Pentatrichomonas hominis in empyema thoracis

TRANSACTIONSOFTHEROYALSOCIETYOFTROPICALMEDICINEANDHYGIENE(2000)94,185-186

1 Short Report

)

P entatrichomonas empyema thoracis

hominis

in

Somchai Jongwutiwes’*, Udomsak Silachamroon2 ‘Department of Paraand Chaturong Putaporntip’ sitology, Faculty of Medicine, Chulalongkom University, Bangkok 10330, Thailand; ‘Department of Clinical Tropical Medicine, Faculty of Tropical Medicine, Mahidol Universi&, Bangkok 10400, Thailand Pentutrichomonashominis, empyema thoracis, pulmonary trichomoniasis, systemic lupus erythematosus, 5.8s rRNA gene, case report, Thailand

Keywords:

Although pulmonary trichomoniasis has not been frequently diagnosed, almost all species identified so far have been regarded as Trichomonas tenax, occurring exclusively in patients with underlying cancers or other lung diseases (WALTON& BACHARACH, 1963).Invery rare cases, intra-thoracic spreading of genitourinary T. vaginalis and intra-abdominal Pentatrikhomonas hominis (formerly known as T. hominis) have been noted (HERSH, 1985). Detailed species characterization of trichomonads in these reports has not been extensively performed since morphology-based diagnosis by fresh wet preparation and staining procedures may not always be conclusive owing to the fragility of the organisms, improper sample processing or interference from co-existing inflammatory cells. Here we describe a fatal case of systemic lupus erythematosus in a woman who harboured l? hominis in both stool and exudative pleural effusion as confirmed by DNA sequencing. Case report In March 1997, a 28-year-old Thai woman was admitted to King Chulalongkorn Memorial Hospital with quadriplegia, fever, dyspnoea and watery diarrhoea of 1 month’s duration. She had also suffered from weight loss, malar rash, alopecia, dysuria, malaise and generalized seizures for 2 months before admission. On physical examination, she was febrile, pale, stuporous with respiratory distress, and decreased motor power in both upper and lower extremities. Laboratory tests showed pancytopenia, positive antinuclear factor of 1:640 speckle type and of 1: 160 peripheral type, and negative anti-HIV. Liver function revealed an elevated level of alkaline phosphatase (1272 IU) and hypoalbuminaemia (1.9 g%). Kidney function was normal. Urinalysis showed 40-50 leucocytesihigh-power field (hpf), 2025 erythrocytes/hpf and protein 2+. Urine culture yielded significant growth of Escherichia coli. Rhabditiform larvae of Strongyloides stercoralis, ova of Opisthorchis viverrini and trophozoites of I? hominis were detected in stool specimens. Magnetic resonance imaging indicated cerebral infarction of both basal ganglia, and right external and internal capsules. Massive left pleural effision and shifting of the mediastinum to the right were apparent on chest radiograph (Fig. 1). On admission, left thoracocentesis with tubal drainage was performed which yielded 300 mL of brownish, foulsmelling exudate containing numerous erythrocytes, 9050 leucocytes/mm3 (85% neutrophils and 15% mononuclear cells) and several actively motile trichomonad *Author for correspondence: fax +662 2524963, e-mail fmedsiw@!md2.md.chula.ac.th Prese&d in part at the Interhospital Conference of the Thoracic Society of Thailand, King Chulalongkom Memorial Hospital, Bangkok, on 19 December 1997.

Fig. 1. Chest radiograph on admission showing massive left pleural effusion with shifting of the mediastinum to rhe right.

flagellates. Staining of exudate revealed a moderate amount of Gram-positive cocci and Gram-negative bacilli; however, culture was negative. Pseudomonas aeruginosa was isolated from sputum. No trichomonad was detected from mouth washings by wet smear. The patient was diagnosed as having systemic lupus erythematosus and was given dexamethasone, amikacin, cefpirome, metronidazole, praziquantel and thiabendazole. Despite the drug treatment and supportive respiratory care, her symptoms deteriorated and she died after 18 days of hospitalization. Precise species identification of trichomonads from pleural fluid was not possible owing to the interference of abundant leucocytes, and most of the parasites appeared as motile spherical bodies. Results of Giemsa staining were also inconclusive in this case. However, l? hominis was successfully isolated from the patient’s stool but not from the pleural exudate using Boeck and Drbohlav’s Locke-egg medium without serum. Cultured I? hominis exhibited typical morphology upon Giemsa staining. In order to verify the species of pulmonary trichomonad, we exploited the polymerase chain reaction (PCR) to amplify the 5.8s rRNA gene and internal transcribed spacer flanking regions (ITS1 and ITS2) of trichomonads, followed by direct sequencing of the PCR products in both directions. The forward and reverse primers for PCR and sequencing were TRICHO-F; 5’-CGG TAGGTGAACCTGCCGTT-3’, and TRICHO-R, 5’-TGCTTCAGTTCAGCGGGTCT-3’, respectively. The DNA templates used were purified from the pleural exudate, and the other from l? hominis in stool culture of the patient before metronidazole administration. Results revealed identical sequences of these samples (accession AF156964) which are consistent with the previously published sequence of l? hominis except 1 nucleotide substitution and deletion of 1 base (Fig. 2) (FELLEISEN, 1997).

186

SOMCHAI JONGWUTIWES ETAL.

Tt: Ph: PX:

< ITS1 CGGTAGGT~GGAWAGT~TAGTTTTAATAA~TAACA~~AAC-TTCTTT .................................. ..-.........T........................................ ..- .. C.-------....AC .................................. ..- .... -------....A-

TV: Tt: Ph: Px:

>< T-ATTAAACAAAAACCAATACAAAATTAAA?.ACTAACT----TCATCAAAAACCAAGTCT .T.....T.......T.......--...T...-.....AACT..........T ....... .--..G.T--.............- .AT...C......----.A..-----GTA.G .... .--. . G.T--.............- .AT...C......----.A..-----GTA.G ....

114 115 97 96

TV: Tt: Ph: PX:

5.8s rRNA CTAAGCAAl-GGATGTCTTGGCTCCTCACACGATGAAGAACGTGGCATAATGTGTTMiGTA ............................................................ .... A.....................................T..........A ...... .... A.....................................T..........A ......

174 175 157 156

TV: Tt: Ph: PX:

ACCGGAGTl'X!AAACATCATGACAGGTTAATCTTn;AATG ..T...........................................T.G ::'i:::::::.G.....TG .... .A.........................AT.C..GA ..T........G.....TG.....A.........................AT.C..GA

TV: Tt: Ph: PX:

>< ITS2 CTCGGTCGAGAAGCATGGGTGTGACAGTACTACATCTTTT T....CT..........C....A.......A....AA....T.ATTC-- .. .T....ATA.A.TCT................A....---....C..A T.ATTC--...T....ATA.A.TCT................A....---....C..A

TV: Tt: Ph: PX:

GCGAATAAGTAAATAATATATAAGACAA&CACGTAGTCTGCCATACGCAGGA&~ AT.............TT....T......T ................ ............... --..GC.A...ACTA.A.GCA.............GG...T.T ......... ------...-.. GC.A...ACTA.A.GCA.............GG...T.T .........

TV: Tt: Ph: PX:

CG m ............... ............... ...............

TV:

59 58 52 51

...... ...... ......

234 C 235 217 .. 216

.................. ... ...

293 294 272 271 353 354 324 323

368 369 339 338

Fig. 2. Sequence alignment of the 5.8s rRNA gene and internal transcribed spacer regions (ITS 1 and ITSZ) of Penzatrichomonas hominis from the patient’s pleural exudate and stool (Px), compared with published sequencesof I? hominis (Ph), T. vaginalis (TV) and T. tenax (Tt) (FELLEISEN, 1997). Identical residues are indicated by dots and deletions by dashes. Underlined primers for PCR and sequencing. Region boundaries are marked above the alignment.

Discussion

It has been suggested that T. tenax gains access into the lungs of patients with poor oral hygiene or diseases of the oral cavity via aspiration (WALZER et al., 1978). Direct intra-thoracic spreading of l? hominis has reportedly originated from subphrenic and liver abscess which coexisted with other pathogens (HERSH, 1985). However, there was no evidence of intra-abdominal and intrathoracic connection at autopsy in this case. Orogenital sexual relation was not the case in this patient and her husband did not harbour any intestinal parasite. It could be speculated that orofaecal contamination in debilitated hosts, followed by aspiration, might be responsible for ectopic settlement of P. hominis. On the other hand, l? horn&is may directly enter the circulation, traversing the large intestine with underlying microvascular pathology. How P. hominis gains access into the lung remains unknown. The occurrence of trichomonads in the respiratory tract might be more frequently detected if a preliminary wet mount smear were routinely performed in patients with underlying cancers, chronic lung diseases, or immunosuppression or in infants delivered vaginally by infected mothers (MCIAREN et al., 1983). Furthermore, rapid disappearance of pulmonary trichomonads after administration of metronidazole or after drainage of pleural fluid renders the condition rarely diagnosed. Despite the fact that some trichomonads such as T. vaginalis and T. foetus, a urogenital flagellate of cattle, exhibit reduced susceptibility to metronidazole (bND & JOHNSON, 1997), the clearance of P. hominis in follow-up stools and pleural effusion samples from our patient makes reduced susceptibility unlikely in our case. P.

sequences represent locations of

hominis is generally considered an intestinal commensal: whether ectopic lodging with other bacterial pathogens or an emergence of virulent strains can aggravate deterioration in an immunocompromised host remains to be elucidated. In this regard, definite species identification is of primary importance. Acknowledgements This work received main financial support from the Hitachi Scholarship Research Grant (Tokyo) and partial support from the Molecular Biology Project of the Faculty of Medicine, Chulalongkom University. References Felleisen, R. S. (1997). Comparative sequence analysis of 5.8s rRNA genes and internal transcribed spacer (ITS) regions of trichomonadid protozoa. Parasitology, 115, 11 l-l 19. Hersh, S. M. (1985). Pulmonary trichomoniasis and Trikhomonas tenax. Journal of Medical Microbiology, 20, 1- 10. Land, K. M. & Johnson, P. J. (1997). Molecular mechanisms underlying metronidazole resistance in trichomonads. Experimental Parasitology, 87, 305-308. McLaren, L. C., Davis, L. E., Healy, G. R. & James, C. G. (1983). Isolation of Trichomonas vaginalis from the respiratory tract of infants with respiratory disease. Pediatrics, 71, 888890. Walton, B. C. & Bacharach, T. (1963). Occurrence of trichomonads in the respiratory tract. Report of three cases. Journal of Parasitology, 49, 35-38. Walzer, I’. D., Rutherford, I. & East, R. (1978). Empyema with Trikhomonas species. American Review of Respiratoy Disease, 118,415-418. Received 23 September 1999; revised 11 November accepted for publication 24 November 1999

1999;