PCR primers targeting the 16S rRNA gene for the specific detection of streptomycetes

Molecular and Cellular Probes (2001) 15, 337–347 doi:10.1006/mcpr.2001.0379, available online at http://www.idealibrary.com on

PCR primers targeting the 16S rRNA gene for the specific detection of streptomycetes H. Rintala,∗ A. Nevalainen, E. Ro¨nka¨ and M. Suutari National Public Health Institute, Department of Environmental Health, PO Box 95, 70701 Kuopio, Finland (Received 22 February 2001, Accepted 5 July 2001) Streptomycetes are filamentous actinobacteria commonly found in soil and biotechnically important, but they also have adverse effects on human health. In this work, two primer pairs, StrepB/ StrepE and StrepB/StrepF combined with BstYI restriction endonuclease digestion, targeting the 16S rRNA gene of streptomycetes were designed. The specificity of the primers was determined by polymerase chain reaction (PCR) amplification from Streptomyces strains and near relatives. All streptomycetes tested positive and non-streptomycetes were not amplified except three strains that, however, gave BstYI restriction endonuclease digestion results distinct from streptomycetes. Moreover, both primer pairs gave an amplification product of the expected size only when Streptomyces VTT E-99-1334 DNA was present in the template DNA mixture isolated from six bacterial and three fungal strains. The primers were further successfully used to amplify from DNA isolated from two soil and two building material samples. The 40 sequenced amplification products obtained with the primer pair StrepB/StrepE showed greater than 96·1% similarity to streptomycete 16S rRNA sequences. Seventy PCR amplification products obtained with the primers StrepB/StrepF were analysed by sequencing and restriction analysis. All 54 PCR products having >95·7% similarity to streptomycete sequences were cleaved with BstYI. No false-positive results were achieved. Both primer sets proved to be specific for streptomycetes, and applicable for the detection of streptomycetes in environmental samples.  2001 Academic Press KEYWORDS: Streptomyces, PCR, primer, water-damaged buildings.

INTRODUCTION Streptomycetes are Gram-positive filamentous bacteria belonging to the class Actinobacteria.1 The genus Streptomyces consists of a large number of species with a wide spectrum of metabolic capabilities, leading to the production of many secondary metabolites and biologically active compounds. Streptomycetes are known as saprophytic soil bacteria. Some species are plant pathogenic,2 but other species are clinically important.3 Spores of actinomycetes, including streptomycetes, have been associated with farmer’s lung

disease.4 Streptomycetes are also detected in waterdamaged buildings, but not in reference buildings.5,6 Spores of Streptomyces strains isolated from waterdamaged buildings have induced inflammatory responses in macrophages in vitro and have shown acute cytotoxicity, which is not connected with the viability of the spores.7,8 Streptomyces griseus has been shown to produce a highly toxic compound, valinomycin.9 Due to the clinical, biotechnological and environmental importance of the streptomycetes, they have been the subject of many studies in the past.

∗ Author to whom all correspondence should be addressed at: National Public Health Institute, PO Box 95, FIN-70701 Kuopio, Finland. Tel: +358 17 201164; Fax: +358 17 201155; E-mail: [email protected]

0890–8508/01/060337+11 $35.00/0

 2001 Academic Press

338

H. Rintala et al.

However, the problems concerning detection of bacteria from environmental samples also apply to streptomycetes. Current sampling techniques combined with cultivation require a long time, up to 14 days. In addition, some environmental and airborne microbes remain undetected by cultivation.10,11 Thus new methods are needed to obtain more accurate knowledge of the occurrence of streptomycetes in different environments. Polymerase chain reaction (PCR)based methods for the detection and identification of microbes offer many advantages over traditional techniques. Non-cultivable micro-organisms are also detected, the time needed for the analysis is shorter, and the detection limit is better. Sequencing of the amplified fragments provides more detailed information about the Streptomyces species involved. The taxonomic classification and identification of streptomycetes is based on morphological and biochemical characterization,12,13 but more recently molecular data, predominantly rRNA gene sequences,14 have been introduced. The identification of streptomycetes by morphological examination is difficult; thus molecular methods could represent an improvement. Streptomycetes-specific probes15 and PCR primers16 targeting the 16S rRNA gene or streptomycin biosynthesis genes17 have been published. Randomly amplified polymorphic DNA (RAPD)-PCR has been used for the identification of actinomycetes18 and streptomycetes,19 and PCR fingerprinting using repetitive intergenic DNA sequences has been used for the classification of pathogenic and disease-suppressive strains.20 In this work, we designed PCR primers for the specific amplification of streptomycetes 16S rRNA genes and demonstrated their suitability for the detection of streptomycetes in environmental samples.

MATERIALS AND METHODS Microbial strains and extraction of genomic DNA The microbial strains, cultivation media and temperatures used in this work are listed in Table 1. For the isolation of genomic DNA, the microbes were grown in 10 ml of the medium given in Table 1 at the appropriate temperature under agitation (200 rpm). The fungi were cultivated for 72 h, the streptomycetes and other bacteria for 48 h, except Micrococcus lylae, Bacillus megaterium, Bacillus subtilis, Brevibacterium fermentas, Escherichia coli, Pseudomonas aeruginosa and Pseudomonas oleovorans that were cultivated for 16 h. The cells were harvested by centrifugation, and 2 volumes of Tris–

EDTA (TE) buffer (pH 8·0) were added to 1 volume of microbial cells (1 mg wet weight >1
l). The suspension was carefully mixed and incubated at 65°C (bacteria) or 100°C (fungi) for 20 min to break the cells. The cell debris was removed by centrifugation (10 000 g), and the supernatant was extracted once with buffered phenol and once with chloroform: isoamylalcohol (24:1 v/v). The aqueous phase was separated by centrifugation, and the DNA was precipitated by adding 1/10 volume of 3  potassium acetate (pH 4·8) and 2 volumes of ethanol. The DNA precipitate was collected by centrifugation at 10 000 g, dissolved in water and stored at −20°C. An aliquot was analysed by agarose gel electrophoresis (1·5%) to assess the DNA concentration.

DNA isolation from environmental samples Soil A originated from a Norway spruce forest stand in south-east Finland and soil B from a Scots pine forest stand in central Finland. Both samples were taken from the humus layer, stored at 4°C for 2–4 weeks and then at −20°C until DNA isolation. The building material sample RM1 was painted concrete from a wall of a dwelling and RM2 was linoleum carpet from the ground floor of a bank building. Visual inspection indicated that both materials had been damaged by moisture and microbial growth. Mesophilic actinobacteria were detected in both building materials by cultivation on tryptone–yeast extract– glucose agar (Bacto Plate Count Agar, Difco, Detroit, MI, USA) supplemented with 0·05% cycloheximide. Two grams of each environmental sample were used for the DNA isolation. Soil was suspended in 13·3 ml 2% sodium hexametaphosphate, pH 8·5, followed by centrifugation (10 000 g, 10 min, 4°C).21 The washing procedure was repeated with 6·7 ml Crombach buffer (0·33  Tris–HCl pH 8·0, 1 m EDTA pH 8·0).22 After centrifugation, 2 g of glass beads, 0·2–0·8 mm in size (Merck, Darmstadt, Germany) and 2·1 ml lysis solution [0·33  Tris–HCl pH 8·0, 1 m EDTA, 70 m NaCl, 1% (w/v) cetyl-trimethylammonium bromide (CTAB) and 1% (w/v) sodium dodecylsulphate (SDS)] were added.23 The sample was carefully mixed and incubated at 65°C for 20 min. To disrupt the cells, the samples were vigorously shaken in Vortex genie-2 (Scientific Industries Inc., New York, USA) for 30 min. The cell debris was removed by centrifugation (15 min, 10 000 g, room temperature) and the supernatant was treated with an equal volume of chloroform– isoamylalcohol (24:1 v/v). The aqueous phase was transferred into a new tube and the DNA was further

PCR primers for Streptomyces spp.

339

Table 1. Microbes, mismatches to the primers, cultivation media and temperatures used in this study Mismatches/position (5′→3′) Species/isolate

Strain/sourcea

Streptomycetes Streptomyces albus

StrepB

StrepE

StrepF

DSM 40313

0

1/14

0

VTT E-99-1331

0

0

VTT E-99-1326

0

DSM 40444 DSM 41741

Temperature (±2)°C

0

65, GYM Streptomyces medium 2×TYg

28

0

0

2×TY

28

1/2

0

0

45

1/2

0

0

65, GYM Streptomyces medium 547, ISP Medium 4

0 0 0 0 0

0 0 0 0 0

0 0 0 0 0

2×TY 2×TY 2×TY 2×TY 2×TY

28 28 28 28 28

DSM 44096

2/2,10

2/14,15

4/2,8,14,15

28

DSM 20108

1/2

3/14,15,18

3/2,4,8

Kineococcus aurantiacus

DSM 7487

2/5,7

2/14,15

Kitasatospora setae

DSM 43861

2/8,17

0

0

Micrococcus lylae

DSM 20315

2/2,8

2/14,15

3/2,4,8

4/2,8,9,16

2/14,15

4/2,8,14,15

4/2,8,9,16

2/14,15

4/2,8,14,15

2/2,8

2/14,15

3/2,4,8

2/2,8

2/14,15

1/2

2/14,15

5/2,8,14,15, 17 3/2,8,15

65, GYM Streptomyces medium 53, Corynebacterium agar 65, GYM Streptomyces mediumh 214, GYM+2% starch 53, Corynebacterium agar 645, Middlebrook medium 645, Middlebrook medium 83, Czapek peptone agar 548, Bennett’s agar

8e

4e

6e 5e

Streptomyces anulatus Streptomyces californicus Streptomyces thermovulgaris Streptomyces thermoalkalitolerans Streptomyces sp. Streptomyces sp. Streptomyces sp. Streptomyces sp. Streptomyces sp. Other Actinobacteria Amycolatopsis methanolica Cellulomonas uda

VTT VTT VTT VTT VTT

E-99-1328 E-99-1329 E-99-1330 E-99-1333 E-99-1334

Mycobacterium DSM 44340 murale Mycobacterium DSM 44203b novocastrense Promicromonospora DSM 43110 citrea Saccharopolyspora DSM 44228 spinosa Thermocrispum DSM 44069 municipale Microbes for the DNA mixture Bacillus VTT E-70007 megaterium Bacillus subtilis ATCC 4944 Brevibacterium NCIB 9943 fermentas Escherichia coli 89Mc Pseudomonas ATCC 10145 aeruginosa Pseudomonas W16d oleovorans Aspergillus niger VTT D-77020 Lipomyces starkeyi DSM 70295 Penicillium VTT D-74021 chrysogenum a

Mediumf

4/8,16,17, 19

28

45

30 30 28 37 30 30 28 28

637, Standard I+malt agar

45

3e

2×TY

30

4e 2e

3e 3e

2×TY 2×TY

30 30

7e 8

6e 8

5e 5

2×TY 2×TY

37 30

12e

7e

7e

2×TY

30

12e n.a. n.a.

11e n.a. n.a.

12e n.a. n.a.

Worth broth Worth broth Worth broth

23 23 23

ATCC, American Type Culture Collection; DSM, German Collection of Microorganisms and Cell Cultures; NCBI, National Collection of Industrial Bacteria; VTT, Technical Research Center, Finland, Biotechnology and Food Research, Espoo, Finland. b Kindly provided by M.-L. Katila, Kuopio University Hospital. c Muddusja¨rvi/Niemela¨, Helsinki University. d Technische Hogeschool, Delft/Wiken. e The DNA sequence of this particular strain was not available. The mismatches were calculated from another strain of the same species. f The number indicates the number of DSM medium. The compositions of the media are available at the DSMZ homepage www.dsmz.de/media. g 1·2% (w/v) tryptone and 0·6% (w/v) yeast extract. h Without CaCO3. n.a. The sequence was not available.

340

H. Rintala et al.

purified with the Wizard DNA Clean up System (Promega, Madison, WI, USA). Finally, the DNA was separated on 0·75% agarose gel, and the fraction >4 kb in size was cut off and purified with the QIAquick gel extraction kit (Qiagen Inc., Valencia, CA, USA). In the DNA isolation from the building materials, the washings with sodium hexametaphosphate and Crombach buffer were omitted. Crombach buffer (0·6 ml) was added to 2 g of building material to wet it before adding the glass beads and lysis solution. After that, the procedure was carried on as with the soil samples.

Design of PCR primers The primers were designed based on Streptomyces spp. 16S rRNA gene sequences. The sequences were obtained from the European Molecular Biology Laboratory (EMBL) and GenBank databases and aligned with PILEUP algorithm of the Wisconsin Package Version 10.0 [Genetics Computer Group (GCG), Madison, WI, USA]. The primers were designed by manually selecting sequences homologous among the streptomycetes. The specificity of the potential primers was determined by comparing their sequences against GenBank (Release 119.0, August 2000) and EMBL (Release 63.0, June 2000) sequence databases using the FASTA algorithm24 of the Wisconsin Package. The primer candidates were evaluated for their predicted PCR performance using an automated search feature of the Oligo v. 5.0 primer analysis software package (National Biosciences Inc., Plymouth, MN, USA), that eliminates oligonucleotides with adverse primer performance characteristics.

Chemical Co.), 0·1 m of each deoxynucleoside triphosphate (Finnzymes), 0·6
 of each primer (Merck Eurolab, Espoo, Finland), 10–40 ng of template DNA, and 1 U of DyNazyme II DNA polymerase (Finnzymes). The reaction mixture was subjected to an initial denaturation of 5 min at 98°C, and then 30 cycles of 1-min denaturation at 95°C, 40-s primer annealing at 52°C and 2-min primer extension at 72°C were performed, followed by a final extension at 72°C for 10 min. The PCR amplifications for further determination of primer specificity using DNA isolated from pure cultures of streptomycetes and related actinobacteria as well as environmental samples as a template were performed as follows. The reaction mixture contained 1× Pfu reaction buffer (Stratagene, Amsterdam, The Netherlands), 0·1 m deoxynucleoside triphosphates (Finnzymes), 0·2
 phosphorylated primers (StrepB and StrepF, CyberGene AB, Huddinge, Sweden; and StrepE, A.I. Virtanen Institute, Kuopio, Finland), 2 ng DNA from pure cultures or 5–20 ng environmental DNA, and 1 U Pfu DNA polymerase (Stratagene). The cycling conditions were: an initial denaturation of 5 min at 98°C, 30 cycles of 45-s denaturation at 95°C, 40-s primer annealing, and 2-min primer extension at 72°C, followed by a final extension at 72°C for 10 min. The annealing temperature used was 54°C for the primers StrepB/StrepE and 58°C for the primer pair StrepB/StrepF. The amplification products (50
l) of each reaction were analysed by electrophoresis for 60 min at 80 V in agarose (1·5%) gels in Tris–borate–EDTA buffer containing 0·5
g ml−1 ethidium bromide. HaeIII-digested X174 DNA (Promega) served as molecularweight marker. The DNA bands in the gels were visualized by U.V. transillumination and photographed using Image Master VDS (Amersham Pharmacia Biotech, Uppsala, Sweden).

PCR amplification and detection of DNA The PCR reactions were carried out in 0·5-ml tubes in a total volume of 50
l, overlaid with 50
l sterile mineral oil (Sigma Chemical Co., St. Louis, MO, USA). One positive control and one tube containing no nucleic acid were included in each set of PCR reactions. The amplifications were performed in a PTC-100 Programmable Thermal Controller (MJ Research, Inc., Watertown, MA, USA). Streptomyces sp. 16S rRNA gene fragments were amplified from a mixture of chromosomal DNA from bacteria and fungi (Table 1) according to the following protocol. The PCR reaction mixture contained 1× DyNAzyme II reaction buffer (Finnzymes, Espoo, Finland), 10% (v/v) dimethylsulfoxide (DMSO) (Sigma

Cloning, DNA sequencing and restriction endonuclease analysis The PCR products from environmental samples were purified from 1% agarose gels with the QIAquick gel extraction kit (Qiagen). The fragments were ligated into SmaI digested and dephosphorylated pUC19 vector (MBI Fermentas, Hanover, MD, USA) using T4 DNA ligase (MBI Fermentas). The ligation mixture was transformed into Escherichia coli XL10-Gold Ultracompetent Cells (Stratagene) according to the manufacturer’s instructions. Plasmid DNA from transformants was isolated with the Wizard Plus SV minipreps kit (Promega), and the inserts were sequenced.

PCR primers for Streptomyces spp.

The sequencing was performed with the Thermosequenase Fluorescent Labeled Primer Cycle Sequencing kit with 7-deaza-GTP, RPN 2538 (Amersham Pharmacia Biotech), and A.L.F. or A.L.F. express DNA sequencer (Amersham Pharmacia Biotech) according to the manufacturer’s instructions. The sequencing primers (A.I.Virtanen Institute) used were universal (5′-GTAAAACGACGGCCAGT-3′) and reverse (5′-AACAGCTATGACCAT-3′) for the fragment amplified with the primer pair StrepB/StrepE, and universal or reverse and an internal sequencing primer (5′-TATTACCGCGGCTGCTGGCA-3′) for the fragment amplified with the primer pair StrepB/StrepF. The sequences obtained were compared to prokaryotic sequences in the EMBL database (Release 65.0, December 2000) with the FASTA algorithm25 available at the EBI homepage (www.ebi.ac.uk/fasta3). The restriction endonuclease BstYI, suitable for the identification of streptomycetes PCR products, was searched by screening the 16S rRNA sequences of streptomycetes and related actinobacteria with the MAP option of the Wisconsin Package Version 10.0. For the restriction endonuclease digestion, BstYI (5 U) was directly added to 10
l of the PCR reaction and incubated at 60°C for 3 h. Plasmid DNA carrying a PCR fragment amplified with the primer pair StrepB/ StrepF was digested with BstYI in a total volume of 10
l. The mixture contained 1× NE Buffer for BstYI (New England Biolabs, Beverly, MA, USA), 0.1 mg ml−1 bovine serum albumin (BSA) and 2 U BstYI (New England Biolabs). The reaction was performed at 60°C for 2 h. The results were analysed in 1·5% agarose gel as described above.

Determination of reaction sensitivity The sensitivity of the PCR amplification was determined with primer pairs StrepB/StrepE and StrepB/ StrepF using serial 10-fold dilutions of Streptomyces sp. VTT E-99-1328 DNA in water as a template. Template amounts of 100, 10, 1, 0·1, 0·01, 0·001 and 0 ng were used. The PCR reaction mixture consisted of 1× Pfu reaction buffer (Stratagene), 0·1 m deoxynucleoside triphosphates (Finnzymes), 0·2
 phosphorylated primers (Merck Eurolab), 1 U Pfu DNA polymerase (Stratagene) and template DNA. The amplifications were performed as described above. The annealing temperature for the primer set StrepB/StrepE was 54°C, and for the primers StrepB/ StrepF 58°C.

341 BstYI 567 bp

507 bp 1074 bp

519 bp V1 V2(γ)

StrepB

V3

V4

StrepE

V5

V6(α) V7(β) V8

StrepF

PCR primers: StrepB 5' - ACAAGCCCTGGAAACGGGGT - 3' nt 139–158 StrepE 5' - CACCAGGAATTCCGATCT - 3' nt 640–657 nt 1194–1212 StrepF 5' - ACGTGTGCAGCCCAAGACA - 3'

Fig. 1. Map of the 16S rRNA gene. The variable regions V1–V8 and , ,  (Ε), the positions of the primers StrepB, StrepE and StrepF and the BstYI restriction endonuclease cleavage site are indicated. The sizes of the PCR amplification products and BstYI restriction fragments, calculated from the S. ambofaciens25 sequence, are given. nt, nucleotides.

RESULTS Primer and restriction endonuclease specificity Two oligonucleotide primer pairs, StrepB/StrepE and StrepB/StrepF, combined with BstYI restriction endonuclease digestion, were designed for the specific PCR amplification and detection of 16S rRNA gene from streptomycetes (Fig. 1).26 According to the FASTA similarity search, the reverse primer StrepF matched perfectly to all available streptomycete sequences. The 18-bp reverse primer StrepE showed one mismatch at position 14 from the 5′ end of the primer to a Streptomyces albus sequence (X53163). The 20-bp forward primer StrepB has one mismatch to Streptomyces thermovulgaris (Z68094), Streptomyces thermonitrificans (X68098) and Streptomyces thermoalkalitolerans (AJ000284) at position 2 from the 5′ end of the primer. Due to the six mismatches of StrepB to Streptomyces megasporus (Z68100) and Streptomyces thermolineatus (Z68097) and seven mismatches to Streptomyces macrosporus (Z68099) 16S rRNA gene sequences, these three species are not likely to be amplified with StrepB. As a result, the primers matched perfectly with 96·5% of the 229 streptomycetes 16S rRNA gene sequences covering the target regions of all three primers and available in the GenBank (Release 119.0) and EMBL (Release 63.0) databases at the time of our last search in February 2001. The primers StrepB, StrepE and StrepF showed no perfect matching with non-streptomycete sequences available in the databases, yet 28 sequences had less than three mismatches to the forward primer StrepB. The specificity of the primer pairs StrepB/StrepE and StrepB/StrepF was experimentally confirmed by

342

H. Rintala et al. 1

2

3

4

5

6

7

8

9

10

11

12

13

14 15

16

17 18

19

20

21 22

(a)

(b)

Fig. 2. The specificity of the constructed primer pairs StrepB/StrepE (a) and StrepB/StrepF (b). Lane 2, Cellulomonas uda; lane 3, Promicromonospora citrea; lane 4, Kitasatospora setae; lane 5, Amycolatopsis methanolica; lane 6, Micrococcus lylae; lane 7, Thermocrispum municipale; lane 8, Kineococcus aurantiacus; lane 9, Saccharopolyspora spinosa; lane 10, Mycobacterium novocastrense; lane 11, Mycobacterium murale; lane 12, Streptomyces albus; lane 13, Streptomyces thermovulgaris; lane 14, Streptomyces thermoalkalitolerans; lane 15, Streptomyces anulatus; lane 16, Streptomyces californicus; lane 17, VTT E-99-1328; lane 18, VTT E-99-1329; lane 19, VTT E-99-1330; lane 20, VTT E-99-1333; lane 21, negative control; lanes 1 and 22, molecular-weight marker X174 DNA digested with HaeIII.

PCR amplification from nine Streptomyces strains and 10 non-Streptomyces strains having one to five mismatches to the primers (Table 1). The 16S rRNA gene was successfully amplified with both primer pairs from all streptomycetes tested including S. albus that has one mismatch to StrepE, and S. thermovulgaris and S. thermoalkalitolerans having one mismatch to StrepB (Fig. 2a and b). From the nonStreptomyces strains, Kitasatospora setae tested positive with the primer pair StrepB/StrepE and Cellulomonas uda, Promicromonospora citrea and Micrococcus lylae with StrepB/StrepF (Fig. 2a and b). All 229 streptomycete 16S rRNA gene sequences screened carried the BstYI restriction endonuclease cleavage site at position 705 (S. ambofaciens numbering25). BstYI cleaved the 1074 bp PCR product amplified with StrepB/StrepF generating fragments of 567 and 507 bp (S. ambofaciens numbering25). The

BstYI cleavage site was found to be characteristic for streptomycetes. The database sequences presenting potential false positives, e.g. non-streptomycetes 16S rRNA sequences having less than three mismatches to StrepB, were checked for their BstYI cleavage sites. Only one Micrococcus lylae (X80750) 16S rRNA sequence was found that had a BstYI digestion site in the gene region limited by the primers StrepB and StrepF, but the restriction-fragment sizes generated are clearly different (459 and 608 bp) from those of the streptomycetes (507 and 567 bp). By the experimental analysis, the BstYI restriction endonuclease digested the Streptomyces PCR fragments generating fragments of the expected size. The C. uda and P. citrea PCR fragments produced negative digestion results with BstYI, and the M. lylae fragment was cleaved as expected generating fragments clearly differing in size from those of streptomycetes (Fig. 3).

PCR primers for Streptomyces spp. 1

2

3

4

5

6

7

8

9

10

343

11

12

13

14

Fig. 3. BstYI restriction enzyme digestion of PCR products amplified with the primer pair StrepB/StrepF. Lane 2, Cellulomonas uda; lane 3, Promicromonospora citrea; lane 4, Micrococcus lylae; lane 5, Streptomyces albus; lane 6, Streptomyces thermovulgaris; lane 7, Streptomyces thermoalkalitolerans; lane 8, Streptomyces anulatus; lane 9, Streptomyces californicus; lane 10, VTT E-99-1328; lane 11, VTT E-99-1329; lane 12, VTT E-99-1330; lane 13, VTT E99-1333; lanes 1 and 14, molecular-weight marker X174 DNA digested with HaeIII. 1

2

3

4

5

6

7

8

9

10

1074 bp 519 bp

Fig. 4. Agarose gel electrophoresis of PCR products obtained by amplification from DNA mixtures isolated from six bacterial and three fungal species with the primer pairs StrepB/StrepE and StrepB/StrepF. Lanes 1 and 6, molecularweight marker X174 DNA digested with HaeIII; lanes 2 and 7, negative control (without template DNA); lanes 3 and 8, positive control (Streptomyces VTT E-99-1334), primers StrepB/StrepE; lanes 4 and 9, DNA mixture with Streptomyces VTT E-99-1334 DNA, primer pairs StrepB/StrepF and StrepB/StrepE, respectively; lanes 5 and 10, DNA mixture without Streptomyces VTT E-99-1334 DNA, primer pairs StrepB/StrepF and StrepB/StrepE, respectively.

Detection of streptomycetes Experimental analyses of the PCR amplification performance of the forward primer StrepB in conjunction with the reverse primers StrepE and StrepF were conducted under the reaction conditions described. The primer pairs StrepB/StrepE and StrepB/StrepF amplified a fragment of the expected size from the DNA isolated from the positive control strain Streptomyces VTT E-99-1334. The specificity of the primers was further examined by PCR amplification using DNA isolated from six bacterial and three fungal strains as the template. Both primer pairs, StrepB/ StrepE and StrepB/StrepF, produced fragments of the expected size only in the presence of Streptomyces VTT E-99-1334 DNA (Fig. 4).

The primer pairs were further used successfully to amplify 16S rRNA gene fragments from template DNA isolated from four separate environmental samples. Under the reaction conditions described, amplification products of the expected size were obtained from all environmental samples. In order to confirm the specificity of the PCR primer pairs, the PCR amplification products were subsequently cloned into pUC19 vector and sequenced. All sequenced amplification products of the primers StrepB/StrepE showed greater than 96·1% similarity with streptomycete 16S rRNA gene sequences (Table 2). The sequences amplified with the primer pair StrepB/ StrepF showed over 95·7% similarity to streptomycete 16S rRNA gene sequences, except for five, one and ten sequences amplified from DNA isolated from

344

H. Rintala et al.

Table 2. Summary of sequence similarity of PCR fragments amplified with primers StrepB/StrepE from soil samples A and B and building materials RM1 and RM2a Sample

Sequence similarity

soilA soilB RM1 RM2 a

99·0–99·6% streptomycetes 96·4–99·8% streptomycetes 99·6% streptomycetes 96·1–99·8% streptomycetes

Ten clones from each sample were analysed.

Table 3. Summary of sequence analysis and BstYI restriction endonuclease digestion of PCR fragments obtained with primers StrepB/StrepF from soil samples A and B and building materials RM1 and RM2 Clones analysed

BstYI

8

+

1

−

22

+

10

−

RM1

17

+

RM2

7

+

5

−

Sample soilA

soilB

Sequence similarity 99·4–99·7% streptomycetes 91·1% Dactylosporangium 96·4–100% streptomycetes 90–93% different actinomycetes 99·4–100% streptomycetes 95·5–99·7% streptomycetes 97·9–98·5% Cellulomas

building material RM2, soil A and soil B, respectively (Table 3). The latter amplification products produced negative digestion results with the BstYI restriction endonuclease, in contrast to the PCR fragments showing similarity to streptomycetes (Fig. 5).

Primer sensitivity The sensitivity of the PCR amplification was determined by using DNA isolated from Streptomyces VTT E-99-1328 in serial 10-fold dilutions as the template. Template concentrations ranging from 1 pg to 100 ng were used, corresponding to approximately 3×101 to 3×106 cells, respectively. With the primer set StrepB/StrepE, an amplification product was observed with 10 pg of template DNA, but no amplification was observed with 1 pg (Fig. 6a). With StrepB/StrepF, an amplification product was visible even with the lowest template DNA amount used, 1 pg (Fig. 6b), indicating that at least 30 cells per PCR reaction could be detected with the primer pair StrepB/StrepF.

DISCUSSION In this work, one forward and two reverse primers were designed specifically targeting the 16S rRNA gene of streptomycetes. Theoretically, the forward primer StrepB and the reverse primers StrepE and StrepF showed to be specific for streptomycetes. This was experimentally confirmed by PCR amplification and BstYI restriction endonuclease digestion of test organisms and sequencing of the PCR amplification products obtained with the primer pairs StrepB/StrepE and StrepB/StrepF combined with BstYI digestion, using DNA isolated from four separate environmental samples as the template. No false-positive results were obtained. The sensitivity of the PCR reaction was 1 pg for the primer pair StrepB/StrepF and 10 pg for the primers StrepB/StrepE, by using agarose gel electrophoresis and U.V.-transillumination visualization of the PCR products. The 16S rRNA gene is frequently used as a target region for PCR primers. Although the 16S rRNA gene is highly conserved among the prokaryotes, with sequence similarity being 80% between S. griseus and Bacillus subtilis and 70% between S. griseus and E. coli,27 it contains sufficient differences in the variable regions to distinguish the taxa. The variable regions V1–V8 would be ideal target sites for specific primers, but they also carry the majority of the interspecies differences within the genus Streptomyces.25,27 Four regions suitable for the specific detection of streptomycetes have been found, located outside the variable regions around nucleotides 120, 640, 800 and 1100.16 For comparison, the primers designed in this work, StrepB, StrepE and StrepF are located at positions 139–158, 640–657 and 1194– 1212 (S. ambofaciens numbering25), respectively. Primers targeting the four streptomycete-specific regions have also been published,16 two of them, AM48 and AM33, partially overlapping with the primers StrepB and StrepE devised in this work. However, the last 11 nucleotides at the 3′ end of StrepB and two nucleotides at the 3′ end of StrepE differed from the primers AM48 and AM33,16 respectively. The 3′ end of the primer is known to be of great importance for primer specificity.28 StrepF is located in a region not previously proposed for any primers or probes, and has no overlapping with other primers. In addition, AM48, as well as three other primers introduced in that work,16 have one to three ambiguous nucleotides, perhaps due to the limited sequence data available at that time. Moreover, the primers were used to amplify from DNA isolated from pure cultures of streptomycetes, and thus nothing is known about their specificity with environmental samples. According to

PCR primers for Streptomyces spp. 1

2

3

4

5

345

6

1353 bp 1078 bp 872 bp 603 bp

310 bp

Fig. 5. BstYI digestion patterns of PCR products amplified with the primers StrepB/StrepF from the environmental sample RM2 and cloned into pUC19-vector. The vector itself is cleaved seven times with BstYI giving three major fragments of 1030, 768 and 762 bp, and four minor fragments ranging from 11 to 86 bp. The polylinker cloning site, into which the PCR fragments were ligated, is situated at the end of the 762-bp fragment. The PCR fragment is cleaved once producing fragments of 507 and 567 bp if it originates from streptomycetes. Lanes 1 and 2, PCR fragments showing similarity to streptomycetes and having different orientations; lane 3, PCR fragment showing similarity to Cellulomonas; lane 4, pUC19 digested with BstYI; lane 5, pUC19; lane 6, X174 digested with HaeIII.

Stackebrandt et al.15 the nucleotide 929 (S. ambofaciens numbering25) and the flanking regions are specific for streptomycetes. This region is included in the PCR fragment generated with the primers StrepB/ StrepF, which allows the use of a specific probe to detect the PCR fragment. The variable regions V2 and V3 comprise the most distinctive differences between E. coli and streptomycetes25 and V2 () also within the streptomycetes.15 Three variable regions,  (or V6, nt 982–998),  (or V7, nt 1102–1122), and particularly the  region (or V2, nt 158–203) have been found to be suitable for the Streptomyces species discrimination.15 Both of the primer pairs designed in this work, StrepB/ StrepE and StrepB/StrepF, amplified the  variable region. In addition, the variable regions  and  are included in the fragment amplified with the primers StrepB/StrepF. This makes the primers useful in many applications, including diversity studies or design of species specific probes and detection methods. The region that StrepB is targeting is not fully conserved among the streptomycetes. The sequences of S. thermovulgaris, S. thermonitrificans and S. thermoalkalitolerans have one mismatch to StrepB. However, these species tested positive in the PCR amplification. In addition, there is a small group of thermophilic streptomycetes that differ in their sequence sufficiently that they are not likely to be detected with the primer StrepB. This phylogenetically distinct clade14 comprises the species S. thermolineatus, S. macrosporus and S. megasporus. These

species are commonly isolated from composts and heated hay or grain,14 and their prevalence and significance in indoor environments is not yet known. Another group comprising Kitasatospora species has two mismatches to StrepB. Kitasatospora setae tested positive with StrepB/StrepE and negative with StrepB/ StrepF. The unification of Kitasatospora with the genus Streptomyces has recently been proposed1,29 and the 16S rRNA sequences are highly similar, e.g. 96·1% 16S rRNA sequence similarity between K. setae and S. griseus.14 It is not known what is their prevalence in indoor environments; however, they can be detected with one of the primer pairs, StrepB/StrepE. Although the primers StrepB, StrepE and StrepF did not match perfectly with non-streptomycete 16S rRNA sequences, there were many sequences in the databases having one or two mismatches to the primers. They originated from near relatives of the streptomycetes, a fact that could create specificity problems in the PCR. Thus, the performance of the primers and the BstYI restriction endonuclease were tested with several organisms and found to be specific for streptomycetes. It seemed that mismatches near to the 5′ end of the primers did not prevent the amplification, but differences close to the 3′ end did. Four separate environmental samples including two soil samples, which are real multitemplate DNA, were further used for the determination of the reaction specificity, and the results also suggested specific performance of the primers. Direct cleavage of the PCR fragments and the sequencing of the PCR frag-

346

H. Rintala et al.

Fig. 6. Agarose gel electrophoresis of PCR products amplified with the primer pairs (a) StrepB/StrepE and (b) StrepB/ StrepF from different concentrations of Streptomyces VTT E-99-1328 DNA. Lanes 1–6, 10, 1, 0·1, 0·01, 0·001 and 0 ng template DNA/reaction; lane 7, molecular-weight marker X174 DNA digested with HaeIII.

ments obtained confirmed the specificity of the BstYI restriction endonuclease cleavage. In summary, the constructed primer sets StrepB/ StrepE and StrepB/StrepF combined with BstYI digestion were specific and applicable for PCR amplification of streptomycete 16S rRNA gene fragments from environmental samples. To our knowledge, this is the first time that specific primers targeting the Streptomyces 16S rRNA gene have been used for PCR amplification from environmental samples.

ACKNOWLEDGEMENTS The work was supported by the Finnish Work Environment Fund (grants no. 96028 and 98103). Mrs Sirpa Lappalainen and Mrs Ulla Kukkonen are thanked for their skilful technical assistance.

REFERENCES 1. Stackebrandt, E., Rainey, F. A. & Ward-Rainey, N. L. (1997). Proposal for a new hierarchic classification system, Actinobacteria classis nov. International Journal of Systematic Bacteriology 47, 479–91. 2. Takeuchi, T., Sawada, H., Tanaka, F. & Matsuda, I. (1996). Phylogenetic analysis of Streptomyces spp. causing potato scab based on 16S rRNA sequences. International Journal of Systematic Bacteriology 46, 476–9. 3. Mishra, S. K., Gordon, R. E. & Barnett, D. A. (1980). Identification of nocardiae and streptomycetes of medical importance. Journal of Clinical Microbiology 11, 728–36. 4. Lacey, J. & Crook, B. (1988). Fungal and actinomycete spores as pollutants of the workplace and occupational allergens. Annals of Occupational Hygiene 32, 515– 33. 5. Nevalainen, A., Pasanen, A.-L., Niininen, M., Reponen, T., Kalliokoski, P. & Jantunen, M. J. (1991). The indoor air quality in Finnish homes with mold

PCR primers for Streptomyces spp. problems. Environment International 17, 299–302. 6. Pasanen, A.-L., Juutinen, T., Jantunen, M. J. & Kalliokoski, P. (1992). Occurrence and moisture requirements of microbial growth in building materials. International Biodeterioration & Biodegradation 30, 273–83. 7. Hirvonen, M.-R., Nevalainen, A., Makkonen, N., Mo¨nkko¨nen, J. & Savolainen, K. (1997). Streptomyces spores from moldy houses induce nitric oxide, TNF and IL-6 secretion from RAW264.7 macrophage cell line without causing subsequent cell death. Environmental Toxicology and Pharmacology 3, 57–63. 8. Hirvonen, M.-R., Ruotsalainen, M., Savolainen, K. & Nevalainen, A. (1997). Effect of viability of actinomycete spores on their ability to stimulate production of nitric oxide and reactive oxygen species in RAW264.7 macrophages. Toxicology 124, 105–14. 9. Andersson, M. A., Mikkola, R., Kroppenstedt, R. M. et al. (1998). The mitochondrial toxin produced by Streptomyces griseus strains isolated from an indoor environment is valinomycin. Applied and Environmental Microbiology 64, 4767–73. 10. Ward, D. M., Weller, R. & Bateson, M. M. (1990). 16S rRNA sequences reveal numerous uncultured inhabitants in a natural community. Nature 345, 63–5. 11. Palmgren, U., Stro¨m, G., Blomquist, G. & Malmberg, P. (1986). Collection of airborne micro-organisms on Nuclepore filters, estimation and analysis – CAMNEA method. Journal of Applied Bacteriology 61, 401–6. 12. Ka¨mpfer, P., Kroppenstedt, R. M. & Dott, W. (1991). A numerical classification of the genera Streptomyces and Streptoverticillium using miniaturized physiological tests. Journal of General Microbiology 137, 1831–91. 13. Goodfellow, M., Lacey, J. & Todd, C. (1987). Numerical classification of thermophilic streptomycetes. Journal of General Microbiology 133, 3135–49. 14. Kim, D., Chun, J., Sahin, N., Hah, Y. C. & Goodfellow, M. (1996). Analysis of thermophilic clades within the genus Streptomyces by 16S ribosomal DNA sequence comparisons. International Journal of Systematic Bacteriology 46, 581–7. 15. Stackebrandt, E., Witt, D., Kemmerling, C., Kroppenstedt, R. & Liesack, W. (1991). Designation of streptomycete 16S and 23S rRNA-based target regions for oligonucleotide probes. Applied and Environmental Microbiology 57, 1468–77. 16. Mehling, A., Wehmeier, U. F. & Piepersberg, W. (1995). Nucleotide sequences of streptomycete 16S ribosomal DNA: towards a specific identification system for streptomycetes using PCR. Microbiology 141, 2139–47. 17. Huddleston, A. S., Cresswell, N., Neves, M. C. P.

18.

19.

20.

21.

22.

23.

24.

25.

26.

27.

28.

29.

347

et al. (1997). Molecular detection of streptomycinproducing streptomycetes in Brazilian soils. Applied and Environmental Microbiology 63, 1288–97. Mehling, A., Wehmeier, U. F. & Piepersberg, W. (1995). Application of random amplified polymorphic DNA (RAPD) assays in identifying conserved regions of actinomycete genomes. FEMS Microbiology Letters 128, 119–26. Roberts, M. A. & Crawford, D. L. (2000). Use of randomly amplified polymorphic DNA as a means of developing genus- and strain-specific Streptomyces DNA probes. Applied and Environmental Microbiology 66, 2555–64. Sadowsky, M. J., Kinkel, L. L., Bowers, J. H. & Schottel, J. L. (1996). Use of repetitive intergenic DNA sequences to classify pathogenic and disease-suppressive Streptomyces strains. Applied and Environmental Microbiology 62, 3489–93. Torsvik, V., Goksoyr, J. & Daae, F. L. (1990). High diversity in DNA of soil bacteria. Applied and Environmental Microbiology 56, 782–7. Crombach, W. H. J. (1972). DNA base composition of soil arthrobacters and other coryneforms from cheese and sea fish. Antonie van Leeuwenhoek Journal of Microbiology 38, 105–20. Zhou, J., Bruns, M. A. & Tiedje, J. M. (1996). DNA recovery from soils of diverse composition. Applied and Environmental Microbiology 62, 316–22. Pearson, W. R. & Lipman, D. J. (1988). Improved tools for biological sequence analysis. Proceedings of the National Academy of Sciences of the United States of America 85, 2444–8. Pernodet, J.-L., Boccard, F., Alegre, M. T., Gagmat, J. & Guerineau, M. (1989). Organisation and nucleotide sequence analysis of a ribosomal RNA cluster from Streptomyces ambofaciens. Gene 79, 33–46. Suutari, M., Rintala, H., Ro¨nka¨, E. & Nevalainen, A. (2001). Oligonucleotide primers for detection of Streptomyces species. Patent no. FI20011004. Kim, E., Kim, H., Hong, S.-P., Kang, K. H., Kho, Y. H. & Park, Y. H. (1993). Gene organisation and primary structure of a ribosomal RNA gene cluster from Streptomyces griseus subsp. griseus. Gene 132, 21–31. Parker, J. D., Rabinovitch, P. S. & Burmer, G. C. (1991). Targeted gene walking polymerase chain reaction. Nucleic Acids Research 19, 3055–60. Wellington, E. M. H., Stackebrandt, E., Sanders, D., Wolstrup, J. & Jorgensen, N. O. G. (1992). Taxonomic status of Kitasatosporia and proposed unification with Streptomyces on the basis of phenotypic and 16S rRNA analysis and emendation of Streptomyces Waksman and Henrici 1943AL. International Journal of Systematic Bacteriology 42, 156–60.