- Email: [email protected]
PCTK1 is overexpressed in cutaneous squamous cell carcinoma and regulates p27 stability and cell cycle
G Model DESC 3138 No. of Pages 9
Journal of Dermatological Science xxx (2016) xxx–xxx
Contents lists available at ScienceDirect
Journal of Dermatological Science journal homepage: www.jdsjournal.com
PCTAIRE1/CDK16/PCTK1 is overexpressed in cutaneous squamous cell carcinoma and regulates p27 stability and cell cycle$ Teruki Yanagia,* , Hiroo Hataa , Eri Mizunoa , Shinya Kitamuraa , Keisuke Imafukua , Shinichi Nakazatoa , Lei Wangb , Hiroshi Nishiharab , Shinya Tanakab , Hiroshi Shimizua a b
Department of Dermatology, Hokkaido University Graduate School of Medicine, Japan Department of Translational Pathology, Hokkaido University Graduate School of Medicine, Japan
A R T I C L E I N F O
A B S T R A C T
Article history: Received 2 December 2016 Received in revised form 8 February 2017 Accepted 20 February 2017
Background: PCTAIRE1 (also known as cyclin-dependent kinase 16 (Cdk16) and PCTK1) is a Cdk family protein that has been implicated in spermatogenesis. We recently revealed the function of PCTAIRE1 in the tumorigenesis of malignancies, including breast and prostate cancers; however, the tumorigenic function of PCTAIRE1 in cutaneous squamous cell carcinoma (SCC) remains unclear. Objective: In this study, we investigated the role of PCTAIRE1 in the tumorigenesis of cutaneous SCCs. Methods and results: In cutaneous/oral SCC A431, DJM-1, HSC-3 cells, PCTAIRE1 gene-knockdown was found to diminish cell proliferation as assessed by cell counting and clonogenic assays. FACS analyses of annexin V-PI staining and DNA content showed PCTAIRE1 knockdown to cause G2/M arrest followed by apoptosis. The depletion of PCTAIRE1 was found to lead to the accumulation of tumor suppressor p27 and down-regulation of c-Myc. In tumor xenografts of A431 cells, the conditional knockdown of PCTAIRE1 restores p27 protein expression and suppresses tumor growth. Clinically, in primary tumors from patients with SCC, PCTAIRE1 is more highly expressed in malignant lesions than in adjacent normal epidermis. Conversely, expression levels of p27 are significantly lower in SCC than in normal epidermis. Conclusions: Our findings reveal a crucial function for PCTAIRE1 in regulating p27, c-Myc levels and tumor growth in cutaneous SCC cells, suggesting that PCTAIRE1 could be a novel target for skin tumor treatment. © 2017 Japanese Society for Investigative Dermatology. Published by Elsevier Ireland Ltd. All rights reserved.
Keywords: Cutaneous squamous cell carcinoma Cyclin dependent kinase p27 Cell cycle
1. Introduction Cutaneous squamous cell carcinoma (SCC) is one of the most common cancers in Caucasian populations, accounting for 20–30% of cutaneous malignancies in this group [1,2]. The risk of metastasis is low in most patients, not exceeding 3–5% [1]; however, aggressive SCC is associated with very high morbidity and mortality [3]. Although cutaneous SCC can be treated by
Abbreviations: Cdk, cyclin-dependent kinase; Dox, doxycycline; PI, propidium iodide; SCC, squamous cell carcinoma. $ This work was supported by Japan Society for the Promotion of Science (JSPS) Grants-in-Aid for Young Scientists (grant number 15H05998, grant number 16K1970106 to T.Y), by Practical Research for Innovative Cancer Control from the Japan Agency for Medical Research and Development (AMED) (grant number 15ck016175h0001 to T.Y), by a research grant from GlaxoSmithKline Japan, and by a research grant from the Nakatomi Foundation. * Corresponding author. at: Department of Dermatology, Hokkaido University Graduate School of Medicine N15 W7, Kita-ku, Sapporo 060-8638, Japan. E-mail address: [email protected] (T. Yanagi).
surgical removal, radiation or chemotherapy, or by a combination of these therapies, the prognosis of patients with metastatic SCC is poor [2,4]. To obtain effective but less toxic therapies, the detailed characterization of the molecular mechanisms involved in cutaneous SCC pathogenesis and the identification of new drug targets are very important. PCTAIRE1 (also known as cyclin-dependent kinase 16 (Cdk16) and PCTK1) is a member of the PCTAIRE family, a group of kinases related to the Cdk family [5]. PCTAIRE1 is expressed ubiquitously, but with the highest levels in neurons (the brain) and the testes [6]. It was suggested that PCTAIRE1 has a physiological function, based on findings from the neurons of mutant PCT-1 nematodes, which showed altered axonal vesicle transport [7], and it was suggested that mammalian PCTAIRE1 is essential for spermatogenesis, based on gene knockout studies in mice [8]. Although PCTAIRE1 has amino acids sequences similar to the cyclin binding sites found in Cdk family proteins [5], the mechanisms of its activation are unclear [9]. PCTAIRE1 is known to be activated by interactions with cyclin Y [8,10], although PCTAIRE1 binding with a Cdk5 activator
http://dx.doi.org/10.1016/j.jdermsci.2017.02.281 0923-1811/ © 2017 Japanese Society for Investigative Dermatology. Published by Elsevier Ireland Ltd. All rights reserved.
Please cite this article in press as: T. Yanagi, et al., PCTAIRE1/CDK16/PCTK1 is overexpressed in cutaneous squamous cell carcinoma and regulates p27 stability and cell cycle, J Dermatol Sci (2017), http://dx.doi.org/10.1016/j.jdermsci.2017.02.281
G Model DESC 3138 No. of Pages 9
2
T. Yanagi et al. / Journal of Dermatological Science xxx (2016) xxx–xxx
does not activate its kinase activity [11]. The PCTAIRE1 substrate phosphorylation consensus sequence is currently undefined, although PCTAIRE1 is known to bind and phosphorylate Ser569 in the vesicular transport protein NSF [12] and to phosphorylate myelin basic protein in vitro [13]. PCTAIRE1 also interacts with the COPII complex, which is involved in the export of proteins secreted from the endoplasmic reticulum [14]. PCTAIRE1 has been reported to regulate integrin-dependent spindle orientation in cell division [15]. Recently, we presented evidence that PCTAIRE1 plays an indispensable role in the proliferation of some types of cancer cells, in that PCTAIRE1-depleted malignant cells show apoptosis with mitotic arrest associated with centrosome dysregulation [16–18]. Moreover, we showed that PCTAIRE1 directly binds with p27 and promotes phosphorylation at Ser10, leading to the degradation of this tumor suppressor [16]. We also discovered that PCTAIRE1 plays a crucial role in anti-TRAIL (TNF-Related Apoptosis-Inducing Ligand)-mediated cell death [19]. Other research groups have shown evidence that PCTAIRE1 plays a role in tumorigenesis. In serous epithelial ovarian cancer cells, PCTAIRE1 expression is upregulated in terms of both mRNA levels and protein levels [20]. In micro RNA study, the expression of miR-494, which targets PCTAIRE1, is down-regulated in the nasopharyngeal carcinoma, suggesting that PCTAIRE1 is associated with the tumorigenesis of nasopharyngeal carcinoma [21]. Very recently, we reported that the lipid-nanoparticle mediated siRNA transfer against PCTAIRE1 inhibits in vivo tumor growth [22]. In this study, we investigated the role of PCTAIRE1 in the tumorigenesis of cutaneous SCCs and discovered that PCTAIRE1knockdown SCC cells show suppressed cell proliferation along with cell cycle arrest followed by apoptosis, and PCTAIRE1 knockdown led to the accumulation of the tumor suppressor p27, and down-regulation of c-Myc. In tumor xenografts, the conditional knockdown of PCTAIRE1 restored p27 expression and suppressed tumor growth. Clinically, the analysis of primary cutaneous SCC revealed elevated levels of PCTAIRE1 and low expression of p27 in cutaneous SCC. Our study reveals that PCTAIRE1 plays an indispensable role in the tumorigenesis of cutaneous SCC cells, suggesting that this kinase could be a novel target for the future development of cutaneous SCC therapeutics. 2. Materials and methods
scramble control (#1) were purchased from Life Technologies (Carlsbad, CA). 2.3. siRNA transfection For transient knockdown, cells were transfected with siRNA duplexes by a reverse transfection method using Lipofectoamine RNAiMAX according to the manufacturer’s instructions (Life Technologies). 2.4. cDNA transfection For gene transfer, DJM-1 cells were transfected using Lipofectamine 2000according to the manufacturer’s instruction (Life Technologies). EGFP-N1 and EGFP-c-Myc plasmids were used in transfection. 2.5. Retroviral transfection PCTAIRE1 (wild-type or kinase-dead mutant K194 M) was inserted into a pWZL-hygro vector (addgene). Retroviral supernatants were generated according to an established protocol [24]. Briefly, the murine EcoVR was first introduced into DJM-1 cells by using amphotropic virus, in order to make human cells susceptible to the subsequent infection with ecotropic viral vectors. Infected cell populations were selected in hygromycin B for two weeks and expanded. These cells were subsequently transfected with lentivirus for Tet-inducible shRNA.
2.6. Tet-inducible short hairpin RNA constructs, lentivirus and infection PCTAIRE1 shRNA#1 (GCTCTCATCACTCCTTCACTT), PCTAIRE1 shRNA#2 (GACCTACATTAAGCTGGACAA) and scramble-control (CAACAAGATGAAGAGCACCAA) were cloned into the inducible pLKO-Tet-On puromycin vector as previously described [25]. Lentiviral supernatants were generated according to an established protocol. Cells were selected with 2 mg/ml puromycin (MP Biomedicals) and expanded. The induction of shRNA was achieved by the addition of 100 ng/ml doxycycline (Sigma) to the medium.
2.1. Cell lines and cell culture 2.7. Extraction of total RNA and quantitative RT-PCR analysis The human cutaneous SCC cell line A431 cells were purchased from the American Type Culture Collection. The human cutaneous SCC DJM-1 cells were isolated from human skin squamous cell carcinoma [23]. The human oral SCC HSC-3 cells were kindly provided by Dr. Masanobu Shindo (Department of Oral Pathology & Biology, Hokkaido University Graduate School of Dental Medicine). The human immortalized keratinocyte cell line (HaCaT) was purchased from Cell Lines Service (Eppelheim, Germany). Cell lines were cultured in DMEM supplemented with 10% FBS. 2.2. Reagents and antibodies Antibodies against PCTAIRE1 (rabbit: HPA001366, Sigma, St. Louis, MO), p27 (mouse G173-524: BD, Franklin Lakes, NJ), c-Myc (9E10, Roche, Switzerland), phospho-histone H3 (3377, CST), Histone H3 (4499S, CST), beta-actin (Sigma) and horseradishperoxidase (HRP)-conjugated secondary antibodies (GE Health Care, UK) were purchased from the indicated sources. Pre-designed small interfering RNA (siRNA) directed against human PCTAIRE1 (siRNA#1:1472, 50 -GGAGAUCAGACUGGAACAU30 , siRNA#2:1656, 50 -AUGUUCCAGUCUGAUCUCC-30 ) and negative
We isolated total RNA from cultured cells using the RNeasy Plus Mini Kit (Qiagen). RNA concentrations were measured spectrophotometrically and samples were stored at 80 C until use for RT-PCR. We reverse-transcribed RNA using SuperScript IV VILO Master Mix (11756050, Thermo Fisher Scientific) according to the manufacturer’s instructions. Complementary DNA samples were analyzed by the SYBR Green system (Takara). The sequences for primers specific for human PCTAIRE1, p27 and the control housekeeping genes for human GAPDH are as follows: Human PCTAIRE1 Forward: 50 - GCAGTGACCCTGGAGAGG 30 Reverse: 50 - TCAAGTCCTCGTGCACAATC 30 Human p27 Forward: 50 - TTTGACTTGCATGAAGAGAAGC 30 Reverse: 50 - AGCTGTCTCTGAAAGGGACATT 30 Human GAPDH Forward: 50 - GAAGGTGAAGGTCGGAGTC 30 Reverse: 50 - ATGGGATTTCCATTGATGAC 30 All experiments were performed in duplicate and normalized with respect to GAPDH levels.
Please cite this article in press as: T. Yanagi, et al., PCTAIRE1/CDK16/PCTK1 is overexpressed in cutaneous squamous cell carcinoma and regulates p27 stability and cell cycle, J Dermatol Sci (2017), http://dx.doi.org/10.1016/j.jdermsci.2017.02.281
G Model DESC 3138 No. of Pages 9
T. Yanagi et al. / Journal of Dermatological Science xxx (2016) xxx–xxx
3
2.8. Cell cycle analysis by FACS
2.14. Tumor xenograft experiments
Cells were first fixed with cold 70% ethanol and then treated with propidium iodide (20 mg/ml) and ribonuclease A (10 mg/ml) prior to cell cycle analysis using a FACS Aria apparatus (BD). A total of 10,000 events were analyzed.
All animal experiments were approved by the Institutional Animal Case and Use Committee of the Hokkaido University Graduate School of Medicine (15-0164). A431 cells (5.0 106) resuspended in 150 ml Matrigel basement membrane matrix (BD) were injected subcutaneously into the flanks of nu/nu mice. Tumor volumes were calculated using the following formula: (long axis x short axis2)/2.
2.9. Analysis of apoptosis and cell death Cells were processed using an annexin V-PI apoptosis assay kit (FITC-annexin V/propidium iodide staining) according to the manufacturer’s protocol (MBL, Japan). A total of 10,000 events were analyzed by flow cytometry. Cell death was also assessed by trypan blue staining (Bio-Rad, Hercules, CA). 2.10. SDS-PAGE and immunoblotting Cells were washed twice with PBS and harvested with radioimmunoprecipitation assay (RIPA) buffer composed of 20 mM Tris-HCl, pH 7.5, 150 mM NaCl, 0.1 mM EDTA, 1% Nonidet P-40, 0.1% SDS, 5 mM NaF and an EDTA-free cOmplete protease cocktail tablet (Roche, Basel, Switzerland). Cells were left on ice for 20 min and centrifuged at 14,000 x g for 10 min. The Bio-Rad protein assay kit (Bio-Rad) was used to determine protein concentrations. Proteins were separated on SDS-PAGE 4–15% gradient gels (Life Technologies, Carlsbad, CA) and transferred onto PVDF membranes. Membranes were blocked for 1 h in Trisbuffered saline (TBS) with 0.05% Tween-20 and 5% non-fat dry milk, and then incubated overnight at 4 C with primary antibodies diluted in blocking buffer. Membranes were rinsed three times in TBS with 0.05% Tween-20 and incubated with secondary HRPconjugated antibodies for 1 h at room temperature. An enhanced chemiluminescence (ECL) method (GE Health Care) was used for detection.
2.15. Immunohistochemistry Dewaxed tissue sections (4.0-5.0 mm) were immunostained as reported previously [26] using primary antibodies. The application of the primary antibody was followed by incubation with goat antimouse or rabbit polymer-based EnVision-HRP-enzyme conjugate (Dako, Japan). DAB chromogen was applied to yield a brown color. For evaluation of immunohistochemical staining, both the intensity and percentage of positively stained tumor cells were recorded. The total score (with values from 0 to 6) was the staining intensity (negative = 0, weak = 1, moderate = 2, strong = 3) plus the proportion of immunopositive tumor cells (0% = 0, 1–25% = 1, 26– 50% = 2, > 50% = 3). 2.16. Patient specimens For cutaneous SCC, actinic keratosis, Bowen’s disease analyses, skin specimens were procured retrospectively under an Institutional Review Board-approved protocol at the Hokkaido University Hospital (015-0031). 17 patients with locally advanced SCC, 6 patients with actinic keratosis, and 9 patients with Bowen’s disease were enrolled during 2001–2015. Normal epidermis was harvested from same patients as SCC (N = 17). 2.17. Statistical analysis
2.11. Cell viability assays using ATP measurement Cell Titer Glo (Promega, Fitchburg, WI) was used for cell viability estimation. Cells were plated at a density of 5000 cells per well (96-well plates) in 100 ml of culture media and cultured for 72 h. The plates were then removed from the incubator and allowed to equilibrate to room temperature for about 10 min. Cell Titer Glo solution was added at 100 ml per well, and the plates were kept in the dark for 15 min before being assessed for luminescence with a luminometer (Spectra Max Paradigm, Molecular Devices) at a 1-s integration time per sample.
Statistical analysis was performed using the Excel add-in software Statcel1 (OMS Ltd., Tokyo, Japan). Means and standard deviation (SD) were calculated statistically from three determinations. The data are expressed as mean SD. The chi-square goodness-of-fit test was used to check whether the data were normally distributed. In this study, all the data were normally distributed; thus, we used t-tests (Student’s or Welch’s t) to assess the statistical significance of differences between various samples. p < 0.05 was considered significant. 3. Results
2.12. Cell growth assay To measure cell growth rates, 1.0 105 cells with Tet-inducible shRNA targeting PCTAIRE1 were plated onto 60-mm-diameter plates. One day later, the culture media was changed to that with (ON) or without (OFF) doxycycline (100 ng/ml). The cells were counted 1, 3, 5 and 7 days after seeding using the TC20 automated cell counter (Bio-Rad). In the siRNA experiments, the cells were counted 72 h after transfection.
2.13. Clonogenic assay Cells with Tet-inducible shRNA targeting PCTAIRE1 were seeded at 500 cells per well in 6 well (35 mm) dishes. Cells were cultured with (ON) or without (OFF) doxycycline for 14 days before fixing and staining. After fixation by methanol, cells were washed with PBS and incubated with 0.5% crystal violet dye in 25% methanol for 20 min. A colony was defined as a group of at least 50 cells.
3.1. Knockdown of PCTAIRE1 regulates cutaneous SCC cell growth and proliferation To investigate the effect of PCTAIRE1 knockdown in cutaneous SCC A431 cells, we performed tetracycline-inducible shRNA experiments using two shRNAs that were previously shown to effectively target PCTAIRE1 [16]. Quantitative RT-PCR and immunoblotting confirmed the knockdown of mRNA and protein levels by both of the PCTAIRE1-targeting shRNAs (Fig. 1A, Supplementary Fig. 1). The growth rates of doxycycline-stimulated PCTAIRE1 knockdown A431 cells (Tet-ON) were significantly diminished (measured over a 5-day period after seeding), relative to the growth rates of the control cells (Tet-OFF) (Fig. 1B). In clonogenic assays, the number of cancer cell colonies was significantly lower for the PCTAIRE1 knockdown (Tet-ON) group than for the control cell culture (Tet-OFF) group (Fig. 1C). The number of colonies in the PCTAIRE1-knockdown A431 cell (shRNA#1) was greater than that in the shRNA#2 cells, which is consistent with shRNA-mediated
Please cite this article in press as: T. Yanagi, et al., PCTAIRE1/CDK16/PCTK1 is overexpressed in cutaneous squamous cell carcinoma and regulates p27 stability and cell cycle, J Dermatol Sci (2017), http://dx.doi.org/10.1016/j.jdermsci.2017.02.281
G Model DESC 3138 No. of Pages 9
4
T. Yanagi et al. / Journal of Dermatological Science xxx (2016) xxx–xxx
Fig. 1. PCTAIRE1 knockdown diminishes cutaneous SCCA431 cell growth. (A) Protein lysates were generated from A431 cells stably containing inducible shRNAs targeting PCTAIRE1 (shRNA#1, #2), scrambled control cultured for 72 h with or without 100 ng/ml doxycycline and analyzed by immunoblotting. (B) A431 cells (10.0 104) stably containing inducible shRNAs were cultured in 60-mm-diameter plates for 24 h and then stimulated with (ON) or without (OFF) doxycycline. The numbers of cells were counted (mean SD; n = 3). *** p < 0.001 (C) A431 cells stably containing inducible shRNAs were seeded at 500 cells per well in 60 mm dishes. After 24 h, doxycycline was added. Colonies consisting of >50 cells were enumerated on day 14. All data represent mean SD (n = 3). ** p < 0.01, *** p < 0.001
gene knockdown levels (mRNA) (Supplementary Fig. 1). To support the results of shRNA experiments, we performed transient siRNA transfection, in which the target sequences of siRNAs were different from those of shRNAs. siRNA-mediated gene knockdown also diminished A431 cell growth (Supplementary Fig. 2). Similar results were obtained for the SCC DJM-1 and HSC-3 cells (Supplementary Figs. 3 and 4). Further, retrovirus-mediated wild-type PCTAIRE1 restored cancer cell (DJM-1 cell) proliferation in endogenous PCTAIRE1-depleted cells (shRNA#1, targeting untranslated region of PCTAIRE1 mRNA), but neither kinase-dead PCTAIRE1 (K194 M mutant) nor empty vector achieved such restoration (Supplementary Fig. 5). Previously, we assessed the
PCTAIRE1 knockdown effect on skin keratinocytes in terms of cell proliferation and apoptosis. In the human immortalized keratinocyte cell line (HaCaT), PCTAIRE1 knockdown did not affect cell growth as assessed by measurement of ATP levels and by counting of cell numbers [17]. Thus, the proliferation of cutaneous SCC cells may be preferentially dependent on PCTAIRE1. 3.2. Knockdown of PCTAIRE1 results in G2/M arrest, followed by apoptosis in SCC cells To examine the mechanisms of cell growth suppression by PCTAIRE1 knockdown, a trypan-blue staining assay and a
Please cite this article in press as: T. Yanagi, et al., PCTAIRE1/CDK16/PCTK1 is overexpressed in cutaneous squamous cell carcinoma and regulates p27 stability and cell cycle, J Dermatol Sci (2017), http://dx.doi.org/10.1016/j.jdermsci.2017.02.281
G Model DESC 3138 No. of Pages 9
T. Yanagi et al. / Journal of Dermatological Science xxx (2016) xxx–xxx
fluorescent annexin V/propidium iodide (PI) double-staining assay were performed, which showed increases of cell death and apoptosis in cultures of PCTAIRE1 RNAi-treated cells (Fig. 2A and B, Supplementary Fig. 1D). Cell cycle analyses were also performed using FACS-based DNA content analysis of A431 cells, which allowed the percentages of 2N, 4N, polyploid (DNA content > 4N) and hypoploid cells to be quantified. In cultures of PCTAIRE1 knockdown cells, the proportion of G2/M-phase cells (4N DNA content) was increased at 48 h, then declined as hypoploid
5
(apoptotic) cells appeared in the cultures at 96 h (Fig. 2C). These results suggest that, in cutaneous SCC cells, the depletion of PCTAIRE1 results in G2/M arrest, which was followed by apoptosis. Similar results were obtained for the SCC DJM-1 cells (Supplementary Figs. 6A and 7). In DJM-1 cells, there were fewer G2/Marrested cells transfected with siRNA#2 than with siRNA#1, which is consistent with the finding that the mRNA level of PCTAIRE1 in DJM-1 cells transfected with siRNA2 was higher than that with siRNA#1 (Supplementary Fig. 6B). Immunoblotting showed that
Fig. 2. PCTAIRE1 knockdown results in G2/M arrest and apoptosis of A431 cells. (A, B) A431 cells stably containing Tet-inducible shRNAs were cultured with Doxycycline (Dox). (A) 48 h after incubation with Dox, cells stained with annexin V and PI were assessed by FACS analyses. The percentages of apoptotic cells (annexin V positive and PI negative) are shown. All data represent mean SD (n = 3). * p < 0.05, *** p < 0.001 (B) 72 h after incubation with Dox, cells were stained with trypan-blue. The percentages of dead cells (trypan-blue positive) are shown. All data represent mean SD (n = 3). *** p < 0.001 (C) A431 cells stably containing Tet-inducible shRNAs (scramble, shRNA#2) were incubated with Dox for 0, 48, or 96 h and then fixed, treated with RNases and stained with DNA-binding fluorochrome propidium iodide, followed by FACS analysis to determine relative DNA content. Data represent relative DNA (PI fluorescence; x-axis) versus relative cell number (y-axis) and are representative of two experiments.
Please cite this article in press as: T. Yanagi, et al., PCTAIRE1/CDK16/PCTK1 is overexpressed in cutaneous squamous cell carcinoma and regulates p27 stability and cell cycle, J Dermatol Sci (2017), http://dx.doi.org/10.1016/j.jdermsci.2017.02.281
G Model DESC 3138 No. of Pages 9
6
T. Yanagi et al. / Journal of Dermatological Science xxx (2016) xxx–xxx
the PCTAIRE1 knockdown resulted in the increased levels of phospho-histone H3 (Supplementary Fig. 6C), which suggests G2/ M arrest. 3.3. PCTAIRE1 knockdown leads to the accumulation of p27 protein and the down-regulation of c-Myc in cutaneous SCC cells p27 (also known as cyclin-dependent kinase inhibitor 1B, Kip1) is a tumor suppressor that regulates cell proliferation and apoptosis [27,28]. Since PCTAIRE1 plays an important role in p27 phosphorylation and degradation [16], we investigated the role of PCTAIRE1 in regulating p27 protein levels in SCC cells. PCTAIRE1
knockdown by inducible shRNAs or siRNAs up-regulated steadystate p27 protein levels in A431, DJM-1 cell lines (Fig. 3A, Supplementary Fig. 8A, 9A), although mRNA levels of p27 were not up-regulated (Supplementary Fig. 8B, C). Meanwhile, PCTAIRE1 knockdown did not induce p27 up-regulation in HaCaT keratinocytes [17], which correlates with the lack of PCTAIRE1 dependence for the growth of these non-tumorigenic cells. Furthermore, c-Myc amplification has been reported to be associated with PCTAIRE1 dependency in medulloblastomas [29], which prompted us to investigate c-Myc expression levels in PCTAIRE1-knockdown SCC cells. Knockdown of PCTAIRE1 suppressed expression levels of cMyc, as assessed by immunoblotting (Fig. 3A, Supplementary
Fig. 3. PCTAIRE1 knockdown leads to the accumulation of p27, and knockdown of PCTAIRE1 suppresses SCC growth in vivo. (A) Protein lysates were generated from A431 cells stably containing inducible shRNAs targeting PCTAIRE1 (shRNA#1, #2), scrambled control-cultured for 72 h with or without 100 ng/ml doxycycline, and analyzed by immunoblotting. (B) A431 cells (5.0 106) stably containing shRNA#2 were subcutaneously injected into the flanks of nu/nu mice. When tumor volumes reached 150–200 mm3 (Day 4), the animals were provided with water with (red circles) or without (blue circles) 2% doxycycline (“Dox”) (n = 6 mice per group). Tumor volumes (mm3) were measured every other day (mean SD; n = 6). *** p < 0.001 (C, D) Tumors recovered from sacrificed mice at day 14 were weighed (mean = horizontal line, *** p < 0.001) and photographed. (E) Cell lysates from extracted tumors were analyzed by SDS-PAGE/immunoblotting.
Please cite this article in press as: T. Yanagi, et al., PCTAIRE1/CDK16/PCTK1 is overexpressed in cutaneous squamous cell carcinoma and regulates p27 stability and cell cycle, J Dermatol Sci (2017), http://dx.doi.org/10.1016/j.jdermsci.2017.02.281
G Model DESC 3138 No. of Pages 9
T. Yanagi et al. / Journal of Dermatological Science xxx (2016) xxx–xxx
Fig. 9A). Furthermore, we have attempted rescue experiments using pEGFP plasmid-mediated c-Myc overexpression. For these experiments, we employed DJM-1 cells transfected with siRNA targeting PCTAIRE1 (siRNAs #1, #2) and scramble control. c-Myc overexpression partially rescued cell growth in PCTAIRE1knockdown DJM-1 cells (Supplementary Fig. 9B, C). 3.4. Knockdown of PCTAIRE1 suppresses SCC growth in vivo To extend these studies into an in vivo context, we used SCC A431 cells containing inducible PCTAIRE1 shRNA (#2, which is a more effective PCTAIRE1 gene knockdown than shRNA#1 knockdown, Supplementary Fig. 1) in a tumor xenograft model. Immunocompromised (nu/nu) mice were injected subcutaneously with A431 cells, and tumors were allowed to grow for four days before doxycycline was added to the drinking water to induce the shRNA vector. Induction of PCTAIRE1 shRNA expression remarkably suppressed tumor growth in vivo (Fig. 3B–D). Immunoblot analyses showed elevated levels of p27 protein and downregulated c-Myc protein in the PCTAIRE1 knockdown A431 tumor xenografts (Fig. 3E), consistent with our studies using cultured cells. 3.5. PCTAIRE1 levels are elevated in cutaneous SCC tissues We assessed the levels of PCTAIRE1 expression in primary SCC tumor specimens by immunohistochemistry. PCTAIRE1 immunostaining was very low in normal epidermis and was markedly higher in cutaneous SCC (Fig. 4A and B). We further examined the
7
expression of p27 in the cutaneous SCC samples. Negative or weak p27 immunostaining was significantly more common in tumor tissues than in normal epidermis. These findings suggest that the expression levels of p27 are inversely correlated with the expression level of PCTAIRE1, consistent with our cell culture results showing that knockdown of PCTAIRE1 stabilizes p27. We also assessed PCTAIRE1 and p27 levels in specimens of actinic keratosis and Bowen’s disease (Supplementary Fig. 10). In the Bowen’s disease specimen, the expression levels of PCTAIRE1 were significantly higher than those of normal epidermis. The expression levels of p27 were also higher than those in invasive SCC and normal epidermis, which is consistent with a previous report [19]. In actinic keratosis, significant differences were not observed in PCTAIRE1 nor in p27 immunostaining scores compared to those of normal epidermis. 3.6. Expressions of PCTAIRE1 and c-Myc are associated with PCTAIRE1dependency Finally, we assessed PCTAIRE1, p27, and c-Myc protein expression levels in various cell lines used in this study (Supplementary Fig. 11). PCTAIRE1 protein levels were substantially higher in SCC cancer lines A431, DJM-1, and HSC-3 cells and normal keratinocytes (proliferating state) than in immortalized human adult keratinocyte HaCaT cells. We also assessed p27 expression levels and found that p27 expression levels were high in A431cells but were low in DJM-1and HSC-3 cells and normal human keratinocyte. c-Myc expression levels were low in normal keratinocytes but high in PCTAIRE1-dependent cancer cells (A431,
Fig. 4. Elevated levels of PCTAIRE1 in cutaneous SCC. PCTAIRE1 and p27 immunostainings were performed using cutaneous SCC samples (N = 17). (A) Representative examples of PCTAIRE1, p27 immunostaining results are provided for normal epidermis and cutaneous squamous cell carcinoma (SCC). Scale Bar = 50 mm. (B) Data (mean SD) comparing normal epidermis (N = 17) is shown. ** p < 0.01, *** p < 0.001 (C) Model of PCTAIRE1/CDK16/PCTK1 function. In squamous cell carcinoma, overexpressed PCTAIRE1 phosphorylates p27, thereby promoting p27 degradation, which leads to cell cycle progression and anti-apoptosis. Knockdown of PCTAIRE1 leads to the accumulation of p27, which suppresses the expression of c-Myc (aberrantly overexpressed in SCC). In normal epidermis, the expression levels of PCTAIRE1 are low, and the role in skin homeostasis is not evident.
Please cite this article in press as: T. Yanagi, et al., PCTAIRE1/CDK16/PCTK1 is overexpressed in cutaneous squamous cell carcinoma and regulates p27 stability and cell cycle, J Dermatol Sci (2017), http://dx.doi.org/10.1016/j.jdermsci.2017.02.281
G Model DESC 3138 No. of Pages 9
8
T. Yanagi et al. / Journal of Dermatological Science xxx (2016) xxx–xxx
DJM-1, and HSC-3 cells) and HaCaT cells. These results suggest that PCTAIRE1-dependency is associated with the combination of high PCTAIRE1 and high c-Myc. 4. Discussion This study has reported that PCTAIRE1 plays a crucial role in cutaneous SCC cell proliferation, with PCTAIRE1 knockdown resulting in elevated p27 levels (Fig. 4C). The protein p27 (also known as Kip1) is a tumor suppressor that regulates cell cycle, motility and apoptosis [27,28]. Consistent with its tumor suppressor function, low expression of nuclear p27 is observed in cutaneous SCC compared with normal epidermis, actinic keratosis, and Bowen’s disease [30,31]. Also, in head and neck SCC, the expression of p27 is a significant independent prognostic factor [32,33]. In contrast to other tumor suppressors such as p53, loss of nuclear p27 expression occurs via increased proteasomal degradation, not through genetic mutations [28]. Especially, the proteasomal degradation mechanism with the E3 ligase Skp2 plays the crucial role in regulation of p27 expression [28,34,35]. An inverse correlation between p27 and Skp2 protein expression levels has been reported in many cancers, including cutaneous SCC [31]. In our study using SCC cell lines, PCTAIRE1 knockdown upregulated the expression of p27, indicating that PCTAIRE1 plays an important role in p27 dysregulation similar to that of Skp2. We also examined the effect of overexpression of PCTAIRE1 in squamous cell carcinoma cell lines. However, overexpression of PCTAIRE1 did not enhance the tumor cell growth in A431 and DJM-1. These results suggest that the requirement of PCTAIRE1 kinase is not very high; endogenous expression is sufficient for tumor cell growth. Our study also shows that the up-regulation of p27 is associated with the G2-M phase cell cycle arrest followed by apoptosis of SCC cells. These results are consistent with our previous study which showed that the up-regulation of p27 induced by PCTAIRE1 knockdown leads to late G2-M phase arrest followed by apoptosis in prostate, breast and cervical cancer cell lines [16]. However, we observed that experimental overexpression of p27 by itself is insufficient to cause G2/M arrest in cancer cells including cutaneous SCC DJM-1 and A431 cells (not shown); thus, other factors influenced by PCTAIRE1 evidently contribute to the cell cycle arrest phenotype. In fact, the PCTAIRE1 (K194 M) kinase dead mutant partially rescued the cell growth of PCTAIRE1 knockdown (Supplementary Fig. 5B). These results suggest that PCTAIRE1 has a multifunctional role that goes beyond just the phosphorylation of p27. Further, melanoma A2058 cells showed apoptosis without obvious cell cycle arrest following PCTAIRE1 knockdown [17]. Therefore, the effect of PCTAIRE1 knockdown varies depending on the cancer cells. Our study also showed that PCTAIRE1 knockdown leads to down-regulation of c-Myc, as well as accumulation of p27. Previously, the loss of p27 was reported to synergize with Myc in murine lymphangiogenesis [36]. p27 has been reported to bind c-Myc, leading to the proteasomal degradation of c-Myc [37]. Clinically, Myc gene copy number aberrations and overexpression of c-Myc are common in cutaneous SCC, suggesting that MYC may play a relevant role in SCC tumorigenesis [38–40]. Herein, our study shows that the combination of high PCTAIRE1 and high cMyc is a characteristic of PCTAIRE1-dependent SCC cells. The above knowledge leads us to propose a novel mechanism for knockdown of PCTAIRE1, in which such knockdown leads to the accumulation of p27, promoting the degradation of aberrantly overexpressed cMyc in SCC (Fig. 4C). PCTAIRE1 is a member of the Cdk-family kinases, and these usually require cyclins for activation. PCTAIRE1 is reportedly activated by interactions with cyclin Y [8,10]. Very recently, mice deficient in cyclin Y-like 1 (ccnyl1) were reported to show infertility
and low expression of the PCTAIRE1 in the murine testes, which suggests that cyclin Y-like 1 regulates the expression and kinase activity of PCTAIRE1 [41]. Although the mechanisms of human PCTAIRE1 activation are unclear, PCTAIRE1 activity in human cancer cells may depend on the expression of cyclin Y or cyclin Ylike 1. In conclusion, we revealed an unrecognized role of PCTAIRE1 in cutaneous SCC cell survival, suggesting that PCTAIRE1-targeted therapy could restore the expression of p27 and down-regulate cMyc expression. PCTAIRE1 is overexpressed in cutaneous malignancies including SCC and melanoma, for which we do not have effective therapeutic weapons, especially in metastatic SCC and nivolumab-resistant melanoma. To date, PCTAIRE1 kinase inhibitors and in vivo therapeutic trials have been reported with promising results; moreover, the inhibition of PCTAIRE1 is known to have synergistic effects with extrinsic cell death cytokines [19]. Thus, PCTAIRE1/Cdk16 may be a novel therapeutic target in intractable/metastatic skin cancers. In future, more specific and effective PCTAIRE1/Cdk16 inhibitors, as well as i n vivo siRNA delivery methods should be investigated. Conflict of interest The authors have no conflict of interest to declare. Appendix A. Supplementary data Supplementary data associated with this article can be found, in the online version, at http://dx.doi.org/10.1016/j. jdermsci.2017.02.281. References [1] V. Madan, V.J.T. Lear, R.M. Szeimies, Non-melanoma skin cancer, Lancet 375 (2010) 673–685. [2] A. Stratigos, C. Garbe, C. Lebbe, J. Malvehy, V. Marmol, H. Pehamberger, et al., Diagnosis and treatment of invasive squamous cell carcinoma of the skin: European consensus-based interdisciplinary guideline, Eur. J. Cancer 51 (2015) 1989–2007. [3] Z. Kopecki, G.N. Yang, J.E. Jackson, E.L. Melville, M.P. Calley, D.F. Murrell, et al., Cytoskeletal protein Flightless I inhibits apoptosis: enhances tumor cell invasion and promotes cutaneous squamous cell carcinoma progression, Oncotarget 6 (2015) 36426–36440. [4] A.S. Weinberg, C.A. Ogle, E.K. Shim, Metastatic cutaneous squamous cell carcinoma: an update, Dermatol. Surg. 33 (2007) 885–899. [5] A.R. Cole, PCTK proteins: the forgotten brain kinases, Neurosignals 17 (2009) 288–297. [6] F. Le Bouffant, P. Le Minter, E. Traiffort, M. Ruat, F. Sladeczek, Multiple subcellular localizations of PCTAIRE-1 in brain, Mol. Cell. Neurosci. 16 (2000) 388–395. [7] C.Y. Ou, V.Y. Poon, C.I. Maeder, S. Watanabe, E.K. Lehrman, A.K. Fu, et al., Two cyclin-dependent kinase pathways are essential for polarized trafficking of presynaptic components, Cell 141 (2010) 846–858. [8] P. Mikolcevic, R. Sigl, V. Rauch, M.W. Hess, K. Pfaller, M. Barisic, et al., Cyclindependent kinase 16/PCTAIRE kinase 1 is activated by cyclin Y and is essential for spermatogenesis, Mol. Cell. Biol. 32 (2012) 868–879. [9] R. Graeser, J. Gannon, R.Y. Poon, T. Dubois, A. Aitken, T. Hunt, Regulation of the CDK-related protein kinase PCTAIRE-1 and its possible role in neurite outgrowth in Neuro-2A cells, J. Cell. Sci. 115 (2002) 3479–3490. [10] S.N. Shehata, M. Deak, N.A. Morrice, E. Ohta, R.W. Hunter, V.M. Kalscheuer, et al., Cyclin Y. phosphorylation- and 14-3-3-binding-dependent activation of PCTAIRE-1/CDK16, Biochem. J 469 (2015) 409–420. [11] K. Cheng, Z. Li, W.Y. Fu, J.H. Wang, A.K. Fu, N.Y. Ip, Pctaire1 interacts with p35 and is a novel substrate for Cdk5/p35, J. Biol. Chem. 277 (2002) 31988–31993. [12] Y. Liu, K. Cheng, K. Gong, A.K. Fu, N.Y. Ip, Pctaire1 phosphorylates Nethylmaleimide-sensitive fusion protein: implications in the regulation of its hexamerization and exocytosis, J. Biol. Chem. 281 (2006) 9852–9858. [13] S. Charrasse, I. Carena, J. Hagmann, K. Woods-Cook, S. Ferrari, PCTAIRE-1: characterization subcellular distribution, and cell cycle-dependent kinase activity, Cell. Growth. Differ. 10 (1999) 611–620. [14] K.J. Palmer, J.E. Konkel, D.J. Stephens, PCTAIRE protein kinases interact directly with the COPII complex and modulate secretory cargo transport, J. Cell. Sci. 118 (2005) 3839–3847. [15] S. Iwano, A. Satou, S. Matsumura, N. Sugiyama, Y. Ishihama, F. Toyoshima, PCTK1 regulates integrin-dependent spindle orientation via protein kinase A regulatory subunit KAP0 and myosin X, Mol. Cell. Biol. 35 (2015) 1197–1208.
Please cite this article in press as: T. Yanagi, et al., PCTAIRE1/CDK16/PCTK1 is overexpressed in cutaneous squamous cell carcinoma and regulates p27 stability and cell cycle, J Dermatol Sci (2017), http://dx.doi.org/10.1016/j.jdermsci.2017.02.281
G Model DESC 3138 No. of Pages 9
T. Yanagi et al. / Journal of Dermatological Science xxx (2016) xxx–xxx [16] T. Yanagi, M. Krajewska, S. Matsuzawa, J.C. Reed, PCTAIRE1 phosphorylates p27 and regulates mitosis in cancer cells, Cancer. Res. 74 (2014) 5795–5807. [17] T. Yanagi, J.C. Reed, S. Matsuzawa, PCTAIRE1 regulates p27 stability: apoptosis and tumor growth in malignant melanoma, Oncoscience 1 (2014) 624–633. [18] T. Yanagi, S. Matsuzawa, PCTAIRE1/PCTK1/CDK16: a new oncotarget? Cell Cycle 14 (2015) 463–464. [19] T. Yanagi, R. Shi, P. Aza-Blanc, J.C. Reed, S. Matsuzawa, PCTAIRE1-knockdown sensitizes cancer cells to TNF family cytokines, PLoS One 10 (2015) e0119404. [20] Q. Zhou, Y. Yu, Upregulated CDK16 expression in serous epithelial ovarian cancer cells, Med. Sci. Monit. 21 (2015) 3409–3414. [21] H.F. Duan, X.Q. Li, H.Y. Hu, Y.C. Li, Z. Cai, X.S. Mei, et al., Functional elucidation of miR-494 in the tumorigenesis of nasopharyngeal carcinoma, Tumour. Biol. 36 (2015) 6679–6689. [22] T. Yanagi, K. Tachikawa, R. Wilkie-Grantham, A. Hishiki, K. Nagai, E. Toyonaga, et al., Lipid nanoparticle-mediated siRNA transfer against PCTAIRE1/PCTK1/ Cdk16 inhibits in vivo cancer growth Mol, Ther. Nucleic Acids 5 (2016) e327. [23] Y. Kitajima, S. Inoue, H. Yaoita, Effects of pemphigus antibody on the regeneration of cell–cell contact in keratinocyte cultures grown in low to normal Ca + + concentration, J. Invest. Dermatol. 89 (1987) 167–171. [24] K. Sasai, T. Akagi, E. Aoyanagi, K. Tabu, S. Kaneko, S. Tanaka, O6-methylguanineDNA methyltransferase is downregulated in transformed astrocyte cells: implications for anti-glioma therapies, Mol. Cancer 6 (2007) 36. [25] D. Wiederschain, S. Wee, L. Chen, A. Loo, G. Yang, A. Huang, et al., Single-vector inducible lentiviral RNAi system for oncology target validation, Cell Cycle 8 (2009) 498–504. [26] M. Krajewska, L.H. Smith, J. Rong, X. Huang, M.L. Hyer, N. Zeps, et al., Image analysis algorithms for immunohistochemical assessment of cell death events and fibrosis in tissue sections, J. Histochem. Cytochem. 57 (2009) 649–663. [27] P.L. Porter, K.E. Malone, P.J. Heagerty, G.M. Alexander, L.A. Gatti, E.J. Firpo, et al., Expression of cell-cycle regulators p27Kip1 and cyclin E alone and in combination, correlate with survival in young breast cancer patients, Nat. Med. 3 (1997) 222–225. [28] I.M. Chu, L. Hengst, J.M. Slingerland, The Cdk inhibitor p27 in human cancer: prognostic potential and relevance to anticancer therapy, Nat. Rev. Cancer. 8 (2008) 253–267. [29] P. Cwiek, Z. Leni, F. Salm, V. Dimitrova, B. Styp-Rekowska, G. Chiriano, et al., RNA interference screening identifies a novel role for PCTK1/CDK16 in medulloblastoma with c-Myc amplification, Oncotarget 6 (2015) 116–129.
9
[30] C.W. Oh, N. Penneys, p27 and mib1 expression in actinic keratosis Bowen disease, and squamous cell carcinoma, Am. J. Dermatopathol. 26 (2004) 22–26. [31] M.T. Fernández-Figueras, L. Puig, E. Musulen, M. Gilaberte, C. Ferrándiz, E. Lerma, et al., Prognostic significance of p27Kip1 p45Skp2 and Ki67 expression profiles in Merkel cell carcinoma, extracutaneous small cell carcinoma, and cutaneous squamous cell carcinoma, Histopathology 46 (2005) 614–621. [32] M.R. De Almeida, M. Pérez-Sayáns, J.M. Suárez-Peñaranda, J.M. SomozaMartín, A. García-García, p27Kip1 expression as a prognostic marker for squamous cell carcinoma of the head and neck, Oncol. Lett. 10 (2015) 2675– 2682. [33] G. Salerno, D. Di Vizio, S. Staibano, G. Mottola, G. Quaremba, M. Mascolo, et al., Prognostic value of p27Kip1 expression in Basaloid Squamous Cell Carcinoma of the larynx, BMC Cancer 6 (2006) 146. [34] A. Besson, S.F. Dowdy, J.M. Roberts, CDK inhibitors: cell cycle regulators and beyond, Dev. Cell. 14 (2008) 159–169. [35] Y. Nagano, T. Fukushima, K. Okemoto, K. Tanaka, D.D. Bowtell, Z. Ronai, et al., Siah1/SIP regulates p27(kip1) stability and cell migration under metabolic stress, Cell Cycle 10 (2011) 2592–2602. [36] C.P. Martins, A. Berns, Loss of p27(Kip1) but not p21(Cip1) decreases survival and synergizes with MYC in murine lymphomagenesis, EMBO J. 21 (2002) 3739–3748. [37] F. Bahram, P. Hydbring, S. Tronnersjö, S.M. Zakaria, O. Frings, S. Fahlén, et al., Interferon-g-induced p27KIP1 binds to and targets MYC for proteasomemediated degradation, Oncotarget 7 (2016) 2837–2854. [38] A. Toll, R. Salgado, M. Yébenes, G. Martín-Ezquerra, M. Gilaberte, T. Baró, et al., MYC gene numerical aberrations in actinic keratosis and cutaneous squamous cell carcinoma, Br. J. Dermatol. 161 (2009) 1112–1118. [39] M.S. Jacobs, D.L. Persons, G.R. Fraga, EGFR and MYC gene copy number aberrations are more common in squamous cell carcinoma than keratoacanthoma: a FISH study, J. Cutan. Pathol. 40 (2013) 447–454. [40] Y. Zheng, G.R. Wang, J.J. Jia, S.J. Luo, H. Wang, S.X. Xiao, Expressions of oncogenes c-fos and c-myc in skin lesion of cutaneous squamous cell carcinoma, Asian. Pac. J. Trop. Med. 7 (2014) 761–764. [41] Z. Zi, Z. Zhang, Q. Li, W. An, L. Zeng, D. Gao, et al., CCNYL1, but not CCNY, cooperates with CDK16 to regulate spermatogenesis in mouse, PLoS Genet. 11 (2015) e1005485.
Please cite this article in press as: T. Yanagi, et al., PCTAIRE1/CDK16/PCTK1 is overexpressed in cutaneous squamous cell carcinoma and regulates p27 stability and cell cycle, J Dermatol Sci (2017), http://dx.doi.org/10.1016/j.jdermsci.2017.02.281
Journal of Dermatological Science xxx (2016) xxx–xxx
Contents lists available at ScienceDirect
Journal of Dermatological Science journal homepage: www.jdsjournal.com
PCTAIRE1/CDK16/PCTK1 is overexpressed in cutaneous squamous cell carcinoma and regulates p27 stability and cell cycle$ Teruki Yanagia,* , Hiroo Hataa , Eri Mizunoa , Shinya Kitamuraa , Keisuke Imafukua , Shinichi Nakazatoa , Lei Wangb , Hiroshi Nishiharab , Shinya Tanakab , Hiroshi Shimizua a b
Department of Dermatology, Hokkaido University Graduate School of Medicine, Japan Department of Translational Pathology, Hokkaido University Graduate School of Medicine, Japan
A R T I C L E I N F O
A B S T R A C T
Article history: Received 2 December 2016 Received in revised form 8 February 2017 Accepted 20 February 2017
Background: PCTAIRE1 (also known as cyclin-dependent kinase 16 (Cdk16) and PCTK1) is a Cdk family protein that has been implicated in spermatogenesis. We recently revealed the function of PCTAIRE1 in the tumorigenesis of malignancies, including breast and prostate cancers; however, the tumorigenic function of PCTAIRE1 in cutaneous squamous cell carcinoma (SCC) remains unclear. Objective: In this study, we investigated the role of PCTAIRE1 in the tumorigenesis of cutaneous SCCs. Methods and results: In cutaneous/oral SCC A431, DJM-1, HSC-3 cells, PCTAIRE1 gene-knockdown was found to diminish cell proliferation as assessed by cell counting and clonogenic assays. FACS analyses of annexin V-PI staining and DNA content showed PCTAIRE1 knockdown to cause G2/M arrest followed by apoptosis. The depletion of PCTAIRE1 was found to lead to the accumulation of tumor suppressor p27 and down-regulation of c-Myc. In tumor xenografts of A431 cells, the conditional knockdown of PCTAIRE1 restores p27 protein expression and suppresses tumor growth. Clinically, in primary tumors from patients with SCC, PCTAIRE1 is more highly expressed in malignant lesions than in adjacent normal epidermis. Conversely, expression levels of p27 are significantly lower in SCC than in normal epidermis. Conclusions: Our findings reveal a crucial function for PCTAIRE1 in regulating p27, c-Myc levels and tumor growth in cutaneous SCC cells, suggesting that PCTAIRE1 could be a novel target for skin tumor treatment. © 2017 Japanese Society for Investigative Dermatology. Published by Elsevier Ireland Ltd. All rights reserved.
Keywords: Cutaneous squamous cell carcinoma Cyclin dependent kinase p27 Cell cycle
1. Introduction Cutaneous squamous cell carcinoma (SCC) is one of the most common cancers in Caucasian populations, accounting for 20–30% of cutaneous malignancies in this group [1,2]. The risk of metastasis is low in most patients, not exceeding 3–5% [1]; however, aggressive SCC is associated with very high morbidity and mortality [3]. Although cutaneous SCC can be treated by
Abbreviations: Cdk, cyclin-dependent kinase; Dox, doxycycline; PI, propidium iodide; SCC, squamous cell carcinoma. $ This work was supported by Japan Society for the Promotion of Science (JSPS) Grants-in-Aid for Young Scientists (grant number 15H05998, grant number 16K1970106 to T.Y), by Practical Research for Innovative Cancer Control from the Japan Agency for Medical Research and Development (AMED) (grant number 15ck016175h0001 to T.Y), by a research grant from GlaxoSmithKline Japan, and by a research grant from the Nakatomi Foundation. * Corresponding author. at: Department of Dermatology, Hokkaido University Graduate School of Medicine N15 W7, Kita-ku, Sapporo 060-8638, Japan. E-mail address: [email protected] (T. Yanagi).
surgical removal, radiation or chemotherapy, or by a combination of these therapies, the prognosis of patients with metastatic SCC is poor [2,4]. To obtain effective but less toxic therapies, the detailed characterization of the molecular mechanisms involved in cutaneous SCC pathogenesis and the identification of new drug targets are very important. PCTAIRE1 (also known as cyclin-dependent kinase 16 (Cdk16) and PCTK1) is a member of the PCTAIRE family, a group of kinases related to the Cdk family [5]. PCTAIRE1 is expressed ubiquitously, but with the highest levels in neurons (the brain) and the testes [6]. It was suggested that PCTAIRE1 has a physiological function, based on findings from the neurons of mutant PCT-1 nematodes, which showed altered axonal vesicle transport [7], and it was suggested that mammalian PCTAIRE1 is essential for spermatogenesis, based on gene knockout studies in mice [8]. Although PCTAIRE1 has amino acids sequences similar to the cyclin binding sites found in Cdk family proteins [5], the mechanisms of its activation are unclear [9]. PCTAIRE1 is known to be activated by interactions with cyclin Y [8,10], although PCTAIRE1 binding with a Cdk5 activator
http://dx.doi.org/10.1016/j.jdermsci.2017.02.281 0923-1811/ © 2017 Japanese Society for Investigative Dermatology. Published by Elsevier Ireland Ltd. All rights reserved.
Please cite this article in press as: T. Yanagi, et al., PCTAIRE1/CDK16/PCTK1 is overexpressed in cutaneous squamous cell carcinoma and regulates p27 stability and cell cycle, J Dermatol Sci (2017), http://dx.doi.org/10.1016/j.jdermsci.2017.02.281
G Model DESC 3138 No. of Pages 9
2
T. Yanagi et al. / Journal of Dermatological Science xxx (2016) xxx–xxx
does not activate its kinase activity [11]. The PCTAIRE1 substrate phosphorylation consensus sequence is currently undefined, although PCTAIRE1 is known to bind and phosphorylate Ser569 in the vesicular transport protein NSF [12] and to phosphorylate myelin basic protein in vitro [13]. PCTAIRE1 also interacts with the COPII complex, which is involved in the export of proteins secreted from the endoplasmic reticulum [14]. PCTAIRE1 has been reported to regulate integrin-dependent spindle orientation in cell division [15]. Recently, we presented evidence that PCTAIRE1 plays an indispensable role in the proliferation of some types of cancer cells, in that PCTAIRE1-depleted malignant cells show apoptosis with mitotic arrest associated with centrosome dysregulation [16–18]. Moreover, we showed that PCTAIRE1 directly binds with p27 and promotes phosphorylation at Ser10, leading to the degradation of this tumor suppressor [16]. We also discovered that PCTAIRE1 plays a crucial role in anti-TRAIL (TNF-Related Apoptosis-Inducing Ligand)-mediated cell death [19]. Other research groups have shown evidence that PCTAIRE1 plays a role in tumorigenesis. In serous epithelial ovarian cancer cells, PCTAIRE1 expression is upregulated in terms of both mRNA levels and protein levels [20]. In micro RNA study, the expression of miR-494, which targets PCTAIRE1, is down-regulated in the nasopharyngeal carcinoma, suggesting that PCTAIRE1 is associated with the tumorigenesis of nasopharyngeal carcinoma [21]. Very recently, we reported that the lipid-nanoparticle mediated siRNA transfer against PCTAIRE1 inhibits in vivo tumor growth [22]. In this study, we investigated the role of PCTAIRE1 in the tumorigenesis of cutaneous SCCs and discovered that PCTAIRE1knockdown SCC cells show suppressed cell proliferation along with cell cycle arrest followed by apoptosis, and PCTAIRE1 knockdown led to the accumulation of the tumor suppressor p27, and down-regulation of c-Myc. In tumor xenografts, the conditional knockdown of PCTAIRE1 restored p27 expression and suppressed tumor growth. Clinically, the analysis of primary cutaneous SCC revealed elevated levels of PCTAIRE1 and low expression of p27 in cutaneous SCC. Our study reveals that PCTAIRE1 plays an indispensable role in the tumorigenesis of cutaneous SCC cells, suggesting that this kinase could be a novel target for the future development of cutaneous SCC therapeutics. 2. Materials and methods
scramble control (#1) were purchased from Life Technologies (Carlsbad, CA). 2.3. siRNA transfection For transient knockdown, cells were transfected with siRNA duplexes by a reverse transfection method using Lipofectoamine RNAiMAX according to the manufacturer’s instructions (Life Technologies). 2.4. cDNA transfection For gene transfer, DJM-1 cells were transfected using Lipofectamine 2000according to the manufacturer’s instruction (Life Technologies). EGFP-N1 and EGFP-c-Myc plasmids were used in transfection. 2.5. Retroviral transfection PCTAIRE1 (wild-type or kinase-dead mutant K194 M) was inserted into a pWZL-hygro vector (addgene). Retroviral supernatants were generated according to an established protocol [24]. Briefly, the murine EcoVR was first introduced into DJM-1 cells by using amphotropic virus, in order to make human cells susceptible to the subsequent infection with ecotropic viral vectors. Infected cell populations were selected in hygromycin B for two weeks and expanded. These cells were subsequently transfected with lentivirus for Tet-inducible shRNA.
2.6. Tet-inducible short hairpin RNA constructs, lentivirus and infection PCTAIRE1 shRNA#1 (GCTCTCATCACTCCTTCACTT), PCTAIRE1 shRNA#2 (GACCTACATTAAGCTGGACAA) and scramble-control (CAACAAGATGAAGAGCACCAA) were cloned into the inducible pLKO-Tet-On puromycin vector as previously described [25]. Lentiviral supernatants were generated according to an established protocol. Cells were selected with 2 mg/ml puromycin (MP Biomedicals) and expanded. The induction of shRNA was achieved by the addition of 100 ng/ml doxycycline (Sigma) to the medium.
2.1. Cell lines and cell culture 2.7. Extraction of total RNA and quantitative RT-PCR analysis The human cutaneous SCC cell line A431 cells were purchased from the American Type Culture Collection. The human cutaneous SCC DJM-1 cells were isolated from human skin squamous cell carcinoma [23]. The human oral SCC HSC-3 cells were kindly provided by Dr. Masanobu Shindo (Department of Oral Pathology & Biology, Hokkaido University Graduate School of Dental Medicine). The human immortalized keratinocyte cell line (HaCaT) was purchased from Cell Lines Service (Eppelheim, Germany). Cell lines were cultured in DMEM supplemented with 10% FBS. 2.2. Reagents and antibodies Antibodies against PCTAIRE1 (rabbit: HPA001366, Sigma, St. Louis, MO), p27 (mouse G173-524: BD, Franklin Lakes, NJ), c-Myc (9E10, Roche, Switzerland), phospho-histone H3 (3377, CST), Histone H3 (4499S, CST), beta-actin (Sigma) and horseradishperoxidase (HRP)-conjugated secondary antibodies (GE Health Care, UK) were purchased from the indicated sources. Pre-designed small interfering RNA (siRNA) directed against human PCTAIRE1 (siRNA#1:1472, 50 -GGAGAUCAGACUGGAACAU30 , siRNA#2:1656, 50 -AUGUUCCAGUCUGAUCUCC-30 ) and negative
We isolated total RNA from cultured cells using the RNeasy Plus Mini Kit (Qiagen). RNA concentrations were measured spectrophotometrically and samples were stored at 80 C until use for RT-PCR. We reverse-transcribed RNA using SuperScript IV VILO Master Mix (11756050, Thermo Fisher Scientific) according to the manufacturer’s instructions. Complementary DNA samples were analyzed by the SYBR Green system (Takara). The sequences for primers specific for human PCTAIRE1, p27 and the control housekeeping genes for human GAPDH are as follows: Human PCTAIRE1 Forward: 50 - GCAGTGACCCTGGAGAGG 30 Reverse: 50 - TCAAGTCCTCGTGCACAATC 30 Human p27 Forward: 50 - TTTGACTTGCATGAAGAGAAGC 30 Reverse: 50 - AGCTGTCTCTGAAAGGGACATT 30 Human GAPDH Forward: 50 - GAAGGTGAAGGTCGGAGTC 30 Reverse: 50 - ATGGGATTTCCATTGATGAC 30 All experiments were performed in duplicate and normalized with respect to GAPDH levels.
Please cite this article in press as: T. Yanagi, et al., PCTAIRE1/CDK16/PCTK1 is overexpressed in cutaneous squamous cell carcinoma and regulates p27 stability and cell cycle, J Dermatol Sci (2017), http://dx.doi.org/10.1016/j.jdermsci.2017.02.281
G Model DESC 3138 No. of Pages 9
T. Yanagi et al. / Journal of Dermatological Science xxx (2016) xxx–xxx
3
2.8. Cell cycle analysis by FACS
2.14. Tumor xenograft experiments
Cells were first fixed with cold 70% ethanol and then treated with propidium iodide (20 mg/ml) and ribonuclease A (10 mg/ml) prior to cell cycle analysis using a FACS Aria apparatus (BD). A total of 10,000 events were analyzed.
All animal experiments were approved by the Institutional Animal Case and Use Committee of the Hokkaido University Graduate School of Medicine (15-0164). A431 cells (5.0 106) resuspended in 150 ml Matrigel basement membrane matrix (BD) were injected subcutaneously into the flanks of nu/nu mice. Tumor volumes were calculated using the following formula: (long axis x short axis2)/2.
2.9. Analysis of apoptosis and cell death Cells were processed using an annexin V-PI apoptosis assay kit (FITC-annexin V/propidium iodide staining) according to the manufacturer’s protocol (MBL, Japan). A total of 10,000 events were analyzed by flow cytometry. Cell death was also assessed by trypan blue staining (Bio-Rad, Hercules, CA). 2.10. SDS-PAGE and immunoblotting Cells were washed twice with PBS and harvested with radioimmunoprecipitation assay (RIPA) buffer composed of 20 mM Tris-HCl, pH 7.5, 150 mM NaCl, 0.1 mM EDTA, 1% Nonidet P-40, 0.1% SDS, 5 mM NaF and an EDTA-free cOmplete protease cocktail tablet (Roche, Basel, Switzerland). Cells were left on ice for 20 min and centrifuged at 14,000 x g for 10 min. The Bio-Rad protein assay kit (Bio-Rad) was used to determine protein concentrations. Proteins were separated on SDS-PAGE 4–15% gradient gels (Life Technologies, Carlsbad, CA) and transferred onto PVDF membranes. Membranes were blocked for 1 h in Trisbuffered saline (TBS) with 0.05% Tween-20 and 5% non-fat dry milk, and then incubated overnight at 4 C with primary antibodies diluted in blocking buffer. Membranes were rinsed three times in TBS with 0.05% Tween-20 and incubated with secondary HRPconjugated antibodies for 1 h at room temperature. An enhanced chemiluminescence (ECL) method (GE Health Care) was used for detection.
2.15. Immunohistochemistry Dewaxed tissue sections (4.0-5.0 mm) were immunostained as reported previously [26] using primary antibodies. The application of the primary antibody was followed by incubation with goat antimouse or rabbit polymer-based EnVision-HRP-enzyme conjugate (Dako, Japan). DAB chromogen was applied to yield a brown color. For evaluation of immunohistochemical staining, both the intensity and percentage of positively stained tumor cells were recorded. The total score (with values from 0 to 6) was the staining intensity (negative = 0, weak = 1, moderate = 2, strong = 3) plus the proportion of immunopositive tumor cells (0% = 0, 1–25% = 1, 26– 50% = 2, > 50% = 3). 2.16. Patient specimens For cutaneous SCC, actinic keratosis, Bowen’s disease analyses, skin specimens were procured retrospectively under an Institutional Review Board-approved protocol at the Hokkaido University Hospital (015-0031). 17 patients with locally advanced SCC, 6 patients with actinic keratosis, and 9 patients with Bowen’s disease were enrolled during 2001–2015. Normal epidermis was harvested from same patients as SCC (N = 17). 2.17. Statistical analysis
2.11. Cell viability assays using ATP measurement Cell Titer Glo (Promega, Fitchburg, WI) was used for cell viability estimation. Cells were plated at a density of 5000 cells per well (96-well plates) in 100 ml of culture media and cultured for 72 h. The plates were then removed from the incubator and allowed to equilibrate to room temperature for about 10 min. Cell Titer Glo solution was added at 100 ml per well, and the plates were kept in the dark for 15 min before being assessed for luminescence with a luminometer (Spectra Max Paradigm, Molecular Devices) at a 1-s integration time per sample.
Statistical analysis was performed using the Excel add-in software Statcel1 (OMS Ltd., Tokyo, Japan). Means and standard deviation (SD) were calculated statistically from three determinations. The data are expressed as mean SD. The chi-square goodness-of-fit test was used to check whether the data were normally distributed. In this study, all the data were normally distributed; thus, we used t-tests (Student’s or Welch’s t) to assess the statistical significance of differences between various samples. p < 0.05 was considered significant. 3. Results
2.12. Cell growth assay To measure cell growth rates, 1.0 105 cells with Tet-inducible shRNA targeting PCTAIRE1 were plated onto 60-mm-diameter plates. One day later, the culture media was changed to that with (ON) or without (OFF) doxycycline (100 ng/ml). The cells were counted 1, 3, 5 and 7 days after seeding using the TC20 automated cell counter (Bio-Rad). In the siRNA experiments, the cells were counted 72 h after transfection.
2.13. Clonogenic assay Cells with Tet-inducible shRNA targeting PCTAIRE1 were seeded at 500 cells per well in 6 well (35 mm) dishes. Cells were cultured with (ON) or without (OFF) doxycycline for 14 days before fixing and staining. After fixation by methanol, cells were washed with PBS and incubated with 0.5% crystal violet dye in 25% methanol for 20 min. A colony was defined as a group of at least 50 cells.
3.1. Knockdown of PCTAIRE1 regulates cutaneous SCC cell growth and proliferation To investigate the effect of PCTAIRE1 knockdown in cutaneous SCC A431 cells, we performed tetracycline-inducible shRNA experiments using two shRNAs that were previously shown to effectively target PCTAIRE1 [16]. Quantitative RT-PCR and immunoblotting confirmed the knockdown of mRNA and protein levels by both of the PCTAIRE1-targeting shRNAs (Fig. 1A, Supplementary Fig. 1). The growth rates of doxycycline-stimulated PCTAIRE1 knockdown A431 cells (Tet-ON) were significantly diminished (measured over a 5-day period after seeding), relative to the growth rates of the control cells (Tet-OFF) (Fig. 1B). In clonogenic assays, the number of cancer cell colonies was significantly lower for the PCTAIRE1 knockdown (Tet-ON) group than for the control cell culture (Tet-OFF) group (Fig. 1C). The number of colonies in the PCTAIRE1-knockdown A431 cell (shRNA#1) was greater than that in the shRNA#2 cells, which is consistent with shRNA-mediated
Please cite this article in press as: T. Yanagi, et al., PCTAIRE1/CDK16/PCTK1 is overexpressed in cutaneous squamous cell carcinoma and regulates p27 stability and cell cycle, J Dermatol Sci (2017), http://dx.doi.org/10.1016/j.jdermsci.2017.02.281
G Model DESC 3138 No. of Pages 9
4
T. Yanagi et al. / Journal of Dermatological Science xxx (2016) xxx–xxx
Fig. 1. PCTAIRE1 knockdown diminishes cutaneous SCCA431 cell growth. (A) Protein lysates were generated from A431 cells stably containing inducible shRNAs targeting PCTAIRE1 (shRNA#1, #2), scrambled control cultured for 72 h with or without 100 ng/ml doxycycline and analyzed by immunoblotting. (B) A431 cells (10.0 104) stably containing inducible shRNAs were cultured in 60-mm-diameter plates for 24 h and then stimulated with (ON) or without (OFF) doxycycline. The numbers of cells were counted (mean SD; n = 3). *** p < 0.001 (C) A431 cells stably containing inducible shRNAs were seeded at 500 cells per well in 60 mm dishes. After 24 h, doxycycline was added. Colonies consisting of >50 cells were enumerated on day 14. All data represent mean SD (n = 3). ** p < 0.01, *** p < 0.001
gene knockdown levels (mRNA) (Supplementary Fig. 1). To support the results of shRNA experiments, we performed transient siRNA transfection, in which the target sequences of siRNAs were different from those of shRNAs. siRNA-mediated gene knockdown also diminished A431 cell growth (Supplementary Fig. 2). Similar results were obtained for the SCC DJM-1 and HSC-3 cells (Supplementary Figs. 3 and 4). Further, retrovirus-mediated wild-type PCTAIRE1 restored cancer cell (DJM-1 cell) proliferation in endogenous PCTAIRE1-depleted cells (shRNA#1, targeting untranslated region of PCTAIRE1 mRNA), but neither kinase-dead PCTAIRE1 (K194 M mutant) nor empty vector achieved such restoration (Supplementary Fig. 5). Previously, we assessed the
PCTAIRE1 knockdown effect on skin keratinocytes in terms of cell proliferation and apoptosis. In the human immortalized keratinocyte cell line (HaCaT), PCTAIRE1 knockdown did not affect cell growth as assessed by measurement of ATP levels and by counting of cell numbers [17]. Thus, the proliferation of cutaneous SCC cells may be preferentially dependent on PCTAIRE1. 3.2. Knockdown of PCTAIRE1 results in G2/M arrest, followed by apoptosis in SCC cells To examine the mechanisms of cell growth suppression by PCTAIRE1 knockdown, a trypan-blue staining assay and a
Please cite this article in press as: T. Yanagi, et al., PCTAIRE1/CDK16/PCTK1 is overexpressed in cutaneous squamous cell carcinoma and regulates p27 stability and cell cycle, J Dermatol Sci (2017), http://dx.doi.org/10.1016/j.jdermsci.2017.02.281
G Model DESC 3138 No. of Pages 9
T. Yanagi et al. / Journal of Dermatological Science xxx (2016) xxx–xxx
fluorescent annexin V/propidium iodide (PI) double-staining assay were performed, which showed increases of cell death and apoptosis in cultures of PCTAIRE1 RNAi-treated cells (Fig. 2A and B, Supplementary Fig. 1D). Cell cycle analyses were also performed using FACS-based DNA content analysis of A431 cells, which allowed the percentages of 2N, 4N, polyploid (DNA content > 4N) and hypoploid cells to be quantified. In cultures of PCTAIRE1 knockdown cells, the proportion of G2/M-phase cells (4N DNA content) was increased at 48 h, then declined as hypoploid
5
(apoptotic) cells appeared in the cultures at 96 h (Fig. 2C). These results suggest that, in cutaneous SCC cells, the depletion of PCTAIRE1 results in G2/M arrest, which was followed by apoptosis. Similar results were obtained for the SCC DJM-1 cells (Supplementary Figs. 6A and 7). In DJM-1 cells, there were fewer G2/Marrested cells transfected with siRNA#2 than with siRNA#1, which is consistent with the finding that the mRNA level of PCTAIRE1 in DJM-1 cells transfected with siRNA2 was higher than that with siRNA#1 (Supplementary Fig. 6B). Immunoblotting showed that
Fig. 2. PCTAIRE1 knockdown results in G2/M arrest and apoptosis of A431 cells. (A, B) A431 cells stably containing Tet-inducible shRNAs were cultured with Doxycycline (Dox). (A) 48 h after incubation with Dox, cells stained with annexin V and PI were assessed by FACS analyses. The percentages of apoptotic cells (annexin V positive and PI negative) are shown. All data represent mean SD (n = 3). * p < 0.05, *** p < 0.001 (B) 72 h after incubation with Dox, cells were stained with trypan-blue. The percentages of dead cells (trypan-blue positive) are shown. All data represent mean SD (n = 3). *** p < 0.001 (C) A431 cells stably containing Tet-inducible shRNAs (scramble, shRNA#2) were incubated with Dox for 0, 48, or 96 h and then fixed, treated with RNases and stained with DNA-binding fluorochrome propidium iodide, followed by FACS analysis to determine relative DNA content. Data represent relative DNA (PI fluorescence; x-axis) versus relative cell number (y-axis) and are representative of two experiments.
Please cite this article in press as: T. Yanagi, et al., PCTAIRE1/CDK16/PCTK1 is overexpressed in cutaneous squamous cell carcinoma and regulates p27 stability and cell cycle, J Dermatol Sci (2017), http://dx.doi.org/10.1016/j.jdermsci.2017.02.281
G Model DESC 3138 No. of Pages 9
6
T. Yanagi et al. / Journal of Dermatological Science xxx (2016) xxx–xxx
the PCTAIRE1 knockdown resulted in the increased levels of phospho-histone H3 (Supplementary Fig. 6C), which suggests G2/ M arrest. 3.3. PCTAIRE1 knockdown leads to the accumulation of p27 protein and the down-regulation of c-Myc in cutaneous SCC cells p27 (also known as cyclin-dependent kinase inhibitor 1B, Kip1) is a tumor suppressor that regulates cell proliferation and apoptosis [27,28]. Since PCTAIRE1 plays an important role in p27 phosphorylation and degradation [16], we investigated the role of PCTAIRE1 in regulating p27 protein levels in SCC cells. PCTAIRE1
knockdown by inducible shRNAs or siRNAs up-regulated steadystate p27 protein levels in A431, DJM-1 cell lines (Fig. 3A, Supplementary Fig. 8A, 9A), although mRNA levels of p27 were not up-regulated (Supplementary Fig. 8B, C). Meanwhile, PCTAIRE1 knockdown did not induce p27 up-regulation in HaCaT keratinocytes [17], which correlates with the lack of PCTAIRE1 dependence for the growth of these non-tumorigenic cells. Furthermore, c-Myc amplification has been reported to be associated with PCTAIRE1 dependency in medulloblastomas [29], which prompted us to investigate c-Myc expression levels in PCTAIRE1-knockdown SCC cells. Knockdown of PCTAIRE1 suppressed expression levels of cMyc, as assessed by immunoblotting (Fig. 3A, Supplementary
Fig. 3. PCTAIRE1 knockdown leads to the accumulation of p27, and knockdown of PCTAIRE1 suppresses SCC growth in vivo. (A) Protein lysates were generated from A431 cells stably containing inducible shRNAs targeting PCTAIRE1 (shRNA#1, #2), scrambled control-cultured for 72 h with or without 100 ng/ml doxycycline, and analyzed by immunoblotting. (B) A431 cells (5.0 106) stably containing shRNA#2 were subcutaneously injected into the flanks of nu/nu mice. When tumor volumes reached 150–200 mm3 (Day 4), the animals were provided with water with (red circles) or without (blue circles) 2% doxycycline (“Dox”) (n = 6 mice per group). Tumor volumes (mm3) were measured every other day (mean SD; n = 6). *** p < 0.001 (C, D) Tumors recovered from sacrificed mice at day 14 were weighed (mean = horizontal line, *** p < 0.001) and photographed. (E) Cell lysates from extracted tumors were analyzed by SDS-PAGE/immunoblotting.
Please cite this article in press as: T. Yanagi, et al., PCTAIRE1/CDK16/PCTK1 is overexpressed in cutaneous squamous cell carcinoma and regulates p27 stability and cell cycle, J Dermatol Sci (2017), http://dx.doi.org/10.1016/j.jdermsci.2017.02.281
G Model DESC 3138 No. of Pages 9
T. Yanagi et al. / Journal of Dermatological Science xxx (2016) xxx–xxx
Fig. 9A). Furthermore, we have attempted rescue experiments using pEGFP plasmid-mediated c-Myc overexpression. For these experiments, we employed DJM-1 cells transfected with siRNA targeting PCTAIRE1 (siRNAs #1, #2) and scramble control. c-Myc overexpression partially rescued cell growth in PCTAIRE1knockdown DJM-1 cells (Supplementary Fig. 9B, C). 3.4. Knockdown of PCTAIRE1 suppresses SCC growth in vivo To extend these studies into an in vivo context, we used SCC A431 cells containing inducible PCTAIRE1 shRNA (#2, which is a more effective PCTAIRE1 gene knockdown than shRNA#1 knockdown, Supplementary Fig. 1) in a tumor xenograft model. Immunocompromised (nu/nu) mice were injected subcutaneously with A431 cells, and tumors were allowed to grow for four days before doxycycline was added to the drinking water to induce the shRNA vector. Induction of PCTAIRE1 shRNA expression remarkably suppressed tumor growth in vivo (Fig. 3B–D). Immunoblot analyses showed elevated levels of p27 protein and downregulated c-Myc protein in the PCTAIRE1 knockdown A431 tumor xenografts (Fig. 3E), consistent with our studies using cultured cells. 3.5. PCTAIRE1 levels are elevated in cutaneous SCC tissues We assessed the levels of PCTAIRE1 expression in primary SCC tumor specimens by immunohistochemistry. PCTAIRE1 immunostaining was very low in normal epidermis and was markedly higher in cutaneous SCC (Fig. 4A and B). We further examined the
7
expression of p27 in the cutaneous SCC samples. Negative or weak p27 immunostaining was significantly more common in tumor tissues than in normal epidermis. These findings suggest that the expression levels of p27 are inversely correlated with the expression level of PCTAIRE1, consistent with our cell culture results showing that knockdown of PCTAIRE1 stabilizes p27. We also assessed PCTAIRE1 and p27 levels in specimens of actinic keratosis and Bowen’s disease (Supplementary Fig. 10). In the Bowen’s disease specimen, the expression levels of PCTAIRE1 were significantly higher than those of normal epidermis. The expression levels of p27 were also higher than those in invasive SCC and normal epidermis, which is consistent with a previous report [19]. In actinic keratosis, significant differences were not observed in PCTAIRE1 nor in p27 immunostaining scores compared to those of normal epidermis. 3.6. Expressions of PCTAIRE1 and c-Myc are associated with PCTAIRE1dependency Finally, we assessed PCTAIRE1, p27, and c-Myc protein expression levels in various cell lines used in this study (Supplementary Fig. 11). PCTAIRE1 protein levels were substantially higher in SCC cancer lines A431, DJM-1, and HSC-3 cells and normal keratinocytes (proliferating state) than in immortalized human adult keratinocyte HaCaT cells. We also assessed p27 expression levels and found that p27 expression levels were high in A431cells but were low in DJM-1and HSC-3 cells and normal human keratinocyte. c-Myc expression levels were low in normal keratinocytes but high in PCTAIRE1-dependent cancer cells (A431,
Fig. 4. Elevated levels of PCTAIRE1 in cutaneous SCC. PCTAIRE1 and p27 immunostainings were performed using cutaneous SCC samples (N = 17). (A) Representative examples of PCTAIRE1, p27 immunostaining results are provided for normal epidermis and cutaneous squamous cell carcinoma (SCC). Scale Bar = 50 mm. (B) Data (mean SD) comparing normal epidermis (N = 17) is shown. ** p < 0.01, *** p < 0.001 (C) Model of PCTAIRE1/CDK16/PCTK1 function. In squamous cell carcinoma, overexpressed PCTAIRE1 phosphorylates p27, thereby promoting p27 degradation, which leads to cell cycle progression and anti-apoptosis. Knockdown of PCTAIRE1 leads to the accumulation of p27, which suppresses the expression of c-Myc (aberrantly overexpressed in SCC). In normal epidermis, the expression levels of PCTAIRE1 are low, and the role in skin homeostasis is not evident.
Please cite this article in press as: T. Yanagi, et al., PCTAIRE1/CDK16/PCTK1 is overexpressed in cutaneous squamous cell carcinoma and regulates p27 stability and cell cycle, J Dermatol Sci (2017), http://dx.doi.org/10.1016/j.jdermsci.2017.02.281
G Model DESC 3138 No. of Pages 9
8
T. Yanagi et al. / Journal of Dermatological Science xxx (2016) xxx–xxx
DJM-1, and HSC-3 cells) and HaCaT cells. These results suggest that PCTAIRE1-dependency is associated with the combination of high PCTAIRE1 and high c-Myc. 4. Discussion This study has reported that PCTAIRE1 plays a crucial role in cutaneous SCC cell proliferation, with PCTAIRE1 knockdown resulting in elevated p27 levels (Fig. 4C). The protein p27 (also known as Kip1) is a tumor suppressor that regulates cell cycle, motility and apoptosis [27,28]. Consistent with its tumor suppressor function, low expression of nuclear p27 is observed in cutaneous SCC compared with normal epidermis, actinic keratosis, and Bowen’s disease [30,31]. Also, in head and neck SCC, the expression of p27 is a significant independent prognostic factor [32,33]. In contrast to other tumor suppressors such as p53, loss of nuclear p27 expression occurs via increased proteasomal degradation, not through genetic mutations [28]. Especially, the proteasomal degradation mechanism with the E3 ligase Skp2 plays the crucial role in regulation of p27 expression [28,34,35]. An inverse correlation between p27 and Skp2 protein expression levels has been reported in many cancers, including cutaneous SCC [31]. In our study using SCC cell lines, PCTAIRE1 knockdown upregulated the expression of p27, indicating that PCTAIRE1 plays an important role in p27 dysregulation similar to that of Skp2. We also examined the effect of overexpression of PCTAIRE1 in squamous cell carcinoma cell lines. However, overexpression of PCTAIRE1 did not enhance the tumor cell growth in A431 and DJM-1. These results suggest that the requirement of PCTAIRE1 kinase is not very high; endogenous expression is sufficient for tumor cell growth. Our study also shows that the up-regulation of p27 is associated with the G2-M phase cell cycle arrest followed by apoptosis of SCC cells. These results are consistent with our previous study which showed that the up-regulation of p27 induced by PCTAIRE1 knockdown leads to late G2-M phase arrest followed by apoptosis in prostate, breast and cervical cancer cell lines [16]. However, we observed that experimental overexpression of p27 by itself is insufficient to cause G2/M arrest in cancer cells including cutaneous SCC DJM-1 and A431 cells (not shown); thus, other factors influenced by PCTAIRE1 evidently contribute to the cell cycle arrest phenotype. In fact, the PCTAIRE1 (K194 M) kinase dead mutant partially rescued the cell growth of PCTAIRE1 knockdown (Supplementary Fig. 5B). These results suggest that PCTAIRE1 has a multifunctional role that goes beyond just the phosphorylation of p27. Further, melanoma A2058 cells showed apoptosis without obvious cell cycle arrest following PCTAIRE1 knockdown [17]. Therefore, the effect of PCTAIRE1 knockdown varies depending on the cancer cells. Our study also showed that PCTAIRE1 knockdown leads to down-regulation of c-Myc, as well as accumulation of p27. Previously, the loss of p27 was reported to synergize with Myc in murine lymphangiogenesis [36]. p27 has been reported to bind c-Myc, leading to the proteasomal degradation of c-Myc [37]. Clinically, Myc gene copy number aberrations and overexpression of c-Myc are common in cutaneous SCC, suggesting that MYC may play a relevant role in SCC tumorigenesis [38–40]. Herein, our study shows that the combination of high PCTAIRE1 and high cMyc is a characteristic of PCTAIRE1-dependent SCC cells. The above knowledge leads us to propose a novel mechanism for knockdown of PCTAIRE1, in which such knockdown leads to the accumulation of p27, promoting the degradation of aberrantly overexpressed cMyc in SCC (Fig. 4C). PCTAIRE1 is a member of the Cdk-family kinases, and these usually require cyclins for activation. PCTAIRE1 is reportedly activated by interactions with cyclin Y [8,10]. Very recently, mice deficient in cyclin Y-like 1 (ccnyl1) were reported to show infertility
and low expression of the PCTAIRE1 in the murine testes, which suggests that cyclin Y-like 1 regulates the expression and kinase activity of PCTAIRE1 [41]. Although the mechanisms of human PCTAIRE1 activation are unclear, PCTAIRE1 activity in human cancer cells may depend on the expression of cyclin Y or cyclin Ylike 1. In conclusion, we revealed an unrecognized role of PCTAIRE1 in cutaneous SCC cell survival, suggesting that PCTAIRE1-targeted therapy could restore the expression of p27 and down-regulate cMyc expression. PCTAIRE1 is overexpressed in cutaneous malignancies including SCC and melanoma, for which we do not have effective therapeutic weapons, especially in metastatic SCC and nivolumab-resistant melanoma. To date, PCTAIRE1 kinase inhibitors and in vivo therapeutic trials have been reported with promising results; moreover, the inhibition of PCTAIRE1 is known to have synergistic effects with extrinsic cell death cytokines [19]. Thus, PCTAIRE1/Cdk16 may be a novel therapeutic target in intractable/metastatic skin cancers. In future, more specific and effective PCTAIRE1/Cdk16 inhibitors, as well as i n vivo siRNA delivery methods should be investigated. Conflict of interest The authors have no conflict of interest to declare. Appendix A. Supplementary data Supplementary data associated with this article can be found, in the online version, at http://dx.doi.org/10.1016/j. jdermsci.2017.02.281. References [1] V. Madan, V.J.T. Lear, R.M. Szeimies, Non-melanoma skin cancer, Lancet 375 (2010) 673–685. [2] A. Stratigos, C. Garbe, C. Lebbe, J. Malvehy, V. Marmol, H. Pehamberger, et al., Diagnosis and treatment of invasive squamous cell carcinoma of the skin: European consensus-based interdisciplinary guideline, Eur. J. Cancer 51 (2015) 1989–2007. [3] Z. Kopecki, G.N. Yang, J.E. Jackson, E.L. Melville, M.P. Calley, D.F. Murrell, et al., Cytoskeletal protein Flightless I inhibits apoptosis: enhances tumor cell invasion and promotes cutaneous squamous cell carcinoma progression, Oncotarget 6 (2015) 36426–36440. [4] A.S. Weinberg, C.A. Ogle, E.K. Shim, Metastatic cutaneous squamous cell carcinoma: an update, Dermatol. Surg. 33 (2007) 885–899. [5] A.R. Cole, PCTK proteins: the forgotten brain kinases, Neurosignals 17 (2009) 288–297. [6] F. Le Bouffant, P. Le Minter, E. Traiffort, M. Ruat, F. Sladeczek, Multiple subcellular localizations of PCTAIRE-1 in brain, Mol. Cell. Neurosci. 16 (2000) 388–395. [7] C.Y. Ou, V.Y. Poon, C.I. Maeder, S. Watanabe, E.K. Lehrman, A.K. Fu, et al., Two cyclin-dependent kinase pathways are essential for polarized trafficking of presynaptic components, Cell 141 (2010) 846–858. [8] P. Mikolcevic, R. Sigl, V. Rauch, M.W. Hess, K. Pfaller, M. Barisic, et al., Cyclindependent kinase 16/PCTAIRE kinase 1 is activated by cyclin Y and is essential for spermatogenesis, Mol. Cell. Biol. 32 (2012) 868–879. [9] R. Graeser, J. Gannon, R.Y. Poon, T. Dubois, A. Aitken, T. Hunt, Regulation of the CDK-related protein kinase PCTAIRE-1 and its possible role in neurite outgrowth in Neuro-2A cells, J. Cell. Sci. 115 (2002) 3479–3490. [10] S.N. Shehata, M. Deak, N.A. Morrice, E. Ohta, R.W. Hunter, V.M. Kalscheuer, et al., Cyclin Y. phosphorylation- and 14-3-3-binding-dependent activation of PCTAIRE-1/CDK16, Biochem. J 469 (2015) 409–420. [11] K. Cheng, Z. Li, W.Y. Fu, J.H. Wang, A.K. Fu, N.Y. Ip, Pctaire1 interacts with p35 and is a novel substrate for Cdk5/p35, J. Biol. Chem. 277 (2002) 31988–31993. [12] Y. Liu, K. Cheng, K. Gong, A.K. Fu, N.Y. Ip, Pctaire1 phosphorylates Nethylmaleimide-sensitive fusion protein: implications in the regulation of its hexamerization and exocytosis, J. Biol. Chem. 281 (2006) 9852–9858. [13] S. Charrasse, I. Carena, J. Hagmann, K. Woods-Cook, S. Ferrari, PCTAIRE-1: characterization subcellular distribution, and cell cycle-dependent kinase activity, Cell. Growth. Differ. 10 (1999) 611–620. [14] K.J. Palmer, J.E. Konkel, D.J. Stephens, PCTAIRE protein kinases interact directly with the COPII complex and modulate secretory cargo transport, J. Cell. Sci. 118 (2005) 3839–3847. [15] S. Iwano, A. Satou, S. Matsumura, N. Sugiyama, Y. Ishihama, F. Toyoshima, PCTK1 regulates integrin-dependent spindle orientation via protein kinase A regulatory subunit KAP0 and myosin X, Mol. Cell. Biol. 35 (2015) 1197–1208.
Please cite this article in press as: T. Yanagi, et al., PCTAIRE1/CDK16/PCTK1 is overexpressed in cutaneous squamous cell carcinoma and regulates p27 stability and cell cycle, J Dermatol Sci (2017), http://dx.doi.org/10.1016/j.jdermsci.2017.02.281
G Model DESC 3138 No. of Pages 9
T. Yanagi et al. / Journal of Dermatological Science xxx (2016) xxx–xxx [16] T. Yanagi, M. Krajewska, S. Matsuzawa, J.C. Reed, PCTAIRE1 phosphorylates p27 and regulates mitosis in cancer cells, Cancer. Res. 74 (2014) 5795–5807. [17] T. Yanagi, J.C. Reed, S. Matsuzawa, PCTAIRE1 regulates p27 stability: apoptosis and tumor growth in malignant melanoma, Oncoscience 1 (2014) 624–633. [18] T. Yanagi, S. Matsuzawa, PCTAIRE1/PCTK1/CDK16: a new oncotarget? Cell Cycle 14 (2015) 463–464. [19] T. Yanagi, R. Shi, P. Aza-Blanc, J.C. Reed, S. Matsuzawa, PCTAIRE1-knockdown sensitizes cancer cells to TNF family cytokines, PLoS One 10 (2015) e0119404. [20] Q. Zhou, Y. Yu, Upregulated CDK16 expression in serous epithelial ovarian cancer cells, Med. Sci. Monit. 21 (2015) 3409–3414. [21] H.F. Duan, X.Q. Li, H.Y. Hu, Y.C. Li, Z. Cai, X.S. Mei, et al., Functional elucidation of miR-494 in the tumorigenesis of nasopharyngeal carcinoma, Tumour. Biol. 36 (2015) 6679–6689. [22] T. Yanagi, K. Tachikawa, R. Wilkie-Grantham, A. Hishiki, K. Nagai, E. Toyonaga, et al., Lipid nanoparticle-mediated siRNA transfer against PCTAIRE1/PCTK1/ Cdk16 inhibits in vivo cancer growth Mol, Ther. Nucleic Acids 5 (2016) e327. [23] Y. Kitajima, S. Inoue, H. Yaoita, Effects of pemphigus antibody on the regeneration of cell–cell contact in keratinocyte cultures grown in low to normal Ca + + concentration, J. Invest. Dermatol. 89 (1987) 167–171. [24] K. Sasai, T. Akagi, E. Aoyanagi, K. Tabu, S. Kaneko, S. Tanaka, O6-methylguanineDNA methyltransferase is downregulated in transformed astrocyte cells: implications for anti-glioma therapies, Mol. Cancer 6 (2007) 36. [25] D. Wiederschain, S. Wee, L. Chen, A. Loo, G. Yang, A. Huang, et al., Single-vector inducible lentiviral RNAi system for oncology target validation, Cell Cycle 8 (2009) 498–504. [26] M. Krajewska, L.H. Smith, J. Rong, X. Huang, M.L. Hyer, N. Zeps, et al., Image analysis algorithms for immunohistochemical assessment of cell death events and fibrosis in tissue sections, J. Histochem. Cytochem. 57 (2009) 649–663. [27] P.L. Porter, K.E. Malone, P.J. Heagerty, G.M. Alexander, L.A. Gatti, E.J. Firpo, et al., Expression of cell-cycle regulators p27Kip1 and cyclin E alone and in combination, correlate with survival in young breast cancer patients, Nat. Med. 3 (1997) 222–225. [28] I.M. Chu, L. Hengst, J.M. Slingerland, The Cdk inhibitor p27 in human cancer: prognostic potential and relevance to anticancer therapy, Nat. Rev. Cancer. 8 (2008) 253–267. [29] P. Cwiek, Z. Leni, F. Salm, V. Dimitrova, B. Styp-Rekowska, G. Chiriano, et al., RNA interference screening identifies a novel role for PCTK1/CDK16 in medulloblastoma with c-Myc amplification, Oncotarget 6 (2015) 116–129.
9
[30] C.W. Oh, N. Penneys, p27 and mib1 expression in actinic keratosis Bowen disease, and squamous cell carcinoma, Am. J. Dermatopathol. 26 (2004) 22–26. [31] M.T. Fernández-Figueras, L. Puig, E. Musulen, M. Gilaberte, C. Ferrándiz, E. Lerma, et al., Prognostic significance of p27Kip1 p45Skp2 and Ki67 expression profiles in Merkel cell carcinoma, extracutaneous small cell carcinoma, and cutaneous squamous cell carcinoma, Histopathology 46 (2005) 614–621. [32] M.R. De Almeida, M. Pérez-Sayáns, J.M. Suárez-Peñaranda, J.M. SomozaMartín, A. García-García, p27Kip1 expression as a prognostic marker for squamous cell carcinoma of the head and neck, Oncol. Lett. 10 (2015) 2675– 2682. [33] G. Salerno, D. Di Vizio, S. Staibano, G. Mottola, G. Quaremba, M. Mascolo, et al., Prognostic value of p27Kip1 expression in Basaloid Squamous Cell Carcinoma of the larynx, BMC Cancer 6 (2006) 146. [34] A. Besson, S.F. Dowdy, J.M. Roberts, CDK inhibitors: cell cycle regulators and beyond, Dev. Cell. 14 (2008) 159–169. [35] Y. Nagano, T. Fukushima, K. Okemoto, K. Tanaka, D.D. Bowtell, Z. Ronai, et al., Siah1/SIP regulates p27(kip1) stability and cell migration under metabolic stress, Cell Cycle 10 (2011) 2592–2602. [36] C.P. Martins, A. Berns, Loss of p27(Kip1) but not p21(Cip1) decreases survival and synergizes with MYC in murine lymphomagenesis, EMBO J. 21 (2002) 3739–3748. [37] F. Bahram, P. Hydbring, S. Tronnersjö, S.M. Zakaria, O. Frings, S. Fahlén, et al., Interferon-g-induced p27KIP1 binds to and targets MYC for proteasomemediated degradation, Oncotarget 7 (2016) 2837–2854. [38] A. Toll, R. Salgado, M. Yébenes, G. Martín-Ezquerra, M. Gilaberte, T. Baró, et al., MYC gene numerical aberrations in actinic keratosis and cutaneous squamous cell carcinoma, Br. J. Dermatol. 161 (2009) 1112–1118. [39] M.S. Jacobs, D.L. Persons, G.R. Fraga, EGFR and MYC gene copy number aberrations are more common in squamous cell carcinoma than keratoacanthoma: a FISH study, J. Cutan. Pathol. 40 (2013) 447–454. [40] Y. Zheng, G.R. Wang, J.J. Jia, S.J. Luo, H. Wang, S.X. Xiao, Expressions of oncogenes c-fos and c-myc in skin lesion of cutaneous squamous cell carcinoma, Asian. Pac. J. Trop. Med. 7 (2014) 761–764. [41] Z. Zi, Z. Zhang, Q. Li, W. An, L. Zeng, D. Gao, et al., CCNYL1, but not CCNY, cooperates with CDK16 to regulate spermatogenesis in mouse, PLoS Genet. 11 (2015) e1005485.
Please cite this article in press as: T. Yanagi, et al., PCTAIRE1/CDK16/PCTK1 is overexpressed in cutaneous squamous cell carcinoma and regulates p27 stability and cell cycle, J Dermatol Sci (2017), http://dx.doi.org/10.1016/j.jdermsci.2017.02.281