Partial role of TLR4 as a receptor responding to damage-associated molecular pattern

Immunology Letters 125 (2009) 31–39

Contents lists available at ScienceDirect

Immunology Letters journal homepage: www.elsevier.com/locate/

Partial role of TLR4 as a receptor responding to damage-associated molecular pattern Kyung-Mi Lee a,b , Seung-Yong Seong c,d,∗ a

Global Research Lab, Department of Biochemistry, Korea University College of Medicine, Seoul 136-705, Republic of Korea Division of Brain Korea 21 Program for Biomedical Science, Korea University College of Medicine, Seoul 136-705, Republic of Korea Department of Microbiology and Immunology, Seoul National University College of Medicine, 28 Yongon-dong, Jongno-gu, Seoul 110-799, Republic of Korea d Department of Biomedical Sciences, Seoul National University College of Medicine, 28 Yongon-dong, Jongno-gu, Seoul 110-799, Republic of Korea b c

a r t i c l e

i n f o

Article history: Received 3 February 2009 Received in revised form 13 April 2009 Accepted 25 May 2009 Available online 6 June 2009 Keywords: Toll-like receptor Necrotic cells Dendritic cells NF-␬B Inflammation DAMP PAMP

a b s t r a c t Part of pathogen-associated molecular pattern (PAMP) and damage-associated molecular pattern (DAMP) activate antigen-presenting cells through Toll-like receptors (TLRs) to initiate immune responses. However, controversy remains if TLR4 mediates DAMP signaling due to the confounding effects of potential LPS contamination. To test if TLR4 functions as a true receptor for DAMP, we compared TLR4pos - and TLR4neg -responders in vitro and in vivo after stimulation with whole necrotic cell (NC) lysates. Using CHO reporter cells transfected with anti-TLR4-siRNAs, TLR4 was found to partially mediate NF-␬B activation in response to NC lysates. TLR4neg DCs exhibited less I-Ab expression and nitric oxide secretion than TLR4pos DCs upon NC stimulation and this defect was well correlated with diminished presentation of H-Y antigen by TLR4neg DCs to I-Ab -restricted CD4pos Marilyn T cells in vitro. Similarly, TLR4neg DCs showed significantly less expression of I-Ab , CD80, CD86, and CD40 than TLR4pos DCs when NC lysates were injected into peritoneal cavity. Finally, delayed type hypersensitivity response to OVA was significantly decreased in TLR4neg mice when NCs were used as an adjuvant. Taken together, our data support the idea that part of the endogenous ligands presented by NCs could activate APCs thru TLR4 and contribute to the development of antigen-specific adaptive immunity. Therefore, endogenous DAMP ligands themselves, not contaminated LPS, activate TLR4 signaling leading to activation of professional antigen-presenting cells. © 2009 Elsevier B.V. All rights reserved.

1. Introduction Prior to the development of antigen-specific adaptive immune responses, antigen-presenting cells (APCs) need to be activated to present antigens to naïve T cells. This phenomenon has long been manifested in the immunizing process with vaccine [1], which requires adjuvants. The adjuvants often contain molecules derived from bacteria and stimulate APCs through a set of patternrecognition receptors (PRRs) on APCs [2,3]. Much effort has put into identifying entities stimulating APCs and their receptors binding these ligands. It is now widely accepted that pathogenassociated molecular pattern (PAMP) can stimulate PRR such as Toll-like receptors (TLRs) [2,4]. PAMP engagement with TLRs induces NF-␬B activation and turns on many genes involved in the

Abbreviations: NC, necrotic cells; DAMP, damage-associated molecular pattern; PAMP, pathogen-associated molecular pattern. ∗ Corresponding author at: Department of Microbiology and Immunology, Seoul National University College of Medicine, 28 Yongon-dong, Jongno-gu, Seoul 110-799, Republic of Korea. Tel.: +82 2 740 8301; fax: +82 2 743 0881. E-mail address: [email protected] (S.-Y. Seong). 0165-2478/$ – see front matter © 2009 Elsevier B.V. All rights reserved. doi:10.1016/j.imlet.2009.05.006

inflammatory response, which amplifies innate immune responses [5,6]. The criteria of PRR ligands are not restricted to pathogens, but extend to various endogenous molecules, their derivatives, or degradation products released by tissue damage [7,8]. The ‘danger’ model, originally proposed by Matzinger in 1994 [9], suggests that APCs recognize endogenous alarm signals released by stressed or injured cells. This concept has challenged Janeway’s ‘the infectious non-self model’ [2]. The endogenous ligands can be any molecules that are not normally exposed to the immune system in physiological conditions. These molecules present patterns that are associated with tissue damage (damage-associated molecular pattern, DAMP) [9–11]. The list of endogenous ligands activating innate immunity is growing, and includes structurally and functionally diverse molecules [8]. DAMPs from dying cells have been identified as endogenous adjuvants activating dendritic cells (DCs); heat shock proteins and uric acid, for example, have previously been shown to induce DC maturation [12,13]. Interestingly, some of the DAMPs stimulate APCs via TLRs, which has been known to distinguish evolutionary distant PAMPs from self-constituents [1]. For example, heat shock proteins stimulate

32

K.-M. Lee, S.-Y. Seong / Immunology Letters 125 (2009) 31–39

TLR2 and TLR4, RNA immune complex binds to TLR7 while chromatin and DNA immune complex binds to TLR9 [14]. In addition, the functionally and structurally more diverse molecules were shown to bind to TLR4, including fibrinogen, surfactant protein A, fibronectin domain A, heparan sulfate, soluble hyaluronan and uric acid, etc. [11]. The endogenous DAMPs known to stimulate TLRs were well reviewed by Tsan and Gao in 2004 [15]. Despite extensive research to prove the role of DAMP in stimulating innate immune responses, controversy still exists as to the presence of contaminated bacterial products in the purified endogenous molecules [16,17]. As the list of endogenous ligands grows longer, however, it is hard to accept that contaminated bacterial products are the common source of DAMP stimulation. Furthermore, recent studies have shown that necrotic fibroblasts or damaged vessels, grown in sterile conditions, can stimulate DCs by up-regulating MHC class II and co-stimulatory molecules [7]. Thus, it appeared that DCs responded to endogenous molecules and became activated. A subtype of TLRs responding to necrotic cells (NCs) has been studied in a series of studies. In the previous study using various TLR-transfected cell lines, TLR2, but not TLR4 or TLR6, was shown to respond to NCs to induce NF-␬B activation [18]. This conclusion was based on the fact that TLR2-transfected HEK293 cells resulted in NF-␬B activation and chemokine expression upon stimulation with NCs. However, whether TLR4 could lead to functional activation of innate immune cells upon recognition of NCs is not clear at present. In this study we showed that TLR4 is necessary, but not sufficient, to fully activate engineered or professional antigenpresenting cells, e.g., CHO cells, HEK293 cells, DCs, and macrophages, in response to NC lysates in vitro. The requirement for TLR4 in mounting NC-induced full activation of DCs was more evident in vivo as revealed by severely impaired delayed type hypersensitivity. Therefore, our data support the notion that TLR4 senses DAMPs from NCs not only in professional APCs, but also extends to other cell types involved in full immune activation and antigen presentation. Additionally, our data strongly support that endogenous ligands themselves, not contaminated LPS, stimulate TLR4 pathway. 2. Materials and methods 2.1. Reagents LPS (Escherichia coli serotype O26:B6) were purchased from Sigma (St. Louis, MO). Otherwise denoted, cells were stimulated with 300 ng/ml of LPS. Antibodies used for FACS analysis were as follows: anti-mouse CD4-APC (clone GK1.5), anti-mouse CD11c-APC (clone HL3), anti-mouse CD40-FITC (clone HM40-3), anti-mouse CD80-FITC (clone 16-10A1), anti-mouse CD86-PE (clone GL1), antimouse CD25-PE (clone 3C7), anti-mouse V␤6-FITC (clone RR4-7), anti-mouse I-Ab -PE (clone AF6), and an appropriate rat-anti-mouse IgG isotype control. All antibodies were from BD Pharmingen, San Diego, CA unless otherwise stated. Anti-FLAG-FITC and 7-aminoactinomycin D (7AAD) was purchased from Sigma–Aldrich. H-Y Dbyp peptide (NAGFNSNRANSSRSS) was synthesized by Invitrogen at >90% purity. 2.2. Mice C57BL/6 (B6) and Rag2neg B6 mice were obtained from Taconic Farms Inc. (Rockville, MD). T cell receptor (TCR) (V1.1, V␤6) transgenic Rag2neg Marilyn mice harboring monoclonal CD4pos T cell populations specific for the male antigen H-Y peptide presented by I-Ab were also obtained from Taconic. We purchased C3H/HeJ (TLR4neg ) mice and C3H/HeN (TLR4pos ) mice from Jackson Lab. (Bar Harbor, Maine). We used various types of TLR4-null mice to ascer-

tain the effects of TLR4. They were bred to raise offspring in our animal facility within a SPF environment. All animals were used in accordance with the Policy and Regulation for the Care and Use of Laboratory Animals (Laboratory Animal Center, Seoul National University, Korea). TLR4neg B6 mice were kindly provided by Dr. S. Akira (Osaka University, Osaka, Japan) [19]. Rag2neg B6 mice were mated with TLR4neg B6 mice to make heterozygote for rag2 loci and tlr4 loci. The F1 heterozygotic mice were crossed with each other to make double KO homozygote. We determined the genotype of KO mice by PCR for the gene encoding rag2 gene and tlr4 gene. The genotypes of other mice were determined as the manufacturer suggested. 2.3. Cells Chinese hamster ovary (CHO) cells carrying a gene for the membrane form of CD25 under the control of NF-␬B responsive promoter and CD14 gene (3E10 cells) were kindly provided by Dr. Golenbock, DT (UMASS, Worsceter, MA) [20]. NF-␬B reporter CHO cells were maintained in Ham’s F-12 medium (Invitrogen, Carlsbad, CA) supplemented with 10% fetal calf serum (FCS; Invitrogen), 400 U/ml of hygromycin (LC Laboratories, Woburn, MA), antibiotics (100 units/ml penicillin, 100 ␮g/ml streptomycin and 50 ␮g/ml gentamycin) (WelGENE Inc., Daegu, Korea), and 400 ␮g/ml of G418 (Invitrogen). For the NF-␬B reporter assay, we synchronized growth of CHO cells by dispensing 5 × 106 cells/plate at day 0. At day 1, after harvesting the cells from the plates, we put 1 × 105 cells/well in flat bottom 96 well plates and cultured for 24 h. We added stimulants at day 2 and cultured for another 14 h. We harvested cells at day 3 and measured CD25 expression by flowcytometry (FACS Calibur, BD, San Jose, CA) using PE-conjugated anti-CD25 antibody (BD Pharmingen, San Diego, CA). The percent activation was determined by subtracting % of CD25pos CHO cells in a medium-stimulated group from the % of CD25pos CHO cells in a test group. The data were from more than three separate experiments unless otherwise denoted. 2.4. Necrotic cells We isolated fibroblasts from the quadriceps muscle of B6 mice to make NCs, as described previously [7]. Briefly, to make NCs, we repeated 10 cycles of freezing and thawing in dry-ice-ethanol bath and 37 ◦ C heat bath. Unless otherwise denoted, 2 × 106 cells/ml was used to stimulate responder cells. In order to make sure that NCs are completely sterile and free of bacterial contaminants, all the reagents, media, and solutions were filtered through 0.2 ␮m sterile filters prior to the use in the experiments. NC preparations obtained after freezing and thawing in the tube were tested for the presence of bacterial endotoxin using Limulus Amebocyte Lysate Test (Nelson Lab, Utah, USA) and only those that passed the test (<0.02 EU/ml) were used for the experiment. Additionally, we have examined the effect of LPS or NC preparations on MD2pos - or MD2neg -CHO NF␬B reporter cells since MD2, a co-receptor for TLR4, is absolutely required for LPS-signaling, but not for NC-mediated signaling (data not shown). 2.5. Silencing TLR4 expression with siRNA CHO cells express endogenous hamster TLR4. To silence endogenous expression of hamster TLR4 on CHO cells, siRNAs against hamster TLR4 were generated against sequence #1—GGATCCCGTTTAAAGTTACAAGGTGTCCATTGATATCCGTGGACACCTTGTAACTTTAAATTTTTTCCAAAAGCTT, #2—GGATCCCGTTAAGGTGTTGAGACTGGTCATTG ATATCCGTGACCAGTCTCAACACCTTAATTTTTTCCAAAAGCTT, and #3—GGATC CCGTGAAAGGCTCCAGGTTGAATATTGATATCCGTATTCAACCTGGAGCCTTTCATTTTTTCCAAAAGCTT. The genes encoding siRNA sequences were cloned in pRNA-U6.1/Zeo vec-

K.-M. Lee, S.-Y. Seong / Immunology Letters 125 (2009) 31–39

tor (GenScript). 3E10 cells were transfected with pRNA-U6.1 plasmids encoding siRNA#1 (pUsRT4-1), siRNA#2 (pUsRT42) or siRNA#3 (pUsRT4-3). Where indicated, two or three plasmids were co-transfected together (pUsRT4-1 + pUsRT4-2, pUsRT4-1 + pUsRT4-2 + pUsRT4-3). 2.6. hIL-8 production in HEK cells Human embryonic kidney (HEK) 293 cells do not express TLR4. Thus, we transfected HEK 293 cells with pFLAG-CMV1 (Sigma–Aldrich) or pFLAG-hTLR4. pFLAG-hTLR4 was kindly provided by Dr. Golenbock, DT (UMASS, Worsceter, MA) [20]. After stimulation of HEK cells with NCs or LPS, the culture supernatants were collected and centrifuged. The IL-8 concentration in the supernatants was determined by using a commercially available ELISA kit (Endogen, Woburn, MA). 2.7. Stimulation of dendritic cells Bone marrow-derived dendritic cells (BMDCs) were generated from bone marrow of Rag2neg mice or Rag2neg × TLR4neg double KO mice. To generate DCs, bone marrow of 6- to 8-week-old mice was flushed from the femurs and tibias with IMDM (Invitrogen). Cells were washed and plated in 96 well culture plates (106 cells/ml) in complete IMDM [IMDM supplemented with 10% heat-inactivated FCS, 50 nM 2-mercaptoethanol (Invitrogen), 2 mM l-glutamine, antibiotics (100 units/ml penicillin, 100 ␮g/ml streptomycin and 50 ␮g/ml gentamycin) (WelGENE Inc.), recombinant mouse GM-CSF (0.75 ng/ml, PeproTech, Rocky Hill, NJ) and mouse IL-4 (1.5 ng/ml; PeproTech)]. Half of the medium was replaced every day with an equal volume of complete IMDM. At day 6 of culture, immature DCs were stimulated with either LPS or NCs for an additional 18 h. 2.8. NO production assay The nitrite in the cytoplasm and culture supernatant was assessed by using a colorimetric reaction with the Griess reagent (Sigma–Aldrich). Briefly, after stimulation for 18 h, culture supernatants and cells were harvested and diluted with equal volume of Griess reagent (0.1% (w/v) N-(1-naphthyl)ethylenediamine dihydrochloride, 1% (w/v) sulfanilamide and 5% (w/v) H3 PO4 ). After 8 min, the absorbance at 540 nm was measured with an automated plate reader (Molecular Devices, Sunnyvale, CA). We obtained “fold induction” by dividing concentration of NO measured in a test group by that of medium-stimulated cultures. 2.9. Phagocytosis assay To obtain peritoneal cells, we injected 3 ml/mouse of fluid thioglycolate broth media into the peritoneal cavity of Rag2neg or Ragneg TLR4neg mice. After 3 days, peritoneal cells were harvested from the mice by lavaging the peritoneal cavity with 10 ml of icecold PBS. Peritoneal cells were incubated with an equal number of CFSE-stained NCs, prepared from two cycles of freezing–thawing, in 96 well plates at 37 ◦ C and 5% CO2 for an hour. The mixture of cells were washed with FACS buffer and stained with anti-F4/80-APC antibody for FACS analysis. F4/80pos CFSEpos cells were considered as macrophages that phagocytosed NCs. 2.10. T cell stimulation assay For in vitro T cell stimulation, both lymph nodes and spleen cells were isolated from Marilyn mice and red blood cells were removed by adding RBC lysis buffer (0.15 M NH4 Cl, 1 mM KHCO3 , 0.1 mM EDTA pH 7.2) for 4 min. Mouse T cells were subsequently enriched

33

by negative selection using Pan T Cell Isolation Kit (MACS; Miltenyi Biotech, CA) containing biotin-conjugated monoclonal antibodies against CD11b, CD45R, DX5 and Ter-119. Enriched cells (1 × 105 ) were subsequently resuspended in complete IMDM without IL-4 and then co-incubated with DCs in 96-well plate for 18 h. Before mixing with T cells, DCs were stimulated with male NCs or female NCs for 18 h. We cultured T cells with DC in complete DC medium without IL-4 for 72 h and pulsed with 1 ␮Ci of [3 H]-thymidine for 18 h. We counted thymidine uptake using a TriLux micro beta counter (PerkinElmer, Shelton, CT). 2.11. Peritoneal DC maturation assay To assess the activation of DCs in vivo, we injected NCs (2 × 106 cells/mouse) intraperitoneally into Rag2neg or Ragneg TLR4neg mice, harvested peritoneal cells after 6 h, and analyzed surface expression of I-Ab , CD40, CD80 and CD86 on CD11cpos cells by FACS. As a negative control, we injected PBS intraperitoneally. 2.12. Delayed type hypersensitivity To analyze T cell responses in vivo, we immunized C3H/HeJ (TLR4neg ) mice and C3H/HeN (TLR4pos ) mice with OVA (10 ␮g/100ul) mixed with NCs (3.3 × 105 /100 ␮l) at the base of the tail. After 7 days, we injected 10 ␮g/10 ␮l of OVA on the right foot pad and PBS on the left foot pad and measured foot pad swelling 2 days later. We calculated net foot pad swelling by subtracting the thickness of the left foot pad from that of the right. 2.13. Statistical analysis Student’s t-test was used. Samples were considered statistically significant when p value <0.05. Data were represented as mean ± SEM of triplicate. The mean values were depicted as a single line between the multiple circles where indicated. 3. Results 3.1. Role of TLR4 in NF-B activation by NC TLR4 has been shown to respond to diverse endogenous and exogenous purified ligands, however, it was not clear if it mediates DAMP signal stimulated by NCs [18]. Since LPS contamination was often found to occur during the multiple steps of ligand purification process, we used whole NC lysates to avoid possible PAMP contamination during the purification of endogenous ligands. NCs, prepared by repetitive freezing and thawing, efficiently stimulated TLR4pos CHO cells expressing reporter CD25 (NF-␬B activation) under the control of NF-␬B-binding promoter (Fig. 1). % CD14pos CD25pos cells were slightly higher (55.1%) in necrotic cell-stimulated CHO cells (Fig. 1C) than in LPS-stimulated CHO cells (51.3%, Fig. 1B). However, LPS showed more heterogeneous expression of CD25 than that of NCs, resulting in higher MFI (Fig. 1B and C). MFI of cells stimulated with NC (66.7) was lower than that of LPS (158.5). Since CHO reporter cells expressed endogenous hamster TLR4, we examined if NF-␬B activation by NC was mediated through TLR4. For this, we transfected CHO reporter cells with plasmid DNAs encoding siRNAs generated against TLR4 and measured the level of NF-␬B upon stimulation with NC or LPS. Three siRNA constructs, siRNA#1 (pUsRT4-1), siRNA#2 (pUsRT4-2) and siRNA#3 (pUsRT4-3), were made against TLR4, however, they were only able to suppress LPS-mediated NF-␬B activation partially, yet statistically significant (p < 0.05, Fig. 1D). Thus, we transfected cells with two or three constructs together (Fig. 1D). When three siRNA constructs were transfected at the same time, 55% and 41% decrease in MFI was obtained in cells treated with LPS or NC, respectively

34

K.-M. Lee, S.-Y. Seong / Immunology Letters 125 (2009) 31–39

Fig. 1. TLR4 partly plays a role in NF-␬B activation of CHO reporter cells upon stimulation with necrotic cells (NC). (A–C) CHO reporter cells, carrying a gene for CD25 under the control of NF-␬B-binding promoter, were incubated with none (medium), 300 ng/ml of LPS, or 1 × 105 NCs for 14 h, and then stained with PE-anti CD25 mAb and APC-anti CD14 mAb. (D) LPS- or NCs-stimulated-NF-␬B activation (MFI) was significantly inhibited by transfecting CHO reporter cells with siRNAs against three different regions of hamster tlr4 gene (*, compared with pRNA-U6.1; p < 0.05). pRNA-U6.1 plasmids encoding siRNA#1 (pUsRT4-1), siRNA#2 (pUsRT4-2) or siRNA#3 (pUsRT4-3) were used as described under Section 2. Where indicated, two (1 + 2) or three plasmids (1 + 2 + 3) were co-transfected. Data are shown as mean ± SEM of triplicate cultures of a representative set among three independent experiments.

(p < 0.01), suggesting that NC-stimulated NF-␬B activation was partially mediated through TLR4. To further confirm the role of TLR4 in recognizing NCs, HEK293 cells, not expressing endogenous TLR4, were transfected with a plasmid carrying FLAG-tagged hTLR4 and examined IL-8 secretion upon stimulation with NCs. As shown in Fig. 2A, HEK293 cells evenly expressed either pFLAG or pFLAG-tagged TLR4 upon transfection, and responded to LPS by producing IL-8 (Fig. 2B; 143.3 ± 6.5 pg/ml (LPS) vs. 81.0 ± 2.7 pg/ml (medium)). When these TLR4-expressing HEK293 cells were mixed with NCs, similar increase of IL-8 production was observed (Fig. 2B; 157.5 ± 9.8 pg/ml). However, even in the absence of exogenously added TLR4 (pFLAG vector-transfected cells), HEK293 cells responded to NCs and elevated IL-8 secretion (118.4 ± 6.1 pg/ml). These data suggest that HEK293 cells expressed other receptors than TLR4 responding to NCs. Nonetheless, the difference between hIL8 secretion of FLAG-HEK cells and TLR4-HEK cells was statistically significant, suggesting that TLR4 partially plays a role in producing hIL8 upon stimulation with NC (p < 0.05). 3.2. Role of TLR4 in DC activation by NC Next, we examined if NCs could stimulate DCs through TLR4. We first determined expression of I-Ab on TLR4pos or TLR4neg DCs stimulated with NCs by FACS. Where indicated, “fold induction” = % CD11cpos I-Ab pos DCs (LPS or NCs)/% CD11cpos I-Ab pos DCS (medium). As shown in Fig. 3A, CD11cpos TLR4pos DCs increased surface I-Ab

expression in response to both LPS and NCs. LPS-stimulated DCs showed higher up-regulation of I-Ab than NC-stimulated DCs (MFI 6.2 ± 0.3-fold vs. 4.9 ± 0.3-fold, respectively; Fig. 3A). As has been known, LPS-mediated up-regulation of I-Ab was completely abolished in TLR4neg DCs. In contrast, NC-induced I-Ab expression was partially decreased in TLR4neg DCs (Fig. 3B, p < 0.05). This suggests that TLR4 partially contributes to the up-regulation of I-Ab of DCs upon stimulation with NC. In in vitro system, we were not able to detect differences between TLR4pos DCs and TLR4neg DCs in expression level of co-stimulatory molecules (CD80, CD86, and CD40). We then examined if LPS or NCs can stimulate Nitric Oxide (NO) production in DCs via TLR4. DCs have been shown to secret small amount of NO in response to various PAMPs when compared to macrophages [21]. As reported, LPS increased NO production by DCs, approximately twofold as compared to the medium-treated control DCs (Fig. 3B). This stimulation was completely abrogated in the absence of TLR4. To our surprise, while LPS-stimulated NO production a little over twofold, NCs induced NO production more than 25-fold over the control level in TLR4pos DCs (Fig. 3B, p < 0.05). This elevation was significantly reduced in TLR4neg DCs (p < 0.05), indicating that a substantial amount of NO production by DCs was mediated through TLR4 upon stimulation with NC. When we stimulated TLR4neg DCs with NC, they still produced quite large levels of NO, again demonstrating the presence of other receptors in DCs responding to NCs. NO level in NCs alone and LPS alone (without DC) was 0.4 ± 0.03 and 0.2 ± 0.3 ␮M. This was significantly lower than that of medium-treated TLR4pos DCs (0.6 ± 0.2 ␮M, p < 0.05).

K.-M. Lee, S.-Y. Seong / Immunology Letters 125 (2009) 31–39

35

Fig. 2. HEK293 cells transfected with hTLR4 showed increased IL-8 secretion upon stimulation with NCs. (A) HEK293 cells were transfected with pFLAG or pFLGA-hTLR4 plasmid DNAs. Expression of transfected genes was monitored by FACS using PE-anti-FLAG Ab. Filled histogram is for isotype control and solid line for PE-anti-FLAG Ab. (B) HEK293 cells were treated with LPS (50 ng/ml) or NCs for 14 h and the supernatants were collected to measure IL-8 by ELISA. Transfection of the TLR4 gene significantly increased hIL8 secretion upon stimulation with NCs (*, pFLAG vs. pFLAG-TLR4; p < 0.05). Data are shown as mean ± SEM of triplicate cultures of a representative set among three independent experiments.

Taken together, these data demonstrate TLR4 as one of the receptors for endogenous molecules presented by NC.

from proliferation of H-Y-specific T cells engaged with H-Y peptide presented by MNC.

3.3. Role of TLR4 in priming naïve T cells by NC-activated DCs in vitro

3.4. Role of TLR4 in phagocytosing NCs by peritoneal macrophages

Next, we examined whether DCs stimulated with NCs are able to prime antigen-specific T cells. Bone marrow-derived DCs prepared from Rag2neg (I-Ab ) female mice were pulsed with male NCs (MNC) or female NCs (FNC) and mixed with H-Y-specific T cells purified from female Marilyn mice (anti-H-Y TCR transgenic). In this system, male, but not female, NCs possessed H-Y peptide that could be presented by DCs and stimulated H-Y-specific Marilyn T cells (Fig. 4). Both FNC and MNC could function to stimulate DCs, however, absence of T-cell specific H-Y antigens in female DCs did not result in proliferation of H-Y Marilyn T cells (Fig. 4B). In contrast, Marilyn T cells proliferated when mixed with female DCs loaded with MNC (Fig. 4A). Within the range of DCs used to stimulate Marilyn T cells, a linear increase in DNA synthesis was obtained. Again, TLR4neg DCs were able to prime Marylin T cells, but significantly less than TLR4pos DCs (p < 0.05). DCs alone or T cells alone did not show any visible thymidine uptake, demonstrating that the stimulation seen with a mixture of DCs and Marylin T cells was resulted

We examined whether phagocytic ability of peritoneal F4/80pos macrophages was dependent on TLR4. Since phagocytic activity of DCs decreases upon activation, we used peritoneal cells instead. We stained NCs with CFSE, and measured the percentage of CFSEpos F4/80pos peritoneal cells after co-incubating them for an hour. The phagocytic index = %CFSEpos F4/80pos /% total F4/80pos cells. As shown in Fig. 5, the average phagocytic index was 49.2 ± 5.0 in TLR4pos macrophages while that in TLR4neg macrophages was 43.1 ± 4.7 (n = 9), demonstrating that the phagocytic process partially depends on the presence of TLR4 (p < 0.05). Together, these data support the role of TLR4 as one of the receptors for endogenous ligands presented by NCs in F4/80pos peritoneal macropahges. 3.5. Role of TLR4 in NC-induced DC activation in vivo Our data indicate the potential for NCs to be utilized as natural adjuvants for boosting immune responses. To confirm both phenotypic and functional changes of DC activation by NCs seen

Fig. 3. Expression of I-Ab and production of nitric oxide in DCs by NCs. (A) Bone marrow-derived TLR4pos DCs and TLR4neg DCs were stimulated with LPS (300 ng/ml) or NCs (2 × 106 cells) for 18 h and stained with PE-anti I-Ab and APC-anti CD11c. Fold induction of I-Ab expression = [% CD11cpos I-Ab pos cells]LPS or NCs /[% CD11cpos I-Ab pos cells]medium . I-Ab expression was significantly higher on TLR4pos DCs than TLR4neg DC upon stimulation with NC (*, TLR4pos vs. TLR4neg ; p < 0.05). (B) Similarly, following stimulation with LPS (300 ng/ml) or NCs (2 × 106 cells) for 18 h, production of NO was measured using Griess reagent. NO production was significantly higher in TLR4pos DCs than TLR4neg DC upon stimulation with NC (*, p < 0.05). Bar graphs are depicted as mean ± SEM of triplicate cultures of representative set among three independent experiments.

36

K.-M. Lee, S.-Y. Seong / Immunology Letters 125 (2009) 31–39

Fig. 4. Activation of naïve Marilyn T cells (anti-H-Y-specific TCR transgenic) by DCs activated with male NCs (H-Ypos ) or female NCs (H-Yneg ), in vitro. (A) DCs prepared from syngeneic female Rag2neg mice were pulsed with NCs for 18 h. Marilyn T cells were then co-cultured with DCs for 3 days and pulsed with [3 H] thymidine for another 16 h. Naïve T cell priming was significantly diminished in TLR4neg DCs compared with TLR4pos DCs (*, p < 0.05). DCs alone or T cells alone did not show thymidine uptake. (B) Negative control experiments using H-Yneg female NCs. Data are shown as mean ± SEM of triplicate cultures of a representative set among three independent experiments.

in vitro, we monitored activation of DCs by NCs in vivo. NC lysates (2 × 106 /100 ␮l) were injected into peritoneal cavity of TLR4pos or TLR4neg mice and expression of co-stimulatory molecules on DCs was assessed by flowcytometry (Fig. 6). CD11cpos DCs showed upregulation of co-stimulatory molecules as CD80, CD86, CD40 along with I-Ab . Compared to TLR4pos DCs, TLR4neg DCs showed decreased expression of these activation markers, confirming that full activation of DCs by NC requires TLR4 in vivo. 3.6. Role of TLR4 in delayed type hypersensitivity responses to NC/OVA To further verify the role of NC stimulation of DCs in vivo, we adopted OVA-induced delayed type hypersensitivity (DTH) model (Fig. 7). TLR4pos and TLR4neg mice were primed with OVA in the presence of NCs, LPS, or CFA, and then challenged with OVA

(10 ␮g/10 ␮l) into the right foot pad 7 days later. Foot pad thickness was measured after 48 h. As seen in Fig. 7, TLR4neg mice showed significantly less foot pad swelling in all cases challenged as compared to the TLR4pos wild type control (Fig. 7, p < 0.05). Interestingly, a functional defect in DTH in the absence of TLR4 was more profound in vivo than those obtained in vitro settings. 4. Discussion This study showed that signal transmission by endogenous DAMP partially relied on activation of the TLR4 pathway both in vitro and in vivo. The activation might not be due to possible LPS contamination in endogenous DAMP (that has been issued for a long time) for the following reasons. First, we used whole NC lysates without further purification that might incur LPS contamination. Second, we assessed endotoxin contamination in all preparations by Limu-

Fig. 5. Phagocytosis of NCs by peritoneal F4/80pos macrophages. (A) Representative FACS plot of F4/80pos macrophages that phagocytosed NCs (CFSEpos F4/80pos ). TLR4pos or TLR4neg peritoneal macrophages were incubated with CFSE-labeled necrotic fibroblasts for 1 h and subsequently stained with anti-F4/80 Ab. (B) The percentage of macrophages that engulfed NCs (CFSEpos F4/80pos ) among total macrophages (F4/80pos ). Each dot was calculated by dividing % F4/80pos CFSEpos cells by % F4/80pos cells. TLR4pos macrophages phagocytosed more NCs than TLR4neg macrophages (*, p < 0.05). Mean of each group was shown as a line (n = 9). Composite data of triplicate cultures from three independent experiments are shown.

K.-M. Lee, S.-Y. Seong / Immunology Letters 125 (2009) 31–39

37

Fig. 6. Up-regulation of CD80, CD86, CD40, and I-Ab on CD11cpos DCs upon stimulation with NCs in vivo. TLR4pos and TLR4neg mice were injected intraperitoneally with PBS or 2 × 106 NC lysates. Six hours later, peritoneal lavage was collected and surface expression of CD80, CD86, CD40, and I-Ab was measured on CD11cpos DCs using flowcytometry. (A) Representative dot plots of CD11cpos DCs from TLR4pos or TLR4neg mice were shown. (B) MFI of each activation markers was shown on CD11cpos DCs taken from individual TLR4pos or TLR4neg mice injected with PBS (NC−) or NCs (NC+). Mean of each group was shown as a line. DC activation was significantly diminished in TLR4neg DCs compared with TLR4pos DCs (*, p < 0.05). Composite data of duplicate staining from three mice per group are shown.

lus assay. Finally, we determined NF-␬B activation of MD2-mutant NF-␬B reporter CHO cells that are not reactive with LPS at all, but are still reactive with NCs. The fact that NCs could activate NF-␬B of MD2-mutant CHO cells suggests that there might be distinct signaling receptor complexes for NCs compared to LPS. Therefore, all the events shown in this study; NF-␬B activation, IL-8 secretion, IAb and co-stimulatory molecules up-regulation, NO secretion, DTH responses might result from stimulation of TLR4 by NCs themselves, not by contaminated LPS. Throughout this study, we found that NCs could stimulate both engineered- and professional-APCs in the absence of TLR4. Furthermore, suppression of TLR4 gene expression by siRNA strategies did not completely abolish APC activation by NCs in vitro. Since NCs are a heterogeneous mixture of lipids, proteins, and carbohydrates, multiple endogenous DAMP might play roles in stimulating cell surface receptors. For instance, uric acid forms hydrophobic crystals when released from injured cells, which is known to induce DC maturation [10]. Various mammalian hsp60 and hsp70 molecules also are capable of triggering CD14-dependent and CD14-independent signaling pathways [22]. Similarly, hyaluronan degradation products released upon disintegration of extracellular matrix (ECM) has been shown to activate an innate immune response through TLR2 [23]. Therefore, it is not surprising to see the involvement of other receptors in delivering DAMP signals from NCs. The partial contribution of TLR4 in responding to NCs might not only be due to multiple ligands present but also to the presence

of multiple PRRs participated. Indeed, TLR4neg DCs still exhibited signs of DC activation upon stimulation with NCs in vitro and in vivo, suggesting the presence of other receptors for DAMP. Thus it appears that some of the activating molecules released by NCs are sensed by TLR4, whereas others are sensed by another receptor or group of receptors, perhaps in a manner similar to the TLRs that bind to some, but not all, exogenous activating molecules. Uric acid, for example, is an alarm signal detected by NALP3, HMGB1 is seen by TLR4, and ATP by the P2 purinergic receptors [24,25]. Recently discovered CLEC9A may also come into play in conjunction with these receptors responding to NCs [26]. Interestingly, the pattern of NF-␬B activation in NC-stimulated CHO cells was quite distinct as compared to that in LPS. While NCs induce uniform activation of NF-␬B in nearly all cells, LPS induces much higher and broader range of NF-␬B activation (Fig. 1A). In contrast to LPS, which only signals positively via TLR4, signal transmission by NCs is mediated by various combinations of DAMPs and PRRs. Some of these combinations might signal positively and the others might signal negatively. Integrated summation of whole signaling process by positive- and negative-pathways might lead to uniform NF-␬B activation of all responder cells. However, the NF␬B activation by LPS–TLR4 interaction might largely depend on the level of TLR4 expressed in individual cells. Indeed, unlike LPS, NCs more efficiently stimulated IL-8 secretion of HEK 293 cells. Addition of TLR4 further enhanced IL-8 secretion by NCs (Fig. 2). Again these data suggest that diverse sig-

38

K.-M. Lee, S.-Y. Seong / Immunology Letters 125 (2009) 31–39

Fig. 7. Impaired DTH responses in TLR4neg mice in vivo. TLR4pos and TLR4neg mice were injected subcutaneously with OVA (10 ␮g/100 ␮l) in the presence of adjuvants (NCs (3.3 × 105 /100 ␮l), LPS (300ng/ml), or CFA) at the base of the tail, and then injected with OVA (10 ␮g/10 ␮l) intradermally into the right foot pad and PBS into the left foot pad 7 days later. Foot pad thickness was measured after 48 h. Net foot pad swelling = right foot pad thickness − left foot pad thickness. DTH response to OVA was significantly higher in TLR4pos mice than TLR4neg mice when NC was used as an adjuvant (*, p < 0.05). Data represent mean of net foot pad swelling (×10 mm) ± SEM (n = 15). Composite data from two independent experiments are shown.

naling was initiated by NCs in HEK293 cells, presumably due to the presence of multiple distinct ligands released from NCs, and that expression of TLR4 rendered further activation of HEK293 cells to produce more IL-8. siRNAs generated against TLR4 were able to suppress NF-␬B activation of CHO reporter cells stimulated by both NCs and LPS up to 50% of the control (Fig. 1D), confirming the partial involvement of TLR4. When two or three siRNAs were mixed together, additional reduction was apparent. siRNA-resistant portion of NF-␬B activation might have been due to activation of other TLR4-independent pathways or residual TLR4 function due to the inability for knocking out TLR4 completely. Nonetheless, it is clear that NCs can stimulate NF-␬B activation, and this stimulation is, at least in part, mediated through TLR4. When role of TLR4 in DC activation by NCs was assessed, it was more profound in in vivo settings than in in vitro settings (Fig. 3 vs. Figs. 6 and 7). While the difference of co-stimulatory molecules expression between TLR4pos DCs and TLR4neg DCs was not detectable upon NCs stimulation in vitro (data not shown), the expression level of CD80, CD86, CD40 and I-Ab on TLR4pos DCs was significantly higher than those of TLR4neg DCs following 6 h of NC injection in vivo. Thus, it appears that cellular cross talk occurring in vivo allows more efficient activation of APCs in response to NCs thru TLR4. Additionally, we were able to detect significant amount NO secretion upon stimulation of DCs with NC. DCs have been shown to secret very small amount of NO in response to various PAMPs when compared to macrophages [21]. In our study, we also found that DCs produced very small amount of NO in response to LPS. However, when we stimulated with NCs, they secreted approximately 20 times more NO as compared to those stimulated with LPS and this event was partly TLR4-dependent. As far as we know, this is the first report demonstrating TLR4-dependent NO production in DCs by NC stimulation. Thus, NO production in NC-stimulated DCs might explain differential signaling between PAMP and DAMP. High levels of NO have been shown to be cytostatic or cytotoxic for tumor cells [27]. In this regard, NO production from NC-stimulated DCs via TLR4 might be crucial in anti-tumor immune response.

In general, TLR4neg mice show “intrinsic DTH defect” since they do not respond to many adjuvants as reported earlier [28]. The intrinsic DTH defect observed in TLR4neg mice might be due to the fact that many known adjuvants stimulate APCs through TLR4 [28]. Among those TLR4 ligands, Neisseria meningitidis lipid A, mineral adjuvant, monophosphoryl lipid A, RC-529 all activate APCs via TLR4 and have been characterized as an adjuvant extensively [28]. Thus, this might underlie the intrinsic DTH defect seen in TLR4neg mice. In this context, our data support the idea that NCs need to activate TLR4 pathway to function as an adjuvant to induce DTH responses, like many other known exogenous adjuvants. Interestingly, we observed that DTH responses were severely abrogated in TLR4neg mice when NCs were used as an adjuvant. This was somewhat surprising given our in vitro results that partial role of TLR4 was observed in NC-stimulated DC activation. In vitro, TLR4neg DCs stimulate TLR4pos Marilyn T cells while in vivo, TLR4neg APCs stimulate TLR4neg T cells in our DTH settings. Therefore, TLR4 expression on T cells appeared to be also crucial in NC-induced DTH responses in vivo. Intriguingly, it has been reported that TLR4 expression on TH1 cells (crucial subset in DTH responses) played pivotal roles in anti-parasite immune responses [29]. In addition, recent findings of the role of TLR4 pathways of APCs in blocking suppressive effects of CD4pos CD25pos Treg cells [30] led to the speculation for constitutive activation of Treg cells and subsequent inhibition of effecter T cell generation in TLR4-deficient mice. Though this hypothesis awaits further elucidation in future studies, these results reiterate the role of TLR4 as a receptor sensing DAMP signals not only in APCs but also to T cells. Taken together, our data support the idea that part of the endogenous ligands presented by NCs could activate APCs thru TLR4 and contribute to the development of antigen-specific adaptive immunity. Therefore, endogenous DAMP ligands themselves, not contaminated LPS, activate TLR4 signaling leading to full activation of professional antigen-presenting cells. Acknowledgements This work was supported by a grant from the Ministry of Health and Welfare and Family, Republic of Korea (A062260). We gratefully acknowledge Dr. Sun-hwa Lee, Dr. Jeong-Hee Son, and Ms. HyeJung Moon for their support in doing experiments and preparing manuscripts; Dr. Golenbock, DT (UMASS, Worsceter, MA) for NF␬B reporter cells and genes; Dr. S. Akira (Osaka University, Osaka, Japan) for TLR4neg B6 mice. References [1] Janeway Jr CA. Approaching the asymptote? Evolution and revolution in immunology. Cold Spring Harb Symp Quant Biol 1989;54(Pt 1):1–13. [2] Janeway Jr CA, Medzhitov R. Innate immune recognition. Annu Rev Immunol 2002;20:197–216. [3] Brightbill HD, Libraty DH, Krutzik SR, Yang RB, Belisle JT, Bleharski JR, et al. Host defense mechanisms triggered by microbial lipoproteins through toll-like receptors. Science 1999;285:732–6. [4] Medzhitov R, Preston-Hurlburt P, Janeway Jr CA. A human homologue of the Drosophila Toll protein signals activation of adaptive immunity. Nature 1997;388:394–7. [5] Kaisho T, Akira S. Toll-like receptor function and signaling. J Allergy Clin Immunol 2006;117:979–87. [6] O’Neill LA. How Toll-like receptors signal: what we know and what we don’t know. Curr Opin Immunol 2006;18:3–9. [7] Gallucci S, Lolkema M, Matzinger P. Natural adjuvants: endogenous activators of dendritic cells. Nat Med 1999;5:1249–55. [8] Beg AA. Endogenous ligands of Toll-like receptors: implications for regulating inflammatory and immune responses. Trends Immunol 2002;23:509–12. [9] Matzinger P. Tolerance, danger, and the extended family. Annu Rev Immunol 1994;12:991–1045. [10] Shi Y, Evans JE, Rock KL. Molecular identification of a danger signal that alerts the immune system to dying cells. Nature 2003;425:516–21. [11] Seong SY, Matzinger P. Hydrophobicity: an ancient damage-associated molecular pattern that initiates innate immune responses. Nat Rev Immunol 2004;4:469–78.

K.-M. Lee, S.-Y. Seong / Immunology Letters 125 (2009) 31–39 [12] Langelaar MF, Hope JC, Rutten VP, Noordhuizen JP, van Eden W, Koets AP. Mycobacterium avium ssp. paratuberculosis recombinant heat shock protein 70 interaction with different bovine antigen-presenting cells. Scand J Immunol 2005;61:242–50. [13] Yang Y, Liu B, Dai J, Srivastava PK, Zammit DJ, Lefrancois L, et al. Heat shock protein gp96 is a master chaperone for toll-like receptors and is important in the innate function of macrophages. Immunity 2007;26:215–26. [14] Barrat FJ, Meeker T, Gregorio J, Chan JH, Uematsu S, Akira S, et al. Nucleic acids of mammalian origin can act as endogenous ligands for Toll-like receptors and may promote systemic lupus erythematous. J Exp Med 2005;202:1131–9. [15] Tsan MF, Gao B. Endogenous ligands of Toll-like receptors. J Leukoc Biol 2004;76:514–9. [16] Bausinger H, Lipsker D, Ziylan U, Manie S, Briand JP, Cazenave JP, et al. Endotoxinfree heat-shock protein 70 fails to induce APC activation. Eur J Immunol 2002;32:3708–13. [17] Geisler F, Algul H, Riemann M, Schmid RM. Questioning current concepts in acute pancreatitis: endotoxin contamination of porcine pancreatic elastase is responsible for experimental pancreatitis-associated distant organ failure. J Immunol 2005;174:6431–9. [18] Li M, Carpio DF, Zheng Y, Bruzzo P, Singh V, Ouaaz F, et al. An essential role of the NF-kappa B/Toll-like receptor pathway in induction of inflammatory and tissue-repair gene expression by necrotic cells. J Immunol 2001;166:7128–35. [19] Takeda K, Kaisho T, Akira S. Toll-like receptors. Annu Rev Immunol 2003;21:335–76. [20] Medvedev AE, Henneke P, Schromm A, Lien E, Ingalls R, Fenton MJ, et al. Induction of tolerance to lipopolysaccharide and mycobacterial components in Chinese hamster ovary/CD14 cells is not affected by overexpression of Toll-like receptors 2 or 4. J Immunol 2001;167:2257–67.

39

[21] Werling D, Hope JC, Howard CJ, Jungi TW. Differential production of cytokines, reactive oxygen and nitrogen by bovine macrophages and dendritic cells stimulated with Toll-like receptor agonists. Immunology 2004;111:41–52. [22] Lehnardt S, Schott E, Trimbuch T, Laubisch D, Krueger C, Wulczyn G, et al. A vicious cycle involving release of heat shock protein 60 from injured cells and activation of toll-like receptor 4 mediates neurodegeneration in the CNS. J Neurosci 2008;28:2320–31. [23] Scheibner KA, Lutz MA, Boodoo S, Fenton MJ, Powell JD, Horton MR. Hyaluronan fragments act as an endogenous danger signal by engaging TLR2. J Immunol 2006;177:1272–81. [24] Martinon F. Detection of immune danger signals by NALP3. J Leukoc Biol 2008;83:507–11. [25] Adinolfi E, Pizzirani C, Idzko M, Panther E, Norgauer J, Di Virgilio F, et al. P2X(7) receptor: death or life? Purinergic Signal 2005;1:219–27. [26] Sancho D, Joffre OP, Keller AM, Rogers NC, Martinez D, Hernanz-Falcon P, et al. Identification of a dendritic cell receptor that couples sensing of necrosis to immunity. Nature 2009 (Epub). [27] Xu W, Liu LZ, Loizidou M, Ahmed M, Charles IG. The role of nitric oxide in cancer. Cell Res 2002;12:311–20. [28] Persing DH, Coler RN, Lacy MJ, Johnson DA, Baldridge JR, Hershberg RM, et al. Taking toll: lipid A mimetics as adjuvants and immunomodulators. Trends Microbiol 2002;10:S32–37. [29] Babu S, Blauvelt CP, Kumaraswami V, Nutman TB. Cutting edge: diminished T cell TLR expression and function modulates the immune response in human filarial infection. J Immunol 2006;176:3885–9. [30] Pasare C, Medzhitov R. Toll pathway-dependent blockade of CD4+CD25+ T cellmediated suppression by dendritic cells. Science 2003;299:1033–6.