Pentraxin 3 promotes oxLDL uptake and inhibits cholesterol efflux from macrophage-derived foam cells

Experimental and Molecular Pathology 96 (2014) 292–299

Contents lists available at ScienceDirect

Experimental and Molecular Pathology journal homepage: www.elsevier.com/locate/yexmp

Pentraxin 3 promotes oxLDL uptake and inhibits cholesterol efflux from macrophage-derived foam cells☆ Weishuo Liu a,b, Jianwei Jiang c, Dan Yan a, Dujuan Li a, Wei Li a, Yungui Ma a, Lili Yang a, Zhiling Qu a, Qiurong Ruan a,⁎ a b c

Institute of Pathology of Tongji Hospital, Tongji Medical College, Huazhong University of Science and Technology, Wuhan, China Department of Pathology of the First Affiliated Hospital of Soochow University, Suzhou, China Department of Hepatobiliary Surgery, Union Hospital, Tongji Medical College, Huazhong Umversiy of Science and Technology, Wuhan, China

a r t i c l e

i n f o

Article history: Received 26 May 2013 Received in revised form 13 March 2014 Available online 24 March 2014 Keywords: Pentraxin 3 Macrophage Atherosclerosis

a b s t r a c t Background: The objective of this study was to determine the effects of pentraxin3 (PTX3) on human oxidized low density lipoprotein (oxLDL) uptake and cholesterol efflux from human macrophage foam cells, which may play a critical role in atherogenesis. Methods: The effects of PTX3 on oxLDL uptake and cholesterol efflux were determined after transfection of human THP-1 macrophages with pSG5hPTX3 or PTX3siRNA plasmids. To evaluate the role of specific signaling pathways, human THP-1 cells were pre-treated with inhibitors of the extracellular signal-regulated protein kinases 1 and 2 (ERK1/2), phosphatidylinositide 3-kinases (PI3-K), and p38 mitogen-activated protein kinase (MAPK) pathways (PD98059, LY294002, and SB203580, respectively), and then exposed to oxLDL for the uptake assay or oxLDL and [3H]-cholesterol and apolipoprotein A-I (apoA-I) for the cholesterol efflux assay. Results: PTX3 overexpression not only promoted oxLDL uptake but also significantly reduced cholesterol efflux to apoA-I; it also significantly decreased the expression of peroxisome proliferator-activated receptor-γ (PPARγ), liver X receptor alpha (LXRα) and ATP-binding membrane cassette transporter A-1 (ABCA1), which was increased with PTX3 silencing. Furthermore, PTX3 significantly increased p-ERK1/2 levels in THP-1-derived foam cells, and inhibition of ERK1/2 by PD98059 significantly reduced the oxLDL uptake and promoted the cholesterol efflux induced by PTX3 overexpression. Conclusion: Here, we demonstrate that PTX3 affects lipid accumulation in human macrophages, increasing oxLDL uptake and inhibiting cholesterol efflux. That is the underlying possible mechanisms of PTX3 contribution to the progression of atherosclerosis. © 2014 Elsevier Inc. All rights reserved.

Introduction It is well documented that immunological and inflammatory processes play a fundamental role in atherogenesis (Klingenberg and Hansson, 2009; Libby et al., 2010; Zwaka et al., 2001). Pentraxins, a superfamily of acute-phase proteins highly conserved during evolution and characterized by a multimeric, usually pentameric structure, are key components of the humoral arm of the innate immune system (Bottazzi et al., 2010; Norata et al., 2009, 2010). The pentraxin family is composed of the short pentraxins, such as C-reactive protein (CRP) and serum amyloid P component (SAP), and long pentraxins, including pentraxin 3 (PTX3). PTX3 is structurally related but distinct from CRP ☆ Financial support: This study was supported by a grant from the National Natural Science Foundation of China (No. 30570725). The funder had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript. ⁎ Corresponding author at: Institute of Pathology, Tongji Hospital, Tongji Medical College, Huazhong University of Science and Technology, Wuhan 430030, China. Fax: +86 27 83650729. E-mail address: [email protected] (Q. Ruan).

http://dx.doi.org/10.1016/j.yexmp.2014.03.007 0014-4800/© 2014 Elsevier Inc. All rights reserved.

and SAP in terms of gene organization and localization, ligand recognition, cellular source, and inducing signals. Unlike CRP, PTX3 is not synthesized in the liver (Lee et al., 1994), but is released by monocytes/ macrophages, endothelial cells, smooth muscle cells, adipocytes, and neutrophils in response to inflammatory cytokines, such as interleukin (IL)-1 and tumor necrosis factor (TNF)-α, as well as acetylated, oxidized, and enzymatically modified LDL. The presence of PTX3 protein was demonstrated in the advanced atherosclerotic plaques and myocardial tissues of patients with acute myocardial infarction (AMI) by immunohistochemistry (Nebuloni et al., 2011; Rolph et al., 2002; Savchenko et al., 2008). In addition, modified atherogenic lipoproteins induced expression of PTX3 by human vascular smooth muscle cells (Klouche et al., 2004). Moreover, elevated plasma PTX3 levels were detected in patients with unstable angina pectoris (Inoue et al., 2007), and in the coronary artery at sites distal from the plaque lesion, PTX3 levels were significantly elevated compared with proximal sites, suggesting that it originated from the atherosclerotic plaque itself and may reflect active atherosclerosis (Inoue et al., 2007). In addition, PTX3 may represent an early marker

W. Liu et al. / Experimental and Molecular Pathology 96 (2014) 292–299

of myocardial lesion; higher PTX3 levels (N10.73 ng/mL) were associated with increased 3-month mortality in patients with AMI (Latini et al., 2004; Peri et al., 2000). Taken together, these data suggest that PTX3 may be involved in the pathogenesis of atherosclerosis. The differentiation of monocytes to macrophages that accumulate oxLDL to form foam cells in the vessel wall represents a major event in the progression of atherosclerosis (Li and Glass, 2002; Ohashi et al., 2005). The uptake of extracellular lipid depots into macrophages is mediated by scavenger receptors, including CD36. In addition to oxLDL uptake, cholesterol efflux may play a pivotal role in the removal of excess cholesterol from extra hepatic cells, including macrophages and smooth muscle cells (Wang et al., 2008). The efflux of internalized cholesterol to apoA-I containing particles is mediated by cholesterol exporters, including ATP-binding cassette transporter (ABCA1), and scavenger receptor BI (SR-BI). Thus, decreased cholesterol efflux from the arterial wall may potentially promote the progression of atherosclerosis. The objective of this study was to examine the hypothesis that PTX3 could directly alter oxLDL uptake and cholesterol efflux from macrophage foam cells. PTX3 overexpression inhibited cholesterol efflux via activation of extracellular signal-regulated protein kinases 1 and 2 (ERK1/2) but not phosphatidylinositide 3-kinases (PI3-K) or p38 mitogen-activated protein kinases (MAPKs) as well as down-regulated the expression of the key cholesterol transporter, ABCA1, and nuclear transcription factors, peroxisome proliferator-activated receptor-γ (PPARγ) and liver X receptor alpha (LXRα). Methods Chemicals and reagents PD98059, Ly294002, and SB203580 were purchased from Calbiochem (San Diego, CA, USA). Phorbol 12-myristate 13-acetate (PMA) and apolipoprotein A-I (apoA-I) were obtained from Sigma (St Louis, MO, USA). [1α, 2α (n)-3H]-Cholesterol was purchased from Perkin-Elmer Life Sciences (Piscataway, NJ, USA). Human oxLDL and 1, 1′-dioctadecyl-3, 3, 3′, 3′-tetramethylindo-carbocyanine percholate-labeled oxLDL (DiloxLDL) were obtained from Yiyuan Biotechnologies (Guangzhou, China). Rabbit polyclonal anti-PTX3 (NBP1-55588) and anti-ABCA1 (NB400-105) antibodies were obtained from Novus Biologicals (Littleton, CO, USA). Anti-ERK1/2 (9102), anti-phospho ERK1/2 (9101S), anti-p38 (9212), and anti-phospho p38 (9211S) antibodies were purchased from Cell Signaling Technology (Beverly, MA, USA); anti-PPARγ (sc-7273) and anti-LXRα (sc-13068) antibodies were obtained from Santa Cruz (Santa Cruz, CA, USA). Anti-β-actin monoclonal antibody (A-5316), the internal standard control, was purchased from Sigma. Cell culture Human THP-1 cells were obtained from the American Type Culture Collection (ATCC) and cultured in RPMI 1640 medium containing 10% FBS (Gibco) at 37 °C in a humidified 5% CO2 atmosphere for 3–4 days before prior to use. The cells were washed twice with RPMI 1640, and 1 × 106 cells/well were plated into 6-well plates, and differentiated to macrophage-like cells by pre-incubation with 160 nM PMA for 24 h. Viability of the cells was N 95% throughout the experimental period as determined by trypan blue exclusion. Transient transfection PMA-differentiated THP-1 cells were grown in 6-well plates until reaching approximately 80% confluence after which the medium was changed to OptiMEM (Invitrogen) for transfection with either pSG5hPTX3 plasmids or PTX3siRNA using Fugene 6 reagent (Promega, Madison, WI, USA) at the indicated concentration (1.5 μg plasmid in 5.25 μL reagent). After 24 h, THP-1 cells were then pretreated with or without inhibitors (20 μM PD98059, 10 μM Ly294002 or 10 μM

293

SB203580) for 30 min prior to the addition of 50 μg/mL oxLDL for 24 h as described previously (Jing et al., 2000; Suzuki et al., 2013; Yamaguchi et al., 2006). The full-length human PTX3 expression vector (PSG5hPTX3) was kindly provided by Dr. Barbara Bottazzi (Rozzano, Milan, Italy). The pSG5 empty vector was used as a control. A PTX3-specific siRNA was amplified using the following primers (Invitrogen): forward primer, 5′-CAAAGAGGAAUCCAUAUGA dTdT-3′ and reverse primer, 5′-UCAU AUGGAUUCCUCUUUG dTdT-3′. The PTX3 siRNA or the negative control RNA (pGCsi.U6/neo/GFP RNAi-NC vector) were transfected into THP-1 cells using Fugene HD 6 reagent (Roche, Mannheim, Germany) for 24 h. To estimate PTX3siRNA transfection efficiency, a construct expressing GFP was routinely used, and its expression was visualized using fluorescence microscopy. The transfection efficiency of THP-1 cells ranged from 30 to 50%. Isolation of LDL and preparation of oxLDL OxLDL was prepared using a kit and following the manufacturer's instructions (Cat No: YB-002; Yiyuan Biotechnologies, Guangzhou, China). Briefly, human LDL (Cat.No.YB-001; Yiyuan Biotechnologies) was purified to homogeneity via ultracentrifugation (1.019 to 1.063 g/cc) and oxidized using 5 μM CuSO4 in PBS at 37 °C for 20 h. Oxidation was terminated by adding excess EDTA-Na2, which was filter sterilized using a 0.22-μm filter, and stored in a solution containing PBS (pH 7.4) and 5 μM EDTA-Na2 at 4 °C. Protein content was determined using the Lowry method, and the purity and charge of both LDL and oxLDL were evaluated by examining their electrophoretic migration in agarose gels. The degree of oxidation was determined by measuring the amount of thiobarbituric acid reactive substances (TBAR). LDL had TBAR values of b1 nmol/mg; oxLDL had TBAR values of N10 and b 30 nmol/mg. All lipoproteins were used for experiments within 4 weeks after preparation. Fluorescence microscopy THP-1 cells (1 × 106 cells/well) were plated onto 6-well tissue culture plates and differentiated to macrophage-like cells by preincubation with 160 nM PMA in RPMI 1640 medium containing 10% FBS for 24 h at 37 °C in 5% CO2. Cells were then transfected with the control or pSG5hPTX3 expression vectors for 24 h; 10 μg/mL Dil-oxLDL was added for the last 6 h in accordance with manufacturer's instruction manual. Plates were washed twice in PBS, and the fluorescence intensity of the cells was analyzed under an inverted fluorescent microscope (ZEISS-SIP No. MIC01774) along with Image Pro Plus image analysis software. Data are shown as mean fluorescence of 500 cells per treatment as previously described (Choi et al., 2005), with three fields analyzed per experiment. Three independent experiments were performed. RT-PCR and real-time RT-PCR analysis Total RNA was isolated from cells using Trizol reagent (TaKaRa). Glyceraldehyde-3-phosphate dehydrogenase (GAPDH), PTX3, PPARγ, LXRα, ABCA1, SR-BI, and CD36 gene expression was analyzed using the primers shown in Table 1 (Invitrogen) and amplification with an Applied Biosystems Thermal Cycler (Carlsbad, CA, USA). GAPDH, PTX3, PPARγ, LXRα, ABCA1, SR-BI, and CD36 mRNA levels were also analyzed by real-time PCR using the SYBR Green Master (Toyobo) with gene-specific primers using a Stratagene Mx3000P system (La Jolla, CA, USA) according to the manufacturer's guidelines. GAPDH or β-actin served as an internal standard. Relative gene expression was calculated using the ΔΔCt method using the following equation: 2−Δ(ΔCt). ΔCt = Ct(specific transcript) − Ct(housekeeping transcript) and Δ(ΔCt) = ΔCt(treatment) − ΔCt(control) as previously described (Rubic and Lorenz, 2006).

294

W. Liu et al. / Experimental and Molecular Pathology 96 (2014) 292–299

cellular cpm), with the subtraction of basal cholesterol efflux, which was defined as the percent of cholesterol in the absence of apoA-I.

Table 1 Sequences of primers for RT-PCR and real-time PCR. Gene

Forward primer

Reverse primer

Amplicon

human PTX3

GTGGGTGGAGAGGAGAAC AA AGATGCAGCCTCATTTCCAC

TTCCTCCCTCAGGAACAATG

175 bp

GCCTTGGATGGAAGAACA AA ATCACCGCCGCACCCAAG AGTTCCTGGAAGGTCTTGTT CAC TCCGGAGGCTCACCAGTTTC CAGCCCTGAAAGATGCGG GGCAGTGATGGCATGGAC TG

150 bp

human CD36 human SR-Bi humanABCA1

ACCGCACCTTCCAGTTCCAG GTCCTCTTTCCCGCATTATC TGG human LXRα GCCGAGTTTGCCTTGCTCA humanPPARγ CAAACACATCACCCCCCT humanGAPDH CGGGAAGCTTGTCATCAA TGG

94 bp 124 bp 187 bp 63 bp 358 bp

Statistical analysis All experiments were performed at least three times in duplicate. Statistical analysis was performed using SPSS statistical software, version 16.0. The experimental results are presented as means ± SD. Inter-group differences were analyzed using one-way ANOVA for the comparison of three or more groups. Student's t-test was used for the comparison between two groups. The level of significance was set at P b 0.05. Results OxLDL increases PTX3 mRNA and protein expression in THP-1 cells

Western blot analysis Cell were incubated in lysis buffer (Fermentas, Pittsburgh, PA), homogenized, and centrifuged for 10 min at 12,000 ×g at 4 °C. The protein concentration was measured with the BCA protein assay (Pierce, Rockford, IL, USA). Equal amount of total proteins (50 μg) was separated by 8–12% SDS-PAGE and transferred to nitrocellulose (Roche) or PVDF membranes (Millipore). Membranes were blocked with 5% nonfat milk in PBS (pH 7.5) with 0.1% Tween 20 and then incubated with primary antibodies specific for PTX3 (diluted 1:1000), PPAR-γ (diluted 1:500), ABCA1 (diluted1:1000), LXRα (diluted 1:500), total ERK1/2, phosphorylated ERK1/2 (p-ERK1/2) (diluted 1:1000) and β-actin (diluted 1:1000). The membranes were next incubated with the appropriate horseradish peroxidase-conjugated antibody. Protein bands were visualized with the ECL plus chemiluminescent substrate (Thermo), and the relative band intensities were analyzed by densitometry using the Image Quant software. Each sample was processed at least three times.

To determine the effects of oxLDL on PTX3 expression, human THP-1 cells were incubated with different concentrations of oxLDL for 24 h. RTPCR and Western blot analyses showed that human THP-1 macrophages expressed PTX3 mRNA and protein, which was up-regulated in response to oxLDL in a dose-dependent manner (Fig. 1A and B, respectively). Specifically, significantly increased PTX3 expression was observed with as little as 25 μg/mL oxLDL, peaking at 50 μg/mL oxLDL (P b 0.05). As shown in Fig. 1B, oxLDL also increased the levels of PTX3 protein expression from THP-1-derived foam cells. Overexpression of PTX3 promotes Dil-oxLDL uptake by human THP-1 cells The effects of PTX3 overexpression on Dil-oxLDL uptake by THP-1 cells were analyzed by fluorescence microscopy. As shown in Fig. 2A–C, PTX3 overexpression significantly increased the cytoplasmic fluorescence of THP-1 cells as compared with pSG5 empty vector control (P b 0.05). Foam cell formation in response to incubation with oxLDL was confirmed by visualizing the intracellular accumulation of fluorescent dye labeled (DiL-I) lipids (Fig. 2D).

Analysis of intracellular cholesterol accumulation After the THP-1 cells were transfected as described above for 24 h, they were pretreated with or without inhibitors (20 μM PD98059, 10 μM Ly294002 or 10 μM SB203580) for 30 min and incubated with 50 μg/mL oxLDL for another 24 h. Total and free cholesterol levels were quantitated using the GMS50063.1 cell total cholesterol continuous cycle enzymes fluorescent kit and the GMS50063.4 cell free cholesterol continuous cycle enzymes fluorescent kit (GenMed Scientifics Inc. USA) following the manufacturer's instructions with a microplate reader at 530 nm excitation and 590 nm emission. Cholesteryl ester (CE) levels were calculated by subtracting the free cholesterol (FC) from the total cholesterol (TC) levels. The results were normalized to cell protein concentrations. Each experiment was performed in triplicate.

Cholesterol efflux assay PMA-differentiated THP-1 cells were transfected with either pSG5hPTX3 plasmids or PTX3siRNA. The cells were then labeled with 0.5 μCi/mL [1α, 2α (n)-3H] cholesterol with or without 50 μg/mL oxLDL for 24 h. In experiments containing the MAPK inhibitors, 20 μM PD98059, 10 μM Ly294002 or 10 μM SB203580 was added. Cells were then washed and incubated in RPMI 1640 in the absence or presence of apoA-I (15 μg/mL) for 8 h after which the medium was collected and centrifuged for 15 min at 4 °C at 15,000 ×g to remove cellular debris, and the supernatant was counted. After cells were harvested using a cell scraper and incubated in 0.1 N NaOH, radioactivity was counted by liquid scintillation counting. Cholesterol efflux was represented as the percentage of medium cpm to total cpm (medium plus

PTX3-induced uptake of oxLDL in THP-1 cells is mediated by ERK1/2 activation The cholesterol content of THP-1 cells in response to PTX3 overexpression and cell signaling inhibitors was next determined. TC, FC, CE and CE/TC levels were significantly increased in THP-1 cells incubated with oxLDL (50 μg/mL) for 24 h compared with untreated cells (P b 0.05, Fig. 3). In addition, the TC, CE, and CE/TC levels were further increased upon overexpression of PTX3 and treatment with 50 μg/mL oxLDL as compared to the oxLDL-treated pSG5 vector controls (P b 0.05). However, the PTX3-induced intracellular lipid accumulation was inhibited by co-incubation with the specific ERK1/2 inhibitor, PD98059 (P b 0.05, Fig. 3). No differences were noted after coincubation with the PI3-K inhibitor, Ly294002, or the p38/MAPK-2 inhibitor, SB203580 (Fig. 3). Thus, PTX3 increases intracellular lipid accumulation in THP-1 macrophages exposed to oxLDL, which is mediated at least in part by ERK1/2 activation. Since the MAPK and PI3K-Akt pathways play important roles in atherosclerosis, we next analyzed the effects of PTX3 and oxLDL on ERK1/2 activation in THP-1-derived foam-like cells. As shown in Fig. 4, Western blot analysis revealed that 50 μg/mL oxLDL significantly increased ERK1/2 phosphorylation as well as PTX3 expression as compared with untreated cells (P b 0.05), which were significantly reduced by the ERK1/2 inhibitor, PD98059 (20 μM). ERK1/2 phosphorylation was also significantly increased upon PTX3 overexpression as compared with untreated cells (P b 0.05), which was blocked by co-incubation with PD98059 (P b 0.05, Fig. 4). Co-incubation with oxLDL did not further increase ERK1/2 phosphorylation over that observed with PTX overexpression. No changes in PI3K and p38 phosphorylation were noted

W. Liu et al. / Experimental and Molecular Pathology 96 (2014) 292–299

295

Fig. 1. OxLDL induced dose-dependent expression of PTX3 mRNA in human THP-1 cells (A). Regulated PTX3 mRNA expression depicted as mean fluorescence intensities by real time RT-PCR. OxLDL induced dose-dependent expression of PTX3 protein in human THP-1 cells (B). Regulated PTX3 protein expression depicted by western blot. For quantification, the internal PTX-3 standard was used and upregulation of PTX3 mRNA and protein by oxLDL was expressed in relation to unstimulated control THP-1 macrophages. Results are depicted as means of triplicate determinations ± S.D. (*, p b 0.05 vs. control).

after PTX3 overexpression (data not shown). These data indicated that oxLDL-induced PTX3 expression may be mediated by ERK1/2 activation and that PTX3 overexpression could activate ERK1/2 in THP-1 cells. PTX3 inhibition of cholesterol efflux in THP-1 cells is mediated by ERK1/2 To confirm the effect of PTX3 overexpression on the uptake of oxLDL in THP-1 cells, cholesterol efflux to apoA-I was measured. Foam cells were first transfected with the PTX3 expression vector or PTX3 siRNA, and cholesterol efflux was initiated by the addition of 15 μg/mL apoA-I. PTX3 overexpression significantly decreased cholesterol

efflux to apoA-I by 33% as compared with pSG5 empty vectortransfected cells (P b 0.05, Fig. 5A). In contrast, THP-1 cells transfected with PTX3 siRNA displayed a significant elevation in [3H] cholesterol efflux to apoA-I by 27% compared with that of the GFP RNAi empty vector control (P b 0.05, Fig. 5A). Overexpression and silencing of PTX3 mRNA and protein expression by pSG5hPTX3 and PTX3 siRNA, respectively were confirmed in Fig. 5C. Furthermore, the ERK1/2 inhibitor, PD98059 (20 μM) reduced the PTX3-induced inhibition of cholesterol efflux from THP-1 cells by 27% as compared with pSG5hPTX3 group (P b 0.05, Fig. 5B); no differences were observed with the PI3-K and p38/MAPK-2 inhibitors (LY294002 and SB203580, respectively).

Fig. 2. PTX3 overexpression promotes Dil-oxLDL uptake by human THP-1 macrophages. THP-1 cells were transfected with the (A) pSG5 empty control vector or (B) the pSG5hPTX3 expression vector in the presence of 10 μg/mL Dil-oxLDL. (C) Dil-oxLDL uptake was determined by analyzing the mean fluorescence intensity. (D) Foam cell formation by THP-1 cells after incubation with oxLDL was visualized by intracellular accumulation of fluorescent dye-labeled lipids (DiL-I). *P b 0.05. Scale bars, 20 μm. Each experiment was repeated at least three times.

296

W. Liu et al. / Experimental and Molecular Pathology 96 (2014) 292–299

Fig. 3. PTX3 increases intracellular cholesterol levels in THP-1 macrophages through ERK1/2 activation. THP-1 macrophages were transfected with the pSG5 control vector or pSG5hPTX3 expression vector in the absence or presence of PD98059, LY294002, and SB203580 inhibitors after which intracellular cholesterol levels were determined. (A) Total cholesterol (TC), free cholesterol (FC) and cholesterol ester (CE) levels were determined by enzymatic assays. (B) The ratio of CE to TC was determined. Data are presented as the mean ± SD (n = 3). *P b 0.05 versus the control group, #P b 0.05 versus the pSG5 + oxLDL group, ΔP b 0.05 versus the pSG5hPTX3 + oxLDL group.

Thus, PTX3 inhibition of cholesterol efflux to apoA-I in THP-1 cells is mediated at least in part by the ERK1/2 pathway.

PTX3-induced oxLDL uptake and cholesterol efflux may be mediated by inhibiting PPARγ, LXRα and ABCA1 expression.

PTX3 decreases the expression of PPARγ, LXRα and ABCA1 in THP-1 cells Discussion To study the possible mechanisms that are responsible for PTX3 action, we analyzed the expression of several key molecules involved in cholesterol handing, including CD36, SR-BI, PPARγ, LXRα, and ABCA1 in foam cells. THP-1 macrophages overexpressing PTX3 displayed significantly reduced PPARγ, LXRα, and ABCA1 mRNA and protein levels (P b 0.05, Fig. 6). Conversely, PPARγ, LXRα, and ABCA1 were up-regulated after PTX3 siRNA transfection (P b 0.05, Fig. 6). No changes in the expression of CD36 and SR-BI were observed between the pSG5hPTX3 and control groups (data not shown). Therefore,

Fig. 4. Effects of the ERK 1/2 inhibitor, PD98059, on ERK1/2 phosphorylation and PTX3 protein levels. THP-1 cells were transfected with the pSG5 control vector or the pSG5hPTX3 expression vector and were treated in the absence and presence of oxLDL and PD98059. ERK 1/2 phosphorylation and PTX3 protein levels were determined using Western blot analysis. Data are presented as the mean ± SD (n = 3). Lanes: 1, THP-1 blank control group; 2, pSG5; 3, DMSO; 4, OxLDL; 5, PD98059 + oxLDL; 6, pSG5hPTX3; 7, pSG5hPTX3 + PD98059; 8, pSG5hPTX3 + oxLDL; 9, pSG5hPTX3+ PD98059 + oxLDL. *P b 0.05 versus the control group, **P b 0.05 versus the 50 μg/mL oxLDL group,ΔP b 0.05 versus the pSG5hPTX3 group, and #P b 0.05 versus the pSG5hPTX3 + oxLDL group.

Inflammation plays an important role in the pathogenesis of atherosclerosis. Several studies have demonstrated the colocalization of PTX3 and macrophages in advanced human atherosclerotic plaques as well as identified PTX3 as a prognostic marker of AMI (Jylhävä et al., 2011; Knoflach et al., 2012; Rolph et al., 2002; Savchenko et al., 2008); however, its role in lipid storage and cholesterol efflux was unknown. In the present study, PTX3 expression was strongly induced by oxLDL stimulation in human macrophages. Moreover, overexpression of PTX3 promoted oxLDL uptake and inhibited cholesterol efflux, which was mediated in part through ERK1/2. Monocyte/macrophages play a pivotal role in the initiation and progression of atherosclerosis, and the removal of cholesterol and lipids from macrophages is a critical step in atherosclerosis regression. Because macrophages are unable to catabolize cholesterol, excess intracellular cholesterol is removed from the cell via extracellular cholesterol acceptors, such as apoA-I and HDL, where it is transported to the liver for degradation and excretion; this process is known as reverse cholesterol transport (RCT) (Ohashi et al., 2005). Cholesterol efflux is the first and most likely rate-limiting step of RCT, and can prevent the development of atherosclerosis (Ohashi et al., 2005). OxLDL is recognized by macrophage scavenger receptors; its accumulation by macrophages results in foam cell formation, which plays a critical role in the development and progression of atherosclerotic lesions (Steinberg and Lewis, 1997). In the present study, PTX3 overexpression in the presence of oxLDL led to a significant accumulation of TC, FC and CE, which was inhibited by co-incubation with the ERK1/2 inhibitor, PD98059. In addition, overexpression of PTX3 inhibited cholesterol efflux to apoA-I, and this inhibition was at least in part mediated by the ERK1/2 pathway. Several key molecules, including ABCA1, ABCG1, SR-B1, and LXRα, mediate cholesterol efflux (O'Connell et al., 2004), and the classic pathway for maintaining cholesterol homeostasis in macrophages is mediated by the PPARγ–LXRα–ABC transporter pathway (Bujold et al., 2009). PPARγ is a nuclear receptor that suppresses inflammation in macrophages by regulating gene expression; it also increases cholesterol uptake and efflux (Duan et al., 2008). In the present study, overexpression of PTX3 down-regulated PPARγ, LXRα and ABCA1 expression in THP-1 cells while PTX3siRNA increased the expression of PPARγ, LXRα and ABCA1. These data suggest that PTX3 may inhibit cholesterol

W. Liu et al. / Experimental and Molecular Pathology 96 (2014) 292–299

297

Fig. 5. PTX3 inhibition of cholesterol efflux in THP-1 cells is mediated in part by ERK1/2 signaling. PMA-differentiated THP-1 cells were transfected with either pSG5hPTX3 plasmids or PTX3siRNA. The cells were then labeled with 0.5 μCi/mL [1α, 2α (n)-3H] cholesterol with or without 50 μg/mL oxLDL for 24 h. In experiments containing the MAPK inhibitors, 20 μM PD98059, 10 μM Ly294002 or 10 μM SB203580 was added. Efflux was measured after incubation with 15 μg/mL apoA-I for 8 h and was calculated as the radioactivity in the medium divided by the sum total of the radioactivity in the medium and in the cells. (A) PTX3 inhibition of cholesterol efflux in THP-1 cells; (B) PTX3 inhibition of cholesterol efflux in THP-1 cells is mediated in part by ERK1/2 signaling. (C) Expression of PTX3 mRNA and protein after transfection with pSG5hPTX3 or PTX3siRNA plasmids for 24 h as detected by RT-PCR and Western blot analyses. Bars represent mean ± SD; n = 3. *P b 0.05. The results are representative of three separate experiments.

efflux through the down-regulation of PPARγ, LXRα and ABCA1 in macrophages. Many studies have now emerged in support of a role for PTX3 in atherogenesis. In a recent study using double-knockout mice lacking PTX3 and ApoE, deficiency of PTX3 promoted vascular inflammation and

atherosclerosis (Norata et al., 2009). In addition, modulation of PTX3 by high-density lipoproteins was observed in endothelial cells (Norata et al., 2008), suggesting a potential cardioprotective function for PTX3 in cardiovascular disease. Of note, increased PTX3 expression was observed in advanced atherosclerotic lesions of ApoE−/− mice,

Fig. 6. PTX3 decreases the expression of PPARγ, LXRα and ABCA1 in THP-1 cells. (A) PPARγ, LXRα, ABCA1 and PTX3 mRNA levels were detected by real-time RT-PCR. (B) PPARγ, LXRα, ABCA1 and PTX3 protein levels were assessed by Western blot analysis. Bars represent mean ± SD; n = 3; *P b 0.05 versus the control group.

298

W. Liu et al. / Experimental and Molecular Pathology 96 (2014) 292–299

Fig. 6 (continued).

confirming previous observations in human atherosclerotic lesions (Rolph et al., 2002; Savchenko et al., 2008). Whether this increase reflects a proatherogenic role for PTX3 or is a result of altered immunoinflammatory response in the vascular wall is debated (Napoleone et al., 2002, 2004; Norata et al., 2009). Given the effects of PTX3 on oxLDL uptake and cholesterol efflux, the results of the present study are consistent with its contribution to atherogenesis. However, in vivo studies using appropriate animal models, such as PTX3 knockout or PTX3 transgenic mice, may elucidate the effects of PTX3 on oxLDL uptake and RCT. In conclusion, PTX3 affects lipid accumulation in human macrophages, increasing oxLDL uptake and inhibiting cholesterol efflux. That is the underlying possible mechanisms of PTX3 contribution to the progression of atherosclerosis. Conflict of interest statement The authors declare that there are no conflicts of interest. Acknowledgments This work was supported by a grant from National Natural Science Foundation of China (No. 30570725). We are grateful to Dr. Barbara

Bottazzi (Rozzano, Milan, Italy) for providing the full-length human PTX3 expression vector (PSG5hPTX3).

References Bottazzi, B., Doni, A., Garlanda, C., Mantovani, A., 2010. An integrated view of humoral innate immunity: pentraxins as a paradigm. Annu. Rev. Immunol. 28, 157–183. Bujold, K., Rhainds, D., Jossart, C., Febbraio, M., Marleau, S., Ong, H., 2009. CD36-mediated cholesterol efflux is associated with PPARγ activation via a MAPK-dependent COX-2 pathway in macrophages. Cardiovasc. Res. 83, 457–464. Choi, J.H., Nam, K.H., Kim, J., Baek, M.W., Park, J.E., Park, H.Y., Kwon, H.J., Kwon, O.S., Kim, D.Y., Oh, G.T., 2005. Trichostatin A exacerbates atherosclerosis in low density lipoprotein receptor–deficient mice. Arterioscler. Thromb. Vasc. Biol. 25, 2404–2409. Duan, S.Z., Usher, M.G., Mortensen, R.M., 2008. Peroxisome proliferator-activated receptor-γ-mediated effects in the vasculature. Circ. Res. 102, 283–294. Inoue, K., Sugiyama, A., Reid, P.C., Ito, Y., Miyauchi, K., Mukai, S., Sagara, M., Miyamoto, K., Satoh, H., Kohno, I., Kurata, T., Ota, H., Mantovani, A., Hamakubo, T., Daida, H., Kodama, T., 2007. Establishment of a high sensitivity plasma assay for human pentraxin3 as a marker for unstable angina pectoris. Arterioscler. Thromb. Vasc. Biol. 27, 161–167. Jing, Q., Xin, S.M., Zhang, W.B., Wang, P., Qin, Y.W., Pei, G., 2000. Lysophosphatidylcholine activates p38 and p42/44 mitogen-activated protein kinases in monocytic THP-1 cells, but only p38 activation is involved in its stimulated chemotaxis. Circ. Res. 87, 52–59. Jylhävä, J., Haarala, A., Kähönen, M., Lehtimäki, T., Jula, A., Moilanen, L., Kesäniemi, Y.A., Nieminen, M.S., Hurme, M., 2011. Pentraxin 3(PTX3) is associated with cardiovascular risk factors: the Health 2000 Survey. Clin. Exp. Immunol. 164, 211–217.

W. Liu et al. / Experimental and Molecular Pathology 96 (2014) 292–299 Klingenberg, R., Hansson, G.K., 2009. Treating inflammation in atherosclerotic cardiovascular disease: emerging therapies. Eur. Heart J. 30, 2838–2844. Klouche, M., Peri, G., Knabbe, C., Eckstein, H.H., Schmid, F.X., Schmitz, G., Mantovani, A., 2004. Modified atherogenic lipoproteins induce expression of pentraxin-3 by human vascular smooth muscle cells. Atherosclerosis 175, 221–228. Knoflach, M., Kiechl, S., Mantovani, A., Cuccovillo, I., Bottazzi, B., Xu, Q., Xiao, Q., Gasperi, A., Mayr, A., Kehrer, M., Willeit, J., Wick, G., 2012. Pentraxin-3 as a marker of advanced atherosclerosis results from the Bruneck, ARMY and ARFY studies. PLoS One 7, 31474. Latini, R., Maggioni, A.P., Peri, G., Gonzini, L., Lucci, D., Mocarelli, P., Vago, L., Pasqualini, F., Signorini, S., Soldateschi, D., Tarli, L., Schweiger, C., Fresco, C., Cecere, R., Tognoni, G., Mantovani, A., 2004. Prognostic significance of the long pentraxin PTX3 in acute myocardial infarction. Circulation 110, 2349–2354. Lee, G.W., Goodman, A.R., Lee, T.H., Vilcek, J., 1994. Relationship of TSG-14 protein to the pentraxin family of major acute-phase proteins. J. Immunol. 153, 3700–3707. Li, A.C., Glass, C.K., 2002. The macrophage foam cell as a target for therapeutic intervention. Nat. Med. 8, 1235–1242. Libby, P., Okamoto, Y., Rocha, V.Z., Folco, E., 2010. Inflammation in atherosclerosis: transition from theory to practice. Circ. J. 74, 213–220. Napoleone, E., Di Santo, A., Bastone, A., Peri, G., Mantovani, A., de Gaetano, G., Donati, M.B., Lorenzet, R., 2002. Long pentraxin PTX3 upregulates tissue factor expression in human endothelial cells. A novel link between vascular inflammation and clotting activation. Arterioscler. Thromb. Vasc. Biol. 22, 782–787. Napoleone, E., di Santo, A., Peri, G., Mantovani, A., de Gaetano, G., Donati, M.B., Lorenzet, R., 2004. The long pentraxin PTX3 up-regulates tissue factor in activated monocytes: another link between inflammation and clotting activation. J. Leukoc. Biol. 76, 203–209. Nebuloni, M., Pasqualini, F., Zerbi, P., Lauri, E., Mantovani, A., Vago, L., Garlanda, C., 2011. PTX3 expression in the heart tissues of patients with myocardial infarction and infectious myocarditis. Cardiovasc. Pathol. 20, 27–35. Norata, G.D., Marchesi, P., Pirillo, A., Uboldi, P., Chiesa, G., Maina, V., Garlanda, C., Mantovani, A., Catapano, A.L., 2008. Long pentraxin 3, a key component of innate immunity, is modulated by high-density lipoproteins in endothelial cells. Arterioscler. Thromb. Vasc. Biol. 28, 925–931. Norata, G.D., Marchesi, P., Pulakazhi Venu, V.K., Pasqualini, F., Anselmo, A., Moalli, F., Pizzitola, I., Garlanda, C., Mantovani, A., Catapano, A.L., 2009. Deficiency of the long pentraxin PTX3 promotes vascular inflammation and atherosclerosis. Circulation 120, 699–708.

299

Norata, G.D., Garlanda, C., Catapano, A.L., 2010. The long pentraxin PTX3: a modulator of the immunoinflammatory response in atherosclerosis and cardiovascular diseases. Trends Cardiovasc. Med. 20, 35–40. O'Connell, B.J., Denis, M., Genest, J., 2004. Cellular physiology of cholesterol efflux in vascular endothelial cells. Circulation 110, 2881–2888. Ohashi, R., Mu, H., Wang, X., Yao, Q., Chen, C., 2005. Reverse cholesterol transport and cholesterol efflux in atherosclerosis. Q.J.M. 98, 845–856. Peri, G., Introna, M., Corradi, D., Iacuitti, G., Signorini, S., Avanzini, F., Pizzetti, F., Maggioni, A.P., Moccetti, T., Metra, M., Cas, L.D., Ghezzi, P., Sipe, J.D., Re, G., Olivetti, G., Mantovani, A., Latini, R., 2000. PTX3, a prototypical long pentraxin, is an early indicator of acute myocardial infarction in humans. Circulation 102, 636–641. Rolph, M.S., Zimmer, S., Bottazzi, B., Garlanda, C., Mantovani, A., Hansson, G.K., 2002. Production of the long pentraxin PTX3 in advanced atherosclerotic plaques. Arterioscler. Thromb. Vasc. Biol. 22, 10–14. Rubic, T., Lorenz, R.L., 2006. Downregulated CD36 and oxLDL uptake and stimulated ABCA1/G1 and cholesterol efflux as anti-atherosclerotic mechanisms of interleukin10. Cardiovasc. Res. 69, 27–535. Savchenko, A., Imamura, M., Ohashi, R., Jiang, S., Kawasaki, T., Hasegawa, G., Emura, I., Iwanari, H., Sagara, M., Tanaka, T., Hamakubo, T., Kodama, T., Naito, M., 2008. Expression of pentraxin 3 (PTX3) in human atherosclerotic lesions. J. Pathol. 215, 48–55. Steinberg, D., Lewis, A., 1997. Oxidative modification of LDL and atherogenesis. Circulation 95, 1062–1071. Suzuki, S., Shishido, T., Funayama, A., Netsu, S., Ishino, M., Kitahara, T., Sasaki, T., Katoh, S., Otaki, Y., Watanabe, T., Shibata, Y., Mantovani, A., Takeishi, Y., Kubota, I., 2013. Long pentraxin PTX3 exacerbates pressure overload-induced left ventricular dysfunction. PLoS One 8, e53133. Wang, X., Liao, D., Bharadwaj, U., Li, M., Yao, Q., Chen, C., 2008. C-reactive protein inhibits cholesterol efflux from human macrophage-derived foam cells. Arterioscler. Thromb. Vasc. Biol. 28, 519–526. Yamaguchi, K., Lee, S.H., Kim, J.S., Wimalasena, J., Kitajima, S., Baek, S.J., 2006. Activating transcription factor 3 and early growth response 1 are the novel targets of LY294002 in a phosphatidylinositol 3-kinase-independent pathway. Cancer Res. 66, 2376–2384. Zwaka, T.P., Hombach, V., Torzewski, J., 2001. C-reactive protein–mediated low density lipoprotein uptake by macrophages: implications for atherosclerosis. Circulation 103, 1194–1197.