Peptide-based candidate vaccine against respiratory syncytial virus

Vaccine 23 (2005) 2261–2265

Peptide-based candidate vaccine against respiratory syncytial virus Vidadi Yusibova,∗ , Vadim Metta , Valentina Metta , Carley Davidsona , Konstantin Musiychuka , Suzan Gilliamb , Ann Fareseb , Thomas MacVittieb , Dean Mannb a

Fraunhofer USA Center for Molecular Biotechnology, 9 Innovation Way, Suite 200, Newark, DE 19711, USA b University of Maryland, Baltimore, MD, USA Available online 21 January 2005

Abstract We engineered a 21-mer peptide representing amino acids 170–190 of the respiratory syncytial virus (RSV) G protein as a fusion with the Alfalfa mosaic virus (AlMV) coat protein (CP), produced recombinant AlMV particles presenting this peptide (VMR-RSV) on their surfaces and tested the immunogenicity in vitro in human dendritic cells and in vivo in non-human primates. Significant pathogen-specific immune responses were generated in both systems: (i) human dendritic cells armed with VMR-RSV generated vigorous CD4+ and CD8+ T cell responses; (ii) non-human primates that received these particles responded by mounting strong cellular and humoral immune responses. This approach may validate the use of a novel RSV vaccine delivery vehicle in humans. © 2005 Elsevier Ltd. All rights reserved. Keywords: AlMV; RSV; Plant virus

1. Introduction Respiratory syncytial virus (RSV), a member of the genus Pneumovirus, of the family Paramyxoviridae, is an enveloped virus with a single stranded negative-sense RNA genome. Virus infection is mainly restricted to the epithelial cells of the nasopharynx [1] and to the respiratory tract [2]. Infection with this virus is the most common cause of lower respiratory tract illness [3,4], and humans are repeatedly infected throughout their lifetime, suggesting that natural infection with this pathogen does not result in protective immunity. RSV infections cause hospitalization of nearly 125,000 children and 1800 deaths in the United States annually, resulting in an estimated expenditure of US$ 500 million per year [5]. The rate of hospitalization due to RSV infections worldwide is even higher with mortality rates approaching 5%. Early efforts to develop a safe and effective vaccine against this pathogen failed [6], as subsequent natural RSV infection resulted in exacerbated disease in vaccine recipients. There are a number of obstacles to RSV vaccine development, includ∗

Corresponding author. Tel.: +1 302 369 3766; fax: +1 302 369 8955. E-mail address: [email protected] (V. Yusibov).

0264-410X/$ – see front matter © 2005 Elsevier Ltd. All rights reserved. doi:10.1016/j.vaccine.2005.01.039

ing, incomplete immunity to RSV induced during natural infection, absence of a good animal model, limited knowledge of RSV cell-mediated immunity, and a neonate’s immature immune system. Despite all these difficulties, there is a significant effort towards RSV vaccine development using different approaches. Vaccines that would prevent RSV infection by antibodymediated neutralization of the virus or by eliminating infected cells are desirable. Virus-specific humoral and cellular immune responses are largely responsible for protection against RSV-associated lower respiratory tract infections and recovery from RSV infection [7]. Therefore, development of an efficacious subunit vaccine that will stimulate strong cellular and humoral immune responses without triggering disease enhancement will be of enormous value. Fusion protein F and cell attachment protein G of RSV, have been extensively studied for subunit vaccine development. Each of these proteins stimulates protective immunity in animals [8,9]. However, studies indicate that immunization with recombinant F or G protein may lead to disease enhancement upon subsequent RSV infection. Enhancement of disease associated with vaccination is believed to result from immune responses leading to the production of TH2-type

2262

V. Yusibov et al. / Vaccine 23 (2005) 2261–2265

cytokines [10]. Analyses of B and T cell epitopes of these viral proteins have identified peptide sequences that provide protection against RSV in laboratory animals and show promise for safe subunit vaccine development [11,12]. The selection of well-characterized epitopes that confer protective immunity may allow elimination of the viral determinants responsible for adverse reactions in immunized individuals and result in the development of a safe and efficacious vaccine. In this study, we present a plant virus-like particle-based approach to RSV vaccine development. A target peptide representing amino acids 170–190 of the RSV G protein was engineered, produced and delivered on the surface of AlMV particles. Using this approach, we assessed the immunogenicity of the target peptide in vivo in non-human primates and in vitro in human dendritic cells. The results suggest that strong pathogen-specific immune responses are stimulated in immunized animals. 2. Materials and methods 2.1. VMR-RSV DNA sequences encoding a 21-mer peptide spanning amino acids 170–190 of the RSV G protein (A2 strain) was PCR-amplified using complementary oligonucleotides 5 GCGGTACCATGTCCTTTGTACCCTGCAGCATATGCAGCAACAATCCA-3 and 5 -CGAGTCGACCTCTGGTATTCTTTTGCAGATAGCCCAGCAGGTTGGATTGTTGCT3 . The resulting PCR product was cloned in full-length AlMV RNA3-based vector VMR, using KpnI and SalI restriction sites, to obtain VMR-RSV. 2.2. In vitro transcription In vitro transcripts of RNA3 were synthesized using T7 RNA polymerase (Promega, Madison, WI), RNA cap structure analog m7G(5)ppp(5)G (Amersham, Piscataway, NJ) and plasmid DNA linearized with SmaI, according to the manufacturer’s guidelines. 2.3. Plant inoculations and virus purification Transgenic Nicotiana tabacum cv. Samsun NN plants expressing the AlMV P1 and P2 (P12) replicase genes were grown in a controlled BL2P greenhouse and inoculated at the six-leaf stage for producing recombinant VMR-RSV particles as described [13]. The recombinant virus was isolated from infected plants 9–12 days post-inoculation and stored at −80 ◦ C.

2.5. In vitro immunogenicity testing of VMR-RSV particles The human peripheral blood mononuclear cells (PBMC) used in these studies were obtained from BRT Laboratories, Baltimore, MD. DNA prepared from lymphocytes was used to identify HLA class I and class II alleles using HLA SSP typing kit (One Lambda, Canoga, CA). Myeloid-derived dendritic cell precursors (pDCs) were isolated by negative selection using monoclonal antibodies that bind CD3, CD56 and CD19. The pDCs were differentiated into immature DCs and incubated with AlMV particles (wt or VMR-RSV). After 24 h incubation at 37 ◦ C, TNF␣ was added to mature the DCs exposed to antigen. DCs were co-cultured with autologous negative selected T cells (using anti-CD14, HLA-DR/DP, CD56 monoclonal antibodies) at a ratio of 1:10 for 7 days in media containing IL-2 and IL-7. The cultured T cells were restimulated with DC, exposed to AlMV particles, and cultured for additional 7 days and again re-stimulated with DC armed as described above. Twenty-four hours after the last exposure, the numbers of CD4+, CD8+ and CD56+ T cells expressing surface IFN␥ (Cytokine Secretion Assays, Miltenyi Biotec) were determined by flow cytometry. 2.6. In vivo immunogenicity testing of VMR-RSV particles The recombinant VMR-RSV particles were administered intramuscularly to two Rhesus macaques (99EO29 and 99EO51) and two Cynomolgus macaques (CO2001 and CO2003). A control animal (Cynomolgus macaque, CO1995) received wt AlMV particles only. Anesthetized macaques were immunized with 500 ␮g of purified particles at days 0, 12 and 21. Five milliliters of blood was withdrawn at each of these times and again at days 28, 35, 42 and 49. PBMC were separated on density gradients and tested for response to the immunogen as well as to wt particles in ELISPOT assays. In brief, for each blood withdrawal date, 105 cells per well, in triplicate, were exposed to AlMV particles (wt or VMR-RSV) at 10 ␮g/ml concentration in Millipore multiscreen 96-well plates (MAIPS4510 Millipore, Bedford, MA) coated with 15 ␮g/ml IFN␥-specific antibody (Monoclonal antibody GZ-4, MABTECH AB, Nacka, Sweden). Ten micrograms per milliliter conA (Sigma, St. Louis, MO) was added as a positive control, while negative control contained no antigen. Plates were incubated at 37 ◦ C, 5% CO2 for 72 h and the number of antigen-specific IFN␥ producing cells was analyzed using standard IFN␥ ELISPOT protocol. 2.7. ELISA

2.4. Western blot analysis Recombinant coat protein (CP) containing peptide from RSV G protein was analyzed by Western blot [13] using antibodies specific for AlMV CP (Agdia, Elkhart, IN) or monoclonal antibodies specific for the target RSV peptide [13].

Sera from immunized animals were analyzed for the presence of antigen-specific antibody by solid phase ELISA as described [13], using 96-well plates coated with 1 ␮g/well of target peptide that spanned amino acids 170–190 of the RSV G protein. HRP-conjugated goat anti-monkey IgG (Research

V. Yusibov et al. / Vaccine 23 (2005) 2261–2265

2263

3.2. In vitro testing of recombinant VMR-RSV particles

Fig. 1. Western blot analysis of recombinant CP in virus particles purified from plants infected with wt AlMV, or VMR-RSV, and Coomassie staining of proteins in the gel. Proteins were separated electrophoretically on a 12% SDS–polyacrylamide gel, transferred to a membrane, and reacted with different antibodies. (A) Monoclonal antibodies specific for AlMV CP recognized 24 kD (AlMV CP), and 26 kD (VMR-RSV) proteins, (B) whereas antibodies specific for RSV G protein recognized only VMR-RSV. (C) Coomassie staining of purified virus particles.

The capacity of the recombinant plant virus particles to generate CD4+, CD8+ and CD56+ (NK) T cell responses in vitro was tested using PBMC. Table 1 summarizes the responses observed with cells from five individuals with different HLA alleles. The results presented are responses to 10 ␮g of VMR-RSV. Responses to VMR-RSV were observed in four of five individuals with six different HLA Class II alleles. Three of five individuals generated strong CD4+ T cell responses and two CD8+ T cell responses. Low levels of response to wt AlMV particles suggest that wt particles were antigenic in some individuals. Of interest, was the observed activation of the CD56+ T cells. Three of five individuals generated strong CD56+ cell responses as a result of exposure to VMR-RSV.

3.3. In vivo testing of VMR-RSV particles Diagnostics, Inc., Flanders, NJ) was used as secondary antibody.

3. Results 3.1. Expression of VMR-RSV in P12 transgenic plants To produce VMR-RSV particles, 6-week-old transgenic P12 plants were mechanically inoculated with in vitrosynthesized transcripts. At 9–12 days post-inoculation, VMR-RSV particles were recovered and assessed for the presence of correct-sized protein, containing target peptide both by Western blot analysis and Coomassie gel staining (Fig. 1). Proteins immunoreactive with AlMV CP-specific antibodies migrated at the predicted molecular mass of 24 kD for wt AlMV CP and 26 kD for recombinant AlMV CP (Fig. 1A). The presence of RSV peptide in VMR-RSV was confirmed using RSV peptide-specific monoclonal antibodies [13] (Fig. 1B). Moreover, Coomassie staining showed that recombinant protein that assembled into virions was of the correct size and could be purified to high homogeneity (Fig. 1C).

PBMC obtained from the immunized animals at each time point were tested for response to recombinant as well as wt AlMV particles. The results (Fig. 2A) are recorded as number of spots per million cells over background (PBMC cultured without particles) after stimulation in vitro with 10 ␮g/ml of particles. All animals immunized with VMR-RSV (99EO29, 99EO51, CO2001, CO2003 and indicated as 29-, 51-, 01- and 03-, respectively) mounted consistently higher target-specific responses compared to that of control animal (CO1995 indicated as 95-). Peak responses were higher in the Rhesus (29-VMR-RSV and 51-VMR-RSV) compared to responses in the Cynomolgus monkeys (01-VMR-RSV and 03-VMRRSV). In some animals, low levels of wt particle-specific T cell responses were observed. These responses occurred after the initial immunization indicating that the plant virus particles were somewhat immunogenic. However, the responses did not seem to increase after the second and third administration of wt AlMV particles. To assess the antibody responses generated by recombinant particles sera from animals immunized with VMRRSV was analyzed by ELISA. Results revealed a substantial increase in RSV-specific antibody levels over that

Table 1 CD4+, CD8+ and CD56+ responses to the RSV-G peptide expressed on the surface of recombinant AlMV particles Percent of IFN␥ positive cellsa (increase over baseline)

HLA type A

2, 74 30 2, 30 11, 68 3, 33

B

57, 72 42, 35 35 35, 44 53, 60

DR

1, 11 9 8, 13 4, 11 4

CD4

CD8

CD56

AlMV

VMR-RSV

AlMV

VMR-RSV

AlMV

VMR-RSV

1.3 1.5 0.7 4.2 0.0

19.3 7.3 2.9 64.6 27.6

0.0 0.1 2.2 0.0 0.1

8.4 2.4 6.4 5.0 25.4

0.0 5.0 5.3 1.6 0.2

6.9 5.4 8.8 10.7 21.6

a Percentages based on numbers of IFN␥-producing cells minus the IFN␥ production by cells cultured under the same conditions without the addition of AlMV or VMR-RSV.

2264

V. Yusibov et al. / Vaccine 23 (2005) 2261–2265

Fig. 2. T and B cell responses resulting from immunization of monkeys [Cynomolgus macaques: 95 (control), 01 and 03 and Rhesus macaque: 29 and 51] with recombinant VMR-RSV particles. (A) IFN␥ Elispot data [Cynomolgus macaques: 95 (control), 01 and 03 and Rhesus macaques: 29 and 51]. Cells were stimulated with wt AlMV or recombinant VMR-RSV particles at a concentration of 10 ␮g/ml. (B) ELISA data [Cynomolgus macaques: CO1995 (control), CO2001 and CO2003 and Rhesus macaques: 99EO29 and 99EO51]. Data reflect serum IgG levels specific for peptide from RSV G protein at different dates. IgG levels are shown at serum dilutions 1:160 (Cynomolgus macaques) and 1:8000 (Rhesus macaques).

found in pre-immune sera and sera from control animals (Fig. 2B).

4. Discussion Often human pathogens do not have similar pathology in model animals used for vaccine testing or may not establish infection that will result in a disease. Although studies in rodent models have significantly contributed to our understanding of the immune response to RSV, there are important differences between rodent and human immune systems. Therefore, to circumvent some of the limitations imposed by the lack of a perfect animal model we assessed the efficacy of AlMV particles in generating CD4+ and CD8+ T cell responses using human PBMC from individuals with a range of different HLA class I and class II alleles. The results of this assessment indicate that DCs are able to acquire recombinant AlMV particles from and process the antigenic components via pathways leading to presentation by both class I and class II molecules. This has important implications relative to the use of this approach for vaccine delivery, particularly if both cellular and humoral immune responses are desired. Moreover, recombinant AlMV particles stimulated NK cell (CD56+) responses. NK cells are the first line of immune response to many pathogens. Our analysis indicates production of IFN␥ by cells expressing both CD56+ and CD3+ (data not shown). In this discussion, we are unable to address the question and predict if the NK cell responses

will result in memory generation, as may occur in some NK T cells populations, or not. Currently, we are investigating which cells with the NK phenotype respond to the plant virus particles. One might anticipate that all of the study subjects have been exposed to RSV in the past and thus, the responses observed reflect immunologic memory. In an attempt to address this question, we exposed T cells to VMR-RSV-armed DCs for 48 h and assayed for IFN␥ production. DCs armed with (cytomegalovirus) CMV or tetanus toxoid served as positive controls. While exposure to CMV and tetanus toxoid resulted in IFN␥ production, there were no responses to the wt virus particles or VMR-RSV (data not shown). The lack of the immediate recall responses to these particles may have been either: (i) due to the presence of insufficient number of T cell precursors that recognized the target peptide; or (ii) due to the fact that prior exposure to RSV did not generate memory responses to the incorporated peptide. Low levels of response to the wt virus particles were observed in some of the PBMC tested. These studies were not designed to differentiate between in vitro generation of immune response to wt virus particles or non-specific T cell activation. This issue is under further investigation. Several monkey species have been shown to be susceptible to RSV infection, particularly Cynomolgus macaques [14]. In our studies, the T cell responses and the antibody levels to the RSV peptide were higher in the Rhesus than in the Cynomolgus macaques. In addition, the Rhesus macaques mounted target-specific immune responses earlier during immuniza-

V. Yusibov et al. / Vaccine 23 (2005) 2261–2265

tion compared to the cynomologous monkeys. This suggests that the Rhesus monkeys probably had prior exposure to RSV. Nonetheless, the responses observed in both species clearly demonstrate that the delivery of RSV peptide by the recombinant AlMV particles generates vigorous response without the use of adjuvant. In summary, our studies clearly demonstrate that plant virus particles generate strong T cell responses in human DCs and both T and B cell responses in non-human primates to the incorporated RSV peptide. The data supports the potential use of this platform for delivery of component vaccines for RSV.

Acknowledgements The authors thank Dr. Shailaja Rabindran for critical reading of the manuscript. The authors also thank Margaret Schillingford and Christopher Hull for excellent technical assistance. This project was funded by grants from Fraunhofer USA.

References [1] Hall WJ, Hall CB, Speers DM. Respiratory syncytial virus infection in adults: clinical, virologic, and serial pulmonary function studies. Ann Int Med 1978;88:203–5. [2] Collins PL, Mcintosh K, Chanock RM. Respiratory syncytial virus. In: Fields BN, Knipe DM, Howley PM, editors. Fields virology. Philadelphia: Raven; 1996. p. 1313–51. [3] Brandt CD, Kim HW, Arrobio JO. Epidemiology of respiratory syncytial virus infection in Washington DC. III. Composite analysis of eleven consecutive yearly epidemics. Am J Epidemiol 1973;98:355–64.

2265

[4] Neuzil KM, Maynard C, Griffin MR, Heagerty P. Winter respiratory viruses and health care use: a population-based study in the northwest United States. Clin Infect Dis 2003;37:201–7. [5] Buraphacheep W, Britt WJ, Sullender W. Detection of antibodies to respiratory syncytial virus attachment and nucleocapsid proteins with recombinant baculovirus-expressed antigens. J Clin Microbiol 1997;35:354–7. [6] Kapikian AZ, Mitchell RH, Chanock RM, Shvedoff RA, Stewart CE. An epidemiologic study of altered reactivity to respiratory syncytial (RS) virus infection in children previously vaccinated with an inactivated RS virus vaccine. Am J Epidemiol 1969;89:405–21. [7] Bangham CRM, Cannon MJ, Karzon DT, Askonas BA. Cyctotoxic T-cell response to respiratory syncytial virus in mice. J Infect Dis 1985;163:687–92. [8] Stott EJ, Ball LA, Young KK, Furze J, Wertz GW. Human respiratory syncytial virus glycoprotein G expressed from a recombinant vaccinia virus vector protects mice against live-virus challenge. J Virol 1986;60:607–13. [9] Haller AA, Mitiku M, MacPhail M. Bovine parainfluenza virus type 3 (PIV3) expressing the respiratory syncytial virus (RSV) attachment and fusion proteins protects hamsters from challenge with human PIV3 and RSV. J Gen Virol 2003;84:2153–62. [10] Plotnicky H, Siegrist C-A, Aubry J-P, et al. Enhanced pulmonary immunopathology following neonatal priming with formalin-inactivated respiratory syncytial virus but not with the BBG2NA vaccine candidate. Vaccine 2003;21:2651–60. [11] Iqbal M, Lin W, Jabbal-Gill I, Davis SS, Steward MW, Illum L. Nasal delivery of chitosan-DNA plasmid expressing epitopes of respiratory syncytial virus (RSV) induces protective CTL responses in BALB/c mice. Vaccine 2003;21:1478–85. [12] Simard C, Nadon F, Seguin C, et al. Subgroup specific protection of mice from respiratory syncytial virus infection with peptides encompassing the amino acid region 174–187 from the G glycoprotein: the role of cysteinyl residues in protection. Vaccine 1997;15:423–32. [13] Belanger H, Fleysh N, Cox S, et al. Human respiratory syncytial virus vaccine antigen produced in plants. FASEB J 2000;78:1213–7. [14] De Swart RL, Kuiken T, Timmerman HH, et al. Immunization of macaques with formalin-inactivated respiratory syncytial virus (RSV) induces interleukin-13-associated hypersensitivity to subsequent RSV infection. J Virol 2002;76:11561–9.