of this enzyme during the tick’s embryogenesis is discussed. 2. Material and methods 2.1. Ticks and eggs Ticks were obtained from a colony maintained at the Faculdade de Veterinária, Universidade Federal do Rio Grande do Sul, Brazil. R. microplus (Acarina, Ixodidae) ticks from the Porto Alegre strain (free of parasites) were reared on calves, which were brought from a naturally tick-free area and maintained in insulated individual boxes in the same University. Calves were infested with 10-day-old tick larvae. After 21 days, partially engorged and fully engorged adult females ticks were collected. Fully engorged females were kept in Petri dishes at 28 ◦ C and 80% relative humidity until completion of oviposition. Eggs were collected on the 1st, 3rd, 6th, 9th, 12th and 15th days after the beginning of oviposition and stored at −70 ◦ C (Da Silva Vaz et al., 1994). 2.2. Protein and enzyme assay Eggs (550 mg/fresh) collected on the 6th day after the beginning of oviposition were homogenized in 1.5 ml of an ice-cold buffer containing 100 mM Tris–HCl (pH 8.0), 10% (v/v) glycerol, 150 mM KCl, 100 ␮M leupeptin and 100 nM pepstatin. The homogenate was centrifuged at 100,000 × g for 40 min at 4 ◦ C. The supernatant was carefully transferred into a glass tube and was kept on ice. The activity was assayed in a reaction medium containing 50 mM MOPS–Tris (pH 7.5), 300 ␮M Na4 PPi (Sigma) and 600 ␮M MgCl2 (Sigma). The reaction was carried out at 30 ◦ C for 15 min. The BmPPase activity was measured colorimetrically by determining the rate of the Pi formed during the reaction as described by Fiske and Subbarow (1925). Measurements of absorbance at 750 nm were performed after 15 min. Protein concentration was measured as described by Bradford (1976), using bovine serum albumin as standard. For the determination of optimal pH, “buffer mix” was prepared: 50 mM Tris/Acetate/Glycine/Citrate (Abreu et al., 2004). 2.3. Cysteine derivatization with DTNB (5,5 -dithio-bis(2-nitrobenzoic acid)) The BmPPase cysteine residues derivatization was carried out by incubating the enzyme in 50 mM MOPS–Tris (pH 8.5) buffer with 600 ␮M MgCl2 (Sigma) and 5 mM DTNB (Sigma). The incubation was carried out at 30 ◦ C for 2, 3, 4 and 6 h. The activity was measured as described in Section 2.2. 2.4. Cloning of BmPPase cDNA Total RNA was extracted from 6-day-old eggs using TRIZOL reagent (Invitrogen) according to the manufacturer’s instructions. First-strand cDNA was synthesized from 4 ␮g of total RNA submitted to reverse transcription (RT) with superscript II (Invitrogen), according to the manufacturer’s

240

E.P. Costa et al. / Veterinary Parasitology 184 (2012) 238–247

instructions. The cDNA encoding BmPPase was amplified by polymerase chain reaction (PCR) using specific primers (forward 5 ATGCTCTGGCAAGGCGTCATTGGG3 and reverse 5 -CTTGAGGCACACGAAGTGCCACTTGTC-3 ) to the sequence of the gene present in the DFCI B. microplus Gene Index. Conditions for amplification with Elongase polymerase were: 3 min at 94 ◦ C, 30 cycles of amplification consisting of 30 s at 94 ◦ C, 30 s at 66 ◦ C, and 2 min at 68 ◦ C; and a final extension at 68 ◦ C for 5 min. The 1023 bp amplified fragment encoding the BmPPase was cloned into cloning vector pGEM-T (Promega) to give the pGEM-BmPPase plasmid. The recombinant plasmid was propagated in E. coli (XL1-Blue) by electroporation and selected in Luria–Bertani (LB) agar medium containing ampicillin (100 ␮g mL−1 ). The integrity of the BmPPase coding sequence was confirmed by PCR, enzyme restriction and sequencing analyses. The clones were sequenced in both directions for five times. 2.5. Sequence analysis Nucleotide sequence identity was performed using the BLAST program (NCBI). Amino acid alignment and analysis of BmPPase similarity for selected species was performed using the Clustal W multiple sequences alignment program included in the BioEdit version 7.0.9.0 software program (Hall, 1999). The phylogenetic and molecular evolutionary analyses were conducted using MEGA version 4 (Tamura et al., 2007). In this analysis, soluble PPases sequences from cytosol (cyt), mitochondria (mit) and chloroplast (chlo) were used. Accession numbers for the sequences are B. taurus cyt (NP 001068586.1), H. sapiens mit (AAG36781.1), S. cerevisiae mit (NP 013994.1), C. reinhardtii chlor (CAC42762.1), C. incerta chlor (ABA01129.1), X. tropicalis cyt (CAJ83623.1), D. rerio cyt (NP 001017833.1), T. marmorata cyt (AAD50298.1), H. sapiens cyt (AF154065 1), T. castaneum cyt (XP 967051.1), N. vitripennis cyt (XP 001604166.1), A. aegypti cyt (ABF18311.1), D. melanogaster (AAC97112.1), R. microplus cyt (TIGR, TC15361), A. suun cyt (BAC66617.1), C. elegans cyt (NP 001023074.1) and S. cerevisiae cyt (PDB: 1M38), L. major cyt (AAQ72355.1), C. reinhardtii cyt (XP 001694912.1), I. scapularis cyt (XP 002409166.1), S. cerevisiae cyt (NP 009565.1), B. subtilis (PDB: 1K23), S. gordonii (PDB: 1K20), B. anthracis (YP 028894.1), S. saprophyticus (YP 300962.1), V. cholerae (YP 001217236.1), P. profundum (ZP 01219255.1), L. acidophilus (AAV42969.1), T. yellowstonii (YP 002248843.1), S. pneumoniae (CAR69279.1), S. aureus (CAG40997.1). 2.6. Homology modeling of BmPPase and molecular dynamics simulation The multiple sequence alignment of BmPPase and other members of related families was performed using ClustalW2 program from the website http://www.ebi.ac.uk/clustalw (Larkin et al., 2007) and based on degree of sequence identity, the structure from Saccharomyces cerevisiae PPase (PDB 1M38, Kuranova et al., 2003) was used to predict the 3D structure of BmPPase. Atomic coordinates of the crystal structure

from S. cerevisiae PPase solved at 1.8 A´˚ resolution were used as template in homology modeling by compliance to spatial restraints (Sali and Blundell, 1993) implemented in the program MODELLER 9v4 (Sali and Blundell, 1993; Fiser et al., 2000; Marti-Renom et al., 2000). MODELLER is a computer program that models three-dimensional structures of proteins and their assemblies by satisfaction of spatial restraints. Ten models were generated in this experiment. The quality of several predicted folds was evaluated using the DOPE score of the variable target function (Marti-Renom et al., 2000). The stereochemical quality of the 3 best scoring models was assessed using the Procheck program (Laskowski et al., 1993) at 1.8 A˚ resolution. The final model was selected based on the overall stereochemical quality for further energy minimization, relaxation and molecular dynamics (MD) simulation experiments using Gromacs 4.02 (Hess et al., 2008). Molecular dynamics (MD) is computer simulation with atoms and/or molecules interacting using some basic laws of physics. The initial molecular model for BmPPase was solvated in water box using the SPC/E model (Brunne et al., 1993). The final system was formed by homodimeric molecule surrounded by 24,000 water molecules, representing more than three layers of solvation in periodic boundary conditions. Protein topologies were obtained using the pdb2gmx tool, using standard protonation states (pH 7.0) for all residues and adding amino and carboxylterminals for each chain. For system neutralization, Na+ and Cl− ions were used. Simulation systems were submitted to a steepest-decent energy minimization, converging to machine precision to remove bad van der Waals contacts. In the energy minimization process, all protein bonds and water molecules were constrained using the LINCS (Hess et al., 1997) algorithm. For further relaxation, the minimized structure of the homodimer was used in unrestrained molecular dynamic for 10 ns with berendsen-type temperature (310 K) and pressure (1 atm) coupled to a NVT octahedral simulation cell, implementing the PME method of electrostatic treatment (Essman et al., 1995). Production dynamics were carried out under the same conditions for 5–20 ns, and GROMACS 4.02 package programs were used in all plots and matrixes calculations.

2.7. Relative quantification of BmPPase mRNA To evaluate BmPPase relative transcription, total RNA was extracted from the midgut, ovary and fat body of partially (non-vitellogenic) and fully (vitellogenic) engorged female ticks and eggs collected on the 1st, 3rd, 6th, 9th, 12th and 15th days after the start of oviposition (individual and pooled samples). Ticks were washed with 70% ethanol and rinsed with PBS prior to dissection of midgut, ovary and fat body under a stereomicroscope. Total RNA was extracted using TRIzol reagent (Invitrogen) following the manufacturer’s recommendations. RNA quantity and quality were estimated by spectrophotometry at 260/280 nm. Two micrograms of total RNA was reverse-transcribed at 37 ◦ C using the High-capacity cDNA Reverse Transcription

E.P. Costa et al. / Veterinary Parasitology 184 (2012) 238–247

241

Fig. 1. Multiple sequence alignment of family I PPases. The signature motif (DxDxxD) from Family I PPases is indicated in the R. microplus amino acids sequence. The Cys residues of BmPPase sequence involved with putative disulfide bond are bold-faced. The red and yellow triangles indicate possible pairs of disulfide bonds. The white and black triangles indicate the cleavage site for signal peptide removal and the 10 catalytically important residues surrounding the active site, respectively. The last red triangle indicates that this Cys is conserved only in ticks and that it is located in the N-terminus. Accession numbers for the sequences follow: R. microplus (TIGR, TC15361), I. scapularis (XP 002409166.1), T. castaneum (XP 967051.1), N. vitripennis (XP 001604166.1), A. aegypti (ABF18311.1) and D. melanogaster (AAC97112.1).

kit with random primers according to manufacturer’s recommendations (Applied Biosystems). The quantification of mRNA was performed at LightCycler® 1.5 platform (Roche) using LightCycler® FastStart DNA Masterplus SYBR Green I amplification kit (Roche). The cDNA encoding BmPPase was amplified with specific primers: 5 -ATGCTCTGGCAAGG-CGTCATTGGG-3 (forward) and 5 -CTTGAGGCACACGAAGTGCCACTTGTC-3 (reverse) to generate a 99 bp PCR product. As reference gene, cDNA encoding 40S ribosomal protein (GenBank EW679928) was amplified with specific primers 5 -GGACGACCGATGGCTACCT-3 (forward) and 5 TGAGTTGATTGGCGCACTTCT-3 (reverse) that generated a 69 bp PCR product. The efficiency curves for BmPPase and 40S were determined with 1/2, 1/5, 1/10 and 1/20 cDNA dilutions in triplicate, and for the analyses 100 ng cDNA was added to each reaction. All experiments were carried out in glass capillaries, in 10 ␮L reactions. The PCR parameters were 10 min at 95 ◦ C followed by 35 cycles of 10 s at 95 ◦ C, 5 s annealing at 55 ◦ C (BmPPase PCR) or 47 ◦ C (40S PCR) and extension at 72 ◦ C for 5 s. After PCR reaction, the melting curve analysis was performed as follows: denaturation at 95 ◦ C for 0 s and annealing at 65 ◦ C for 15 s followed by a gradual increase in temperature (transition

rate of 0.1 ◦ C/s) to 95 ◦ C with continuous fluorescence detection. The relative expression ratio of BmPPase gene was determined by using the CP values from each run according to the mathematical model described by Pfaffl (2001) on Relative Expression Software Tool (REST-MCS©) (Pfaffl et al., 2002), using R. microplus 40S ribosomal protein S3a as reference gene (Pohl et al., 2008). The cDNA from embryonic cells BME26 (Esteves et al., 2008) was used as calibrator for the analysis of tissue and embryos together. Results were expressed as mean and standard error of three independent experiments. 3. Results 3.1. Amino acid sequence analysis The gene of an inorganic pyrophosphatase from Rhipicephalus (Boophilus) microplus was cloned (Genbank JF919678) and characterized. The Ixodes scapularis inorganic pyrophosphatase (IsPPase, GenBank XM 002409122), a related tick, showed 75% amino acid sequence similarity to R. microplus. Multiple alignment analyses of BmPPase with other PPase sequences, InterProScan (Zdobnov and Apweiler, 2001) (IPR008162) and

242

E.P. Costa et al. / Veterinary Parasitology 184 (2012) 238–247

Fig. 2. Phylogenetic analysis. Phylogenetic tree was constructed by the neighbor-joining method generated by MEGA (version 4) software after alignment in the Clustal W program. Bootstrap values were calculated from 1000 replications. Sequences of Family I (cytosolic, mitochondrial and chloroplast) and Family II PPases were used for the analysis.

PROSITE (PDOC00325) (De Castro et al., 2006) revealed the conservation of three Asp residues of Family I PPase signature motif and 10 other catalytically important residues surrounding the active site (Fig. 1). In addition, the SignalP 3.0 Server (Bendtsen et al., 2004) identified a cleavage site for the removal of the signal peptide between amino acids 21 and 22. Additionally, the multiple alignment revealed that both BmPPase and IsPPase contains important eukaryotic characteristics, as the low number of Cys residues (BmPPase: 6 cys and IsPPase: 8 cys) (Lee et al., 2007). However, BmPPase and IsPPase share 5 Cys residues, with being 4 exposed to solvent (Fig. 1). The sequence analysis showed that the 1023 bp open reading frame (ORF) encode a 341-aa putative protein with theoretical molecular mass and pI value estimated as 38.7 kDa and 5.56, respectively, and exhibits 30–70% identity (data not shown) with other eukaryotic Family I PPases. The amino acid sequences of PPase were used to build a distance dendrogram using the Neighbor-Joining method and the phylogenetic analysis indicated that arthropods PPases form a distinct cluster from other animal Family I PPases (Fig. 2) and it clustered within the same subgroup of eukaryotic Family I PPases.

3.2. Biochemical properties of BmPPase The BmPPase activity was analyzed during embryogenesis, and the peak was on the 6th day after oviposition (Fig. 3A). The optimal pH of the BmPPase activity was around 7.5 (Fig. 4A insert). Afterwards, we investigated the influence of calcium and magnesium ions on BmPPase activity and the inhibitory effect of fluoride and EDTA. Our results show that BmPPase is totally inhibited by EDTA (1 mM) (Fig. 4A), confirming its divalent metal-dependent activity. We also observed that fluoride (1 mM) inhibited BmPPase activity by 80% (Fig. 4A). These characteristics are in agreement with Family I PPase. In this sense, BmPPase was also totally inhibited by 500 nM Ca2+ (Fig. 4A), and this effect was antagonized by increasing Mg2+ concentrations (Fig. 4B). 3.3. Relative transcription analysis To investigate BmPPase relative transcription in different tissues of partially (non-vitellogenic) and fully (vitellogenic) engorged female ticks (Fig. 3C) and also in eggs (Fig. 3B) collected at different embryogenesis stages, we performed qPCR analysis, using cDNA samples of

E.P. Costa et al. / Veterinary Parasitology 184 (2012) 238–247

Fig. 3. Activity profile, relative transcription analysis during embryogenesis and in tissues at two stages of development. (A) The specific activity of BmPPase was measured in buffer MOPS–Tris (pH 7.5) in 300 ␮M Na4 PPi and 600 ␮M MgCl2 under incubation for 15 min at 30 ◦ C. After incubation the activity was measured colorimetrically by determining the rate of the Pi formed during reaction as described by Fiske and Subbarow (1925). (B) The cDNA was synthesized from RNA isolated from eggs collected on days 1, 3, 6, 9, 12 and 15 after the beginning of oviposition. Respective cDNA quantitative values are shown relative to the amount of the 40S cDNA. Both relative expression analyses of BmPPase were determined according to Pfaffl (2001) using 40S ribosomal protein S3a as reference gene (see Section 2). (C) The cDNA was synthesized from RNA isolated from ovary, midgut and fat body from partially engorged adult females (white bars) and engorged adult females (black bars). Eggs were collected on day 1 after the beginning of engorged female oviposition. All results are expressed as mean ± S.E. of three independent experiments, in triplicates. Unpaired Student’s t test (p < 0.05) was carried out. *p < 0.5; **p < 0.01; ***p < 0.001 represent significant differences from control conditions or one-day-old eggs.

midgut, fat body and ovaries. The ovaries (Fig. 3C) had the highest levels and were the only organ where the levels of BmPPase mRNA are higher in fully engorged females as compared to partially engorged females. Additionally, relative amount of transcript during embryogenesis (Fig. 3B) is higher in one-day-old eggs than at later times of the embryogenesis.

243

Fig. 4. Effect of pH, Ca2+ , Mg2+ , EDTA and NaF on BmPPase activity. (A) The BmPPase activity was assayed in the “buffer mix” with the pH adjusted as indicated (insert). After incubation, the activity was measured colorimetrically by determining the rate of the Pi formed during reaction as described in Section 2. The effect of EDTA, NaF and Ca2+ was tested in soluble fraction partially purified from 6-day-old eggs. The results are expressed as mean ± S.E. of three independent experiments, in triplicates. (B) The reversion of inhibitory effect of Ca2+ on BmPPase activity was evaluated using increasing concentrations of Mg2+ . The results are expressed as the mean of three independent experiments, in triplicates.

3.4. Structural features of BmPPase Due to the amount of cysteine residues conserved in ticks (Fig. 1), the BmPPase structural model was constructed to evaluate other parameters. The predicted 3D model of BmPPase has the same quaternary structure of eukaryotic PPases. According to our analyses, this BmPPase is a homodimeric protein (Fig. 5) like other eukaryotic PPases. Remarkably, the amino acids involved with the dimer interface are not extensively conserved. For eukaryotic PPases, the dimer interface is formed by 4 amino acids, 2 in each hairpin. In the present case, for BmPPase, the first hairpin loads arginine (Arg106 ) and tryptophan (Trp107 ) and the second hairpin loads arginine (Arg182 ) and valine (Val183 ) (Fig. 1). In yeast PPase the first hairpin is conserved, but the second hairpin loads threonine (T) and isoleucine (I). In order to better understand this structural model and its peculiarities, we used molecular dynamics (MD) simulation to evaluate it (Fig. 5). The “best” model was elected by global stereochemical quality in Verify3D (Luthy et al., 1992; Eisenberg et al., 1997) and

244

E.P. Costa et al. / Veterinary Parasitology 184 (2012) 238–247

Fig. 5. Homology modeling of BmPPase. The S. cerevisiae soluble PPase (PDB 1M38) was used as template based on degree sequence identity (60%) after multiple alignment. ␤-sheet is labeled in purple and ␣-helix is labeled in yellow. Mg2+ ions residues, in the conserved activity site region, were shown by green spheres. The putative disulfide bonds are indicated by arrows.

Procheck servers, and visualized in the NOC V3.01 software (http://noch.sourceforge.net/#Downloading). 3.5. Effect of the dithionitrobenzoic acid (DTNB) on BmPPase activity To investigate the effect of this cysteine derivatizing agent on the structure destabilization, BmPPase was incubated with 5 mM DTNB for different time periods (2–6 h) at 30 ◦ C (Fig. 6). After a 2 h incubation period, no effects were detected in BmPPase activity; however, after 3, 4 and 6 h inactivation was induced by DTNB by about 47%, 79% and 100%, respectively. 4. Discussion To our knowledge, little information has been published on soluble PPases using arthropods as model (Gdula

Fig. 6. Effect of DTNB on BmPPase activity. The samples were incubated with 5 mM DTNB for 2, 3, 4 and 6 h, respectively, in water bath at 30 ◦ C. Then, BmPPase activity was measured in MOPS-Tris buffer (pH 7.5) in 300 ␮M Na4 PPi and 600 ␮M MgCl2 under incubation for 15 min. After incubation, activity was measured colorimetrically by determining the rate of the Pi formed during reaction as described by Fiske and Subbarow (1925). All results are expressed as mean ± S.E. of three independent experiments, in triplicates. Unpaired Student’s t test (p < 0.05) was carried out. *p < 0.5; **p < 0.01; ***p < 0.001 represent significant differences from control conditions.

et al., 1998). In this paper, we describe an atypical Family I PPase with distinct sequence and structural characteristics. In addition, our data suggest that this enzyme could be involved in vitellogenesis and embryogenesis of R. microplus. Tick embryogenesis is characterized by the formation of a noncellular syncitium up to day 4, after which the embryo becomes a multicellular organism and starts organogenesis (Campos et al., 2006). In order to understand the role of BmPPase during embryogenesis, we analyzed this enzyme’s activity (Fig. 3A). We observed that its activity profile increased up to the 6th day after oviposition. This result makes sense, since this period is characterized by the intense anabolism during embryo development (Campos et al., 2006). Freitas et al. (2007) showed that glutathione S-transferase (GST) activity considerably increased during this period, which is interesting, since oxygen consumption increased too. Therefore, oxidative stress may be controlled by GST, catalase (CAT) and GSH content, thus contributing for the maintenance of a reducing environment. Kornberg (1962) showed that the PPi hydrolysis catalyzed by soluble inorganic pyrophosphatase is an important process for many anabolic reactions, especially those involved in the synthesis of DNA, RNA and proteins, due the fact that it promotes a thermodynamic pull. Since then, several other works have demonstrated the critical role of PPi in several prokaryotes (Chen et al., 1990), yeasts (Lundin et al., 1991) and nematodes (Ko et al., 2007). Like other Family I PPases, BmPPase is a metal-dependent enzyme (Fig. 4A) (Hoe et al., 2001; Gómez-García et al., 2004) and is inhibited by 80% by NaF 1 mM (Jeon and Ishikawa, 2005; van Alebeek et al., 1994). The Family I PPases and some H+ -PPases are well known to be highly sensitive to calcium (Samygina et al., 2001; Motta et al., 2004), which may suppress enzyme activity completely. For BmPPase, 500 nM Ca2+ promoted total inhibition (Fig. 4A), and we observed this effect being antagonized by increasing Mg2+ concentrations (Fig. 4B). This cation modulation occurred in a medium with

E.P. Costa et al. / Veterinary Parasitology 184 (2012) 238–247

physiological concentrations, suggesting that the balance between free Ca2+ and Mg2+ in eggs could play an important role in the regulation of BmPPase activity. Furthermore the BmPPase phylogenetic analysis corroborates the classification of this enzyme as a member of Family I PPases (Fig. 2). When we analyzed the transcription profile between partially and fully engorged females we observed that this enzyme transcript was more expressed by ovaries and this ovarian expression increased during the tick feeding process (Fig. 3C). This observation suggests that the transcription in this organ of this gene is probably related to vitellogenesis, and that it is closely related to the levels presented by ovaries from vitellogenic females. This may indicate the existence of a maternal RNA uptake mechanism from vitellogenic ovaries (Rosenthal and Wilt, 1986; Lublin and Evans, 2007), for posterior protein expression during embryogenesis (Fig. 3B). Vitellogenesis involves the processing of hemolymphatic protein called vitellogenin (Vg). Vg is a hemolymphatic phospholipoglycoprotein stored in growing oocytes. Once inside the oocytes, it is conventionally called vitellin (VT) and represents the main component of yolk platelets (Sappington and Raikhel, 1998). In R. microplus, VT degradation occurs concomitantly with yolk granules acidification before blastoderm formation, within six days after oviposition (Abreu et al., 2004), whereas in other arthropods this acidification promotes activation of intragranular enzymes such as acid phosphatases (Nordin et al., 1991; Fialho et al., 2002). During R. microplus embryogenesis we identified an increase in the specific activity of BmPPase between day 1 and day 6 (Fig. 3A), the same period in which acidification was detected in cytoplasmic periphery of eggs, as shown by Abreu et al. (2004). On the other hand, the transcription analysis of BmPPase shows an unaltered profile during embryogenesis (Fig. 3B), indicating that the enzyme is regulated by activity control. In conformity with multiple sequence alignments, BmPPase has six cysteine residues, five of which are conserved in another tick (Fig. 1). Thus, in face of these peculiarities, the three-dimensional structure was analyzed. The homology model was carried out using the structure of the S. cerevisiae PPase (PDB 1M38) (Kuranova et al., 2003) as template. The BmPPase and ScPPase showed 60% sequence identity. According to molecular dynamics simulation, our results suggest that Cys138 –Cys339 residues can make a disulfide bond, since both Cys residues were accommodated 3.5 A´˚ away from one another in the initial model. In addition, during assessment of the model by MD simulation, we observed that other cysteine residues (Cys167 –Cys295 ) were also interacting. The stereochemical characteristics of the structural model with disulfide bonds between Cys138 –Cys339 and Cys167 –Cys295 were in accordance with other well-solved structures, which are, to our knowledge, the first suggestion of disulfide bonds in soluble PPases. Our results suggest that BmPPase is an atypical Family I PPase, due to the possibility to form disulfide bonds. To date, disulfide bonds have not yet been described for soluble PPases, only for H+ -PPase (Mimura et al., 2005).

245

For a significant number of proteins, DTNB is a substance that classically alters structural stabilization when interfering in exposed cysteines (Pérez-Montfort et al., 1999). For the endoparasite Trypanosoma brucei, methyl methanethiosulfonate (MMTS), another cysteine derivatizing reagent, was able to interfere in the structure, reducing the activity of triosephosphate isomerase significantly (Gómez-Puyou et al., 1995). DTNB also was reported to reduce the intrinsic fluorescence spectrum and the activity for isocitrate dehydrogenase (Nagaoka et al., 1977) and triosephosphate isomerase (Moraes et al., 2011). In the BmPPase case, our results indicate some cysteine residues, probably Cys 167 and 295, are more exposed to solvent than others (Fig. 5). Therefore, after 4 h of incubation (Fig. 6), the cysteine residues that were poorly accessible on the surface area of the protein could be derivatized, which enhanced the deleterious effect promoted by DTNB, probably Cys 138 and 339 (Fig. 5). DTNB could be involved in the structural destabilization of BmPPase by chemical modification of these cysteine residues (Fig. 6), which is the main difference found in the amino acid sequence (Fig. 1) and structural model (Fig. 5) of this Family I PPase. Our results indicate that cysteine residues were in the reduced form and that they critically affect enzyme activity (Fig. 6). We believe that, in vivo, these cysteine residues may be targeted by oxidizing agents (H2 O2 , • OH, O2 − and NO) and thus participate in a redox control mechanism. Depending on the optimal pH of BmPPase in the acid range (Fig. 4A insert) the reducing environment probably is important to the stabilization of this enzyme. When these data are taken together, it is tempting to speculate that the acidification detected in the first part of embryogenesis (Abreu et al., 2004), until blastoderm formation on day 6 (Campos et al., 2006) promotes a reducing environment that may be accounting for the stabilization of the BmPPase activity (Fig. 3A). Finally, the molecular dynamic simulation suggests disulfide bond formation in BmPPase, which could be involved in the control of this enzyme activity. Interestingly, one-day-old eggs also presented the same quantity of BmPPase transcripts as vitellogenic ovaries, suggesting that BmPPase transcription during egg formation has a maternal origin, as described for other organisms (Rosenthal and Wilt, 1986; Lublin and Evans, 2007) and may offer an important contribution for embryo development, until embryos are able to transcribe BmPPase by themselves (Lasky et al., 1980; DeLeon et al., 1983; Isomura et al., 1989). In addition, the BmPPase activity profile during R. microplus embryogenesis is in agreement with anabolic metabolism, mainly in the first phase of embryo development. In this sense, a more comprehensive understanding of pyrophosphate metabolism in this tick may offer support to reveal additional targets that could be effective in control strategies against this ectoparasite. Acknowledgments We are grateful to Cristóvão Barros Pinheiro and Isabela Dantes Sampaio for their excellent technical assistance. We thank Dr. Gustavo Lazzaro Rezende by the critical

246

E.P. Costa et al. / Veterinary Parasitology 184 (2012) 238–247

review of this paper. This work was supported by grants from Fundac¸ão de Amparo à Pesquisa do Estado do Rio de Janeiro – FAPERJ, Conselho Nacional de Desenvolvimento Científico e Tecnológico – CNPq, Programa de Núcleos de Excelência – PRONEX, Programa Nacional de Cooperac¸ão Acadêmica – PROCAD-CAPES and INCT - Entomologia Molecular. References Abreu, L.A., Valle, D., Manso, P., Fac¸anha, A., Palejo-Machado, M., Masuda, H., Masuda, A., Vaz Jr., I., Lenzi, H., Oliveira, P.L., Logullo, C., 2004. Proteolytic activity of Boophilus microplus Yolk pro-Cathepsin D (BYC) is coincident with cortical acidification during embryogenesis. Insect Biochem. Mol. Biol. 34, 443–449. Avaeva, S.M., Vorobyeva, N.N., Kurilova, S.A., Nazarova, T.I., Polyakov, K.M., Rodina, E.V., Samygina, V.R., 2000. Mechanism of Ca2+ -induced inhibition of Escherichia coli inorganic pyrophosphatase. Biochemistry (Moscow) 65, 373–387. Baykov, A.A., Shestakov, A.S., Kasho, V.N., Vener, A.V., Ivanov, A.H., 1990. Kinetics and thermodynamics of catalysis by the inorganic pyrophosphatase of Escherichia coli in both directions. Eur. J. Biochem. 194, 879–887. Belogurov, G.A., Fabrichniy, I.P., Pohjanjoki, P., Kasho, V.N., Lehtihuhta, E., Turkina, M.V., Cooperman, B.S., Goldman, A., Baykov, A.A., Lahti, R., 2000. Catalytically important ionizations along the reaction pathway of yeast pyrophosphatase. Biochemistry 39, 13931–13938. Bendtsen, J.D., Nielsen, H., von Heijne, G., Brunak, S., 2004. Improved prediction of signal peptides: SignalP 3.0. J. Mol. Biol. 4, 783–795. Bradford, M.M., 1976. A rapid and sensitive method for the quantitation of microgram quantities of protein utilizing the principle of protein-dye binding. Anal. Biochem. 72, 248–254. Brunne, R.M., Liepinsh, E., Otting, G., Wüthrich, K., van Gunsteren, W.F., 1993. Hydration of proteins. A comparison of experimental residence times of water molecules solvating the bovine pancreatic trypsin inhibitor with theoretical model calculations. J. Mol. Biol. 231, 1040–1048. Campos, E., Moraes, J., Facanha, A.R., Moreira, E., Valle, D., Abreu, L., Manso, P.P., Nascimento, A., Pelajo-Machado, M., Lenzi, H., Masuda, A., da Silva Vaz Jr., I., Logullo, C., 2006. Kinetics of energy source utilization in Boophilus microplus (Canestrini, 1887) (Acari: Ixodidae) embryonic development. Vet. Parasitol. 138, 349–357. Chen, J., Brevet, A., Fromant, M., Leveque, F., Schmitter, J.M., Blanquet, S., Plateau, P., 1990. Pyrophosphatase is essential for growth of Escherichia coli. J. Bacteriol. 172, 5686–5689. Da Silva Vaz Jr., I., Ozaki, S.L., Masuda, A., 1994. Serum of Boophilus microplus infested cattle reacts with different tick tissues. Vet. Parasitol. 52, 71–78. De Castro, E., Sigrist, C.J.A., Gattiker, A., Bulliard, V., Langendijk-Genevaux, P.S., Gasteiger, E., Bairoch, A., Hulo, N., 2006. ScanProsite: detection of PROSITE signature matches and ProRule-associated functional and structural residues in proteins. Nucleic Acids Res. 34, W362–W365. DeLeon, D.V., Cox, K.H., Angerer, L.M., Angerer, R.C., 1983. Most earlyvariant histone mRNA is contained in the pronucleus of sea urchin eggs. Dev. Biol. 100, 197–206. Eisenberg, D., Luthy, R., Bowie, J.U., 1997. VERIFY3D: assessment of protein models with three-dimensional profiles. Methods Enzymol. 277, 396–404. Essman, U., Perela, L., Berkowitz, M.L., Darden, T., Lee, H., Pedersen, L.G., 1995. A smooth particle mesh Ewald method. J. Chem. Phys. 103, 8577–8592. Esteves, E., Lara, F.A., Lorenzini, D.M., Costa, G.H., Fukuzawa, A.H., Pressinotti, L.N., Silva, J.R., Ferro, J.A., Kurtti, T.J., Munderloh, U.G., Daffre, S., 2008. Cellular and molecular characterization of an embryonic cell line (BME26) from the tick Rhipicephalus (Boophilus) microplus. Insect Biochem. Mol. Biol. 5, 568–580. Fagotto, F., 1990. Yolk degradation in tick eggs. I. Occurrence of a cathepsin L-like acid proteinase in yolk spheres. Arch. Insect Biochem. Physiol. 14, 217–235. Fialho, E., Silveira, A.B., Masuda, H., Silva-Neto, M.A.C., 2002. Oocyte fertilization triggers acid phosphatase activity during Rhodnius prolixus embryogenesis. Insect Biochem. Mol. Biol. 32, 871–880. Fiser, A., Do, R.K., Sali, A., 2000. Modeling of loops in protein structures. Protein Sci. 9, 1753–1773. Fiske, C.F., Subbarow, Y., 1925. The colorimetric determination of phosphorus. J. Biol. Chem. 66, 375–400.

Freitas, D.R., Rosa, R.M., Moraes, J., Campos, E., Logullo, C., da Silva Vaz Jr., I., Masuda, A., 2007. Relationship between glutathione S-transferase, catalase, oxygen consumption, lipid peroxidation and oxidative stress in eggs and larvae of Boophilus microplus (Acarina: Ixodidae). Comp. Biochem. Physiol. A Mol. Integr. Physiol. 146, 688–694. Gdula, D.A., Sandaltzopoulos, R., Tsukiyama, T., Ossipow, V., Wu, C., 1998. Inorganic pyrophosphatase is a component of the Drosophila nucleosome remodeling factor complex. Genes Dev. 12, 3206–3216. Guranowski, A., 2000. Specific and non-specific enzymes involved in the catabolism of mononucleosides and dinucleoside polyphosphates. Pharmacol. Ther. 87, 117–139. Gómez-García, M.R., Ruiz-Pérez, L.M., González-Pacanowska, D., Serrano, A., 2004. A novel calcium-dependent soluble inorganic pyrophosphatase from the trypanosomatid Leishmania major. FEBS Lett. 560, 158–166. Gómez-Puyou, A., Saavedra-Lira, E., Becker, I., Zubillaga, R.A., RojoDomínguez, A., Pérez-Montfort, R., 1995. Using evolutionary changes to achieve species-specific inhibition of enzyme action – studies with triosephosphate isomerase. Chem. Biol. 2, 847–855. Guerrero, F.D., Nene, V.M., George, J.E., Barker, S.C., Willadsen, P., 2006. Sequencing a new target genome: the Boophilus microplus (Acari: Ixodidae) genome project. J. Med. Entomol. 43, 9–16. Hall, T.A., 1999. BioEdit: a user-friendly biological sequence alignment editor and analysis program for Windows 95/98/NT. Nucleic Acids Symp. Ser. 41, 95–98. Herbomel, P., Ninio, J., 1980. Fidelity of a polymerization reaction according to the proximity of equilibrium. C. R. Seances Acad. Sci. D 291, 881–884. Hess, B., Bekker, J., Berendsen, H.J.C., Fraaije, J.G.E.M., 1997. LINCS: a linear constraint solver for molecular simulations. J. Comput. Chem. 18, 1463–1472. Hess, B., Kutzner, C., van der Spoel, D., Lindahl, E., 2008. GROMACS 4: algorithms for highly efficient, load balanced, and scalable molecular simulations. J. Chem. Theory Comput. 4, 435–447. Hoe, H.-S., Kim, H.-K., Kwon, S.-T., 2001. Expression in Escherichia coli of the thermostable inorganic pyrophosphatase from the Aquifex aeolicus and purification and characterization of the recombinant enzyme. Protein Expr. Purif. 23, 242–248. Isomura, H., Itoh, N., Ikegami, S., 1989. RNA synthesis in starfish embryos: developmental consequences of its inhibition by formycin. Biochim. Biophys. Acta 1007, 343–349. Jeon, S.J., Ishikawa, K., 2005. Characterization of the Family I inorganic pyrophosphatase from Pyrococcus horikoshii OT3. Archaea 1, 385–389. Ko, K.M., Lee, W., Yu, J.-R., Ahnn, J., 2007. PYP-1, inorganic pyrophosphatase, is required for larval development and intestinal function in C. elegans. FEBS Lett. 581, 5445–5453. Kornberg, A., 1962. On the metabolic significance of phosphorolytic and pyrophosphorolytic reactions. In: Kasha, M., Pullman, B. (Eds.), Horizons in Biochemistry. Academic Press, New York, pp. 251–264. Kuranova, I.P., Polyakov, K.M., Smirnova, E.A., Höhne, W.E., Lamzin, V.S., Meijer, R., 2003. Three-dimensional structure of Saccharomyces cerevisiae inorganic pyrophosphatase complexed with cobalt and phosphate ions. Crystallogr. Rep. 48, 953–958. Larkin, M.A., Blackshields, G., Brown, N.P., Chenna, R., McGettigan, P.A., McWilliam, H., Valentin, F., Wallace, I.M., Wilm, A., Lopez, R., Thompson, J.D., Gibson, T.J., Higgins, D.G., 2007. ClustalW and ClustalX version 2.0. Bioinformatics 23, 2947–2948. Lasky, L.A., Lev, Z., Xin, J.H., Britten, R.J., Davidson, E.H., 1980. Messenger RNA prevalence in sea urchin embryos measured with cloned cDNAs. Proc. Natl. Acad. Sci. USA 77, 5317–5321. Laskowski, R.A., MacArthur, M.W., Moss, D.S., Thornton, J.M., 1993. PROCHECK: a program to check the stereochemical quality of protein structures. J. Appl. Cryst. 26, 283–291. Lee, M.-J., Huang, H., Lin, W., Yang, R.-R., Liu, C.-L., Huang, C.-Y., 2007. Activation of Helicobacter pylori inorganic pyrophosphatase and the importance of Cys16 in thermostability, enzyme activation and quaternary structure. Arch. Microbiol. 188, 473–482. Logullo, C., Moraes, J., Dansa-Petretski, M., Vaz, I.S., Masuda, A., Sorgine, M.H.F., Braz, G.R., Masuda, H., Oliveira, P.L., 2002. Binding and storage of heme by vitellin from the cattle tick, Boophilus microplus. Insect Biochem. Mol. Biol. 32, 1805–1811. Lublin, A.L., Evans, T.C., 2007. The RNA binding proteins PUF-5, PUF-6, and PUF-7 reveal multiple systems for maternal mRNA regulation during C. elegans previous oogenesis. Dev. Biol. 303, 635–649. Lundin, M., Baltscheffsky, H., Ronne, H., 1991. Yeast PPA2 gene encodes a mitochondrial inorganic pyrophosphatase that is essential for mitochondrial function. J. Biol. Chem. 266, 12168–12172. Luthy, R., Bowie, J.U., Eisenberg, D., 1992. Assessment of protein models with three-dimensional profiles. Nature 356, 83–85.

E.P. Costa et al. / Veterinary Parasitology 184 (2012) 238–247 Marti-Renom, M.A., Stuart, A.C., Fiser, A., Sánchez, R., Melo, F., Sali, A., 2000. Comparative protein structure modeling of genes and genomes. Annu. Rev. Biophys. Biomol. Struct. 29, 291–325. Merckel, M.C., Fabrichniy, I.P., Salminen, A., Kalkkinen, N., Baykov, A.A., Lahti, R., Goldman, A., 2001. Crystal structure of Streptococcus mutans pyrophosphatase: a new fold for an old mechanism. Structure 9, 289–297. Mimura, H., Nakanishi, Y., Maeshima, M., 2005. Disulfide-bond formation in the H+ -pyrophosphatase of Streptomyces coelicolor and its implications for redox control and enzyme structure. FEBS Lett. 579, 3625–3631. Mitchell, S.J., Minnick, M.F., 1997. Cloning, functional expression, and complementation analysis of an inorganic pyrophosphatase from Bartonella bacilliformis. Can. J. Microbiol. 43, 734–743. Moraes, J., Arreola, R., Cabrera, N., Saramago, L., Freitas, D., Masuda, A., da Silva Vaz Jr., I., Tuena de Gómez-Puyou, M., Pérez-Montfort, R., Gómez-Puyou, A., Logullo, C., 2011. Structural and biochemical characterization of a recombinant triosephosphate isomerase from Rhipicephalus (Boophilus) microplus. Insect Biochem. Mol. Biol. 41, 400–409. Motta, L.S., da Silva, W.S., Oliveira, D.M.P., de Souza, W., Machado, E.A., 2004. A new model for proton pumping in animal cells: the role of pyrophosphate. Insect Biochem. Mol. Biol. 34, 19–27. Nagaoka, T., Hachimori, A., Takeda, A., Samejima, T., 1977. DTNB modification of SH groups of isocitrate dehydrogenase from Bacillus stearothermophilus purified by affinity chromatography. J. Biochem. 81, 71–78. Nordin, J.H., Beaudoin, E.L., Lin, X., 1991. Acidification of yolk granules in Blatella germanica eggs coincides with proteolytic processing of vitellin. Arch. Insect Biochem. Physiol. 18, 177–192. Parfenyev, A.N., Salminen, A., Halonen, P., Hachimori, A., Baykov, A.A., Lahti, R., 2001. Quaternary structure and metal ion requirement of family II pyrophosphatases from Bacillus subtilis, Streptococcus gordonii, and Streptococcus mutans. J. Biol. Chem. 276, 24511–24518. Parizi, L.F., Pohl, P.C., Masuda, A., Da Silva Vaz, I., 2009. New approaches toward anti-Rhipicephalus (Boophilus) microplus tick vaccine. Rev. Bras. Parasitol. Vet. 18, 1–7. Pérez-Montfort, R., Garza-Ramos, G., Alcántara, G.H., Reyes-Vivas, H., Gao, X.G., Maldonado, E., de Gómez-Puyou, M.T., Gómez-Puyou, A., 1999. Derivatization of the interface cysteine of triosephosphate isomerase from Trypanosoma brucei and Trypanosoma cruzi as probe of the interrelationship between the catalytic sites and the dimer interface. Biochemistry 38, 4114–4120. Pfaffl, M.W., 2001. A new mathematical model for relative quantification in real-time RT-PCR. Nucleic Acids Res. 29, 2002–2007. Pfaffl, M.W., Horgan, G.W., Dempfle, L., 2002. Relative expression software tool (REST) for group-wise comparison and statistical analysis of relative expression results in real-time PCR. Nucleic Acids Res. 30, e36.

247

Pohl, P.C., Sorgine, M.H.F., Leal, A.T., Logullo, C., Oliveira, P.L., da Silva Vaz Jr., I., Masuda, A., 2008. An extraovarian aspartic protease accumulated in tick oocytes with vitellin-degradation activity. Comp. Biochem. Physiol. B Biochem. Mol. Biol. 151, 392–399. Rosenthal, E.T., Wilt, F.H., 1986. Patterns of maternal messenger RNA accumulation and adenylation during previous oogenesis in Urechis caupo. Dev. Biol. 117, 55–63. Sali, A., Blundell, T.L., 1993. Comparative protein modelling by satisfaction of spatial restraints. J. Mol. Biol. 234, 779–815. Samygina, V.R., Popov, A.N., Rodina, E.V., Vorobyeva, N.N., Lamzin, V.S., Polyakov, K.M., Kurilova, S.A., Nazarova, T.I., Avaeva, S.M., 2001. The structures of Escherichia coli inorganic pyrophosphatase complexed with Ca2+ or CaPPi at atomic resolution and their mechanistic implications. J. Mol. Biol. 314, 633–645. Sappington, T.W., Raikhel, A.S., 1998. Molecular characteristics of insect vitellogenins and vitellogenin receptors. Insect Biochem. Mol. Biol. 28, 277–300. Shintani, T., Uchiumi, T., Yonezawa, T., Salminen, A., Baykov, A.A., Lahti, R., Hachimori, A., 1998. Cloning and expression of a unique inorganic pyrophosphatase from Bacillus subtilis: evidence for a new family of enzymes. FEBS Lett. 439, 263–266. Sivula, T., Salminen, A., Parfenyev, A.N., Pohjanjoki, P., Goldman, A., Cooperman, B.S., Baykov, A.A., Lahti, R., 1999. Evolutionary aspects of inorganic pyrophosphatase. FEBS Lett. 454, 75–80. Sonenshine, D.E., Kocan, K.M., de la, F.J., 2006. Tick control: further thoughts on a research agenda. Trends Parasitol. 22, 550–551. Tamura, K., Dudley, J., Nei, M., Kumar, S., 2007. MEGA4: Molecular Evolutionary Genetics Analysis (MEGA) software version 4.0. Mol. Biol. Evol. 24, 1596–1599. Vainonen, Y.P., Kurilova, S.A., Avaeva, S.M., 2002. Hexameric, trimeric, dimeric, and monomeric forms of inorganic pyrophosphatase from Escherichia coli. Bioorg. Khim. 28, 426–433. van Alebeek, G.J., Keltjens, J.T., van der Drift, C., 1994. Purification and characterization of inorganic pyrophosphatase from Methanobacterium thermoautotrophicum (strain delta H). Biochim. Biophys. Acta 1206, 231–239. Westfall, D., Aboushadi, N., Shacklford, J.E., Krisans, S.K., 1997. Metabolism of farnesol by rat liver microsomal and peroxisomal fractions. Biochem. Biophys. Res. Commun. 230, 562–568. Young, T.W., Kuhn, N.J., Wadeson, A., Ward, S., Burges, D., Cooke, G.D., 1998. Bacillus subtilis ORF yybQ encodes a manganese-dependent inorganic pyrophosphatase with distinctive properties: the first of a new class of soluble pyrophosphatase? Microbiology 144, 2563–2571. Zdobnov, E.M., Apweiler, R., 2001. InterProScan: an integration platform for the signature-recognition methods in InterPro. Bioinformatics 17, 847–848.