- Email: [email protected]
Pathogenicity and immunosuppressive potential of fowl adenovirus in specific pathogen free chickens
Research Note Pathogenicity and immunosuppressive potential of fowl adenovirus in specific pathogen free chickens Yujuan Niu, Qinqin Sun, Guihua Zhang, Wei Sun, Xingpo Liu, Yihong Xiao, Yingli Shang, and Sidang Liu1 Department of Animal Science and Technology, Shandong Agricultural University, 61 Daizong Road, Tai’an 271018, Shandong, PR China ABSTRACT To elucidate the effect of fowl adenovirus (FAdV)-C in specific-pathogen-free (SPF) chickens, we investigated the pathogenicity, body weights, enzymatic systems, and immune organs of chickens in response to Newcastle disease virus (NDV) and avian influenza virus subtype H9 (AIV-H9) vaccination. Chickens were divided randomly into four groups, which included injection groups (FAdV-C, vaccination, and FAdV-C plus vaccination) and a negative control group. The results indicated that FAdV-C was highly pathogenic in SPF chickens and led to a 40% mortality rate and growth retardation, compared with the
control birds. Significant changes in clinical chemical markers of all infected birds, together with histopathological lesions, indicated impairment of the liver and heart integrity and function. Furthermore, chickens in the FAdV-C plus vaccination group had significantly lower titers of antibodies against NDV and AIV-H9 than the uninfected and vaccinated chickens. The results of this study provide new insights into the pathogenesis of hydropericardium syndrome, a disease that progresses to a metabolic disorder and causes serious growth retardation and immunosuppression.
Key words: fowl adenovirus, growth retardation, immunosuppression, metabolic disorder 2017 Poultry Science 96:3885–3892 http://dx.doi.org/10.3382/ps/pex206
INTRODUCTION Fowl adenoviruses (FAdVs) belong to the genus Aviadenovirus within the family Adenoviridae, and they are further divided into five species (A to E) based on restriction fragment length polymorphisms of the full FAdV genome, and 12 serotypes based on cross neutralization tests (Hess, 2000; McFerran and Smyth, 2000; Benk¨ o et al., 2005; Harrach et al., 2012). To date, most FAdV strains causing hydropericardium syndrome (HPS) belong to FAdV-C serotype 4 (FAdV4) and are highly pathogenic to chickens. It was reported previously that HPS occurs primarily in broilers, although outbreaks have been reported frequently in breeders and layers (Li et al., 2016), which results in substantial economic losses to the poultry industry worldwide because of the sudden and high mortality in young chickens combined with reduced performance among flocks (Balamurugan and Kataria, 2004; Hafez, 2011; Hess, 2013). The previous study has demonstrated that infection with FAdV-D and E field strains significantly affected C 2017 Poultry Science Association Inc. Received February 25, 2017. Accepted September 14, 2017. 1 Corresponding author: [email protected]
the growth, enzymatic systems, and metabolite concentrations of layer chickens (Matos et al., 2016). However, the influence of FAdV-C strain on layers remains unknown. Therefore, the purpose of the present study was to investigate the influence of a virulent FAdV-4 field strain on enzymatic systems and the immune responses of specific-pathogen-free (SPF) White Leghorn Layers (egg-producing chickens).
MATERIALS AND METHODS Ethics Statement This study was approved by the Animal Care and Use Committee of Shandong Agricultural University (permit number: SDAUA-2015-003), and it was performed in accordance with the “Guidelines for Experimental Animals” of the Ministry of Science and Technology (Beijing, China). All the chickens were cared for in accordance with humane procedures.
Virus The FAdV strain used in the present study (SDDM4/15) was isolated from a liver sample of a miscellaneous broiler during a recent HPS outbreak in China,
3885
3886
NIU ET AL.
Table 1. Experimental design and mortality of birds after subcutaneous injection with FAdV isolate. Sampling scheme and mortality on the following days after inoculation Group (7 d)
Adenovirus infection
vaccination (14 d)
A
+
+
B
–
+
C
+
D
Killed birds Dead birds Killed birds Dead birds Killed birds Dead birds Killed birds Dead birds
and genotyping revealed that it belongs to serotype 4 (Niu et al., 2016). The virus was purified and propagated three times in chicken embryos. Polymerase chain reaction (PCR) and reverse transcription–PCR were performed to confirm the absence of contamination by chicken anemia virus and avian reticuloendotheliosis virus, respectively. To titrate the stock virus, the embryo infectious dose was determined using the method of Reed and Muench (1938). Twenty-one SPF chicken embryos were grouped and injected via the yolk sac with different viral dilutions. A viral titer of 103.5 median embryo infectious dose in 0.2 mL was used to inoculation chicks throughout the study.
Animal Trials One hundred and twenty one-day-old SPF layers were divided into four groups (A to D) and housed in separated isolators receiving filtered positive-pressure air. The birds in groups A and C were inoculated subcutaneously with 0.2 mL of SDDM-4/15 at 7 days of age, while the birds in groups B and D were left uninoculated (Table 1). At 14 days of age, the birds in groups A and B were vaccinated subcutaneously with an inactivated vaccine against Newcastle disease virus (NDV) and avian influenza virus subtype H9 (AIV-H9) (Qilu Animal Health Products Co., Ltd., Jinan, China). Ten birds from groups C and D were monitored twice daily and scored for clinical signs for 21 days. Clinical signs were given daily clinical scores: 0, normal; 1, mild depression; 2, severe depression; 3, paralysis/prostration; and 4, death. The body weights of birds in groups C and D were measured every 2 days.
Post–mortem and Histopathological Examination To determine dynamic changes of histopathology, three chickens from groups C and D were bled and euthanized, and then the heart, pancreas, liver, lungs, kidneys, bursa, and thymus were collected at 1, 3, 5, 7, and 9 days post-infection (dpi). Sample tissues were fixed in 4% neutral-buffered formalin, embedded in paraffin blocks, and cut into 4-μm sections, which
1
3
4
5
7
8
9
14
21
No. of birds
– – – – 3 – 3 -
– 1 – – 3 1 3 -
– 4 – –
– 1 – – 3 1 3 -
– – – – 3 – 3 -
– – – –
– – – – 3 1 3 -
– – – – 3 – 3 -
– – – – 3 – 3 -
24
2 -
– -
10 55 31
were stained with hematoxylin and eosin and examined under a light microscope for lesions associated with FAdV infection.
Immunohistochemical Analysis Sections of liver tissue were processed according to standard immunohistochemical (IHC) protocols with minor modifications. Sections were dewaxed in xylene and rehydrated with increasing concentrations of alcohol. Antigens were retrieved by immersing sections in trypsin (0.25%, pH 8.0) for 20 min. To block endogenous peroxidase activity, sections were treated for 30 min with 100% methanol containing 3% hydrogen peroxide. Non-specific binding was blocked by incubation in 1% normal rabbit serum in phosphatebuffered saline. Slides were incubated with prepared polyclonal antibody (1:200) (laboratory preservation) at 4◦ C overnight, reacted with horseradish peroxidaseconjugated anti-rabbit IgG (Solarbio, Beijing, China) for 1 h, and then washed three times with phosphate buffer (0.05 M, pH 7.2). Immunocomplexes were detected using the 3, 3 -diaminobenzidine-enhanced liquid substrate system (TIANamp, Beijing, China), and the sections were counterstained with hematoxylin, dehydrated, and mounted. To evaluate the amount of cell staining and quantity of the target antigen in liver tissue, the images were analyzed with Image Pro-Plus 6.0 analysis software (Media Cybernetics, Inc., Rockville, MD) to obtain the total cross-sectional integrated optical density (IOD) (Rivera et al., 2006).
Observation by Transmission Electron Microscopy and Viral DNA Detection in Liver and Heart Samples The liver and heart samples of the killed and dead chickens from groups C and D were used to determine viral dynamics by transmission electron microscopy (TEM) and PCR. Viral DNA was extracted from 200 μL of homogenized tissue samples using the EasyPure Viral DNA/RNA Kit (TransGen Biotech, Beijing, China) according to the manufacturer’s protocol. PCR was performed as described by Niu et al. (2016).
PATHOGENICITY AND IMMUNOSUPPRESSION OF ADENOVIRUS
Determining the Viral Loads of Serum Samples At 1, 3, 5, 7, 9, 14, and 21 dpi, we collected three serum samples from groups C and D, which were used to determine the dynamics of viremia by quantitative PCR. Total DNA was extracted from 200 μL of serum with Tris–phenol (Solarbio) according to manufacturer’s instructions. The absolute FAdV genomic load in serum was quantified using the following primers specific for FAdV-4: the FAdV forward primer, 5 –GACGGCGGCGCAGGTGACGAAGATT– 3 , and the FAdV reverse primer, 5 –TGAGACT TGGCGAAGCGACCGAGCA–3 . A standard curve was prepared over a 10-fold range of dilutions with comparable reaction efficiencies to estimate the viral copy numbers from the sample cycle threshold values. The standard sample was a plasmid containing a 126-bp fragment of FAdV that was amplified with the primers pair and then cloned into the pCAGGS vector (Invitrogen Corporation, Carlsbad, CA). Seven 10-fold serial dilutions of the plasmid were performed, which produced a range of 1.42 × 102 to 1.42 × 109 plasmid copies per reaction.
Determination of Antibody Responses to NDV and H9-AIV in Hemagglutination Inhibition Tests To determine the immunosuppressive effect of the SDDM-4/15 virus on the antibody response to vaccination, serum samples that were collected from all chickens in group A and B on days 7, 14, and 21 post-vaccination were used to measure the hemagglutination inhibition (HI) antibody titers to NDV and AIV-H9.
Clinical Chemistry Prior to euthanasia, blood was collected from the jugular vein of the birds, and it was transferred into procoagulant-coated tubes. Then, the serum was separated and the values of the following clinical chemical constituents were calculated using an enzyme-linked immunosorbent assay (Enzyme-linked Biotechnology, Shanghai, China): alanine aminotransferase (ALT), lactate dehydrogenase (LDH), and creatine kinase (CK).
Statistical Analysis All data are expressed as the mean ± standard error of the mean. Statistical comparisons were analyzed by independent-sample t tests and one-way analysis of variance using SPSS Statistics for Windows, version 17 (SPSS Inc., Chicago, IL). A probability (P) value of less than 0.05 was considered statistically significant.
3887
RESULTS Clinical Signs, Mortality, Body Weight, and Gross Pathology Chickens inoculated with 103.5 embryo infectious doses of the SDDM-4/15 strain showed depression starting at 2 dpi to 10 dpi, with high clinical scores reached at 4 dpi (Figure 1A). The condition of the SPF chickens downgraded very quickly, and the death commenced at 3 dpi and continued for 6 days. The survival rate of the inoculated chickens was 60%, which was significantly greater than that of the control group D at the end of the observation period (P < 0.05) (Figure 1B). Moreover, the body weights of the inoculated layers were significantly lower at 11 to 21 dpi, compared with the body weights of the control layers (Figure 1C). No clinical signs or mortality were observed in the control group D. During the entire experimental period, the most prominent lesions were severe hepatitis and hydropericardium (Figure 1D) in all dead birds. The kidneys in most dead birds were swollen and pale. In most of the sacrificed chickens from group C, the livers were swollen, pale yellow, and friable with necrotic foci at 1, 3, 5, 7, and 9 dpi. The changes to the heart were variable. Some birds with severe hepatitis exhibited, a flabby heart with slight or severe hydropericardium. In other birds with slight hepatitis, there was no hydropericardium, although the kidneys were enlarged and pale with prominent tubules. No significant gross lesions were found in the counterpart tissues of the uninoculated control birds in group D.
Histological and IHC Analyses At 1 dpi, no characteristic macroscopic lesions were observed in any of the organs in group C. The most severe histological changes in the infected birds were recorded at 3 to 7 dpi, when large, basophilic intranuclear inclusion bodies were found in the hepatocytes and acinar cells of the liver and pancreas, respectively, together with large areas of cellular degeneration and necrosis. Meanwhile, areas of macrophage and lymphocyte infiltration were observed among myocardial fibers. Severe hyperemia and massive degeneration of the epithelium in all renal tubules and serious congestion and edema in the lung were also found. Lymphocyte depletion in the medullary area of the bursa of Fabricius and thymus were observed. At 9 dpi, the numbers of large intranuclear inclusion bodies decreased and lesions in the other organs were mild. The localization and amount of FAdV in the liver was evaluated by an IHC analysis, which showed that the FAdV-4 antigen was detected primarily in the nucleus and rarely in the cytoplasm of infected hepatocytes. Moreover, the presence of the virus was not limited to a specific site, as it was also found in the portal or central vein areas of the hepatic lobule. At 1 dpi, there
3888
NIU ET AL.
Figure 1. The clinical indices of chickens after inoculation with FAdV SDDM-4/15 strain. (A) Clinical scoring: 0, normal; 1, mild depression; 2, severe depression; 3, paralysis/prostration; and 4, death. The mean scores per group per day are shown. (B) The percentages of birds that survived in the infected groups were significantly lower than that in the control group. (C) Mean differences in body weights (%) of infected birds compared with the control group D, at 1, 3, 5, 7, 9, 11, 13, 5, 17, 19, and 21 dpi. The error bars indicate standard deviations. Asterisks indicate statistical significant difference (P < 0.05). (D) A swollen and friable liver with multifocal areas of necrosis and petechial hemorrhage, and a misshapen and flabby heart with the accumulation of clear, watery, or jelly-like fluid in the pericardial sac (arrow).
was no immunoreactivity. At 3, 5, and 7 dpi, there were a greater number of FAdV-4 antigen immunoreactive positive cells. At 9 dpi, staining of the immunoreactive positive cells was much weaker (Figure 2A). Based on image processing, the IOD of FAdV-4 immunoreactivity of the infected group C was greater than that of the control group D at 3 and 5 dpi. Then at 7 and 9 dpi, the IOD decreased (Figure 2B).
TEM and Viral DNA Detection in the Liver and Heart Viral DNA and particles in the liver and heart were detected by PCR and TEM, respectively. The results are summarized in Table 2. In group C, viral DNA was detected in all the livers or hearts (10/10, 100%) samples collected from the dead chickens. For the noninfected chickens in the group D, no virus particles were observed in the cytoplasm and nuclei of liver cells and cardiomyocytes, and the nuclear membranes were intact (Figure 3A and C). At 1 dpi, no viral DNA or particles were detected in the liver or heart. At 5 dpi, all (3/3, 100%) of the liver samples collected from the sacrificed chickens were positive for viral DNA and particles (Figure 3B), while all (3/3, 100%) of the heart samples only possessed viral DNA not particles (Figure 3D). Subsequently, the viral DNA- positive rate decreased. At 7 dpi, viral DNA could not be detected in the heart (0/3), only in the liver (2/3), and viral
particles were found in one liver sample (1/3). At 9 dpi, viral DNA was only detected in one liver sample (1/3), but no viral particles were observed by electron microscopy (0/3).
Viral Load During the experimental period, viremia increased and peaked in 3 dpi. Then, the viral titer began to decrease until 21 dpi (Figure 4).
Influence of FAdV Infection on HI Antibody Titers to NDV and AIV-H9 after Vaccination As shown in Figure 5, at day 7 post immunization, there was no significant difference (P > 0.05) in the humoral response against inactivated NDV and AIV-H9 vaccines between the FAdV-infected plus vaccination group A and the control group B; however, at days 7 and 21 post immunization, the group A exhibited significantly lower (P < 0.05) titers than the control group B.
Clinical Chemistry The clinical chemistry results are presented in Figure 6. At 1 to 5 dpi, the level of the liver enzyme, ALT in serum from the group C chickens was significantly higher than that of the serum from the control group D
3889
PATHOGENICITY AND IMMUNOSUPPRESSION OF ADENOVIRUS
Figure 2. The localization and amount of FAdV-4 in the liver. (A) Dynamic change of FAdV-4 immunoreactive positive cells at 1, 3, 5, 7, and 9 dpi and the enlarged immunoreactive positive cells in the top left corner at 7 dpi (IHC, original magnification, 400×). (B) The IOD of FAdV-4 immunostaining in the liver at 1, 3, 5, 7, and 9 dpi.
Table 2. Dynamic changes of virus in heart and liver. Detection in virus from collected tissues1 1 dpi
3 dpi
5 dpi
7 dpi
9 dpi
Group
Methods
Birds
Heart
Liver
Heart
Liver
Heart
Liver
Heart
Liver
Heart
Liver
C
PCR
D
TEM PCR TEM
Killed Died Killed Killed Killed
0/3 – 0/3 0/3 0/3
0/3 – 0/3 0/3 0/3
2/3 1/1 0/3 0/3 0/3
2/3 1/1 2/3 0/3 0/3
3/3 3/3 0/3 0/3 0/3
3/3 3/3 3/3 0/3 0/3
0/3 – 0/3 0/3 0/3
2/3 – 1/3 0/3 0/3
0/3 1/1 0/3 0/3 0/3
1/3 1/1 0/3 0/3 0/3
1 Tissue samples from the euthanized and dead birds at 1, 3, 5, 7, and 9 dpi were examined by PCR and TEM methods. Data are number of positive samples/number of tested samples.
chickens. At 7 dpi, high value of ALT was also seen in group C, although there was no significant difference with the control group D. Measurements of the heart enzymes, LDH and CK, were significantly higher at 1 to 7 dpi in the group C than in the control group D. In addition, at 9 dpi, high value of CK was also seen in group C, although no significant difference was observed.
DISCUSSION FAdV-4 infection has been very common in commercial layers flocks in China since 2015 (Zhao et al., 2015; Li et al., 2016). FAdV-4 can cause HPS characterized by high mortality rates (20 to 70%), which results in severe economic losses (Hess et al., 1999; Ganesh and
3890
NIU ET AL.
Figure 3. Detection of viral particles by TEM. (A) Lack of viral particles in the cytoplasm and nucleus of a non-infected liver cell, intact nuclear membrane (TEM, original magnification, 15,000×). (B) Latticed viral particles (70-nm) in the liver nuclei of an infected chicken (TEM, original magnification, 15,000×) and the top right corner (TEM, original magnification, 60,000×). (C and D) No viral particles were observed in the cardiomyocytes of non-infection and infected chickens (TEM, original magnification, 15,000×).
Figure 4. Viral load in serum. Fold changes of viral loads in the serum increased and peaked at 3 dpi and then decreased until 21 dpi.
Raghavan, 2000; Balamurugan et al., 2002; Asthana et al., 2013; Kajan et al., 2013; Kim et al., 2014). The aim of the present study was to assess and elucidate the influence of SDDM-4/15 on SPF layers at different
times after infection. The pathogenicity of the FAdV-C strain SDDM-4/15 in chickens was determined by observing clinical signs, mortality, body weight, and gross pathology. The results demonstrated that the isolate had high pathogenicity in SPF layers and led to 40% mortality and growth retardation, compared with the control birds throughout the experimental period. The course of the disease is usually 10 to 14 days. The peak period of death appeared at 3 to 7 dpi (Figure 1A and B), marked by severe pathological lesions. Meanwhile, the viral load of the liver, heart, and serum were highest at 3 to 7 dpi (Table 2, Figures 2 and 4). Theoretically, severe lesions in the liver and heart may contribute to disturbances in enzyme homeostasis (Figure 6). Therefore, the blood ALT, LDH, and CK concentrations were determined throughout the study, as ALT metabolism is a good indicator of liver functions, and LDH and CK metabolism are good indicators of heart functions. Under normal conditions, the concentration of these three enzymes in serum is very low; however, once liver cells or cardiac muscle cells are damaged, their contents will rise sharply. It was shown that the pathogenic FAdV strain is capable of interfering with enzymatic systems related to the liver and heart. The results of the present study showed a link among the viral load in target organs with histopathological and macroscopic lesions, clinical chemistry, and clinical signs during the experimental period.
PATHOGENICITY AND IMMUNOSUPPRESSION OF ADENOVIRUS
3891
Figure 5. Influence of FAdV-4 infection on HI antibody titers to NDV and AIV-H9 post-vaccination in SPF chickens (Log2). The antibody titers of NDV and AIV-H9 in group A were similar to those in group B on day 7 post-vaccination (P > 0.05). Later, the HI titers of NDV and AIV-H9 were significantly weaker in group A than in group B on days 14 and 21 post-vaccination (P < 0.05). Asterisks indicate statistically significant differences (P < 0.05).
Figure 6. Clinical chemistry analyses. Means and standard deviations of blood ALT, LDH, and CK concentrations from groups C and D at 1, 3, 5, 7, 9, 14, and 21 dpi. Asterisks indicate statistically significant differences (P < 0.05).
Interestingly, immunoreactivity in the myocardial fibers was not strong and no viral particles were observed by TEM (Figure 3B). However, the pathological changes were very typical. In comparison, FAdV induces inclusion body hepatitis, which rarely affects the heart (Matos et al., 2016). Thus, further studies would be of interest to fully address this issue as the mechanism underlying the pathogenicity of HPS-associated FAdV has not yet been investigated thoroughly. In addition, there was no evidence of the presence of HPS-associated FAdV in the lymphoid organs or its involvement as an immunosuppressive agent in the layers. In this study, we presented a systematic and indepth analysis of growth retardation and immunosuppression of layer chickens infected with FAdV-4. This
results showed that chickens infected with FAdV-4 experienced not only much more severe growth retardation and mortality, but also greater inhibition of antibody responses to inactivated vaccines against NDV and AIV-H9 than was observed in control the group B (Figure 4). In combination with the histopathological changes to the lymphoid organs, there is no doubt that FAdV-4 infection can suppress the humoral immune response. However, its impact on cellular immunity needs to be validated. In conclusion, this is the first study to report the influence of FAdV-4 on SPF layers and the proliferation of the virus in vivo, and its effect on enzyme homeostasis. Therefore, we propose that FAdV infections could lead to greater organ damage and metabolic disorders at 3
3892
NIU ET AL.
to 7 dpi, in which severe lesions in the liver and heart seemed to play an important role. Nevertheless, further studies are needed to better understand the pathogenic mechanism of HPS in chickens, as well as the reason for the characteristic pathological changes of the liver and heart caused by FAdV-4.
ACKNOWLEDGMENTS We thank the staff of Jinan Weiya Biotechnology Cfo., Ltd., Shandong, China, for performing transmission electron microscopy. This research did not receive any specific grant from funding agencies in the public, commercial, or not-for-profit sectors.
REFERENCES Asthana, M., R. Chandra, and R. Kumar. 2013. Hydropericardium syndrome: current state and future developments. Arch. Virol. 158:921–931. Balamurugan, V., and J. M. Kataria. 2004. The hydropericardium syndrome in poultry—A current scenario. Vet. Res. Commun. 28:127–148. Balamurugan, V., J. Kataria, R. Kataria, K. Verma, and T. Nanthakumar. 2002. Characterization of fowl adenovirus serotype-4 associated with hydropericardium syndrome in chicken. Comp. Immunol. Microbiol. Infect. Dis. 25:139–147. ´ Ad´ ´ am, C. Benk¨o, M., B. Harrach, G. Both, W. Russell, B. Adair, E. de Jong, M. Hess, M. Johnson, A. Kajon, A. Kidd, H. Lehmkuhl, Q. Li, V. Mautner, P. Pring-Akerblom, and G. Wadell. 2005. The Virus Taxonomy, VIIIth, ed. Pages 213–228 in Adenoviridae. C. Fauquet, ed. Academic Press, London. Ganesh, K., and R. Raghavan. 2000. Hydropericardium hepatitis syndrome of broiler poultry: current status of research. Res. Vet. Sci. 68:201–206. Hafez, H. 2011. Avian adenoviruses infections with special attention to inclusion body hepatitis/ hydropericardium syndrome and egg drop syndrome. Pak. Vet. J. 31:85–92. Harrach, B., M. Benk¨ o, G. Both, M. Brown, A. Davison, M. Echavarria, M. Hess, M. Jones, A. Kajon, H. Lehmkuhl, V. Mautner, S. Mittal, and G. Wadell. 2012. The Committtee Taxon. Viruses,
9th, ed. Pages 125–141 in Family Adenoviridae. A. King, ed. Academic Press, New York. Hess, M. 2000. Detection and differentiation of avian adenoviruses: A review. Avian Pathol. 29:195–206. Hess, M. 2013. The Diseases of Poultry 13th, ed. Pages 290–300 in Aviadenovirus infections. J. Glisson, ed. Wiley Black well, Ames, IA. Hess, M., R. Raue, and C. Prusas. 1999. Epidemiological studies on fowl adenoviruses isolated from cases of infectious hydropericardium. Avian Pathol. 28:433–439. Kajan, G., S. Kecskemeti, B. Harrach, and M. Benko. 2013. Molecular typing of fowl adenoviruses, isolated in Hungary recently, reveals high diversity. Vet. Microbiol. 167:357–363. Kim, M., T. Lim, D. Lee, H. Youn, S. Yuk, B. Kim, S. Choi, C. Jung, J. Han, and C. Song. 2014. An inactivated oilemulsion fowl adenovirus serotype 4 vaccine provides broad crossprotection against various serotypes of fowl adenovirus. Vaccine 32:3564–3568. Li, H., J. Wang, L. Qiu, Z. Han, and S. Liu. 2016. Fowl adenovirus species C serotype 4 is attributed to the emergence of hepatitishydropericardium syndrome in chickens in China. Infection Genetics Evolution 45:230–241. Matos, M., B. Grafl, D. Liebhart, and M. Hess. 2016. The outcome of experimentally induced inclusion body hepatitis (IBH) by fowl aviadenoviruses (FAdVs) is crucially influenced by the genetic background of the host. Veterinary Research 47:1–10. McFerran, J., and J. Smyth. 2000. Avian adenoviruses. Rev. Sci. Tech. 19:589–601. Niu, Y., W. Sun, G. Zhang, Y. Qu, P. Wang, H. Sun, L. Wang, Y. Xiao, and S. Liu. 2016. Hydropericardium syndrome outbreak caused by fowl adenovirus serotype 4 in China in 2015. Journal of General Virology 97:2684–2690. Reed, L., and H. Muench. 1938. A simple method of estimating fifty per cent endpoints. Am. J. Hyg. 27:493–497. Rivera, A., L. Agnati, T. Horvath, J. Valderrama, A. de La Calle, and K. Fuxe. 2006. Uncoupling protein 2/3 immunoreactivity and the ascending dopaminergic and noradrenergic neuronal systems: relevance for volume transmission. Neuroscience 137:1447–1461. Zhao, J., Q. Zhong, Y. Zhao, Y. Hu, and G. Zhang. 2015. Pathogenicity and complete genome characterization of fowl adenoviruses isolated from chickens associated with inclusion body hepatitis and hydropericardium syndrome in China. PLoS One 10:e0133073.
control birds. Significant changes in clinical chemical markers of all infected birds, together with histopathological lesions, indicated impairment of the liver and heart integrity and function. Furthermore, chickens in the FAdV-C plus vaccination group had significantly lower titers of antibodies against NDV and AIV-H9 than the uninfected and vaccinated chickens. The results of this study provide new insights into the pathogenesis of hydropericardium syndrome, a disease that progresses to a metabolic disorder and causes serious growth retardation and immunosuppression.
Key words: fowl adenovirus, growth retardation, immunosuppression, metabolic disorder 2017 Poultry Science 96:3885–3892 http://dx.doi.org/10.3382/ps/pex206
INTRODUCTION Fowl adenoviruses (FAdVs) belong to the genus Aviadenovirus within the family Adenoviridae, and they are further divided into five species (A to E) based on restriction fragment length polymorphisms of the full FAdV genome, and 12 serotypes based on cross neutralization tests (Hess, 2000; McFerran and Smyth, 2000; Benk¨ o et al., 2005; Harrach et al., 2012). To date, most FAdV strains causing hydropericardium syndrome (HPS) belong to FAdV-C serotype 4 (FAdV4) and are highly pathogenic to chickens. It was reported previously that HPS occurs primarily in broilers, although outbreaks have been reported frequently in breeders and layers (Li et al., 2016), which results in substantial economic losses to the poultry industry worldwide because of the sudden and high mortality in young chickens combined with reduced performance among flocks (Balamurugan and Kataria, 2004; Hafez, 2011; Hess, 2013). The previous study has demonstrated that infection with FAdV-D and E field strains significantly affected C 2017 Poultry Science Association Inc. Received February 25, 2017. Accepted September 14, 2017. 1 Corresponding author: [email protected]
the growth, enzymatic systems, and metabolite concentrations of layer chickens (Matos et al., 2016). However, the influence of FAdV-C strain on layers remains unknown. Therefore, the purpose of the present study was to investigate the influence of a virulent FAdV-4 field strain on enzymatic systems and the immune responses of specific-pathogen-free (SPF) White Leghorn Layers (egg-producing chickens).
MATERIALS AND METHODS Ethics Statement This study was approved by the Animal Care and Use Committee of Shandong Agricultural University (permit number: SDAUA-2015-003), and it was performed in accordance with the “Guidelines for Experimental Animals” of the Ministry of Science and Technology (Beijing, China). All the chickens were cared for in accordance with humane procedures.
Virus The FAdV strain used in the present study (SDDM4/15) was isolated from a liver sample of a miscellaneous broiler during a recent HPS outbreak in China,
3885
3886
NIU ET AL.
Table 1. Experimental design and mortality of birds after subcutaneous injection with FAdV isolate. Sampling scheme and mortality on the following days after inoculation Group (7 d)
Adenovirus infection
vaccination (14 d)
A
+
+
B
–
+
C
+
D
Killed birds Dead birds Killed birds Dead birds Killed birds Dead birds Killed birds Dead birds
and genotyping revealed that it belongs to serotype 4 (Niu et al., 2016). The virus was purified and propagated three times in chicken embryos. Polymerase chain reaction (PCR) and reverse transcription–PCR were performed to confirm the absence of contamination by chicken anemia virus and avian reticuloendotheliosis virus, respectively. To titrate the stock virus, the embryo infectious dose was determined using the method of Reed and Muench (1938). Twenty-one SPF chicken embryos were grouped and injected via the yolk sac with different viral dilutions. A viral titer of 103.5 median embryo infectious dose in 0.2 mL was used to inoculation chicks throughout the study.
Animal Trials One hundred and twenty one-day-old SPF layers were divided into four groups (A to D) and housed in separated isolators receiving filtered positive-pressure air. The birds in groups A and C were inoculated subcutaneously with 0.2 mL of SDDM-4/15 at 7 days of age, while the birds in groups B and D were left uninoculated (Table 1). At 14 days of age, the birds in groups A and B were vaccinated subcutaneously with an inactivated vaccine against Newcastle disease virus (NDV) and avian influenza virus subtype H9 (AIV-H9) (Qilu Animal Health Products Co., Ltd., Jinan, China). Ten birds from groups C and D were monitored twice daily and scored for clinical signs for 21 days. Clinical signs were given daily clinical scores: 0, normal; 1, mild depression; 2, severe depression; 3, paralysis/prostration; and 4, death. The body weights of birds in groups C and D were measured every 2 days.
Post–mortem and Histopathological Examination To determine dynamic changes of histopathology, three chickens from groups C and D were bled and euthanized, and then the heart, pancreas, liver, lungs, kidneys, bursa, and thymus were collected at 1, 3, 5, 7, and 9 days post-infection (dpi). Sample tissues were fixed in 4% neutral-buffered formalin, embedded in paraffin blocks, and cut into 4-μm sections, which
1
3
4
5
7
8
9
14
21
No. of birds
– – – – 3 – 3 -
– 1 – – 3 1 3 -
– 4 – –
– 1 – – 3 1 3 -
– – – – 3 – 3 -
– – – –
– – – – 3 1 3 -
– – – – 3 – 3 -
– – – – 3 – 3 -
24
2 -
– -
10 55 31
were stained with hematoxylin and eosin and examined under a light microscope for lesions associated with FAdV infection.
Immunohistochemical Analysis Sections of liver tissue were processed according to standard immunohistochemical (IHC) protocols with minor modifications. Sections were dewaxed in xylene and rehydrated with increasing concentrations of alcohol. Antigens were retrieved by immersing sections in trypsin (0.25%, pH 8.0) for 20 min. To block endogenous peroxidase activity, sections were treated for 30 min with 100% methanol containing 3% hydrogen peroxide. Non-specific binding was blocked by incubation in 1% normal rabbit serum in phosphatebuffered saline. Slides were incubated with prepared polyclonal antibody (1:200) (laboratory preservation) at 4◦ C overnight, reacted with horseradish peroxidaseconjugated anti-rabbit IgG (Solarbio, Beijing, China) for 1 h, and then washed three times with phosphate buffer (0.05 M, pH 7.2). Immunocomplexes were detected using the 3, 3 -diaminobenzidine-enhanced liquid substrate system (TIANamp, Beijing, China), and the sections were counterstained with hematoxylin, dehydrated, and mounted. To evaluate the amount of cell staining and quantity of the target antigen in liver tissue, the images were analyzed with Image Pro-Plus 6.0 analysis software (Media Cybernetics, Inc., Rockville, MD) to obtain the total cross-sectional integrated optical density (IOD) (Rivera et al., 2006).
Observation by Transmission Electron Microscopy and Viral DNA Detection in Liver and Heart Samples The liver and heart samples of the killed and dead chickens from groups C and D were used to determine viral dynamics by transmission electron microscopy (TEM) and PCR. Viral DNA was extracted from 200 μL of homogenized tissue samples using the EasyPure Viral DNA/RNA Kit (TransGen Biotech, Beijing, China) according to the manufacturer’s protocol. PCR was performed as described by Niu et al. (2016).
PATHOGENICITY AND IMMUNOSUPPRESSION OF ADENOVIRUS
Determining the Viral Loads of Serum Samples At 1, 3, 5, 7, 9, 14, and 21 dpi, we collected three serum samples from groups C and D, which were used to determine the dynamics of viremia by quantitative PCR. Total DNA was extracted from 200 μL of serum with Tris–phenol (Solarbio) according to manufacturer’s instructions. The absolute FAdV genomic load in serum was quantified using the following primers specific for FAdV-4: the FAdV forward primer, 5 –GACGGCGGCGCAGGTGACGAAGATT– 3 , and the FAdV reverse primer, 5 –TGAGACT TGGCGAAGCGACCGAGCA–3 . A standard curve was prepared over a 10-fold range of dilutions with comparable reaction efficiencies to estimate the viral copy numbers from the sample cycle threshold values. The standard sample was a plasmid containing a 126-bp fragment of FAdV that was amplified with the primers pair and then cloned into the pCAGGS vector (Invitrogen Corporation, Carlsbad, CA). Seven 10-fold serial dilutions of the plasmid were performed, which produced a range of 1.42 × 102 to 1.42 × 109 plasmid copies per reaction.
Determination of Antibody Responses to NDV and H9-AIV in Hemagglutination Inhibition Tests To determine the immunosuppressive effect of the SDDM-4/15 virus on the antibody response to vaccination, serum samples that were collected from all chickens in group A and B on days 7, 14, and 21 post-vaccination were used to measure the hemagglutination inhibition (HI) antibody titers to NDV and AIV-H9.
Clinical Chemistry Prior to euthanasia, blood was collected from the jugular vein of the birds, and it was transferred into procoagulant-coated tubes. Then, the serum was separated and the values of the following clinical chemical constituents were calculated using an enzyme-linked immunosorbent assay (Enzyme-linked Biotechnology, Shanghai, China): alanine aminotransferase (ALT), lactate dehydrogenase (LDH), and creatine kinase (CK).
Statistical Analysis All data are expressed as the mean ± standard error of the mean. Statistical comparisons were analyzed by independent-sample t tests and one-way analysis of variance using SPSS Statistics for Windows, version 17 (SPSS Inc., Chicago, IL). A probability (P) value of less than 0.05 was considered statistically significant.
3887
RESULTS Clinical Signs, Mortality, Body Weight, and Gross Pathology Chickens inoculated with 103.5 embryo infectious doses of the SDDM-4/15 strain showed depression starting at 2 dpi to 10 dpi, with high clinical scores reached at 4 dpi (Figure 1A). The condition of the SPF chickens downgraded very quickly, and the death commenced at 3 dpi and continued for 6 days. The survival rate of the inoculated chickens was 60%, which was significantly greater than that of the control group D at the end of the observation period (P < 0.05) (Figure 1B). Moreover, the body weights of the inoculated layers were significantly lower at 11 to 21 dpi, compared with the body weights of the control layers (Figure 1C). No clinical signs or mortality were observed in the control group D. During the entire experimental period, the most prominent lesions were severe hepatitis and hydropericardium (Figure 1D) in all dead birds. The kidneys in most dead birds were swollen and pale. In most of the sacrificed chickens from group C, the livers were swollen, pale yellow, and friable with necrotic foci at 1, 3, 5, 7, and 9 dpi. The changes to the heart were variable. Some birds with severe hepatitis exhibited, a flabby heart with slight or severe hydropericardium. In other birds with slight hepatitis, there was no hydropericardium, although the kidneys were enlarged and pale with prominent tubules. No significant gross lesions were found in the counterpart tissues of the uninoculated control birds in group D.
Histological and IHC Analyses At 1 dpi, no characteristic macroscopic lesions were observed in any of the organs in group C. The most severe histological changes in the infected birds were recorded at 3 to 7 dpi, when large, basophilic intranuclear inclusion bodies were found in the hepatocytes and acinar cells of the liver and pancreas, respectively, together with large areas of cellular degeneration and necrosis. Meanwhile, areas of macrophage and lymphocyte infiltration were observed among myocardial fibers. Severe hyperemia and massive degeneration of the epithelium in all renal tubules and serious congestion and edema in the lung were also found. Lymphocyte depletion in the medullary area of the bursa of Fabricius and thymus were observed. At 9 dpi, the numbers of large intranuclear inclusion bodies decreased and lesions in the other organs were mild. The localization and amount of FAdV in the liver was evaluated by an IHC analysis, which showed that the FAdV-4 antigen was detected primarily in the nucleus and rarely in the cytoplasm of infected hepatocytes. Moreover, the presence of the virus was not limited to a specific site, as it was also found in the portal or central vein areas of the hepatic lobule. At 1 dpi, there
3888
NIU ET AL.
Figure 1. The clinical indices of chickens after inoculation with FAdV SDDM-4/15 strain. (A) Clinical scoring: 0, normal; 1, mild depression; 2, severe depression; 3, paralysis/prostration; and 4, death. The mean scores per group per day are shown. (B) The percentages of birds that survived in the infected groups were significantly lower than that in the control group. (C) Mean differences in body weights (%) of infected birds compared with the control group D, at 1, 3, 5, 7, 9, 11, 13, 5, 17, 19, and 21 dpi. The error bars indicate standard deviations. Asterisks indicate statistical significant difference (P < 0.05). (D) A swollen and friable liver with multifocal areas of necrosis and petechial hemorrhage, and a misshapen and flabby heart with the accumulation of clear, watery, or jelly-like fluid in the pericardial sac (arrow).
was no immunoreactivity. At 3, 5, and 7 dpi, there were a greater number of FAdV-4 antigen immunoreactive positive cells. At 9 dpi, staining of the immunoreactive positive cells was much weaker (Figure 2A). Based on image processing, the IOD of FAdV-4 immunoreactivity of the infected group C was greater than that of the control group D at 3 and 5 dpi. Then at 7 and 9 dpi, the IOD decreased (Figure 2B).
TEM and Viral DNA Detection in the Liver and Heart Viral DNA and particles in the liver and heart were detected by PCR and TEM, respectively. The results are summarized in Table 2. In group C, viral DNA was detected in all the livers or hearts (10/10, 100%) samples collected from the dead chickens. For the noninfected chickens in the group D, no virus particles were observed in the cytoplasm and nuclei of liver cells and cardiomyocytes, and the nuclear membranes were intact (Figure 3A and C). At 1 dpi, no viral DNA or particles were detected in the liver or heart. At 5 dpi, all (3/3, 100%) of the liver samples collected from the sacrificed chickens were positive for viral DNA and particles (Figure 3B), while all (3/3, 100%) of the heart samples only possessed viral DNA not particles (Figure 3D). Subsequently, the viral DNA- positive rate decreased. At 7 dpi, viral DNA could not be detected in the heart (0/3), only in the liver (2/3), and viral
particles were found in one liver sample (1/3). At 9 dpi, viral DNA was only detected in one liver sample (1/3), but no viral particles were observed by electron microscopy (0/3).
Viral Load During the experimental period, viremia increased and peaked in 3 dpi. Then, the viral titer began to decrease until 21 dpi (Figure 4).
Influence of FAdV Infection on HI Antibody Titers to NDV and AIV-H9 after Vaccination As shown in Figure 5, at day 7 post immunization, there was no significant difference (P > 0.05) in the humoral response against inactivated NDV and AIV-H9 vaccines between the FAdV-infected plus vaccination group A and the control group B; however, at days 7 and 21 post immunization, the group A exhibited significantly lower (P < 0.05) titers than the control group B.
Clinical Chemistry The clinical chemistry results are presented in Figure 6. At 1 to 5 dpi, the level of the liver enzyme, ALT in serum from the group C chickens was significantly higher than that of the serum from the control group D
3889
PATHOGENICITY AND IMMUNOSUPPRESSION OF ADENOVIRUS
Figure 2. The localization and amount of FAdV-4 in the liver. (A) Dynamic change of FAdV-4 immunoreactive positive cells at 1, 3, 5, 7, and 9 dpi and the enlarged immunoreactive positive cells in the top left corner at 7 dpi (IHC, original magnification, 400×). (B) The IOD of FAdV-4 immunostaining in the liver at 1, 3, 5, 7, and 9 dpi.
Table 2. Dynamic changes of virus in heart and liver. Detection in virus from collected tissues1 1 dpi
3 dpi
5 dpi
7 dpi
9 dpi
Group
Methods
Birds
Heart
Liver
Heart
Liver
Heart
Liver
Heart
Liver
Heart
Liver
C
PCR
D
TEM PCR TEM
Killed Died Killed Killed Killed
0/3 – 0/3 0/3 0/3
0/3 – 0/3 0/3 0/3
2/3 1/1 0/3 0/3 0/3
2/3 1/1 2/3 0/3 0/3
3/3 3/3 0/3 0/3 0/3
3/3 3/3 3/3 0/3 0/3
0/3 – 0/3 0/3 0/3
2/3 – 1/3 0/3 0/3
0/3 1/1 0/3 0/3 0/3
1/3 1/1 0/3 0/3 0/3
1 Tissue samples from the euthanized and dead birds at 1, 3, 5, 7, and 9 dpi were examined by PCR and TEM methods. Data are number of positive samples/number of tested samples.
chickens. At 7 dpi, high value of ALT was also seen in group C, although there was no significant difference with the control group D. Measurements of the heart enzymes, LDH and CK, were significantly higher at 1 to 7 dpi in the group C than in the control group D. In addition, at 9 dpi, high value of CK was also seen in group C, although no significant difference was observed.
DISCUSSION FAdV-4 infection has been very common in commercial layers flocks in China since 2015 (Zhao et al., 2015; Li et al., 2016). FAdV-4 can cause HPS characterized by high mortality rates (20 to 70%), which results in severe economic losses (Hess et al., 1999; Ganesh and
3890
NIU ET AL.
Figure 3. Detection of viral particles by TEM. (A) Lack of viral particles in the cytoplasm and nucleus of a non-infected liver cell, intact nuclear membrane (TEM, original magnification, 15,000×). (B) Latticed viral particles (70-nm) in the liver nuclei of an infected chicken (TEM, original magnification, 15,000×) and the top right corner (TEM, original magnification, 60,000×). (C and D) No viral particles were observed in the cardiomyocytes of non-infection and infected chickens (TEM, original magnification, 15,000×).
Figure 4. Viral load in serum. Fold changes of viral loads in the serum increased and peaked at 3 dpi and then decreased until 21 dpi.
Raghavan, 2000; Balamurugan et al., 2002; Asthana et al., 2013; Kajan et al., 2013; Kim et al., 2014). The aim of the present study was to assess and elucidate the influence of SDDM-4/15 on SPF layers at different
times after infection. The pathogenicity of the FAdV-C strain SDDM-4/15 in chickens was determined by observing clinical signs, mortality, body weight, and gross pathology. The results demonstrated that the isolate had high pathogenicity in SPF layers and led to 40% mortality and growth retardation, compared with the control birds throughout the experimental period. The course of the disease is usually 10 to 14 days. The peak period of death appeared at 3 to 7 dpi (Figure 1A and B), marked by severe pathological lesions. Meanwhile, the viral load of the liver, heart, and serum were highest at 3 to 7 dpi (Table 2, Figures 2 and 4). Theoretically, severe lesions in the liver and heart may contribute to disturbances in enzyme homeostasis (Figure 6). Therefore, the blood ALT, LDH, and CK concentrations were determined throughout the study, as ALT metabolism is a good indicator of liver functions, and LDH and CK metabolism are good indicators of heart functions. Under normal conditions, the concentration of these three enzymes in serum is very low; however, once liver cells or cardiac muscle cells are damaged, their contents will rise sharply. It was shown that the pathogenic FAdV strain is capable of interfering with enzymatic systems related to the liver and heart. The results of the present study showed a link among the viral load in target organs with histopathological and macroscopic lesions, clinical chemistry, and clinical signs during the experimental period.
PATHOGENICITY AND IMMUNOSUPPRESSION OF ADENOVIRUS
3891
Figure 5. Influence of FAdV-4 infection on HI antibody titers to NDV and AIV-H9 post-vaccination in SPF chickens (Log2). The antibody titers of NDV and AIV-H9 in group A were similar to those in group B on day 7 post-vaccination (P > 0.05). Later, the HI titers of NDV and AIV-H9 were significantly weaker in group A than in group B on days 14 and 21 post-vaccination (P < 0.05). Asterisks indicate statistically significant differences (P < 0.05).
Figure 6. Clinical chemistry analyses. Means and standard deviations of blood ALT, LDH, and CK concentrations from groups C and D at 1, 3, 5, 7, 9, 14, and 21 dpi. Asterisks indicate statistically significant differences (P < 0.05).
Interestingly, immunoreactivity in the myocardial fibers was not strong and no viral particles were observed by TEM (Figure 3B). However, the pathological changes were very typical. In comparison, FAdV induces inclusion body hepatitis, which rarely affects the heart (Matos et al., 2016). Thus, further studies would be of interest to fully address this issue as the mechanism underlying the pathogenicity of HPS-associated FAdV has not yet been investigated thoroughly. In addition, there was no evidence of the presence of HPS-associated FAdV in the lymphoid organs or its involvement as an immunosuppressive agent in the layers. In this study, we presented a systematic and indepth analysis of growth retardation and immunosuppression of layer chickens infected with FAdV-4. This
results showed that chickens infected with FAdV-4 experienced not only much more severe growth retardation and mortality, but also greater inhibition of antibody responses to inactivated vaccines against NDV and AIV-H9 than was observed in control the group B (Figure 4). In combination with the histopathological changes to the lymphoid organs, there is no doubt that FAdV-4 infection can suppress the humoral immune response. However, its impact on cellular immunity needs to be validated. In conclusion, this is the first study to report the influence of FAdV-4 on SPF layers and the proliferation of the virus in vivo, and its effect on enzyme homeostasis. Therefore, we propose that FAdV infections could lead to greater organ damage and metabolic disorders at 3
3892
NIU ET AL.
to 7 dpi, in which severe lesions in the liver and heart seemed to play an important role. Nevertheless, further studies are needed to better understand the pathogenic mechanism of HPS in chickens, as well as the reason for the characteristic pathological changes of the liver and heart caused by FAdV-4.
ACKNOWLEDGMENTS We thank the staff of Jinan Weiya Biotechnology Cfo., Ltd., Shandong, China, for performing transmission electron microscopy. This research did not receive any specific grant from funding agencies in the public, commercial, or not-for-profit sectors.
REFERENCES Asthana, M., R. Chandra, and R. Kumar. 2013. Hydropericardium syndrome: current state and future developments. Arch. Virol. 158:921–931. Balamurugan, V., and J. M. Kataria. 2004. The hydropericardium syndrome in poultry—A current scenario. Vet. Res. Commun. 28:127–148. Balamurugan, V., J. Kataria, R. Kataria, K. Verma, and T. Nanthakumar. 2002. Characterization of fowl adenovirus serotype-4 associated with hydropericardium syndrome in chicken. Comp. Immunol. Microbiol. Infect. Dis. 25:139–147. ´ Ad´ ´ am, C. Benk¨o, M., B. Harrach, G. Both, W. Russell, B. Adair, E. de Jong, M. Hess, M. Johnson, A. Kajon, A. Kidd, H. Lehmkuhl, Q. Li, V. Mautner, P. Pring-Akerblom, and G. Wadell. 2005. The Virus Taxonomy, VIIIth, ed. Pages 213–228 in Adenoviridae. C. Fauquet, ed. Academic Press, London. Ganesh, K., and R. Raghavan. 2000. Hydropericardium hepatitis syndrome of broiler poultry: current status of research. Res. Vet. Sci. 68:201–206. Hafez, H. 2011. Avian adenoviruses infections with special attention to inclusion body hepatitis/ hydropericardium syndrome and egg drop syndrome. Pak. Vet. J. 31:85–92. Harrach, B., M. Benk¨ o, G. Both, M. Brown, A. Davison, M. Echavarria, M. Hess, M. Jones, A. Kajon, H. Lehmkuhl, V. Mautner, S. Mittal, and G. Wadell. 2012. The Committtee Taxon. Viruses,
9th, ed. Pages 125–141 in Family Adenoviridae. A. King, ed. Academic Press, New York. Hess, M. 2000. Detection and differentiation of avian adenoviruses: A review. Avian Pathol. 29:195–206. Hess, M. 2013. The Diseases of Poultry 13th, ed. Pages 290–300 in Aviadenovirus infections. J. Glisson, ed. Wiley Black well, Ames, IA. Hess, M., R. Raue, and C. Prusas. 1999. Epidemiological studies on fowl adenoviruses isolated from cases of infectious hydropericardium. Avian Pathol. 28:433–439. Kajan, G., S. Kecskemeti, B. Harrach, and M. Benko. 2013. Molecular typing of fowl adenoviruses, isolated in Hungary recently, reveals high diversity. Vet. Microbiol. 167:357–363. Kim, M., T. Lim, D. Lee, H. Youn, S. Yuk, B. Kim, S. Choi, C. Jung, J. Han, and C. Song. 2014. An inactivated oilemulsion fowl adenovirus serotype 4 vaccine provides broad crossprotection against various serotypes of fowl adenovirus. Vaccine 32:3564–3568. Li, H., J. Wang, L. Qiu, Z. Han, and S. Liu. 2016. Fowl adenovirus species C serotype 4 is attributed to the emergence of hepatitishydropericardium syndrome in chickens in China. Infection Genetics Evolution 45:230–241. Matos, M., B. Grafl, D. Liebhart, and M. Hess. 2016. The outcome of experimentally induced inclusion body hepatitis (IBH) by fowl aviadenoviruses (FAdVs) is crucially influenced by the genetic background of the host. Veterinary Research 47:1–10. McFerran, J., and J. Smyth. 2000. Avian adenoviruses. Rev. Sci. Tech. 19:589–601. Niu, Y., W. Sun, G. Zhang, Y. Qu, P. Wang, H. Sun, L. Wang, Y. Xiao, and S. Liu. 2016. Hydropericardium syndrome outbreak caused by fowl adenovirus serotype 4 in China in 2015. Journal of General Virology 97:2684–2690. Reed, L., and H. Muench. 1938. A simple method of estimating fifty per cent endpoints. Am. J. Hyg. 27:493–497. Rivera, A., L. Agnati, T. Horvath, J. Valderrama, A. de La Calle, and K. Fuxe. 2006. Uncoupling protein 2/3 immunoreactivity and the ascending dopaminergic and noradrenergic neuronal systems: relevance for volume transmission. Neuroscience 137:1447–1461. Zhao, J., Q. Zhong, Y. Zhao, Y. Hu, and G. Zhang. 2015. Pathogenicity and complete genome characterization of fowl adenoviruses isolated from chickens associated with inclusion body hepatitis and hydropericardium syndrome in China. PLoS One 10:e0133073.