PEG-functionalized zinc oxide nanoparticles induce apoptosis in breast cancer cells through reactive oxygen species-dependent impairment of DNA damage repair enzyme NEIL2

Author’s Accepted Manuscript PEG-functionalized zinc oxide nanoparticles induce apoptosis in breast cancer cells through reactive oxygen species-dependent impairment of DNA damage repair enzyme NEIL2 Soumyananda Chakraborti, Samik Chakraborty, Shilpi Saha, Argha Manna, Shruti Banerjee, Arghya Adhikary, Shamila Sarwar, Tapas K. Hazra, Tanya Das, Pinak Chakrabarti

PII: DOI: Reference:

www.elsevier.com

S0891-5849(16)31083-8 http://dx.doi.org/10.1016/j.freeradbiomed.2016.11.048 FRB13103

To appear in: Free Radical Biology and Medicine Received date: 1 July 2016 Revised date: 10 November 2016 Accepted date: 28 November 2016 Cite this article as: Soumyananda Chakraborti, Samik Chakraborty, Shilpi Saha, Argha Manna, Shruti Banerjee, Arghya Adhikary, Shamila Sarwar, Tapas K. Hazra, Tanya Das and Pinak Chakrabarti, PEG-functionalized zinc oxide nanoparticles induce apoptosis in breast cancer cells through reactive oxygen species-dependent impairment of DNA damage repair enzyme NEIL2, Free Radical Biology and Medicine, http://dx.doi.org/10.1016/j.freeradbiomed.2016.11.048 This is a PDF file of an unedited manuscript that has been accepted for publication. As a service to our customers we are providing this early version of the manuscript. The manuscript will undergo copyediting, typesetting, and review of the resulting galley proof before it is published in its final citable form. Please note that during the production process errors may be discovered which could affect the content, and all legal disclaimers that apply to the journal pertain.

PEG-functionalized zinc oxide nanoparticles induce apoptosis in breast cancer cells through reactive oxygen species-dependent impairment of DNA damage repair enzyme NEIL2 Soumyananda Chakrabortia12, Samik Chakrabortyb13, Shilpi Sahab, Argha Mannab, Shruti Banerjeeb, Arghya Adhikaryb4, Shamila Sarwara, Tapas K. Hazrac, Tanya Das*,b, Pinak Chakrabarti*a

a

Department of Biochemistry, Bose Institute, P-1/12 CIT Scheme, VIIM, Kolkata 700054, India. Division of Molecular Medicine, Bose Institute, P-1/12 CIT Scheme, VIIM, Kolkata 700054, India c Sealy Center for Molecular Science, University of Texas Medical Branch, Galveston, Texas 77555-1079. b

[email protected] (P.C) [email protected] (T.D) *Correspondence.

1 2

3

These authors contributed equally. Present address: Malopolska Centre of Biotechnology, Jagiellonian University, 30-387 Krakow, Poland.

Present address: Division of Nephrology, Boston Children’s Hospital, Harvard Medical School,

Boston, Massachusetts 02115. 4

Present address: Centre for Research in Nanoscience & Nanotechnology (CRNN), University of Calcutta, JD-2, Salt Lake City, Kolkata 700098, West Bengal, India. 1

Abstract We find that PEG functionalized ZnO nanoparticles (NP) have anticancer properties primarily because of ROS generation. Detailed investigation revealed two consequences depending on the level of ROS – either DNA damage repair or apoptosis – in a time-dependent manner. At early hours of treatment, NP promote NEIL2-mediated DNA repair process to counteract low ROSinduced DNA damage. However, at late hours these NP produce high level of ROS that inhibits DNA repair process, thereby directing the cell towards apoptosis. Mechanistically at low ROS conditions, transcription factor Sp1 binds to the NEIL2 promoter and facilitates its transcription for triggering a ‘fight-back mechanism’ thereby resisting cancer cell apoptosis. In contrast, as ROS increase during later hours, Sp1 undergoes oxidative degradation that decreases its availability for binding to the promoter thereby down-regulating NEIL2 and impairing the repair mechanism. Under such conditions, the cells strategically switch to the p53-dependent apoptosis. Graphical Abstract

2

Keywords: Apoptosis, breast cancer, NEIL2, p53, PEG-ZnO nanoparticles, ROS, Sp1.

3

Introduction The incidence of breast cancer is increasing worldwide (http://globocan.iarc.fr/Pages/fact_sheets_cancer.aspx). However, current anticancer chemotherapies have several drawbacks including limited solubility, reduced bioavailability, drug resistance, systemic toxicity and a poor nonselective bio-distribution, thus resulting in severe damage to healthy tissues through non-specific toxicity.1,2 Therefore, there is an urgent need to develop novel anticancer drugs with new modes of action that can selectively target cancer cells while sparing normal cells of the host. Recently nanotechnology is being widely used in the research of oncotherapy. Chemical stability, high specific surface area, and electrochemical activity of nanoparticles (NP) have attracted considerable attention for their potential therapeutic applications including cancer.3 Beside this due to their smaller size, NP bypass the multidrug resistance mechanisms of cancer cells as they enter cells mostly via endocytosis.4-6 Among the available NP, the advantage of metal oxide NP lies in their ability to interact with cancer cells as they frequently contain a high percentage of anionic phospholipids on their outer membrane.7 At physiological pH the positively charged metal oxide NP, such as ZnO (with a pI of ~9)8 interact with cancer cell membrane mostly by electrostatic interactions, thereby promoting cellular uptake, phagocytosis and ultimate cytotoxicity.7, 9 Recently it has been shown that when ZnO NP is co-administrated with chemotherapeutic drug daunorubicin it caused synergistic cytotoxic effects on leukemic cells.10 There are other studies where ZnO cytotoxicity against different cancer cell lines has been explored in details.11-14 However, the selective cytotoxicity of ZnO NP is still under debate as the underlying mechanism of the NP induced apoptosis has not been thoroughly investigated. Additionally, the poor solubility in biological medium and biocompatibility are two major concerns in the possible application of ZnO NP in cancer therapy. Another concern is its non-specific toxicity towards normal healthy cells15 which make it inappropriate for clinical trial. Capping of NP with the hydrophilic group such as polyethylene glycol (PEG) is a common approach to improve many functions, such as in vitro dispersion, in vivo circulation, stability, solubility, biocompatibility and most importantly to reduce toxicity.16 PEGylation also decreases non-specific protein adsorption to the gold nanorods and therefore, influence cellular uptake.17 Studies show magnetic NP with a PEG-modified surface showed appreciable increase in cellular uptake by breast cancer cell BT20 compared to un-modified particles.18 Oyewumi et al19 also reported that folate-, PEG- and thiamine-modified gadolinium NP can be easily taken up by the tumor cells. The increased solubilization of the nanoparticles in the cell membrane lipid bilayer mediated by PEG, most possibly the reason for higher uptake.20 However, PEGylation does not always improve internalization of NP, sometimes it can even reduce uptake.18 It is actually a very complex event and cell 4

architecture and composition play an important role in it.20 Unfortunately, no systematic study has been made on ZnO PEGylation, its internalization to cell and subsequent cytotoxicity. However, this could be a promising strategy to improve different physicochemical properties of ZnO and cellular uptake. Apoptosis is controlled cell death and one of the common mechanism through which anticancer agents exert their cytotoxicity.21-22 A variety of intracellular and extracellular signals including serum starvation, ionizing-irradiation and reactive oxygen species (ROS) are known to induce apoptotic cascade.23-24 Recent studies have confirmed close link between (ROS) production and stress-induced apoptosis. Mitochondria, the major producer of ROS23, are known to play vital role in cell death pathways. Mitochondrial ROS generation is also linked to p53-dependent apoptotic response, since ROS generation induces DNA damage that also triggers p53-based intrinsic signaling.21 In fact, an assault to the cell by ROS induces a plethora of proceedings coordinated by sensor, transducer and effector proteins that sense the damage and activate either a repair mechanism or an apoptotic program in case of overwhelming damage. Recent reports have also shown that suppression of DNA damage repair (DDR) pathway can also potentiate apoptosis.24 DDR is a complex event involving number of proteins that works in synchronized way to repair damaged DNA and thereby maintaining integrity of the cell. The first step in this pathway is the recognition and removal of the damaged DNA base, usually performed by a glycosylase enzyme.25 Among numerous proteins involved in DDR, NEIL2 plays a key regulatory role when DNA damage is induced by ROS. Functionally NEIL2 is a glycosylase belongs to the Fpg/Nei family of enzymes.26, 27 In the present study, we synthesized PEG modified ZnO and tested it against different breast cancer cell line. It has been found that PEG-ZnO is active against most of the breast cancer cell lines. However, cell carrying functional p53 is found to be most susceptible to PEG-ZnO treatment. The main mechanism by which PEG-ZnO kills cancer cell is by generating ROS. Detail investigation found a link between NP induced ROS and DDR pathway through NEIL2. In early hours of NP treatment DDR pathway provides protection to cell from ROS induced stress by overexpressing NEIL2, and it is very effective when amount of ROS is low. However, this pathway completely collapses when NP induced ROS influx is high; in such situation it triggers p53-dependent apoptosis leading to cell death. In addition, our data also suggest that on PEGylation nonspecific toxicity of ZnO towards normal cell gets significantly reduced and there is faster internalization of NP inside cancer cell. Methods Zinc acetate dehydrate (Zn(CH3COO)2·2H2O), lithium hydroxide monohydrate (LiOH.H2O), ethanol, n-hexane, polyethylene glycol (PEG) were purchased from Sigma (St. Louis, MO, USA). Fetal bovine serum (FBS), Dulbecco's modified Eagle's medium (DMEM), streptomycin, penicillin, insulin, L-glutamine and sodium pyruvate were obtained from Gibco 5

BRL (Gaithersburg, MD, USA). 4P, 6P-diamidino-2-phenylindole (DAPI), T4 polynucleotide kinase and general reagents were purchased from Sigma (St. Louis, MO, USA). Polyclonal antibodies, horseradish peroxidase conjugated goat anti-mouse and goat anti-rabbit antibodies were obtained from Santa Cruz (CA, USA) and Sigma (St. Louis, MO, USA). All other reagents were procured (analytical grade) from local vendors. Synthesis of ZnO Nanoparticles and its capping with Polyethylene Glycol (PEG) The acetate adsorbed ZnO NP (i.e., ZnO-Ac NP) were synthesized by modified sol–gel route as described before.28 Freshly prepared 2mL ethanolic solution containing ZnO NP was diluted to 8mL of ethanol. A separate solution of 50mM PEG (MW 600) was prepared by stirring at 45°C until the solution became transparent; it was then cooled down to room temperature. To previously prepared ZnO solution, a portion of 300μl of 50mM aqueous PEG solution was added with vigorous stirring. The precipitate was collected by centrifuging. PEG-capped ZnO NP (PEG-ZnO in short) was re-dispersed in the solvent of choice, e.g. water, ethanol etc. Detail characterization of NP is provided in supporting information. Transmission Electron Microscopy The particle size and dispersity of the prepared NP were studied using transmission electron microscope (TEM). TEM grids were prepared by placing 10µl of the diluted and well sonicated sample solutions on a carbon-coated copper grid and dried completely in dust free atmosphere. The bright field electron micrographs of the samples were recorded on JEM2010 (Orius SC1000) at the accelerating voltage of 200 kV. Atomic Force Microscopy To determine the morphology of PEG-functionalized ZnO NP on a silicon wafer surface, deposited by spin casting, the samples were analyzed ex situ by Atomic Force Microscopy (AFM). AFM characterization was carried out using a Digital Instruments Nanoscope III. AFM measurements were performed in taping mode using a Si3N4 tip with resonance frequency of 100 kHz and spring constant being 0.6 Nm-1 to obtain surface topography of deposited PEG-ZnO NP. The film was air dried in dust free environment before measurement. It is important to note that AFM images actually represent surface morphology of NP. Usually, the surface morphology studies do not provide the individual particle size; rather they show the average grain size at the deposited film surface. To generate better quality image spin casting was used here; however, spin casting also result in increases of the grain size of PEG-ZnO NP at silicon surface as compared to the dispersed small particles in solution. FTIR Spectroscopy FTIR technique was used to determine the binding of PEG to ZnO. FTIR scanning was performed in the transmission mode with constant nitrogen purging using Perkin-Elmer 6

spectrometer equipped with a DTGS KBr detector and a KBr beam splitter with constant nitrogen purging. IR grade KBr was used as scanning matrix. 1-2mg of fine sample powder and 90-100mg of KBr powder were mixed and dried completely, then transferred to 13mm disk to make a nearly transparent and homogeneous pallet. All spectra were taken at 4cm-1 resolution, averaged over 20 scans in the range 400 to 4000cm-1. Dynamic Light Scattering (DLS) Aggregation kinetics of ZnO and its PEG capped analogue in solution were studied using DLS with high performance particle sizer (ZetasizernanoS, Malvern) at 25°C. The same instrument was used for determination of zeta potential. DLS measurements were carried out using a ZetasizernanoS instrument (Malvern Instrument, U.K.). Samples were excited with a 633nm wavelength laser. The scattering intensities were recorded at a 1730 angle in kilo counts per sec. Dissolution measurements Dissolution experiments of PEG-ZnO NP were performed in a glass beaker at room temperature (~25°C). In the beaker pH was varied between 5 to 7 and each time a fixed concentration of PEG-ZnO NP (400μg/mL) were added with continuous stirring and incubated for 3h. Aliquots from the supernatant were collected from the beaker, and the solid component was removed by centrifugation. From these samples, the concentration of zinc ions was measured by a Varian 720-ES inductively coupled plasma optical emission spectrometer (ICP-OES). The average of triplicate measures is reported for all dissolution measurements. Scanning electron microscopic (SEM) SEM has been used as a tool to analyze the surface topography of the cancer cell. Cancer cells were grown overnight in RPMI medium (HiMedia) and then treated with PEG-ZnO NP (25μg/mL). Samples were removed at regular intervals, fixed with 2% glutaraldehyde, dehydrated with ethanol and examined by SEM (FEI Quanta-200 MK2) with an accelerating voltage of 20kV. The same instrument is coupled to EDX (energy dispersive X-ray analyzer); the sample preparation for EDX is similar to SEM. Cell Culture and treatments p53-wild-type-MCF-7 and p53-mutated-MDA-MB-231, MDA-MB-468 and T47D human breast cancer cells were obtained from NCCS and routinely maintained in complete DMEM medium (HiMedia) at 37°C in humidified incubator containing 5% CO2.22,29-30 Cells were treated with different concentration of PEG-ZnO NP (6.25-37.5µg/mL) for different time periods to select the optimum dose and the time required for killing.

7

Trypan Blue Exclusion Test To determine the viable cell number, trypan blue exclusion test was performed. Cells were suspended in phosphate buffer saline (PBS). A small sample (0.1mL) of cells from single cell suspension was aseptically removed and mixed with 0.16% trypan blue (in PBS). Viable cells (the cells which were not intruded by trypan blue) were counted in hemocytometer. Detail methods regarding cytotoxicity, flow cytometry based analysis, RT-PCR, immunoblotting and siRNA/plasmid based transfection are provided in supporting information. Peripheral blood mononuclear cells (PBMC) isolation Human blood (10mL) was collected from volunteers not connected with the study. Recruitment of participants was performed according to protocol approved by the Internal Review Board for the Ethical committee on Human Subjects of Bose Institute. Peripheral blood collected from healthy volunteers was centrifuged over Ficoll-Hypaque (Ammersham Pharmacia) density gradient to obtain total lymphocytes.31 Cell cycle phase distribution and apoptosis assay For the determination of cell cycle phase distribution of DNA content, untreated/PEG-ZnO NP-treated MCF-7 cells were permeabilized and nuclear DNA was labeled with propidium iodide (PI) using Cycle TEST PLUS DNA reagent kit. Cell cycle phase distribution of nuclear DNA was determined on FACS Callibur (BD Biosciences, CA), fluorescence detector equipped with 488nm argon laser light source and 623nm band pass filter (linear scale) using CellQuest software (Becton Dickinson). A total of 10,000 events were acquired and analysis of flow cytometric data was performed using ModFit software. A histogram of DNA content (x-axis, PI fluorescence) versus counts (y-axis) has been displayed.29 Percent apoptotic cell death was determined by flow cytometrically (FACS Calibur, BD Biosciences, CA, USA) after staining with 7AAD/Annexin-V-FITC and analyzed using CellQuest Pro software (BD Biosciences, CA, USA).21,30 For DAPI staining cell were first fixed in 3% p-formaldehyde/Triton-X100 and then stained with 4’,6-diamidino-2phenylindole (DAPI; Pharmingen).32 A Leica fluorescent microscope DM 900 was used to visualize the fluorescent images. Digital images were captured with a highly sensitive cool (−25°C) charged coupled device camera (Princeton Instruments) controlled with the MetaMorph software (Universal Imaging). Flow cytometric measurement of mitochondrial membrane potential For measurement of mitochondrial transmembrane potential (MTP) loss, cells were loaded with potential sensitive dye, dihexyloxa-carbonicao cyanine (DiOC6, Merck, Germany) during the last 30min of treatment at 37°C in the dark. Fluorescence of retained DiOC6 was

8

determined flow cytometrically using logarithmic amplification by CellQuestsoftware (Becton Dickinson).32 Co‐immunoprecipitation and immunoblotting For western analysis cell lysates were prepared in lysis buffer (20mM Tris-HCl (pH 7.4), 100mM NaCl, 1% NP40, 0.5% sodium deoxy cholate, and 1mM EGTA) containing protease inhibitors. Mitochondrial and cytosolic fractions were prepared according to Mazumdar et al.29 A total of 50μg of protein was separated by SDS-PAGE and transferred to PVDF membrane (GE Biosciences, NJ, USA) for Western blotting using required antibodies like, anti-ubiquitin, anti-DNP, anti-caspases 7and 9, anti-Cytochrome-c (C-20), anti-MnSOD (N20) from Santa Cruz. The protein of interest was visualized by chemiluminescence (GE Biosciences, NJ, USA).2 Equivalent protein loading in cytosolic fractions was verified using anti-α-actin antibodies (Santa Cruz, CA, USA), respectively. Plasmids, siRNA transfections Cells were transfected with 300pmole of p53/Neil2 siRNA (Santa Cruz) using lipofectamine2000 separately for 12h. The p53 and Neil2-siRNA transfection efficacy in MCF-7 cells was validated by Western blot analysis. The protein levels of p53 and Neil2 were estimated by Western blotting.The expression construct pcDNA NEIL2 vector [Wild Type Flag tagged] (2µg/million cells),was introduced into exponentially growing cancer cells using Lipofectamine 2000 (Invitrogen) according to the protocol given by the manufacturer and the protein levels of the cDNA was estimated by Western blotting. RT- PCR assay 2μg of total RNA, extracted with TRIzol reagent, was reverse-transcribed and then subjected to PCR with enzymes and reagents of the RTplus PCR system (Eppendorf, Hamburg, Germany) using GeneAmp PCR system 2720 (Applied Biosystems; Foster City) (20, 22). Primers for p53 were 5’-CCCACTCACCGTACTAA-3’ (forward) and 5’GTGGTTTCAAGGCC-AGATGT-3’(reverse);for NEIL2 were5’GCAGTGCCAGTTCTCCTAAG-3’(forward) and 5’- GCACCTCTGACCCACACTAT3’(Reverse) and for GAPDH (internal standard) were 5′-CAGAACAT-CATCCCTGCCTCT3′(forward) and 5′-GCTTGACA-AAGTGGTCGTTGAG-3′(Reverse). Bioinformatics analysis rVISTA2.0 (http://rvista.dcode.org), which allows the in-silico identification of putative binding sites of different transcription factors within a gene sequence, was initially used to scan for various ROS-responsive element binding sites on NEIL2 promoter, which was later restricted to Sp1.

9

Chromatin Immunoprecipitation ChIP assays were done with a ChIP assay kit (Millipore) following manufacturer’s instructions.32 1% formaldehyde was used to fix 2 ×106 cells for 10min at 37°C resulting in cross-linking of the protein-DNA complexes. Then they were harvested and washed properly with chilled PBS containing protease inhibitors. SDS lysis buffer was added to the cells and incubated on ice for 10min. After that sonication was done to shear the DNA to lengths between 200 and 1000 base pairs and then centrifuged at 13,000rpm for 10min at 4°C. The sonicated cell supernatants were first diluted 10-fold in ChIP dilution buffer and then subjected to preclearing with protein A-agarose/salmon sperm DNA for 30min at 4°C with agitation. The supernatant was recovered after the agarose has been pelleted down by centrifugation and then specific antibody against SP1 was added and incubated overnight at 4°C. The antibody-protein-DNA complexes were collected by again adding protein Aagarose/salmon sperm DNA or 1h at 4°C with rotation. Immunoprecipitated antibodyprotein-DNA complexes were washed and eluted with freshly prepared extraction buffer (1% SDS, 0.1M NaHCO3). To reverse cross-links, 5M NaCl was added to each eluate and heated to 65°C for 5h. Proteins were digested with 10mg/mL proteinase K for 1h at 45°C and phenol/chloroform extraction method was adopted to recover the DNA. DNA fragments were amplified by 40 cycles of PCR. The sequences of Neil2 promoter-specific primers are: 5’GCCTCGACCTAGACCCACTT-3’ (Forward), 5’-TAGGGGA-CGCCCCTGTAG-3’ (Reverse). Input DNA, rabbit IgG-pulled DNA served as controls for all the experiment. Glyceraldehyde-3-phosphate dehydrogenase promoter was used as a nonspecific control for all the ChIP experiment. Primers used for GAPDH are 5’-CGTATTGGGCGCCTGGTCAC3’ (Forward) and 5’-ATGA-TGACCCTTTTGG-CTCC-3’ (Reverse). Determination of Lipid Peroxidation The occurrence of malondialdehyde (MDA), a secondary end product of the oxidation of polyunsaturated fatty acids, is considered a useful index of general lipid peroxidation. A common method for measuring MDA, referred to as the thiobarbituric acid-reactivesubstances (TBARS) assay, is to react it with thiobarbituric acid (TBA) and record the absorbance at 532 nm. In our experimental setup, cells were exposed to PEG-ZnO NP

(25μg/mL) for different time intervals. After exposure, the cells were harvested in chilled PBS by scraping and washed twice with 1X PBS at 4°C by centrifugation for 6min at 1,500rpm. The cell pellet was then sonicated at 15W for 10s (3 cycles) to obtain the cell lysate. The ROS generated or lipid peroxidation was determined in the cell lysate using TBARS assay.33 For the same, 10% SDS was added to the cell lysate, which was then swirled vigorously. Then freshly prepared thiobarbituric acid (TBA) was added to the above mixture and incubated at 95°C for 60min after which it was cooled down to room temperature and centrifuged at 3500rpm for 15min. The absorption spectrum of the

10

supernatant was recorded at 532nm to estimate the formation of thiobarbituric acid reactive substances (TBARS). From the TBARS intensities, the corresponding levels of MDA were deduced following the standard protocol33.

Assessment of ROS For detection of ROS, untreated/PEG-ZnO NP treated cells were incubated during the last 20min at 37°C in the dark with 10µM of dichlorofluorescindiacetate (DCF-DA, Sigma). DCF fluorescence was measured flow cytometrically and subjected to analysis using Cell Quest 3.2 (BD Biosciences, CA) software. The probe was excited at 488nm and emission was measured through a 530nm band-pass filter. For confocal microscopy a Leica fluorescent microscope DM 900 was used to visualize the images of PEG-ZnO NP-treated cells and incubated with DCF-DA (10µM). DCF-DA is colorless and non-fluorescent until both of the acetate groups are hydrolyzed and the products are subsequently oxidized to fluorescein derivatives (H2DCFDA). Digital images were captured with a cool (-25°C) charged coupled device (CCD) camera (Princeton Instruments) controlled with the AndoriQBioimaging software. Statistical analyses Values are shown as standard error of mean, except otherwise indicated. Data were analyzed and the appropriate significance (p < 0.05) of the differences between mean values was determined by a Student's t test. Results The ZnO were prepared according to earlier described protocol28 and subsequently modified with polyethylene glycol (PEG). PEG-functionalized ZnO NP (PEG-ZNO NP) were characterized using high resolution transmission electron microscopy (HRTEM), atomic force microscopy (AFM) Fourier transform infrared spectroscopy (FTIR) and zeta potential (Table S1, supplementary information). The average size of ZnO NP was found to be ~7 nm (Figure 1A), which increased to 150 nm on PEG capping as revealed by high resolution AFM image (Figure 1B). Particle size and morphology was further confirmed by Atomic Force Microscopy (AFM). The presence of PEG on the surface of ZnO was validated by FTIR (Figure1C). The spectrum of PEG-ZnO NP showed a distinct peak around 578 cm-1 representing Zn-O metal oxide bond. Further, a broad and strong peak in 3200-3500 cm-1 is attributed to the absorption of O-H group in PEG-ZnO NP. The peak at 1584 cm-1 is assigned to the symmetric C-H bending together with C-O-H bending vibration mode of PEG molecule. Due to high surface energy ZnO is also very susceptible to aggregation. ZnO NP aggregation34 have been extensively studied under different buffer and in presence of variable surface capping agent, and it was found that proper surface capping agent was effective in 11

preventing aggregation. In our study, we also found similar trend on PEG capping. The result further suggests that PEG- impart stabilization in ZnO NP at least for 5h, with no detectable aggregation (Figure1 D). PEG-capping reduced the inherent toxicity of ZnO NP To determine the optimal dose of treatment, toxicity screening of ZnO NP and its PEG capped analog was carried out against peripheral blood mononuclear cells (PBMCs). Results of trypan blue exclusion assay revealed that ZnO NP is toxic to PBMCs even at very low (6.25µg/mL, 24h) concentration of exposure (Figure 2A, 15% cell-death). In contrast, PEGZnO NP found safe even at 25µg/mL concentration and exert only 5% PBMCs death while the same dose of ZnO NP induced 24% cell-death in PBMC. It was also observed that PEGZnO dose above 25µg/mL causes toxicity to PBMC and that is the reason we restricted our dose limit up to 25µg/mL. PEG-capped ZnO NP efficiently triggered apoptosis in breast cancer cell The anticancer efficacy of PEG-ZnO NP was evaluated against different breast cancer cell lines including MCF-7, MDA-MB-231, MDA-MB-468 and T47D. Test cell lines were treated with 25µg/mL of PEG-ZnO NP for 24h. Results of trypan-blue assay showed that exposure to PEG-ZnO NP resulted in significant cell death (40%) in wild-type p53expressing MCF-7 cells while mutant p53-expressing MDA-MB-231, MDA-MB-468 and T47D cells showed much reduced effect (maximum of 18%) (Figure 2B). We also studied cytotoxicity of normal ZnO against both functional p53-expressing and p53-mutant cell lines and found that ZnO is less effective in killing cancer cell compared to PEG-ZnO (Table S2). Therefore, for subsequent studies we used PEG-ZnO, and MCF-7 cells (which had the maximum susceptibility). Our goal to understand the molecular mechanism underneath NP induced cell death began with the flow cytometric analysis of treated cell; we found an increase in the hypoploid (sub-G0/G1) DNA content (Figure 2C) along with high ratio of Annexin-V-positive cells (Figure 2D), indicating apoptosis as the mode of cell death, supported by development of nuclear blebbing as evidenced by DAPI-stained fluorescent images of PEG-ZnO NP-treated MCF-7 nucleus (Figure 2E). Scanning Electron Microscopy (SEM) images, also demonstrated membrane blebbing (Figure 2F), and further supported the earlier findings. PEG-capped ZnO NPs efficiently generate ROS in breast cancer cells ROS generation is one of the very common mechanism by which ZnO exerts toxicity. So we begin our line of investigation with measuring the changes in ROS level during PEG-ZnO treatment on MCF-7 cells using DCFDA assays. The assay detected initiation of ROS production in MCF-7 cells only after 2h of PEG-ZnO NP treatment (Figure 3A), which amplified over time. These findings were further supported by confocal imaging (Figure 3B). Furthermore, ROS-induced lipid peroxidation upon PEG-ZnO treatment was also assessed. 12

Our results show that NP treatment increased the formation of MDA, a secondary end product of the oxidation of polyunsaturated fatty acids, and a useful index of general lipid peroxidation (Figure 3C). We performed energy dispersive X-ray (EDX) at different time points with treated cells to examine the internalization of PEG-ZnO NPs inside the cell and to correlate this data with ROS generation. EDX spectrum analysis confirmed peaks corresponding to Zn and O on the spectrum only after 2h of incubation (Figure 3D). When we compared the data on internalization of ZnO inside MCF-7 cell over time with that of PEG-ZnO, our results showed that the extent of ZnO internalization was much lower than that of PEG-ZnO NP. For example, we did not notice any internalization of ZnO for first 3h of treatment, although the same dose could internalize >28% PEG-ZnO in MCF-7 cells within same time point (data not shown). Overall, our findings confirmed internalization of PEG-ZnO NP and further suggested that augmentation of ROS by PEG-ZnO NP might be correlated with lipid peroxidation of the cell membrane and organelles. PEG-ZnO NP ensure ROS-mediated management of DNA damage repair enzyme NEIL2 NEIL2, has been reported as a potential candidate in removing ROS-mediated DNA lesion in many cases.27 Our results clearly showed an increase in NEIL2 expression in first 2h of PEGZnO treatment, after which it started declining gradually and finally a sharp fall at 8h of treatment (Figure 4A). Interestingly, in the presence of ROS scavenger NAC (40mM, 1h), PEG-ZnO NP failed to promote NEIL2 expression levels (Figure 4B, upper panel). To unveil the mechanism underlying such variation in NEIL2 expression, we used H2O2 to externally mimic the condition of PEG-ZnO mediated ROS generation. Our results showed that low dose of H2O2 (0.5M) led to an increase in NEIL2, while higher concentration of H2O2 (4M) resulted a decrease of NEIL2 (Figure 4B, lower panel). These results pointed towards a ROS-dependent expressional switch of NEIL2 to induce breast cancer cell apoptosis at late hours of PEG-ZnO NP treatment. Supporting our hypothesis, the percent cell death was found to be significantly higher in NEIL2 siRNA-transfected cells as compared to control si-RNA-transfected cells (Figure 4C). We also checked the expression level of γ-H2AX (a marker of DNA damage) 35 and of p5336, in NEIL2-silenced and NEIL2-overexpressed cells. Our results revealed significant up-regulation of γ-H2AX and p53 in NEIL2-silenced cells at late hours compared to early hours (Figure 4D). In NEIL2-overexpressed cells, the expression levels of γ-H2AX and p53 were extremely low in early hour of treatment. However, at late hour, expression of both the molecules increased although the extent of increase was lesser than that in NEIL2silenced cells (Figure 4E). All these findings indicated that at low ROS, induction of NEIL2 inhibits DNA damage thereby protecting the cells from DNA damage-induced apoptosis, while at high ROS down-regulation of NEIL2 impairs DDR system thereby paving way to

13

apoptosis. These results signify the role of NEIL2 as a binary switch that dictates opposite tumour responses to varying degree of oxidative stress generated by PEG-ZnO NP. ROS regulate NEIL2 by modulating the expression of Sp1 as well as its binding to the NEIL2 promoter We also investigated NEIL2 expression regulation. For this we first checked the status of (Specificity protein 1) Sp 1, a major transcription factor responsible for NEIL2 expression27, under variable ROS conditions. Result (Figure 4F) showed an up-regulation of Sp1 expression at initial hours of NP treatment (up to 2h) when ROS level was low and thus justifying the increase in NEIL2 expression under these conditions. However, Sp1 expression was down-regulated over time especially when ROS level was high (Figure 4F). Most probably the decrease in Sp1 at later time points is due to its degradation by high amount of ROS. The immunoblot of degraded protein determined by the Oxyblot also confirmed that Sp1 degradation was due to oxidative stress. (Figure 4G). Promoter analysis using bioinformatics also revealed presence of putative Sp1 binding sites between the regions 100 to -144 of NEIL2 promoter (Figure 4H). Results of ChIP assay showed a marked increase in Sp1 binding to NEIL2 promoter at initial hours (first 2 h) beyond which the binding decreased gradually in treated MCF-7 cell (Figure 4I). These results indicate that at early time points, low ROS enhanced the binding of Sp1 to NEIL2 promoter thus facilitating transcription of NEIL2 to activate DNA damage repair. However, at high ROS, the oxidative degradation of Sp1 decreased its availability for binding to NEIL2 promoter. Involvement of ROS in triggering p53-mediated apoptosis in breast cancer cells Next we questioned how down-regulation of NEIL2 is related to apoptosis. Investigation revealed a significant up-regulation of γ-H2AX (a DNA damage marker) in NEIL2-silenced cells at late hours as compared to early hour (Figure 4D). In contrast, in NEIL2-over expressed cells, the expression level of γ-H2AX was extremely low in early hours of treatment while at late hours, it was increased however the extent was much lesser than that in NEIL2-silenced cells (Figure 4E). These results confirmed that down-regulation of NEIL2 has an effect on DNA damage and apoptosis. At late time points of treatment we also found a significant up-regulation of p53, both at protein and mRNA levels (Figure 5A). To understand whether NEIL2 has any cross-talk with p53 in NP-treated MCF-7 cell, we took NEIL2-silenced cells and found that on NP-treatment there was a significant increase in p53 expression at early hour (Figure 4D). In contrast, in NEIL2-over expressed cells, the expression level of p53 was low at the same time points, which increased with time, however in a much lesser extent compared to NEIL2-silenced cells (Figure 4E). Interestingly, in p53-silenced MCF-7 cells, PEG-ZnO NP did not induce significant apoptosis (Figure 5B). These results confirmed the important role of functional p53 in PEG-ZnO NP-induced MCF-7 cell apoptosis and also justify the reason behind the 14

enhanced apoptosis in functional p53-expressing breast cancer cells than the cells expressing mutant-p53 (Figure 2B). All these findings led to hypothesis that at late hour’s ROS-induced down-regulation in NEIL2 causes activation of p53 which further activates intrinsic apoptotic pathway. To confirm our hypothesis, we checked the phosphorylation (phosphorylation activates the protein) level of one of the key DNA damage sensor ATM (Ataxia Telangiectasia Mutated), and found increase in phosphorylation (Figure 5C). Activated ATM in turn phosphorylated p53 at serine-15 residue (Figure 5C), which in turns activates its down-stream regulators Bax and PUMA (Figure 5C). Pharmacological inhibition of ATM by kinase inhibitor, Wortmannin, decrease the expression of p-Ser-15-p53 (Figure 5D) and simultaneously inhibited PEG-ZnO NP-induced apoptosis (Figure 5E). We also investigated the role of ROS inhibitors on p53-mediated death pathway. It was found that NAC-pretreatment (40mM, 1h) significantly perturbed expression levels of p-ATM, p-Ser-15-p53 and other apoptosis mediators, Bax and PUMA (Figure 5F), further substantiating the pivotal role of ROS in PEG-ZnO NP-mediated breast cancer cell apoptosis. Induction of the mitochondrial death cascade on PEG-ZnO NP-treatment A gradual accumulation of Bax and Bid in the mitochondrial fraction due to translocation was also noted in treated cell line (Figure 6A) along with loss in mitochondrial transmembrane potential (MTP; Figure 6B). Loss of MTP further leads to release of cytochrome C in cytosolic fraction of MCF-7 cell and this phenomenon was prominent especially at late hours of NP-treatment. All the result suggests the involvement of mitochondrial death cascade in PEG-ZnO NP-induced MCF-7 cell apoptosis. Contribution of mitochondrial death cascade was further reinforced when mitochondrial pore blocker, CsApre-exposed cells significantly resisted PEG-ZnO NP-induced apoptosis (Figure 6B). Furthermore, CsA pre-treatment abrogated the activation of PEG-ZnO NP-induced caspase-9 as well as executioner caspase-7 in these cells (Figure 6C). Discussion The present study provides in-detail mechanism, mostly ROS mediated, underlying PEGZnO NP induced apoptosis of MCF-7 cancer cells. ROS, generated from either endogenous or exogenous sources37 also produce mutagenic DNA lesions. If not repaired, these lesions could also lead to genomic instability and, potentially, to cancer development. To counteract the deleterious effect of these lesions, cells have developed DNA repair mechanisms for their removal. The efficiency of such repair system was frequently found to be low in cells of patients with cancers.38 Therefore, deficiency in DNA repair could play an important role in carcinogenesis in humans. Endonuclease VIII-like 2 (NEIL2; EC 4.2.99.18), a mammalian base excision repair (BER) protein and orthologue of the bacterial Fpg/Nei, excises oxidized DNA lesions from bubble or single-stranded structures, suggesting its involvement in transcription-coupled DNA repair. Perturbation in NEIL2 expression may, therefore, 15

significantly impact BER capacity and promote genomic instability. Recent report by Kinslow et al.27 has also implicated ROS in regulating NEIL2 transcription. Another report shows that defective function of NEIL2, can lead to a significant increase in mutation frequency in cultured mammalian lung cells.39 There were reports of ROS mediated apoptosis by ZnO NP via p53 route in many different cancer cell lines.14, 40-41 However in this study we have demonstrated that low to moderate exposure of ROS is not sufficient to trigger apoptosis; only when ROS availability is high cancer cell undergoes apoptosis. We have also identified the key protein (NEIL2) which provides initial protection to ROS induced oxidative stress. During early hours of NP (PEG-ZnO) treatment when ROS exposure is low, NEIL2 gets overexpressed and clears up damaged DNA formed by ROS and protect the cell from apoptosis. In this phase, ROS responsive element Sp1, which acts as a transcription factor in many signaling pathways,42 binds to NEIL2 promoter and help NEIL2 to overexpress. Earlier studies have shown that Sp transcription factors were overexpressed in many breast cancer cell lines and tumors, and knockdown of Sp1 and its related transcription factor Sp3, Sp4 or their combination by RNA interference (RNAi) arrests cell growth and migration and induces apoptosis.43 Structurally Sp1, Sp3 and Sp4 are very similar and bind GC-rich promoter sequences. ROS-inducing anticancer agents such as arsenic trioxide, phenethylisothiocyanate (PEITC), betulinic acid decrease expression of Sp1, Sp3 and Sp4, so these protein are potential therapeutic target.44 There are many nanoparticles showing anticancer activity3,6 however none of them known to target these proteins, in this respect the mechanism of anticancer action of PEG-ZnO is novel. Work is undergoing in our lab to study whether PEG-ZnO can downregulate other Sp related transcription factors, such as Sp3 and Sp4, and also compare PEG-ZnO activity against other known Sp targeting agent. At later hours, higher ROS induce ubiquitin-mediated oxidative degradation of Sp1 was observed, thereby decreasing Sp1 availability for binding to the NEIL2 promoter for NEIL2 expression. As a consequence of NEIL2 down-regulation, the repair pathway becomes non-responsive and under such anti-survival cellular micro-environment, ROSmediated activation of ATM with subsequent phosphorylation and activation of p53 switches on the mitochondrial pathway of apoptosis. The regulation of ROS-NEIL2 negative feedback loop is therefore, an important factor in both tumor development and responses to anticancer therapies. Our findings on such dual role of ROS have been supported by Mohanty et al,22 who report that during genotoxic attack, while low ROS conditions favor ATM-mediated NFKβ activation and lung cancer cell survival, higher ROS conditions suppress NFKβ and ensure JNK-mediated apoptosis. We believe this is the first study showing direct evidence of any nanoparticles regulating NEIL2 transcription and eventually DNA repair pathway in breast cancer cell lines.

16

In this paper we mostly focused on ROS induced cytotoxicity pathway of PEG-ZnO NP; however we could not rule out the possible cytotoxicity comes from Zn+2 especially at late hours of NP treatment, when NP is heavily internalized inside the cell. Normally ZnO internalization happens through lysosomes where it experiences low pH and gets partially dissociated,45 there is no reason to believe that PEG-ZnO would follow a completely different route. So it is possible that a fraction of PEG-ZnO would dissociate at low pH releasing Zn+2. Zinc is an essential trace element involved in many biological regulations; however, an excessive zinc concentration leads to cell death. Zn2+ also have many role on cancer cells, including gene expression alteration, reduction in cellular metabolism, and induction of apoptosis.46 It has been demonstrated that ZnO kills triple negative breast cancer cell (TNBC) by generating Zn+2.47 To understand the PEG-ZnO behavior inside cancer cell, we lowered the pH of our buffer (pH 5) and measured the dissociation of PEG-ZnO, and our data (Table S3) showed that at pH 5 >30% PEG-ZnO got dissociated and forms Zn+2, and the rate of dissociation is higher compared to ZnO. We have also found that PEG-ZnO stability is extremely sensitive to pH changes as there was hardly any dissociation of PEG-ZnO at pH 7; however, the scenario change completely when pH was lowered only by 2 units. To summarize, our synthesized NP showed minimal toxicity towards normal cell, enhance the apoptosis in breast cancer cells while simultaneously impeding the repair pathway. Therefore, PEG-ZnO NP has the potency to evolve as a promising therapeutic approach for constructing nanotechnology-driven new generation of anti-cancer agent.

Supplementary Material Available. Supplementary data associated with this article (three tables (S1 – S3)) can be found in the online version. Funding: Financial support received from the Department of Science and Technology, India; the Council of Scientific and Industrial Research, India.

17

References 1. Nie S, Xing Y, Kim GJ, Simons JW. Nanotechnology applications in cancer. Annu Rev Biomed Eng. 2007; 9: 257-88. 2. Hait WN. Anticancer drug development: the grand challenges. Nat Rev Drug Discov 2010; 9: 253-54. 3. Ferrari M. Cancer nanotechnology: opportunities and challenges. Nat Rev Cancer 2005; 5: 161-71. 4. Ng K, Khoo S, Heng B, Setyawati M, Tan E, Zhao X, Xiong S, Fang W, Leong D, Loo J. The role of the tumor suppressor p53 pathway in the cellular DNA damage response to zinc oxide nanoparticles. Biomaterials 2011; 32: 8218-25 5. Li B, Xu H, Li Z, Yao M, Xie M, Shen H, Shen S, Wang X, Jin Yi. Bypassing multidrug resistance in human breast cancer cells with lipid/polymer particle assemblies. Int J Nanomedicine 2012; 7: 187-97. 6. Markman JL, Rekechenetskiy A, Holler E, Ljubimova JY. Nanomedicine therapeutic approaches to overcome cancer drug resistance. Adv Drug Deliv Rev 2013; 65:1866-79. 7. Rasmussen J, Martinez E, Louka P, Wingett D. Zinc oxide nanoparticles for selective destruction of tumor cells and potential for drug delivery applications. Expert Opinion on Drug Delivery 2010; 7: 1063-77. 8. Chakraborti S, Chatterjee T, Joshi P, Poddar A, Bhattacharyya B, Singh S, Gupta V, Chakrabarti,

P.

Structure

and

Activity

of

Lysozyme

on

Binding

to

ZnO

Nanoparticles. Langmuir 2010; 26: 3506-13. 9. Fröhlich E. The role of surface charge in cellular uptake and cytotoxicity of medical nanoparticles. Int J Nanomedicine 2012; 7:5577-91. 10. Guo D, Wu C, Jiang H. Synergistic cytotoxic effect of different sized ZnO nanoparticles and daunorubicin against leukemia cancer cells under UV irradiation. J Photochem Photobiol B 2008; 93:119-26. 11. Premanathan M, Karthikeyan K, Jeyasubramanian K, Manivannan G. Selective toxicity of ZnO nanoparticles toward Gram-positive bacteria and cancer cells by apoptosis through lipid peroxidation. Nanomedicine 2011; 7: 184-92. 12. Moos PJ, Chung K, Woessner D. ZnO particulate matter requires cell contact for toxicity in human colon cancer cells. Chem Res Toxicol 2010; 23,733-39. 13. Sasidharan A1, Chandran P, Menon D, Raman S, Nair S, Koyakutty M. Rapid dissolution of ZnO nanocrystals in acidic cancer microenvironment leading to preferential apoptosis. Nanoscale 2011; 3:3657-69. 18

14. Zhang H, Chen B, Jiang H, Wang C, Wang H, Wang X A strategy for ZnO nanorod mediated multi-mode cancer treatment. Biomaterials 2011; 32:1906-14. 15.

Vandebriel

R,

Dejong

W.

A

review

of

mammalian

toxicity

of

ZnO

nanoparticles. Nanotechnology, Science and Applications 2012. 5, 61-71. 16. Jokerst J, Lobovkina T, Zare R, Gambhir S. Nanoparticle PEGylation for imaging and therapy. Nanomedicine 2011; 6: 715-28. 17. Alkilany A, Thompson L, Boulos S, Sisco P, Murphy C. Gold nanorods: Their potential for photothermal therapeutics and drug delivery, tempered by the complexity of their biological interactions. Advanced Drug Delivery Reviews 2012; 64: 190-99. 18. Zhang Y, Kohler N, Zhang M. Surface modification of superparamagnetic magnetite nanoparticles and their intracellular uptake. Biomaterials 2002: 23:1553-61. 19. Oyewumi M, Yokel R, Jay M, Coakley T, Mumper R. Comparison of cell uptake, biodistribution and tumor retention of folate-coated and PEG-coated gadolinium nanoparticles in tumor-bearing mice. Journal of Controlled Release 2004; 95: 613-26. 20. Yamazaki M, Ito T. Deformation and instability in membrane structure of phospholipid vesicles caused by osmophobic association: mechanical stress model for the mechanism of poly(ethylene glycol)-induced membrane fusion. Biochemistry. 1990; 29:1309-14. 21. Chakraborty S, Mazumdar M, Mukherjee S, Bhattacharjee P, Adhikary A, Manna A, Chakraborty S, Khan P, Sen A, Das T. Restoration of p53/miR-34a regulatory axis decreases survival advantage and ensures Bax-dependent apoptosis of non-small cell lung carcinoma cells. FEBS Letters 2014 588: 549-59 22. Mohanty S, Saha S, Md S Hossain D, Adhikary A, Mukherjee S, Manna A, Chakraborty S, Mazumdar M, Ray P, Das K, Chakraborty J, Sa G, Das, T. ROS-PIASγ cross talk channelizes ATM signaling from resistance to apoptosis during chemo sensitization of resistant tumors. Cell Death Dis 2014; 5: e1021. 23. Le Bras M, Clément MV, Pervaiz S, Brenner C. Reactive oxygen species and the mitochondrial signaling pathway of cell death. Histol Histopathol 2005; 20: 205. 24. De Zio D, Cianfanelli V, Cecconi, F. New insights into the link between DNA damage and apoptosis. Antioxidants & Redox Signaling 2013 19, 559-71. 25. Devlin H, Mack P, Burich R, Gumerlock P, Kung H, Mudryj M, deVere White R. Impairment of the DNA repair and growth arrest pathways by p53R2 silencing enhances DNA damage-induced apoptosis in a p53-dependent manner in prostate cancer Cells. Molecular Cancer Research 2008; 6; 808-18

19

26. Hegde M, Hazra T, Mitra S. Early steps in the DNA base excision/single-strand interruption repair pathway in mammalian cells. Cell Res 2008; 18: 27-47. 27. Kinslow C, El-Zein R, Rondelli C, Hill C, Wickliffe J, Abdel-Rahman S. Regulatory regions responsive to oxidative stress in the promoter of the human DNA glycosylase gene NEIL2. Mutagenesis 2009; 25: 171-77. 28. Joshi P, Chakraborti S, Chakrabarti P, Haranath D, Shanker V, Ansari ZA. Role of surface adsorbed anionic species in antibacterial activity of ZnO quantum dots against Escherichia coli. J Nanosci Nanotechnol 2009; 9: 6427-33. 29. Mazumdar M, Adhikary A, Chakraborty S, Mukherjee S, Manna A, Saha S, Mohanty S, Dutta A, Bhattacharjee P, Ray P, Chattopadhyay S, Banerjee S, Chakraborty J, Ray A, Sa G, Das T. Targeting RET to induce medullary thyroid cancer cell apoptosis: an antagonistic interplay between PI3K/Akt and p38MAPK/caspase-8 pathways. Apoptosis 2013; 18: 58904. 30. Saha B, Adhikary A, Ray P, Saha S, Chakraborty S, Mohanty S, Das K, Mukherjee S, Mazumdar M, Lahiri L, Hossain D, Sa G, Das T. Restoration of tumor suppressor p53 by differentially regulating pro- and anti-p53 networks in HPV-18-infected cervical cancer cells. Oncogene 2011; 31: 173-86. 31. Saha S, Bhattacharjee P, Mukherjee S, Mazumdar M, Chakraborty S, Khurana A. Contribution of the ROS-p53 feedback loop in Thuja-induced apoptosis of mammary epithelial carcinoma cells. Oncol Rep 2014; 31: 1589-98. 32. Lahiry L, Saha B, Chakraborty J, Adhikary A, Mohanty S, Hossain D, Banerjee S, Das K, Sa G, Das T.Theaflavins target Fas/caspase-8 and Akt/pBad pathways to induce apoptosis in p53-mutated human breast cancer cells. Carcinogenesis 2009; 31: 259-268. 33. Dutta R, Nenavathu B, Gangishetty M, Reddy A. Studies on antibacterial activity of ZnO nanoparticles by ROS induced lipid peroxidation. Colloids and Surfaces B: Biointerfaces 2012; 94: 143-50. 34. Bian S, Mudunkotuwa I, Rupasinghe T, Grassian, V. Aggregation and dissolution of 4 nm ZnO nanoparticles in aqueous environments: influence of pH, ionic strength, size, and adsorption of humic acid. Langmuir 2011; 27: 6059-68. 35. Kuo LJ, Yang LX. γ-H2AX - A Novel Biomarker for DNA Double-strand Breaks. In Vivo 2008; 22: 305-09. 36. Haupt S, Berger M, Goldberg Z, Haupt Y. Apoptosis-the p53 network. J Cell Sci 2003; 116: 4077-85.

20

37. Maraldi T, Prata C, Vieceli Dalla Sega F, Caliceti C, Zambonin L, Fiorentini D, Hakim G. NAD(P)H oxidase isoform Nox2 plays a prosurvival role in human leukaemia cells. Free Radical Research 2009; 43: 1111-21. 38. Janik J, Swoboda M, Janowska B, Cieśla J, Gackowski D, Kowalewski J, Olinski R, Tudek B, Speina E. 8-Oxoguanine incision activity is impaired in lung tissues of NSCLC patients

with

the

polymorphism

of

OGG1

and

XRCC1

genes. Mutation

Research/Fundamental and Molecular Mechanisms of Mutagenesis 2011; 709-710: 21-31. 39. Dey S, Maiti A, Hegde M, Hegde P, Boldogh I, Sarkar P, Abdel-Rahman S, Sarker A, Hang B, Xie J, Tomkinson A, Zhou M, Shen B, Wang G, Wu C, Yu D, Lin D, Cardenas V, Hazra T. Increased risk of lung cancer associated with a functionally impaired polymorphic variant of the human DNA glycosylase NEIL2. DNA Repair 2012; 11: 570-78. 40. Sharma V, Anderson D, Dhawan A. Zinc oxide nanoparticles induce oxidative DNA damage and ROS-triggered mitochondria mediated apoptosis in human liver cells (HepG2). Apoptosis 2012; 17: 852-70. 41. Ahamed M, Akhtar M, Raja M, Ahmad I, Siddiqui M, AlSalhi M, Alrokayan S. ZnO nanorod-induced apoptosis in human alveolar adenocarcinoma cells via p53, survivin and bax/bcl-2 pathways: role of oxidative stress. Nanomedicine 2011; 7: 904-13. 42. Safe S, Abdelrahim M. Sp transcription factor family and its role in cancer. European Journal of Cancer 2005; 41: 2438-48. 43. Jutooru I, Guthrie AS, Chadalapaka G, Pathi S, Kim K, Burghardt R, Jin UH, Safe S. Mechanism of action of phenethylisothiocyanate and other reactive oxygen species-inducing anticancer agents. Mol Cell Biol 2014; 34:2382-95. 44. Hedrick E, Cheng Y, Jin UH, Kim K, Safe S. Specificity protein (Sp) transcription factors Sp1, Sp3 and Sp4 are non-oncogene addiction genes in cancer cells. Oncotarget 2016; doi: 10.18632/oncotarget.7925. 45. K. H. Muller, J. Kulkarni, M. Motskin, A. Goodi, P. Winship, J. N. Skepper, M. P. Ryan, A. E. Porter. pH-dependent toxicity of high aspect ratio ZnO nanowires in macrophages due to intracellular dissolution. ACS Nano 2010: 4; 6767. 46. Sasidharan A, Chandran P, Menon D, Raman S, Nair S, Koyakutty M. Rapid dissolution of ZnO nanocrystals in acidic cancer microenvironment leading to preferential apoptosis. Nanoscale 2011; 3:3657-69. 47. Othman BA, Greenwood C, Abuelela AF, Bharath AA, Chen S, Theodorou I, Douglas T, Uchida M, Ryan M, Merzaban JS, Porter AE. Correlative Light-Electron Microscopy Shows RGD-Targeted ZnO Nanoparticles Dissolve in the Intracellular Environment of Triple 21

Negative Breast Cancer Cells and Cause Apoptosis with Intratumor Heterogeneity. Adv Healthc Mater 2016; doi: 10.1002/adhm.201501012.

Figure Legend

Figure 1. Characterization of PEG-ZnO nanoparticles by (A) TEM, at 20nm scale bar. (B) AFM image in 2D representing the surface morphology. (C) FTIR spectrum in the transmittance mode; and (D) the relative aggregation profile of PEG-ZnO as well as ZnO over time determined using DLS (data are presented as mean±SEM of three independent experiments). Figure 2. PEG-ZnO induced apoptosis in variety of breast cancer cells, sparing normal cells. (A) Dose-dependent (0-37.5µg/mL; 24h) apoptotic effects of ZnO and PEG-ZnO on peripheral blood mononuclear cells (PBMC) were scored by trypan blue exclusion test. (B) The non-toxic dose of PEG-ZnO NP (25µg/mL) was administered to a set of breast cancer cells, MCF-7, MDA-MB-231, MDA-MB-468, and T47D for 24h and percent cell death was determined. (C) Cell cycle phase distribution of nuclear DNA after NP (25µg/mL) treatment was determined by flow cytometry in MCF-7 cells. (D) PEG-ZnO treated MCF-7 cells were subjected to Annexin-V/7AAD staining and were analyzed by flow cytometry. (E) DAPI staining of nuclear blebbing in PEG-ZnO treated MCF-7 cells is shown (Magnification 40X). (F) SEM images showing morphological changes in MCF-7 cells after PEG-ZnO treatment resulting apoptotic membrane blebbing have been presented. Values are mean ± SEM of three independent experiments. Figure 3. PEG-ZnO induce ROS causes lipid peroxidation and apoptosis of MCF-7 cell (A) Treated MCF-7 cells were assessed for intracellular ROS generation by measuring DCFfluorescence and analyzed by a flow cytometer. (B) Confocal microscopic representation of ROS generation was visualized after fixation and permeabilization of control/ NP-treated MCF-7 cells using DCF-fluorescence measurement (Magnification 40X). (C) Membrane lipid peroxidation was determined in cell lysate by TBARS assay and is reported as relative percentage of MDA formation against time. (D) Internalization of NP measured through EDX in MCF-7 cells after 2h. (E) Treated MCF-7 cells were examined for time-dependent (0-24h) variation in the expression profile of phospho-H2AX by western blot analysis (left panel). The intensities of p-H2AX bands were quantitated and normalized with

22

corresponding α-actin band intensities (right panel). (F) MCF-7 cells pre-treated with with/without NAC incubated in presence or absence of PEG-ZnO and percent apoptosis was determined by Annexin-V/7AAD staining. (G) Treated MCF-7 cells were examined for expression of phospho-H2AX with/without NAC treatment by western analysis (left panel). The intensities of p-H2AX bands were quantitated and normalized with corresponding αactin band intensities (right panel). All data are furnished as mean±SEM or representative of three independent experiments. Figure 4. ROS mediated switching of NEIL2 leading to DNA damage and oxidative stress. ROS regulates NEIL2 by modulating Sp1 expression and its binding to the NEIL2 promoter. (A) Treated cells were examined for time-dependent (0-24h) variation in the expression profile of NEIL2 protein by western blot (upper left panel) and the mRNA by RT-PCR (lower left panel). The intensities of NEIL2 bands were quantitated and normalized with corresponding α-actin band intensities (right panel). (B) PEG-ZnO treated MCF-7 cells were examined for expression of NEIL2 in the presence of high and low concentrations of H2O2 (expression checked after 8h of treatment) and NAC (expression checked after 2h of treatment) (left panel). The intensities of NEIL2 bands were quantitated and normalized with corresponding α-actin band intensities (right panel). (C) MCF-7 cells transfected with control-siRNA or NEIL2-siRNA, were examined for percent apoptosis after PEG-ZnO NPtreatment. (D) MCF-7 cells transfected with control siRNA and NEIL2-siRNA were examined for the expression of p53 and γ-H2AX at early and late hours (upper left and upper right panel, respectively) of PEG-ZnO NP treatment. The intensities of p53 and γ-H2AX bands were quantitated and normalized with corresponding α-actin band intensities (lower panel). (E) MCF-7 cells transfected with NEIL2-cDNA were examined for expression of p53 and γH2AX at early and late hours (upper left and upper right panel, respectively) of PEGZnO NP treatment. The intensities of p53 and γ-H2AX bands were quantitated and normalized with corresponding α-actin band intensities (lower panel). (F) PEG-ZnO NPstreated MCF-7 cells were examined for time-dependent (0-24h) variation in the expression profile of Sp1 protein by western blot (left panel). The intensities of Sp1 bands were quantitated and normalized with corresponding α-actin band intensities (right panel). (G) Sp1-immunoprecipitates from PEG-ZnO NP treated MCF7 cells were probed with anti-DNP and anti-ubiquitin antibodies to determine the levels of Sp1 oxidation and degradation. Total Sp1 level was also determined in these cells. (H) Computational analysis showed presence of putative Sp1 binding sites between -100 to -144 fragments of NEIL2 promoter. (I) Status of Sp1 binding to NEIL2 promoter, was observed by ChIP assay at varying time points (0-24h) in treated MCF-7 cells. All data are presented as mean±SEM or representative of three independent experiments.

23

Figure 5. PEG-ZnO induced breast cancer cells apoptosis via p53 route. (A) Treated MCF-7 cells were examined for time-dependent (0-24h) variation in the expression profiles of p53 protein by western (upper left panel) and mRNA by RT-PCR (lower left panel). The intensities of p53 bands were quantitated and normalized with corresponding α-actin band intensities (right panel). (B) MCF-7 cells, transiently transfected with control-siRNA or p53siRNA, were examined for percent apoptosis after PEG-ZnO NP-treatment. The efficiency of transfection was assessed by evaluating the expression of p53 (inset). (C) Treated MCF-7 cells were examined for time-dependent (0-24h) variation in the expression profiles of phospho-ATM, phospho-p53 at Ser-15, Bax and PUMA by western blot analysis (left panel). The intensities of phospho-ATM, phospho-p53 at Ser-15, Bax and PUMA bands were quantitated and normalized with corresponding α-actin band intensities (right panel). (D) Expression profiles of phospho-p53 at Ser-15 (left panel) were determined in MCF-7 cells pre-treated with Wortmannin and subjected to PEG-ZnO NP treatment. The intensities of phospho-p53 at Ser-15 bands were quantitated and normalized with corresponding α-actin band intensities (right panel).(E) Percent cell death were determined in MCF-7 cells pretreated with Wortmannin and subjected to PEG-ZnO NP treatment. (F) Expression profiles of phospho-ATM, phospho-p53 at Ser-15, Bax and PUMA in MCF-7 cells were determined by western blot on NAC pre-treated PEG-ZnO NP exposed cells (left panel). The intensities of phospho-ATM, phospho-p53 at Ser-15, Bax and PUMA bands were quantitated and normalized with corresponding α-actin band intensities (right panel). Data are provided as mean ± SEM or representative of three independent experiments. α-actin and GAPDH were used as internal loading control. Figure. 6. PEG-ZnO triggered mitochondrial death cascade in MCF-7 cells. (A) t-Bid and Bax translocation to mitochondria and release of cytochrome-c were determined by analyzing the levels of t-Bid, Bax and cytochrome-c in mitochondrial and cytosolic fractions of untreated and PEG-ZnO treated MCF-7 cells (left panel). The intensities of t-Bid, Bax and cytochrome-c bands were quantitated and normalized with corresponding α-actin/MnSOD band intensities (right panel). (B) Loss of MTP of tumor cells treated with NP with and without mitochondrial pore blocker cyclosporine A (CsA; left panel). In a parallel set, percentage apoptosis was scored by Annexin-V/7AAD assay (right panel). (C) Expression profile of cleaved-caspase -7 and -9 were determined by western analysis in CsA-pretreated PEG-ZnO NP exposed MCF-7 cells (left panel). The intensities of the cleaved-caspase -7 and -9 bands were quantitated and normalized with corresponding α-actin band intensities (right panel). Data are presented as mean±SEM or representative of three independent experiments. α-actin and MnSOD were used as internal loading control.

24

Figure 1.

25

Figure 2.

26

Figure 3.

27

Figure 4.

28

Figure 5. 29

Figure 6.

Highlights 

PEG-coated ZnO nanoparticles (PEG-ZnO NPs) have greater stability than ZnO NPs. 30



PEG-ZnO NPs have significant anti-tumor activity against human breast cancer cells.



DNA repair or apoptosis occurs depending on ROS level in a time-dependent manner.



There is ROS-NEIL2 cross-talk in deciding cell fate during PEG-ZnO NP treatment.

31