Partial complementation between the immediate early proteins ICP4 of herpes simplex virus type 1 and IE180 of pseudorabies virus

Journal Pre-proof Partial complementation between the immediate early proteins ICP4 of herpes simplex virus type 1 and IE180 of pseudorabies virus L. Lerma (Conceptualization) ˜ (Methodology)Analysis), A.L. Munoz (Conceptualization) (Methodology), R. Garc´ıa Utrilla (Methodology), B. Sainz Jr. (Conceptualization) (Methodology)Analysis) (Resources), F. Lim ´ (Conceptualization) (Conceptualization) (Resources), E. Tabares ´ ´ (Resources) (Funding acquisition), S. Gomez-Sebastian (Conceptualization) (Methodology)Analysis) (Project administration) (Supervision)

PII:

S0168-1702(19)30394-6

DOI:

https://doi.org/10.1016/j.virusres.2020.197896

Reference:

VIRUS 197896

To appear in:

Virus Research

Received Date:

13 June 2019

Revised Date:

6 February 2020

Accepted Date:

7 February 2020

˜ AL, Garc´ıa Utrilla R, Sainz B, Lim F, Tabares ´ E, Please cite this article as: Lerma L, Munoz ´ ´ S, Partial complementation between the immediate early proteins ICP4 of Gomez-Sebasti an herpes simplex virus type 1 and IE180 of pseudorabies virus, Virus Research (2020), doi: https://doi.org/10.1016/j.virusres.2020.197896

This is a PDF file of an article that has undergone enhancements after acceptance, such as the addition of a cover page and metadata, and formatting for readability, but it is not yet the definitive version of record. This version will undergo additional copyediting, typesetting and review before it is published in its final form, but we are providing this version to give early visibility of the article. Please note that, during the production process, errors may be discovered which could affect the content, and all legal disclaimers that apply to the journal pertain. © 2020 Published by Elsevier.

1 Title: Partial complementation between the immediate early proteins ICP4 of herpes simplex virus type 1 and IE180 of pseudorabies virus. L. Lerma 1, A. L. Muñoz1, R. García Utrilla1, B. Sainz, Jr.2, F. Lim3, E. Tabarés1 and S. Gómez-Sebastián1*

1

Departamento de Medicina Preventiva, Salud Pública y Microbiología, Facultad

de Medicina, Universidad Autónoma de Madrid, Arzobispo Morcillo 4, 28029

2

ro of

Madrid, Spain. Departamento de Bioquímica, Facultad de Medicina, Instituto de Investigaciones

Biomédicas "Alberto Sols" CSIC-UAM, Universidad Autónoma de Madrid,

3

-p

Arzobispo Morcillo 4, 28029 Madrid, Spain.

Departamento de Biología Molecular, Facultad de Ciencias, Universidad Autónoma

lP

re

de Madrid, Cantoblanco, 28049 Madrid, Spain.

*Corresponding author. Mailing address: Departamento de Medicina Preventiva, Salud Pública y Microbiología, Facultad de Medicina, Universidad de

Madrid,

Arzobispo

na

Autónoma

Morcillo

4,

28029

Madrid,

Spain.

Jo

ur

[email protected].

1

2

Highlights

HSV-1 ICP4-mutants can produce early (DNA polimerase) and late viral proteins (VP16 and gC) in presence of the IE180 protein of PRV though at very low yields



The HSV-1 ICP4-mutant carrying the TAD of the ICP4 protein produced higher yields of those selected early and late viral proteins in presence of the IE180 protein of PRV



The IE180 protein partially complements the TAD domain but no viral progeny can be obtained.

ro of



Summary

We previously described that the immediate early (IE) IE180 protein of PRV

-p

can down-regulate the transactivation of the ICP4 promoter of HSV-1, and that the d120 virus (an ICP4-deficient HSV-1 strain) can partially replicate its viral DNA in the

re

presence of the IE180 protein. Herein, we demonstrate that this partial complementation

lP

of d120 by IE180 is sufficient for transcription of β, γ1 and γ2 products such as DNA pol, VP16 and gC, respectively. However, expression levels are low for VP16 and even lower for the gC, such that IE180 is unable to fully substitute for ICP4 functionally.

na

Viral progeny was not detected in PK15 cells expressing PRV IE180.

ur

Keywords: functional complementation, immediately early protein, herpes

Jo

simplex virus type 1, pseudorabies virus.

2

3

Herpes simplex virus 1 (HSV-1) and pseudorabies virus (PRV) are distantly related members of the subfamily Alphaherpesvirinae. PRV belongs to the Varicellovirus genus and HSV-1 to the Simplexvirus genus (Fields et al., 2007). The natural hosts for HSV-1 and PRV are humans and pigs, respectively; however, the genomes of PRV and HSV-1 are largely collinear, with the exception of an inversion

ro of

within the UL region. The predicted transcript arrangement is also highly homologous (Klupp et al., 2004), suggesting functional similarities between the two viruses. In both viruses, the viral genes are expressed in three temporally ordered tiers, designated

immediately-early (IE) or α genes, early (E) or β genes and late (L) or γ genes (Fields

-p

et al., 2007; Klupp et al., 2004). HSV-1 has six IE genes, α0, α4, α22, α27, α47 and

re

US1.5, which encode for infected-cell proteins (ICPs) ICP0, ICP4, ICP22, ICP27, ICP47 and US1.5, respectively (Fields et al., 2007); while PRV has only one IE gene

lP

which encodes for the IE180 protein (Ihara et al., 1983). Viral IE mRNAs are synthesized within the first few minutes of infection, even in the total absence of new

na

protein synthesis. They are usually overexpressed when the infection is carried out in the presence of protein synthesis inhibitors such as cycloheximide (CHX) or

ur

anysomycin (Preston and McFarlane, 1998). This suggests that only host factors are required for IE expression, which can be activated by the virion VP16 protein or

Jo

regulated for their own genes, like ICP4 that autoregulates its own gene expression (Fields et al., 2007; Spector et al., 1991). In addition, IE proteins, especially ICP4, play an important role in the regulation of the expression of other viral genes. Early gene expression is dependent on IE proteins, and E proteins are necessary for viral DNA replication. The late genes are the last set of genes that are expressed and mainly encode for components of the virion. These genes have been further divided into either leaky3

4 late (γ1) or true-late (γ2), depending on the requirement of DNA synthesis for their expression. The γ1 genes can be sub-optimally expressed in absence of viral DNA synthesis, whereas the γ2, or true late genes, have a strict requirement for viral DNA synthesis. True late promoters are clearly distinct from IE and E promoters. IE180 has a high level of similarity to the IE proteins of other alphaherpesviruses such as ICP4 of HSV-1, IE140 of varicella-zoster virus (VZV), IE1 of equine herpesvirus 1, and p180 of bovine herpesvirus 1 (Vlcek et al., 1989). ICP4

ro of

and IE180 are the major regulatory proteins for the replicative cycle of HSV-1 and PRV, respectively, affecting viral gene expression either positively or negatively,

including their own regulation (Leopardi et al., 1995). Moreover, they are

-p

multifunctional proteins that share similar functional domains. They have been divided into five collinear regions based on their predicted amino acid sequences, with a high

re

level of similarity in regions 2 and 4 and little, if any, in regions 1, 3 and 5 (Cheung,

lP

1989; Wu and Wilcox, 1991). The auto-regulation domain, the nuclear localization signal (NLS) and the transactivation domain (TAD) are located in regions 2 and 4. We previously described that the IE180 protein of PRV can down-regulate the

na

transactivation of the promoter that encodes the ICP4 protein of HSV-1 (GomezSebastian and Tabares, 2004).

ur

Several studies have shown complementation among immediately early proteins

Jo

of related alphaherpesviruses, such as restoration of plaquing efficiency in low multiplicity infections with an ICP0-mutant HSV-1 strain, by coinfection of this virus with VZV or the human cytomegalovirus (HCMV) (Stow and Stow, 1989). Also VZV can complement ICP4 and ICP27 temperature-sensitive mutants of HSV-1 (Felser et al., 1987). In these cases, the complementation never resulted in a phenotype identical to that of the wild type viruses. This could indicate that, despite having a common

4

5 origin, these proteins have diverged to best adapt to their natural host. Previously, we have shown in transient expression assays, that the IE180 protein of PRV can partially complement the ICP4 deficient HSV-1 virus (strain d120), since we could detect HSV1 DNA replication without viral progeny; however, no complementation was detected in the case of the G2 strain virus (Gomez-Sebastian and Tabares, 2004). In the present work, we treat to show the levels of complementation between PRV IE180 and HSV-1 ICP4 through the viral cycle expression, by using d120 and G2

ro of

HSV-1 ICP4 viral mutants. The d120 mutant expresses the first 150 amino acids of the ICP4 protein, including the TAD domain (DeLuca et al., 1985; DeLuca and Schaffer,

1988) and produces appreciable levels only of immediate-early proteins and ICP6

-p

(DeLuca et al., 1985). The G2 mutant has deleted both entire copies of ICP4. (McCarthy et al., 1989). Our results show that the IE180 protein can complement partially ICP4-

re

deficient viruses. However, the lack of viral progeny when the deficient virus were

lP

propagated in the presence of the IE180 protein indicates severe impairments in the L phase of the viral replication cycle, since we could barely detect transcription of the

na

true-late gene (gC).

We previously showed that the IE180 protein of PRV is a trans repressor of

ur

ICP4 gene transcription (Gomez-Sebastian and Tabares, 2004), possibly via binding to a specific site in its promoter (Wu and Wilcox, 1991). In addition, we saw that cells

Jo

expressing the IE180 protein of PRV can support only a small amount of viral DNA replication of the d120 mutant strain, which express the first 150 amino acids of the ICP4 protein including the TAD, but not in the case of the G2 mutant strain (GomezSebastian and Tabares, 2004) which is completely defective for the ICP4 protein (Fig 1 (a)). In order to clarify the extent of viral replication of HSV-1 virus mutants, we first studied the transcription of representative genes of the IE, E and L viral transcription 5

6 phases in cells that transiently express IE180 (293T transfected cells) by RT-PCR a semiquantitative approach. 293T cells were used based on their high efficiency for DNA transfection. To study the IE phase, we analysed the expression of the gene that encodes the ICP27 protein as this protein performs essential replicative functions and is involved specifically in modulating HSV-1 gene expression (DeLuca et al., 1985; McCarthy et al., 1989; Sacks et al., 1985). ICP27 gene transcription levels in 293T cells transiently expressing IE180 and infected with either d120 or G2 strains of HSV-1 (Fig.

ro of

1 (b)) were similar to those obtained in E5 cells (which express ICP4) infected with the same strains (Fig. 1 (b)). Interestingly the IE phase during the infection with the ICP4mutant strains was normal even in non-complementing cells (Fig. 1(b)).

-p

The DNA polymerase gene (DNApol) was selected for studying the E phase as this is a critical gene for viral DNA replication. In this case, the transcription levels of

re

the pol gene (UL30) were lower than the levels detected in E5 cells infected with the

lP

same mutant strains (Fig. 1 (b)), indicating incomplete complementation. The L phase of the viral replicative cycle depends on the correct execution of the early phase: transcription of true-late genes depends on successful viral DNA replication. Thus, the

na

low efficiency of d120 viral DNA replication when complemented by IE180 (GomezSebastian and Tabares, 2004) would implied too little transcription of L genes to

ur

produce viral progeny. To explore this idea, we checked the transcription of the late

Jo

gene (γ1) encoding the VP16 protein and the true-late gene (γ2) encoding the gC protein. Surprisingly, we detected considerable VP16 transcription levels in IE180expressing 293T cells infected with all three viruses; however, when compared to wtinfected cells, VP16 levels in 293T cells infected with G2 or d120 were reduced (Fig. 1 (b)). Regarding the true-late gene gC, transcription was only detected in wt virusinfected infection (Fig. 1 (b)).

6

7 We next analysed the transcription of these genes by RTqPCR in PK15 cells that express IE180 (PK15-IE180 cells) when induced with doxycycline (DOX) (Oyibo et al., 2014). The analysis of ICP27 IE gene transcription showed that the levels were significantly higher in G2 or d120- infected PK15-IE180 cells compared to PK15 cells (p< 0.05) (Fig.2 (a)). Thus, the presence of the IE180 protein can increase ICP27 mRNA transcription. This result could be due in part to higher levels of VP16, a transactivator of the IE promoters, in those cells (Marsden et al., 1987; Spector et al., 1991). Indeed,

ro of

the highest VP16 transcription levels were detected in d120-infected cells expressing the IE180 protein (Fig.2 (c)), similar results were also observed for this protein by

western blot (data not shown). However, the amount of ICP27 mRNA in d120-IE180

-p

infected cells was still lower than that obtained in wt virus-infected cells, coincident

also with the lesser amount of VP16 mRNA in d120 mutant -infected cells (Fig.2 (a)

re

and (c)).

lP

When checking DNApol transcription we observed higher differences than for the ICP27 gene. Again, the presence of the IE180 protein seemed to increase the DNApol yield with significant differences for G2 and d120-PK15 IE180 infected cells

na

comparing with the PK15-infected cells (p<0.05). Also in presence of DOX the expression is further induced (p<0.05), but in all the cases the expression yield is far

ur

from those obtained for the wt-infected cells (Fig.2 (b)). In our previous work (Gomez-

Jo

Sebastian and Tabares, 2004) we could observed severe DNA synthesis impairment which was even more severe in those IE180 expressing cells infected with the G2 strain. The lower DNApol expression detected here could in part explain our previous results. We also checked the transcription of the (γ1) late gene encoding the VP16 protein and the true-late gene gC. Whereas we could detect a clear increase in VP16 transcription levels in IE180-expressing PK15 cells infected with both mutants (p<

7

8 0.05) (Fig. 2 (c)), the same could not be said for the gC gene, although the yields were always higher in d120-infected cells (p< 0.05) (Fig.2 (c) and (d)). DOX treatment also allowed for a higher increase in both cases (p< 0.05); however, levels for both genes were again much lower compared to those obtained in wt virus-infected cells, even in presence of DOX (p< 0.05) (Fig. 2 (c) and (d)). In general, higher yields the mRNAs analysed were obtained in cells infected at a low MOI (0,1 TCID50/cell) with d120 virus compared to those infected with the G2

ro of

virus, but the trends were similar for both viruses. Low MOI experiments were also performed in order to detect any cytopathic effect due to viral replication and to easily follow viral spread. Nevertheless, it is important to note that conclusions drawn from

-p

the low MOI infection experiments maybe be a result of having fewer cells infected rather than lower levels of expression. Therefore, we also ran infections at a high MOI

re

(5 TCID50/cell), and similar results were obtained in terms of a severe impairment in

lP

the expression of the genes studied, even more when analysing early and late genes (Fig. 1, supplementary data).

Consistently, no viral progeny was obtained from DOX-treated PK15-IE180

na

cells infected with the R120vGF recombinant virus. The R120vGF recombinant virus is a d120-ICP4 mutant that also express the EGFP protein under the IE promoter. The

ur

infection efficiency and subsequent spread (foci formation) of this virus can be

Jo

monitored by EGFP expression, as the fluorescent reporter is expressed under the regulation of the IE promoter. Using this virus, no foci were detected in monolayers at 48 hpi when using a fluorescence microscope (Fig.3 (a)). Furthermore, when the supernatant from infected cells was transferred to naïve Vero cell monolayers, no EGFP expressing cells were observed following inoculation with the supernatant derived from R120vGF-infected PK15 or PK15-IE180 cells (Fig.3 (b)). As a positive control, the

8

9 FTKGF recombinant HSV-1 was used. This virus encodes an intact ICP4 protein and an amino terminal deletion of the TK gene, which includes all of the first 316 codons, followed by the EGFP coding sequence. Those cells infected with the FTKGF recombinant virus exhibited not only GFP expression but also foci at 48 hpi. Furthermore, Vero monolayers could also be infected with the supernatant derived from FTKGF-infected PK15 or PK15-IE180 cells (Fig.3 (b)). The no EGFP expression was confirmed by flow cytometry analysis (Fig. 2 (a), supplementary data). Similar results

ro of

were obtained when using high MOI (5 TCID50/cell) (Fig. 3, supplementary data). Moreover, no viral DNA has been detected at high MOI (Figure 3 (d),

supplementary data) from those supernatants from DOX-treated PK15-IE180 cells

-p

infected with the R120vGF recombinant virus.

We conclude that PRV IE180 can only partially complement ICP4-mutant

re

HSV-1 strains in spite of the homology between IE180 and ICP4 proteins. Interestingly,

lP

this complementation is higher when the N terminal (containing the TAD domain) of the ICP4 protein is present (d120 mutant). In addition, we have seen that the IE180 protein also increased the transcription of the viral genes examined in HSV-1 wt since

na

we observed higher yields of the different assayed genes when IE180 is present (Fig. 2 and Fig. 1 supplementary data)

ur

The ICP4 activation domain, contained within the N-terminal 210 amino acids,

Jo

can function on its own which activity can be further increased by the 520 aa of the C terminal (Wagner et al., 2013). The C terminal domain of ICP4 (520 aa) interact with cellular factors to stabilize them for multimerization with DNA molecules necessary for a proper viral gene transcription (Kuddus and DeLuca, 2007). Maybe the mechanism for the partial complementation in the case of the d120 mutant described in this study could be explain to the formation of heterodimers between functional

9

10 domains or could be due to the inability of the IE180 C terminal to stabilize the cellular factors with the N terminal of the d120-ICP4 protein, perhaps due to a specific adaptation to their natural host. However, the specific mechanism implicated need to be addressed in future experiments.

Conflicts of interest

ro of

Authors declare no potential conflicts of interest.

Funding information

This work was supported by a grant PI070017 from Fondo Investigación

-p

Sanitaria (FIS) (Spain).

re

Author statement:

ur

na

lP

Laura Lerma: conceptualization, methodology, analysis, writting and edditing the original and revised versions. Ana Luisa Muñoz: conceptualization and methodology. R. García Utrilla: methodology. Filip Lim: conceptualization, resources and reviewing the original and revised manuscript. Bruno Sainz: conceptualization, methodology, analysis, resources and reviewing the original and revised manuscripts. Enrique Tabares: conceptualization, resources, reviewing the original and revised manuscript and funding acquisition. Silvia Gomez-Sebastian: conceptualization, methodology, analysis, writting, edditing and project administration and supervision.

Jo

References:

Cheung, A.K., 1989. DNA nucleotide sequence analysis of the immediate-early gene of pseudorabies virus. Nucleic Acids Res 17, 4637-4646. Chomczynski, P., Sacchi, N., 1987. Single-step method of RNA isolation by acid guanidinium thiocyanate-phenol-chloroform extraction. Analytical biochemistry 162, 156-159.

10

11 DeLuca, N.A., McCarthy, A.M., Schaffer, P.A., 1985. Isolation and characterization of deletion mutants of herpes simplex virus type 1 in the gene encoding immediate-early regulatory protein ICP4. J Virol 56, 558-570. DeLuca, N.A., Schaffer, P.A., 1988. Physical and functional domains of the herpes simplex virus transcriptional regulatory protein ICP4. J Virol 62, 732-743. Felser, J.M., Straus, S.E., Ostrove, J.M., 1987. Varicella-zoster virus complements herpes simplex virus type 1 temperature-sensitive mutants. J Virol 61, 225-228. Fields, B.N., Knipe, D.M., Howley, P.M., 2007. Fields virology. Wolters Kluwer Health/Lippincott Williams & Wilkins, Philadelphia.

ro of

Gomez-Sebastian, S., Tabares, E., 2004. Negative regulation of herpes simplex virus type 1 ICP4 promoter by IE180 protein of pseudorabies virus. J Gen Virol 85, 21252130. Ihara, S., Feldman, L., Watanabe, S., Ben-Porat, T., 1983. Characterization of the immediate-early functions of pseudorabies virus. Virology 131, 437-454.

-p

Klupp, B.G., Hengartner, C.J., Mettenleiter, T.C., Enquist, L.W., 2004. Complete, annotated sequence of the pseudorabies virus genome. J Virol 78, 424-440.

re

Kuddus, R.H., DeLuca, N.A., 2007. DNA-dependent oligomerization of herpes simplex virus type 1 regulatory protein ICP4. J Virol 81, 9230-9237.

lP

Leopardi, R., Michael, N., Roizman, B., 1995. Repression of the herpes simplex virus 1 alpha 4 gene by its gene product (ICP4) within the context of the viral genome is conditioned by the distance and stereoaxial alignment of the ICP4 DNA binding site relative to the TATA box. J Virol 69, 3042-3048.

na

Marsden, H.S., Campbell, M.E., Haarr, L., Frame, M.C., Parris, D.S., Murphy, M., Hope, R.G., Muller, M.T., Preston, C.M., 1987. The 65,000-Mr DNA-binding and virion trans-inducing proteins of herpes simplex virus type 1. J Virol 61, 2428-2437.

ur

McCarthy, A.M., McMahan, L., Schaffer, P.A., 1989. Herpes simplex virus type 1 ICP27 deletion mutants exhibit altered patterns of transcription and are DNA deficient. J Virol 63, 18-27.

Jo

Oyibo, H.K., Znamenskiy, P., Oviedo, H.V., Enquist, L.W., Zador, A.M., 2014. Longterm Cre-mediated retrograde tagging of neurons using a novel recombinant pseudorabies virus. Frontiers in neuroanatomy 8, 86. Preston, C.M., McFarlane, M., 1998. Cytodifferentiating agents affect the replication of herpes simplex virus type 1 in the absence of functional VP16. Virology 249, 418426. Sacks, W.R., Greene, C.C., Aschman, D.P., Schaffer, P.A., 1985. Herpes simplex virus type 1 ICP27 is an essential regulatory protein. J Virol 55, 796-805.

11

12 Spector, D., Purves, F., Roizman, B., 1991. Role of alpha-transinducing factor (VP16) in the induction of alpha genes within the context of viral genomes. J Virol 65, 35043513. Stow, E.C., Stow, N.D., 1989. Complementation of a herpes simplex virus type 1 Vmw110 deletion mutant by human cytomegalovirus. J Gen Virol 70 ( Pt 3), 695-704. Szpara, M.L., Parsons, L., Enquist, L.W., 2010. Sequence variability in clinical and laboratory isolates of herpes simplex virus 1 reveals new mutations. J Virol 84, 53035313.

ro of

Vlcek, C., Paces, V., Schwyzer, M., 1989. Nucleotide sequence of the pseudorabies virus immediate early gene, encoding a strong transactivator protein. Virus Genes 2, 335-346. Wagner, L.M., Bayer, A., Deluca, N.A., 2013. Requirement of the N-terminal activation domain of herpes simplex virus ICP4 for viral gene expression. J Virol 87, 1010-1018.

-p

Wu, C.L., Wilcox, K.W., 1991. The conserved DNA-binding domains encoded by the herpes simplex virus type 1 ICP4, pseudorabies virus IE180, and varicella-zoster virus ORF62 genes recognize similar sites in the corresponding promoters. J Virol 65, 11491159.

Jo

ur

na

lP

re

Xiao, W., Pizer, L.I., Wilcox, K.W., 1997. Identification of a promoter-specific transactivation domain in the herpes simplex virus regulatory protein ICP4. J Virol 71, 1757-1765.

12

13

ro of

Figures and tables

-p

Figure 1. Panel A: Schematic representation of the ICP4 protein of wt and d120 or

re

G2 mutant viruses. The panels show the five protein regions and the specific location of the transactivation domain (TAD) (white box). Adapted from (Cheung, 1989; Xiao

lP

et al., 1997).

Panel B: Complementation study of ICP4-mutant HSV-1 viruses, d120 and G2, by

na

the IE180 protein of PRV, at different stages of their replicative cycle. 293T cells were transfected with 5-10 μg of pE180 plasmid (Gomez-Sebastian and Tabares, 2004)

ur

or the transfection control plasmid pEGFP-N1 plasmid (Clontech) with calcium phosphate. 48 h post-transfection, the efficiency was about 80-90% (pEGFP-N1

Jo

(Clontech) was used as transfection control). 293T cells nontransfected (293T, lanes 1-4) or transfected with pE180 (293T+pE180, lanes 5-8) or E5 cells (Vero cells expressing the ICP4 protein of HSV-1 (DeLuca et al., 1985)) (E5, lanes 9-12) were uninfected (-) or infected (+) at a MOI of 0.1 TCID50/cell with d120, or G2, or wt HSV-1. RNA was isolated using the RNeasy mini kit (Qiagen) and treated with DNAse (DNA-free kit, Applied Biosystems, Ambion). With this 13

14 combination the DNA contamination is below the detection limit of the PCR. RT-PCRs were carried out with 0.5 μg of RNA by using the RT OneStep RT-PCR Kit (Qiagen) to amplify the ICP27, DNA pol, VP16 and gC of HSV-1. These genes were selected as representatives of the IE, E, E-L or L classes respectively. The ICP27 gene was used as internal control for studying the E and L transcription pattern. The bands were analysed by densitometry. 180-D

(5´-CGCTTCAACCAGTTCTGC-3´)

TGAAGGTCTTCTGGGTGC-3´)

for

the

IE180 and

TGACCTCGGCCTGGACCTCTCC-3’)

and gene,

180-R

(5´-

ICP27-S

(5’-

ro of

Primers

ICP27-AS

(5’-

GTACGCCGGGGTCTTCTGGACG-3’) for the HSV-1 ICP27 gene, DNApol-F (5’and

DNApol-R

-p

GGTGAACGTCTTTTCGCACT-3’)

(5’-

GTGTTGTGCCGCGGTCTCAC-3’) for the HSV-1 DNA polymerase gene, VP16-S (5’-CGCGCTATGTACCATGCTCG-3’)

re

and

VP16-AS

(5’-

lP

CCATTCCACCACATCGTCGG-3’) for the HSV-1 VP16 gene, gC-S (5'TCCTGTGGAGCCTGTTGTGG

-3')

and

gC-AS

(5'-

CTCCATGCGGGTGGAATTCC -3') for the HSV-1 gC gene. Also a RT-PCR analysis

na

was done for the expression of the IE180 protein in those 293T pE180 non-transfected or transfected cells (asterisk).

ur

1% agarose gel electrophoresis confirmed the specificity of the amplification products.

Jo

DNA sizes of 192 bp for the IE180, 214 bp for the ICP27 gene, 120 for the DNA pol gene, 121 bp for the VP16 gene, and 427 bp and for the gC gene.

14

re

-p

ro of

15

Figure 2. Analysis of IE, E and L mRNA expression in d120- and G2-

lP

infected cells. PK15 (pig kidney cells) (open bar) or PK15-IE180-expressing cells (Oyibo et al., 2014) with (darkest bar) or without 2 μg/ml doxycycline (DOX)

na

(Clontech) (grey line) were infected with the d120 or G2 mutant viruses at a MOI of 0.1 TCID50/cell. Cells were harvested at 48 hpi and total RNA was isolated using the

ur

acid guanidinium thiocyanate-phenol-chloroform extraction method (Chomczynski and Sacchi, 1987). One μg of RNA was reverse-transcribed using the QuantiTect Reverse

Jo

Transcription Kit (Qiagen). RTqPCR was performed to amplify the viral ICP27 (panel A), DNApol (panel B), VP16 (panel C) and gC (panel D). The same primers as for the RT-PCR were used. Values were normalized to β-actin mRNA (primers SusβActin-L 5’-GACATCCGCAAGGACCTCTA-3’

and

SusβActin-R

5’-

ACACGGAGTACTTGCGCTCT-3’). The RTqPCR reactions were performed with a Real-Time PCR StepOnePlusTM instrument (Applied Biosystems) using FAST-SYBR 15

16 Green (Applied Biosystems) according to the manufacturer’s protocol. The reaction mixture consisted of 1x FAST-SYBR Green (Applied Biosystems), sense and antisense primers each at 0.25 μM, and 15 ng cDNA. Thermal cycling consisted of an initial 10 min denaturation step at 95ºC followed by 40 cycles of denaturation (15 s at 95ºC) and annealing/extension (1 min at 60ºC). The panels show the fold change represented in logarithmical scale of each value in d120- or G2-infected PK15-IE180 cells with or without DOX treatment relative to HSV-1 strain F-infected PK15 cells.

ro of

A constant value of 1 was added to the data prior to applying the log transformation in order to avoid negative values.

Values represent the mean and standard deviation (error bars) from three

-p

independent experiments.

Statistical analysis was done using analysis of variance (ANOVA) and mean

re

differences among viruses were determined by Tukey’s test. Bars showing different

Jo

ur

na

lP

letters represent values significantly different from each other (p< 0.05).

Figure 3. Analysis of complementation at the replication level between IE180 protein and d120 HSV-1 mutant. Panel A: Recombinant viruses FTKGF (derived 16

17 from a wt HSV-1) and R120vGF (derived from the d120 mutant) expressing the GFP protein, were used to infect (a MOI of 0,1 TCID50/cell) PK15 cells or PK15 cells expressing the IE180 protein of PRV in presence of DOX. At 48 hpi, those infected with the FTKGF recombinant are able to form infection foci while this was not observed in cells infected by the d120 recombinant where only isolated cells express the GFP protein. The pictures were taken using an inverted microscope using the 10x + 20x objectives. Panel B: Vero cells (African green monkey kidney cells) infected with 500 µl of supernatant obtained from the infected PK15 or PK15-IE180 samples shown in panel A. No GFP expression is observed using supernatants from cells infected by the R120vGF mutant which is defective for the Ct domains of the ICP4 protein at 48 hpi.

ro of

The pictures were taken using an inverted microscope using the 10x + 20x objectives. Panel C: The recombinant FTKGF virus was obtained by infection of HSV-1 strain F virus at a MOI of 0.1 TCID50/cell, followed of transfection with plasmid DNA of pUPTKGF digested with AspI and AlwNI into U2OS cells using lipofectamine 2000

-p

(Invitrogen). Recombinant progenies were selected in the presence of 25 μg/ml ganciclovir (GCV) by using EGFP expression as a marker. Recombinant virus was

re

plaque-purified five times in Vero cells in the presence of 25 μg/ml GCV. The pUPTKGF plasmid contains the IE-CMV-EGFP-BGH polyA cassette flanked by viral

lP

homologous sequences of the thymidine kinase (TK) region for recombination in HSV1 strain F. The left-hand flanking homologous sequence consisted of nt 45,647 - 46,771 from the HSV-1 strain F genome (GenBank GU734771, (Szpara et al., 2010) and the

na

right-hand flanking homologous sequence consisted of nt 47,907 - 48,488 from the HSV-1 strain F genome (Szpara et al., 2010). The FTKGF virus characterization was carried

out

by

PCR

using

specific

primers

ICP0-E2-S

(5'-

ur

ATGCAATTGCGCAACACC-3') and ICP0-E3-AS (5'-TGTTGGTGTTACTGCTGC3') for the ICP0 gene, HTK-2 (5'-CCAGGATAAAGACGTGCATG-3') and HTK-8 (5'-

Jo

TTGACCTGGCTATGCTGG-3')

for

the

TK

gene

and

HL41-S

(5'-

ACAATTGACCTGCCATGG-3') and HL41-AS (5'-CGAATACAGAACAGATGC3') for the UL41 gene using conditions previously described (Lerma et al., 2016). DNA of the FTKGF or a HSV wt virus were used as templates. PCR products were separated by gel electrophoresis in 1% agarose gel: ICP0 (592 bp), thymidine kinase TK (UL23) (306 bp) and UL41 (541 bp) genes from FTKGF (lane A) and HSV-1 strain F (lane B). Negative PCR control without DNA (lane C). A 1 Kbp DNA ladder was used as DNA size control (Invitrogen) (lane L). Specific fragments could be amplified from the UL41 17

18 and ICP0 genes, used as viral control, but not from the TK gene when using the FTKGF viral DNA (lanes A) whereas all the bands were detected when using the wt viral DNA

Jo

ur

na

lP

re

-p

ro of

(lanes B).

18