Performance, beef quality and expression of lipogenic genes in young bulls fed low-fat dried distillers grains

Journal Pre-proof Performance, beef quality and expression of lipogenic genes in young bulls fed low-fat dried distillers grains

V.V.A. Reis, R.A. Reis, T.L. Araujo, J.F. Lage, P.D. Teixeira, T.R.S. Gionbelli, M.M. Ladeira PII:

S0309-1740(19)30109-3

DOI:

https://doi.org/10.1016/j.meatsci.2019.107962

Reference:

MESC 107962

To appear in:

Meat Science

Received date:

12 February 2019

Revised date:

22 August 2019

Accepted date:

3 October 2019

Please cite this article as: V.V.A. Reis, R.A. Reis, T.L. Araujo, et al., Performance, beef quality and expression of lipogenic genes in young bulls fed low-fat dried distillers grains, Meat Science (2019), https://doi.org/10.1016/j.meatsci.2019.107962

This is a PDF file of an article that has undergone enhancements after acceptance, such as the addition of a cover page and metadata, and formatting for readability, but it is not yet the definitive version of record. This version will undergo additional copyediting, typesetting and review before it is published in its final form, but we are providing this version to give early visibility of the article. Please note that, during the production process, errors may be discovered which could affect the content, and all legal disclaimers that apply to the journal pertain.

© 2019 Published by Elsevier.

Journal Pre-proof Performance, beef quality and expression of lipogenic genes in young bulls fed low-fat dried distillers grains

V. V. A. Reis1, R. A. Reis2, T. L. Araujo2, J. F. Lage3, P. D. Teixeira1, T. R. S. Gionbelli1, and M. M. Ladeira1*

1

Department of Animal Science, Universidade Federal de Lavras, Lavras, Minas

oo

2

f

Gerais, 37.200-000, Brazil

Department of Animal Science, Universidade Estadual Paulista, Jaboticabal, São

Trouw Nutrition, Campinas, São Paulo, 13080-650, Brazil

Pr

e-

3

pr

Paulo, 14.884-900, Brazil

al

* [email protected]

rn

ABSTRACT: Two studies were carried out, the first with the objective to evaluate performance, beef quality and expression of genes involved in lipid metabolism in the

Jo u

muscle of bulls fed with or without low-fat dried distillers grains with solubles (DDGS, 21% DM) in the diet. In the second, eight rumen-fistulated bulls were assigned in a switch back design to evaluate the fatty acid profile of omasal fluid. We hypothesized that bulls fed DDGS may have an improved fatty acid profile and expression of genes involved in lipid metabolism may be altered, without affecting performance. Bulls fed DDGS had greater (P < 0.05) concentrations of PUFA n-6 in the omasum and muscle. CLA t10, c12 content was higher and there was lower expression of the LPL gene (P = 0.05) in the muscle of animals fed DDGS (P = 0.03). In conclusion, DDGS can be used as a protein feedstuff because it maintains beef quality.

Journal Pre-proof

2

Keywords: CLA; DDGS; fatty acids; mRNA; tenderness

1. Introduction The rise in costs of regular feedstuffs have led beef producers to introduce more cost-effective production methods and seek new sources of protein and energy, such as dried distillers grains with solubles (DDGS). Usually, DDGS is a coproduct recognized as a good source of rumen-undegradable protein (UDP) (Council, 2012a). However, the

oo

f

protein availability of distillers grains can differ among industrial ethanol plants, presumably due to differences in heat processing (Fastinger, Latshaw, & Mahan, 2006).

pr

In addition, when corn starch is fermented to produce ethanol, the remaining nutrients

e-

(protein, fat and fiber) are concentrated approximately 3-fold. However, ethanol plants in

Pr

the USA and Brazil are producing DDGS with low-fat content (approximately 2% of ether extract), and according to Jolly-Breithaupt et al. (2018), limited data are available

al

on animal performance when distillers grains with low-fat are used. The same is true for

rn

beef quality and fatty acid profiles.

Jo u

Metabolism studies also suggest that fat in DDGS may be partially protected from ruminal degradation, leading to a greater proportion of unsaturated fatty acids in the duodenum (Klopfenstein, Erickson, & Bremer, 2008). However, there are few results in the literature that have evaluated the fatty acid profile of material escaping the rumen when distillers grains were used in feedlot diets (Vander Pol, Luebbe, Crawford, Erickson, & Klopfenstein, 2009). Most of the studies published so far have evaluated the effect of distillers grains on performance, carcass and beef quality, but none have analyzed fatty acid profiles in both the rumen and muscle. Fatty acid composition is one of the determining factors behind fat quality, lipid oxidation rate and flavor (Wood et al., 2003). Beef from cattle finished on diets containing

Journal Pre-proof

3

DDGS may have a greater concentration of polyunsaturated fatty acids (PUFA) and, therefore, may be more susceptible to oxidative rancidity (Koger et al., 2010). Depenbusch, Coleman, Higgins, & Drouillard (2009) found that the concentration of linoleic acid, total n-6 fatty acids, and total PUFA linearly increased with greater levels of DDGS in the diets. Meat color is also one of the most influential factors determining beef purchases for consumers. Animal diet can affect meat muscle fatty acid concentration and antioxidant content, which may influence myoglobin oxidation and,

oo

f

finally, beef color (Mancini & Hunt, 2005).

Marbling and fatty acid profiles in beef are also dependent on membrane

pr

transporters and enzyme activities (Ladeira et al., 2018), which can be evaluated

e-

indirectly by gene expression analyses. According to Teixeira et al. (2017), C18:2 trans

Pr

10, cis 12 has a negative impact on de novo fat synthesis due to its down-regulation of SREBF1 expression. In addition, the low expression of this transcription factor inhibits

al

SCD1 expression. This gene is responsible for encoding stearoyl-CoA desaturase (SCD),

rn

which converts saturated fatty acids (SFA) into monounsaturated fatty acids (MUFA) and

Jo u

converts trans-vaccenic acid into conjugated linoleic acid (CLA). Moreover, Oliveira et al. (2014) found that lipoprotein lipase (LPL) and fatty acid binding protein (FABP4) abundance may be influenced by dietary fatty acids. Our hypothesis for the current study was feeding low-fat DDGS may improve beef fatty acid profiles and alter expression of genes involved in lipid metabolism without affecting animal performance. Therefore, the objective was to evaluate the average daily gain, feed efficiency and carcass traits of young bulls fed diets with or without the inclusion of low-fat DDGS, and examine effects in beef chemical composition, fatty acid profiles, tenderness and color. In addition, the expression of genes involved in muscle lipid metabolism were analyzed, as well as fatty acid profile in the omasal fluid.

Journal Pre-proof

4

2. MATERIALS AND METHODS Two experiments were carried out simultaneously at the Department of Animal Science of the Sao Paulo State University and Federal University of Lavras. The protocol used was approved by the Ethics Committee of Animal Use CEUA/UNESP- Jaboticabal (protocol number 12703/15).

oo

f

2.1 Experiment 1 2.1.1 Animals, diet and omasal collections

pr

Eight rumen-fistulated Nellore bulls, with an average body weight of 470 kg ±28

e-

kg, were assigned to a switch back design with three periods of 24 days each. The surgical

Pr

technique for rumen fistulation was performed according to Murri, Murri, & Gabellini (2009).

al

Bulls received one of two diets: without DDGS (control) or with 21% of DDGS

rn

on a dry matter basis (Table 1). Diets were formulated according to the National Research

Jo u

Council (NRC, 2000) to be isonitrogenous, isocaloric and were given ad libitum to the animals at 7:30 and 15:30. This trial aimed to collect samples from the omasum to analyze the profile of fatty acids in the omasal fluid, which is indicative of the fatty acids escaping the reticulum-rumen. Twenty-one adaption days and 3 days of sample collection were used in this trial. From each animal, in each period and at eight different time points, samples were collected and lyophilized for the fatty acid profile analysis (Allen & Linton, 2007).

Journal Pre-proof

5

2.1.2 Fatty acids analyses Lipid contents from the omasal fluid were extracted from lyophilized samples using chloroform and then methylated in methanolic sulfuric acid solution, according to the previous method established by Shingfield et al. (2003). After transmethylation, omasum samples were analyzed in a gas chromatograph (Focus GC-Finnigan, Thermo Finnigan, San Jose, CA, USA) with a flame ionization detector and a capillary column SLB-IL111 with a 100 m × 0.25 μm internal diameter and 0.20 μm film thickness

oo

f

(Supelco, Bellefonte, PA, USA). Hydrogen was used as the carrier gas at a flow rate of 2.0 mL/min. The starting programmed temperature of the oven was 70°C, which was

pr

maintained for 4 min, followed by an increase of 13°C/min up to 150°C, which was

e-

maintained for 39 min followed by an increase of 10°C/min up to 215°C, this was

Pr

maintained for 10 min, for 53 min in total. The injector temperature was 250°C, and the detector was at 300°C.

al

The different fatty acids from the omasum were identified by comparing the

rn

retention times of methyl esters in the samples with commercial standards (Supelco TM

Jo u

Component FAME Mix, cat 18919, Sigma Supelco, Bellefonte, PA, USA) and conjugated linoleic acid (CLA, cat 05632 – Sigma Supelco, Bellefonte, PA, USA). Fatty acids were quantified by normalizing the areas of methyl esters. Fatty acid results were expressed as the percentage of the area (%) obtained using Chromquest 4.1 software (Thermo Electron, Milan, Italy).

2.2 Experiment 2 2.2.1 Animals, diet, slaughter and meat collection Forty young Nellore bulls with an initial average body weight of 442 ±43 kg were allotted to individual pens in a completely randomized design with 2 treatments and 20

Journal Pre-proof

6

animals per treatment. Animal was the experimental unit, and the diets were the same as those used in experiment 1. The experimental period lasted 84 days and was preceded by an adaption period of 21 days. At the beginning of the adaption period, animals were treated for internal parasites (Doramectin 1%/Dectomax, Zoetis, Campinas, SP, Brazil). Animals were weighed at the beginning and end of the experiment, after a 16-h fasting period to measure initial and final body weight, average daily gain (ADG) and feed efficiency. Dry matter intake was measured daily.

oo

f

Samples of concentrate feedstuffs and corn silage were collected every 14 days, and a composite sample was used to analyze dry matter (DM), crude protein (CP), ether

pr

extract (EE), neutral detergent fiber (NDF) and starch. Analyses of DM, CP and EE were

e-

performed according to AOAC (Helrich, 1990). The NDF was analyzed according to Van

Pr

Soest et al. (1991), and starch was analyzed according to Hall (2008). Nonfiber carbohydrates (NFC) and metabolizable energy were calculated using equations proposed

al

by NASEM (2016). Results of these analyses are presented in Table 1.

rn

After the experimental period, the bulls were transported 87 km to an inspected

Jo u

commercial packing facility (Minerva Foods, Barretos, SP), where they were stunned by captive bolt and exsanguinated, followed by hide removal and evisceration. Carcasses were identified, washed and split into halves. Fat thickness was measured between the 12th and 13th ribs, at ¾ of the medial border of the LT with a graduated caliper. Rib eye area was also measured between the 12th and 13th ribs by outlining using transparency paper and measuring using a LAI-3100 area meter (LI-COR, Lincoln, NE, USA). Twenty-four hours after slaughter and cooling, six 2.54 cm-thick steaks from LT muscle were collected from the left side of the carcass from the 13th rib toward the head for chemical composition, fatty acid profile, color, thiobarbituric acid-reactive substances (TBARS index) and cooking loss analyses. Each steak was identified, and vacuum packed

Journal Pre-proof

7

in polyethylene bags (water vapor permeability <10 g/m2/24 h at 38°C and oxygen permeability <40 mL/m2/24 h at 25°C) and stored at −20°C for 30 days until further analysis. One of the six steaks was thawed overnight at room temperature (4°C), ground and used to analyze composition (protein, ether extract, ash and moisture) using near infrared analyses (AOAC method: 2007-04) using a FoodscanTM (FOSS, Hillerod, Denmark). Four of the six steaks were thawed at 4°C overnight before aging for 0, 7, 14

oo

f

and 21 days postmortem at 4°C, and each sample was analyzed for color and cooking

pr

loss. The last steak was divided into two parts to analyze TBARS and fatty acid profile.

e-

2.2.2 Cooking loss

Pr

Cooking loss was obtained as the difference between the weight of the steak before and after cooking on a grill at 200°C. A thermometer was used to monitor the

al

internal temperature of the steak until the center reached 71°C. Subsequently, each steak

rn

was conditioned to room temperature, and after temperature stabilization, the steak was

Jo u

weighed (AMSA, 1995).

2.2.3 Fatty acid analyses

Muscle lipids were extracted according to the procedures established by Hara and Radin (1978) and methylated according to Christie (1982). After transmethylation, muscle samples were analyzed in the same gas chromatographer as the omasal samples with the same program. The different fatty acids for the muscle samples were identified by comparison of the retention times as well as to the omasum samples.

Journal Pre-proof

8

2.2.4 Thiobarbituric acid-reactive substances (TBARS) From the steaks chosen for the TBARS analyses, twenty grams of meat sample from each steak was thawed at room temperature and then, half of the samples were stored at 4°C to perform analyses at two different time points. Zero and four days were chosen to simulate retail display times. Samples were identified, packed on a polyethylene tray, overwrapped with PVC film and stored for 0 and 4 days at 4°C. The determination of thiobarbituric acid-reactive substances (TBARS) was performed according to Tarladgis,

oo

f

Watts, Younathan, and Dugan (1960) and adapted by Carvalho et al. (2014). The absorbance was measured at 530 nm in a spectrophotometer (Bel Photonics, model SP

pr

1105, Piracicaba, Brazil). The TBARS value expressed as the mg of malonaldehyde/kg

e-

meat was obtained by multiplying the absorbance by 7.8 (Tarladgis, Watts, Younathan,

Pr

and Dugan, 1960).

al

2.2.5 Meat color

rn

Determination of the CIE L*, a* and b* color components were performed after

Jo u

thawing LT muscle samples for 12 h at refrigerated temperature (4°C). The beef was removed from the vacuum package and exposed to atmospheric air for 30 min, allowing for myoglobin oxygenation (blooming). After that, color reading was performed on the surface of steaks at each aging time using a Minolta CM-700 spectrophotometric colorimeter (Konica Minolta, Osaka, Japan) and using the CIE L*a*b* system, illuminant A and 10º as the standard observing point. Six readings were performed per slice, and the averages were used in the statistical analysis.

Journal Pre-proof

9

2.2.6 Gene expression analyses Samples containing muscle fibers and intramuscular fat, were taken just after exsanguination, from the longissimus thoracis (LT) of the left half-carcass at the 13th rib height and immediately stored in liquid nitrogen and then stored at -80°C until further analysis. The design of target and reference primers was performed using sequences that are registered and published in the GenBank public database, a National Center for Biotechnology Information (NCBI) platform. Primers (Table 3) were designed using the

oo

f

OligoPerfect Designer software (Invitrogen, Karlsruhe, Germany).

Total RNA was extracted from the LT muscle samples using QIAzol (QIAGEN,

pr

Valencia, CA, USA) and treated with Turbo DNA-free (Invitrogen, Carlsbad, CA, USA).

e-

cDNA synthesis was performed using the High-Capacity cDNA Reverse Transcription

Pr

Kit (Applied Biosystems, Foster City, CA, USA). Then, samples were stored at −20°C. For gene expression analysis by reverse-transcription quantitative PCR (RT-

al

qPCR), the Mastercycler RealPlex (Eppendorf, Foster City, CA, USA) was used with the

rn

SYBR Green detection system (Applied Biosystems, Foster City, CA, USA). The RT-

Jo u

qPCR analyses for each studied gene were performed using cDNAs from 20 biological replicates with three technical replicates per biological replicate. The results were normalized using the threshold cycle (CT) method for the expression of the reference genes β-actin and glyceraldehyde-3-phosphate dehydrogenase (Pfaffl, 2001). A validation assay was performed to demonstrate that the amplification efficiencies of the target and reference genes were approximately equivalent. Standard curves were generated for the studied genes with the following dilutions: 1:5, 1:25, 1:125, 1:625 and 1:3125. Relative expression levels were calculated according to the method described by Pfaffl (2001), which is based on CT values that are corrected for the amplification efficiency of each primer pair.

Journal Pre-proof

10

2.3 Statistical analyses The data were analyzed as a completely randomized design, and animal was considered the experimental unit. Fatty acid profile (omasum and muscle), muscle pH and chemical composition were analyzed using PROC MIXED of SAS (SAS Inst. Inc., Cary, NC, USA), with diet as the fixed effect. Cooking loss, color and lipid oxidation were analyzed as repeated measurements using the PROC MIXED of SAS, with diet,

oo

f

days of aging and their interaction as fixed effects. Analysis was conducted using days as a repeated measure in time.

pr

To calculate gene expression, a Shapiro-Wilk test was performed to assess the

e-

normality of all collected data. When data were not normally distributed, they were

Pr

transformed using PROC RANK of SAS (SAS Inst. Inc., Cary, NC, USA). Then, gene expression was analyzed using PROC GLM of SAS.

3. RESULTS

Jo u

rn

0.10 were considered trends.

al

Characteristics with P ≤ 0.05 were considered significant effects, and 0.05 < P ≤

3.1 Experiment 1

Lauric, pentadecanoic and palmitoleic acids contents were greater in the omasum of animals fed the control diet than in the animals fed DDGS diet (Table 4). On the other hand, oleic acid content was greater in the omasum of animals fed the DDGS diet, and there was a tendency (P = 0.06) of greater concentration of linoleic acid and PUFA n-6 when this diet was used. In addition, the n-6:n-3 ratio was over twice as high in the omasum of animals fed DDGS.

Journal Pre-proof

11

3.1 Experiment 2 Animals fed DDGS had greater final body weight, ADG, DM intake and feed efficiency than animals fed the control diet. Animals fed DDGS were 7.3% heavier at slaughter than animals fed the control diet, and the DDGS diet increased the hot carcass weight by 10.3% (Table 5). Fat thickness tended to be greater in the carcass of animals fed the DDGS diet. The LT muscle of animals fed DDGS had greater protein and lower moisture content (Table 6). However, ash and ether extract concentrations were not

oo

f

affected by the treatments.

A greater concentration of lauric, myristic, pentadecanoic and palmitic acids was

pr

observed in LT muscle of bulls fed control diet compared to the muscle of bulls fed

e-

DDGS. On the other hand, linoleic and arachidonic acids were greater in the muscle of

Pr

animals fed the DDGS diet. Nevertheless, C18:2 cis 9, trans 11 content in the muscle was not influenced by diets, while C18:2 trans 10, cis 12 was greater in the muscle of bulls

al

fed DDGS than in the LT of bulls fed the control diet. In addition, palmitoleic, stearic,

Jo u

treatments (Table 7).

rn

oleic and α-linoleic contents were not different in the muscle of animals between

The percentage SFA was greater in the muscle of animals fed the control diet. In addition, the muscle of animals fed DDGS had a greater percentage of PUFA, UFA/SFA ratio, n-6, n-6:n-3 ratio and tended to increase concentration of UFA. There was an interaction between aging time and diet on lightness, where muscle of animals fed DDGS had higher L* after 14 days of aging (Figure 1A). However, after 21 days, the beef of both treatments had similar L*. When a* and b* were evaluated, muscle from animals fed DDGS tended to have higher a* and had higher b* compared with beef from animals fed the control diet. Components a* and b* decreased at the beginning of aging and then started to increase (Figure 1B and 1C). Beef from animals

Journal Pre-proof

12

fed DDGS did not differ in lipid oxidation compared with muscle from animals fed the control diet. However, beef on day 0 of retail display was less oxidized compared with the results of analyses performed 4 days later (Figure 2). There was no diet effect on the expression of PPARA, PPARG, SREBF1, FABP4, ACACA, FASN, SCD1 and ACOX. However, the muscles of animals fed the DDGS diet had lower expression of LPL and tended to have increased expression of CPT2 (Figure

oo

f

4).

4. DISCUSSION

pr

Average daily gain in this trial was below that predicted by the NASEM (2016).

e-

Diets based on DDGS are less susceptible to acidosis due to the low starch and high fiber

Pr

content of this coproduct (Council, 2012b; Klopfenstein et al., 2008) and it may be an explanation for a lower intake variation when feeding distillers grains. In this case, greater

al

rumen pH in bulls fed the DDGS diets would support greater intake and, consequently,

rn

greater ADG. Another hypothesis for the better ADG in animals fed DDGS would be the

Jo u

high UDP content of the CP (Depenbusch et al., 2009; DiCostanzo, 2010). Animals fed DGGS had heavier live weights and hot carcass weights due to greater ADG, which resulted in greater fat thickness. Similarly, Koger et al. (2010) observed that steers fed corn distillers grains also had greater fat thickness. The chemical composition of bovine muscles is relatively constant (approximately 75% water, 19 to 25% protein and 1 to 2% minerals), and the greatest variability observed is usually in fat content (Geay, Bauchart, Hocquette, & Culioli, 2001). In addition, protein increases in proportion with moisture; and protein and moisture decrease as fat content increases (Lawrie, 2004). However, in this study, the variation in protein and moisture was disproportionate and unexpected; when protein

Journal Pre-proof

13

content of the muscle of animals fed DDGS diet was greater, the moisture was lower. Different results were reported by Segers et al. (2011) who found no differences in moisture, protein, or fat content when steers were fed DDGS as a protein source. Additionally, Aldai et al. (2010) reported no difference in beef lean tissue composition when corn, wheat dried distillers grains, or barley-based finishing diets were fed to beef cattle. The absence of a difference in muscle fat content can be explained by the lack of

oo

f

diet effect on the mRNA abundance of genes primarily expressed in the adipocytes, including PPARA, PPARG, SREBF1, ACACA and FASN. In addition, as reviewed by

pr

Ladeira et al. (2018), intramuscular fat content is the result of synthesis, muscle uptake

e-

and degradation, and gene expression results show that these mechanisms acted in a

Pr

similar way, regardless the diets. PPAR-alpha is a transcription factor that may control lipogenic or lipolytic gene expression, regulating expression of other genes involved in

al

synthesis and β-oxidation of fatty acids in the muscle (Bionaz, Chen, Khan, & Loor,

rn

2013). PPAR-gamma is essential for adipogenesis (Huang et al., 2006) and SREBP-1c is

Jo u

also associated with regulation of lipogenesis (Teixeira et al., 2017). As no differences in the expression of genes responsible for encoding these three transcription factors were found in this study (Figure 3), it is probably lipogenesis and lipolysis were similar in the muscle of both groups. The results of transcription factor expression also explain the lack of differences in the expression of most of the genes. For example, genes related to fatty acid synthesis in the muscle (ACACA, FASN and SCD1) and genes related to fatty acid degradation in the muscle (ACOX) had no difference in their mRNA abundance. The greater expression of LPL in LT muscles of animals fed the control diet could be due to the difference in composition of fatty acids in the muscle tissue, as ether extract was similar in both diets (Table 1). According to Wang, Kuksis, and Manganaro (1982)

Journal Pre-proof

14

and Oliveira et al. (2014), LPL expression is regulated by fatty acids. In this case, the greater concentration of linoleic and arachidonic acids in the muscle of bulls fed DDGS diets down-regulated LPL expression. Joseph, Pratt, Pavan, Rekaya, and Duckett (2010) demonstrated that supplementation with 0.31 kg/d of corn oil (57% C18:2 n-6) downregulated the expression of LPL in steer adipose tissue. The greater concentration of linoleic acid and PUFA in the omasum and muscle of animals fed DDGS was probably due to the greater concentration of linoleic acid in

oo

f

the DDGS diet (2 times more). DDGS is a byproduct from corn ethanol plants, where corn starch is hydrolyzed and fermented to alcohol. Consequently, there is an increase in

pr

other nutrients, such as protein, fiber and ether extract. However, the DDGS used in this

e-

study had low ether extract because ethanol plants are now extracting oil from DDGS. In

Pr

this case, the DDGS diet was not a rich source of PUFA, which may explain the lack of differences in C18:1 trans fatty acid content in the omasum and muscle, as well as the

al

concentration of C18:2 cis 9, trans 11 in the muscle. These fatty acids are intermediates

rn

in rumen biohydrogenation, and their production by bacteria is based on the amount

Jo u

PUFA reaching the rumen. Another noteworthy result of our study is the efficiency of muscle incorporation at PUFA due to the large difference (approximately 6 times more) in omasum compared to muscle. In addition, the difference between oleic and stearic acid contents in the omasum and muscle were due to the action of the SCD enzyme in the muscle, converting stearic into oleic acid. The lack of dietary effect on the expression of the SCD1 gene helps to explain the similar concentration of these both fatty acids in the muscle of bulls fed the control and DDGS diets. The same explains the absence of a difference in CLA cis 9, trans 11 content in the muscle, because SCD converts C18:1 trans 11 to CLA. This observation agrees with previous studies by Gill et al. (2008),

Journal Pre-proof

15

Koger et al. (2010) and Segers et al. (2011), who reported that the use of dry distillers grains in feedlot diets has little or no effect on CLA content. Muscle from animals fed DDGS had lower concentration of lauric, myristic and palmitic acids, and this result is beneficial for human health because these fatty acids are considered hypercholesterolemic (Vahmani et al., 2015). According to French, O'Riordan, Monahan, Caffery, and Moloney (2003), myristic acid is the most undesirable SFA for human health, along with lauric and palmitic acids. According to Woollett,

oo

f

Spady, and Dietschy (1992), fatty acids act on LDL receptors in the liver, thereby reducing the uptake of LDL from plasma. The greater amounts of hypercholesterolemic

pr

fatty acids in the muscle from bulls fed the control diet may be due to the greater

e-

concentrations of lauric, myristic, myristoleic and palmitoleic acids in the control diet.

Pr

These last two fatty acids are easily saturated during biohydrogenation. However, despite the effect of diets on the hypercholesterolemic fatty acids, it is important to address that

al

concentrations of lauric and myristic acids are low to have a significant negative impact

rn

on the human diet. Lower concentrations of hypercholesterolemic fatty acids were also

steers.

Jo u

observed in the Segers et al. (2011) and Koger et al. (2010) studies using DDGS to finish

Lipid oxidation increased over time as indicated by TBARS concentrations. Similarly, Depenbusch et al. (2009) did not find a difference in muscle lipid oxidation between increasing DDGS in the diet compared with a steam-flaked corn diet. However, Gill et al. (2008) found greater lipid oxidation in the muscle of steers fed DDGS at 15% of the DM and attributed this result to the greater PUFA content in the muscle. Likewise, Koger et al. (2010) concluded that beef from cattle finished on diets containing DGGS will likely have a greater proportion of PUFA and therefore may be more susceptible to oxidative rancidity. Even though there was a greater concentration of PUFA in the muscle

Journal Pre-proof

16

of animals fed DDGS in our study, TBARS were not affected, and one explanation is the low concentration of intramuscular fat compared to the other studies mentioned above. The greater value of TBARS in this study when compared with other studies (Depenbush et al. 2009; Koger et al. 2010), is associated with the freezing and thawing processes prior to analysis. According to Moore & Young (1991), large fluctuation in temperature during the freezing and thawing processes stimulates formation of secondary products (α and β aldehydes) of lipid oxidation (Lynch & Faustman, 2000). However,

oo

f

despite an increase in oxidation during retail display time, this beef can be considered acceptable for consumption. According to Tarladgis et al. (1960), a TBARS value of

pr

approximately 0.5 mg of malonaldehyde/kg of meat is considered the threshold for

Pr

can be detected by consumers.

e-

acceptable meat, and values above these indicate a level of lipid oxidation products that

Meat color is mainly determined by the concentration of pigment and the chemical

al

state of the heme group (Mancini & Hunt, 2005). In addition, frozen steaks lead to greater

rn

and faster metmyoglobin deposition on the surface during aging, which contributes to

Jo u

faster deterioration of the color components, which significantly reduces retail life (Aroeira et al. 2016). In this study, the meat was darker and redder during the first few days of aging due to previous freezing. These results agree with Aroeira et al. (2016) that evaluated conventional aging (fresh meat) and freezing prior to aging. The L* values changed over aging time, most likely due to myoglobin oxidation. According to Faustman and Cassens (1990) and McKenna et al. (2005), the decline of the meat color indices over aging can be attributed to the oxidation of myoglobin (deoxymyoglobin or oxymyoglobin) to metmyoglobin. Depenbusch et al. (2009) only reported darker color in steaks from heifers fed DDGS at 45% of diet DM. Data from our study also agree with those of Gill et al. (2008), who noted lighter color from cattle fed

Journal Pre-proof

17

DDGS compared to cattle fed no distillers grains. Koger (2004) reported that beef from cattle fed distillers grains was redder than beef from cattle fed no distillers grains, which agrees with the present study, which showed a tendency for meat to be redder with the inclusion of DDGS in the diet.

5. CONCLUSION The use of low-fat dried distillers’ grains with solubles increased live animal

oo

f

performance of bulls. In addition, this study suggests that low-fat dried distillers’ grains with solubles increases beef quality by increasing lightness and redness. Finally, the use

pr

of this ingredient altered n-6 PUFA biohydrogenation and muscle concentration with

ACKNOWLEDGEMENTS

Pr

e-

minor impacts on lipogenic gene expression, down-regulating only LPL expression.

al

The authors would like to thank Trouw Nutrition, Campinas, SP; Fundação de Amparo à

rn

Pesquisa do Estado de São Paulo – Fapesp (grant number: 2015/16631-5); and

Jo u

Coordenação de Aperfeiçoamento de Pessoal de Nível Superior – Brasil (CAPES) – Finance Code 001.

6. LITERATURE CITED

Aldai, N., Aalhus, J., Dugan, M., Robertson, W., McAllister, T., Walter, L., & McKinnon, J. (2010). Comparison of wheat-versus corn-based dried distillers’ grains with solubles on meat quality of feedlot cattle. Meat Science, 84(3), 569-577. Allen, M. S., & Linton, J. A. V. (2007). In vivo methods to measure digestibility and digestion kinetics of feed fractions in the rumen. Paper presented at the SIMPÓSIO INTENACIONAL AVANÇOS EM TÉCNICAS DE PESQUISA EM NUTRIÇÃO DE RUMINANTES, São Paulo, SP. AMSA, A. M. S. A.-. (1995). Research guidelines for cookery, sensory evaluation, and instrumental tenderness Measurements of fresh meat. Chicago: American Meat Science Association (AMSA) & National Live Stock and Meat Board. Aroeira, C. N., de Almeida Torres Filho, R., Fontes, P. R., Ramos, A. d. L. S., de Miranda Gomide, L. A., Ladeira, M. M., & Ramos, E. M. (2017). Effect of freezing prior to

Journal Pre-proof

18

Jo u

rn

al

Pr

e-

pr

oo

f

aging on myoglobin redox forms and CIE color of beef from Nellore and Aberdeen Angus cattle. Meat science, 125, 16-21. Bionaz, M., Chen, S., Khan, M. J., & Loor, J. J. (2013). Functional Role of PPARs in Ruminants: Potential Targets for Fine-Tuning Metabolism during Growth and Lactation. PPAR Research, 28 págs. doi: 10.1155/2013/684159 Carvalho, J., Chizzotti, M., Ramos, E., Neto, O. M., Lanna, D., Lopes, L., . . . Ladeira, M. (2014). Qualitative characteristics of meat from young bulls fed different levels of crude glycerin. Meat science, 96(2), 977-983. Chouinard, P., Girard, V., & Brisson, G. (1998). Fatty Acid Profile and Physical Properties of Milk Fat from Cows fed Calcium Salts of Fatty Acids with Varying Unsaturation1. Journal of Dairy Science, 81(2), 471-481. Christie, W. W. (1982). A simple procedure for rapid transmethylation of glycerolipids and cholesteryl esters. Journal of Lipid Research, 23(7), 1072-1075. Council, U. G. (2012a). A guide to distiller’s dried grains with solubles (DDGS). Disponoble en: http://www.ddgs. umn. edu/prod/groups/cfans/@ pub/@ cfans/@ ansci/documents/ass et/cfans_asset_417244. pdf, 25(04), 2013. Council, U. G. (2012b). Physical and chemical characteristics related to handling and storage of DDGS. DDGS User Handbook. US Grains Council, Washington, DC, 1-16. Depenbusch, B. E., Coleman, C. M., Higgins, J. J., & Drouillard, J. S. (2009). Effects of increasing levels of dried corn distillers grains with solubles on growth performance, carcass characteristics, and meat quality of yearling heifers1. Journal of Animal Science, 87(8), 2653-2663. doi: 10.2527/jas.2008-1496 DiCostanzo, A. (2010). Beef Symposium: Population data analyses to evaluate trends in animal production systems. Journal of Animal Science, 88(13 elect suppl), E1-E2. doi: 10.2527/jas.2010-2955 Fastinger, N. D., Latshaw, J., & Mahan, D. (2006). Amino acid availability and true metabolizable energy content of corn distillers dried grains with solubles in adult cecectomized roosters. Poultry science, 85(7), 1212-1216. Faustman, C., & Cassens, R. (1990). The biochemical basis for discoloration in fresh meat: a review. Journal of Muscle Foods, 1(3), 217-243. French, P., O'Riordan, E. G., Monahan, F. J., Caffery, P. J., & Moloney, A. P. (2003). Fatty acid composition of intra-muscular tricylglycerols of steers fed autumn grass and concentrates. Livestock Production Science, 81. Geay, Y., Bauchart, D., Hocquette, J. F., & Culioli, J. (2001). Effect of nutritional factors on biochemical, structural and metabolic characteristics of muscles in ruminants, consequences on dietetic value and sensorial qualities of meat. Reproduction Nutrition Development, 41(1), 1-26. Gill, R., VanOverbeke, D., Depenbusch, B., Drouillard, J., & DiCostanzo, A. (2008). Impact of beef cattle diets containing corn or sorghum distillers grains on beef color, fatty acid profiles, and sensory attributes12. Journal of animal science, 86(4), 923-935. Hall, M. B. (2008). Determination of starch, including maltooligosaccharides, in animal feeds: Comparison of methods and a method recommended for AOAC collaborative study. Journal of AOAC International, 92(1), 42-49. Hara, A., & Radin, N. S. (1978). Lipid extraction of tissues with a low-toxicity solvent. Analytical biochemistry, 90(1), 420-426. Harvatine, K., & Bauman, D. (2006). SREBP1 and thyroid hormone responsive spot 14 (S14) are involved in the regulation of bovine mammary lipid synthesis during diet-induced milk fat depression and treatment with CLA. J Nutr, 136(10), 2468 - 2474. Huang, Z. G., Xiong, L., Zhen-Shan, L. I. U., Yong, Q. I. A. O., Shou-Ren, L. I. U., Hang-Xing, R. E. N., ... & Xue-Bin, L. I. (2006). The developmental changes and effect on IMF content of H-FABP and PPARγ mRNA expression in sheep muscle. Acta Genetica Sinica, 33(6), 507-514. Jolly-Breithaupt, M. L., Nuttelman, B. L., Schneider, C. J., Burken, D. B., Gramkow, J. L., Shreck, A. L., ... & Erickson, G. E. (2018). Finishing performance and diet digestibility

Journal Pre-proof

19

Jo u

rn

al

Pr

e-

pr

oo

f

for feedlot steers fed corn distillers grains plus solubles and distillers solubles with and without oil extraction. Journal of animal science, 96(5), 1996-2011. Joseph, S. J., Pratt, S. L., Pavan, E., Rekaya, R., & Duckett, S. K. (2010). Omega-6 fat supplementation alters lipogenic gene expression in bovine subcutaneous adipose tissue. Gene regulation and systems biology, 4, GRSB. S5831. Klopfenstein, T. J., Erickson, G. E., & Bremer, V. R. (2008). BOARD-INVITED REVIEW: Use of distillers by-products in the beef cattle feeding industry1. Journal of animal science, 86(5), 1223-1231. Koger, T., Wulf, D., Weaver, A., Wright, C., Tjardes, K., Mateo, K., . . . Smart, A. (2010). Influence of feeding various quantities of wet and dry distillers grains to finishing steers on carcass characteristics, meat quality, retail-case life of ground beef, and fatty acid profile of longissimus muscle. Journal of animal science, 88(10), 3399-3408. Ladeira, M. M., Schoonmaker, J. P., Swanson, K. C., Duckett, S. K., Gionbelli, M. P., Rodrigues, L. M., & Teixeira, P. D. (2018). Nutrigenomics of marbling and fatty acid profile in ruminant meat. Animal, 1-13. Lawrie, R.A. (2004). Ciência da carne. 6.ed. Porto Alegre: Artmed, 384 p. Lynch, M. P., & Faustman, C. (2000). Effect of aldehyde lipid oxidation products on myoglobin. Journal of Agricultural and Food Chemistry, 48(3), 600–604 Mancini, R., & Hunt, M. (2005). Current research in meat color. Meat science, 71(1), 100-121. McKenna, D., Mies, P., Baird, B., Pfeiffer, K., Ellebracht, J., & Savell, J. (2005). Biochemical and physical factors affecting discoloration characteristics of 19 bovine muscles. Meat Science, 70(4), 665-682. Moore, V. J., & Young, O. A. (1991). The effects of electrical stimulation, thawing, ageing and packaging on the colour and display life of lamb chops. Meat Science, 30(2), 131–145. Muzzi, Leonardo Augusto Lopes, Muzzi, Ruthnéa Aparecida Lázaro, & Gabellini, Endrigo Leonel Alves. (2009). Técnica de fistulação e canulação do rúmen em bovinos e ovinos. Ciência e Agrotecnologia, 33(spe), 2059-2064. https://dx.doi.org/10.1590/S141370542009000700060 National Academies of Sciences, Enginering & Medicine. (2016). Nutrient requirements of beef cattle: National Academies Press. NRC. (2000). Nutrient Requirements of Beef Cattle (updated 7th ed.). Washington, DC, USA: National Academy Press. Oliveira, D. M., Chalfun-Junior, A., Chizzotti, M. L., Barreto, H. G., Coelho, T. C., Paiva, L. V., . . . Ladeira, M. M. (2014). Expression of genes involved in lipid metabolism in the muscle of beef cattle fed soybean or rumen-protected fat, with or without monensin supplementation. J. Anim Sci. doi: 10.2527/jas.2014-7855 Pfaffl, M. W. (2001). A new mathematical model for relative quantification in real-time RTPCR. Nucl Acids Res, 29. doi: 10.1093/nar/29.9.e45 Teixeira, P. D., Oliveira, D. M., Chizzotti, M. L., Chalfun-Junior, A., Coelho, T. C., Gionbelli, M. P., . . . Ladeira, M. M. (2017). Subspecies and diet affect the expression of genes involved in lipid metabolism and chemical composition of muscle in beef cattle. Meat Science, 133(Supplement C), 110-118. doi: 10.1016/j.meatsci.2017.06.009 Ramos, E. M., & Gomide, L. A. M. (2007). Avaliação da qualidade de carne: fundamentos e metodologias. E. M. Ramos (Ed.) (pp. 599). Segers, J., Stewart, R., Lents, C., Pringle, T., Froetschel, M., Lowe, B., . . . Stelzleni, A. (2011). Effect of long-term corn by-product feeding on beef quality, strip loin fatty acid profiles, and shelf life. Journal of animal science, 89(11), 3792-3802. Shingfield, K., Ahvenjärvi, S., Toivonen, V., Ärölä, A., Nurmela, K., Huhtanen, P., & Griinari, J. M. (2003). Effect of dietary fish oil on biohydrogenation of fatty acids and milk fatty acid content in cows. Animal Science, 77(1), 165-179. Silva, D. R. G., Torres Filho, R. A., Cazedey, H. P., Fontes, P. R., Ramos, A. L. S., & Ramos, E. M. (2015). Comparison of Warner–Bratzler shear force values between round and square cross-section cores from cooked beef and pork Longissimus muscle. Meat Science, 103, 1-6.

Journal Pre-proof

20

Jo u

rn

al

Pr

e-

pr

oo

f

Tarladgis, B. G., Watts, B. M., Younathan, M. T., & Dugan, L. (1960). A distillation method for the quantitative determination of malonaldehyde in rancid foods. [journal article]. Journal of the American Oil Chemists Society, 37(1), 44-48. doi: 10.1007/bf02630824 Vahmani, P., Mapiye, C., Prieto, N., Rolland, D. C., McAllister, T. A., Aalhus, J. L., & Dugan, M. E. (2015). The scope for manipulating the polyunsaturated fatty acid content of beef: a review. Journal of animal science and biotechnology, 6(1), 1. Vander Pol, K. J., Luebbe, M. K., Crawford, G. I., Erickson, G. E., & Klopfenstein, T. J. (2009). Performance and digestibility characteristics of finishing diets containing distillers grains, composites of corn processing coproducts, or supplemental corn oil. Journal of animal science, 87(2), 639-652. Wang, C.-S., Kuksis, A., & Manganaro, F. (1982). Studies on the substrate specificity of purified human milk lipoprotein lipase. Lipids, 17(4), 278-284. Wood, J. D., Richardson, R. I., Nute, G. R., Fisher, A. V., Campo, M. M., Kasapidou, E., . . . Enser, M. (2003). Effects of fatty acids on meat quality: review. Meat Science, 66. Woollett, L. A., Spady, D. K., & Dietschy, J. M. (1992). Saturated and unsaturated fatty acids independently regulate low density lipoprotein receptor activity and production rate. Journal of lipid research, 33(1), 77-88.

Journal Pre-proof

21

Table 1: Percentage of ingredients, chemical composition and percentage of fatty acids of experimental diets

1

Jo u

rn

DDGS2

30.0 16.0 42.0 11.96

30.0 21.0 34.6 14.45

73.4 14.2 25.7 21.8 69.3 1.94 2.18 42.2

73.7 15.1 38.2 31.6 66.1 2.16 2.18 36.7

pr

oo

f

Control1

e-

al

Pr

Diet Ingredients, % of DM Corn silage DDGS Cottonseed meal Ground corn Mineral mixture3 Nutrients, % of DM Dry matter4 Crude protein Rumen undegradable protein (%CP) Neutral detergent fiber Non-fiber Carbohydrate Ether extract Metabolized energy (Mcal/kg) Starch Fatty acids, % of total FA Lauric, C12:0 Myristic, C14:0 Myristoleic, C14:1 c9 Pentadecylic, C15:0 Palmitic, C16:0 Palmitoleic, C16:1 c9 Stearic, C18:0 Oleic, C18:1 c9 Linoleic, C18:2 c9, c12 α-linolenic, C18:3 n3 Arachidic, C20:0

2.33 3.99 1.34 1.89 18.8 3.77 7.66 17.3 12.9 3.92 2.47

0.13 0.19 0.054 0.45 22.9 0.51 2.84 37.2 26.4 3.67 0.39

Diet without DDGS; Diet with 21% DDGS in DM; 3 Assurance levels per kg of concentrate: CONTROL: kaolin: 7.06 g; CaCo3: 1.97 g; Urea: 1.02 g; Ca: 1.39 g; P: 0.3 g; Na: 0.35 g; Zn: 48 mg; Cu: 15.7 mg; Mg: 35.9 mg; Co: 0.92 mg; I: 0.7 mg; Se: 0.2 mg; Vitamin A: 2.600 UI; Vitamin D: 360 UI; Vitamin E: 36 mg; Fe: 66.8 mg; F: 3.34 mg; sodium monensin 23 mg; DDGS: kaolin: 8.23 g; CaCo3: 2.58 g; Urea: 1.02 g; Ca: 1.5 g; P: 0.3 g; Na: 0.36 g; Zn: 48 mg; Cu: 15.7 mg; Mg: 35.9 mg; Co: 1.21 mg; I: 7 mg; Se: 0.2 mg; Vitamin A: 2.600 UI; Vitamin D: 360 UI; Vitamin E: 36 mg; Fe: 56.75 mg; F: 12.3 mg; sodium monensin 23 mg; 4 Natural matter basis. 2

Journal Pre-proof

22

Table 2: Chemical composition of dried distillers grain Nutrients, % of DM Dry matter1 Crude protein Rumen undegradable protein2 Ashes Ether extract Starch 1 Natural matter basis; 2% of crude protein

Jo u

rn

al

Pr

e-

pr

oo

f

90.5 29.0 51.4 4.74 3.11 5.0

Journal Pre-proof

Table 3: Sequences (5’ to 3’) and efficiencies of the primers used in the reverse-transcription quantitative PCR (RT-qPCR) Symbol PPARA PPARG SREBF1 SCD1 ACACA LPL FABP4 FASN ACOX CPT2 β-actin GAPDH

Name Peroxisome proliferator activated receptor alpha Peroxisome proliferator activated receptor gamma Sterol regulatory element Binding protein Stearoyl CoA desaturase

Forward (F) and reverse (R) F CAATGGAGATGGTGGACACA R TTGTAGGAAGTCTGCCGAGAG F CGACCAACTGAACCCAGAGT R TCAGCGGGAAGGACTTTATG F GAGCCACCCTTCAACGAA R TGTCTTCTATGTCGGTCAGCA F TTATTCCGTTATGCCCTTGG R TTGTCATAAGGGCGGTATCC Acetyl CoA carboxylase F TGAAGAAGCAATGGATGAACC R TTCAGACACGGAGCCAATAA Lipoprotein lipase F CTCAGGACTCCCGAAGACAC R GTTTTGCTGCTGTGGTTGAA Adipocyte-type fatty F GGATGATAAGATGGTGCTGGA acid-binding protein R ATCCCTTGGCTTATGCTCTCT Fatty acid synthase F ATCAACTCTGAGGGGCTGAA R CAACAAAACTGGTGCTCACG Acyl-coenzyme A oxidase 1 F GCTGTCCTAAGGCGTTTGTG R ATGATGCTCCCCTGAAGAAA Carnitine palmitoyltransferase 2 F CATGACTGTCTCTGCCATCC R ATCACTTTTGGCAGGGTTCA β-actin F GTCCACCTTCCAGCAGATGT R CAGTCCGCCTAGAAGCATTT Glyceraldehyde 3-phosphate F CGACTTCAACAGCGACACTC Dehydrogenase R TTGTCGTACCAGGAAATGAGC

l a

o J

n r u

Access number Amplicon R2 Efficiency NM_001034036.1 95 0.99 99.2

f o

NM_181024.2

83

0.99

99.9

NM_001113302.1

o r p

88

0.98

94.6

NM_173959.4

83

0.98

95.8

NM_174224.2

88

0.99

96.6

r P

NM_001075120.1

98

0.99

96.7

NM_174314.2

73

0.99

92.6

U34794.1

83

0.97

99.5

BC102761.2

83

0.99

99.0

BC105423.1

91

0.91

99.9

BC142413.1

90

0.99

100.0

NM_001034034.1

96

0.99

101.4

e

Journal Pre-proof Table 4: Composition (%) and proportion (%) of main fatty acids in the omasum of young bulls fed dried distillers grains with solubles (DDGS) or a diet without distillers grain with solubles (Control) Control1 DDGS2 n = 12 n = 12 Lauric 0.15 0.12 Myristic 1.11 1.14 Pentadecanoic 0.65 0.52 Palmitic 15.6 15.42 Palmitoleic 0.56 0.44 Stearic 61.52 60.57 Octadecenoic 4.40 4.92 C18:1 t9 0.41 0.4 C18:1 t10 0.99 1.01 C18:1 t11 3.23 3.77 Oleic 4.05 4.74 Linoleic 0.83 1.26 CLA c9, t11 0.05 0.10 CLA t10, c12 0.01 0.05 α-linolenic 0.04 0.04 Arachidonic nd nd ∑ Saturated 80.79 80.44 ∑ Unsaturated 19.14 19.53 ∑UFA/ ∑SFA 0.24 0.24 ∑ Monounsatured 17.56 17.19 ∑ Polyunsatured 0.85 1.35 ∑ n-3 0.04 0.03 ∑ n-6 0.83 1.26 ∑ n-6:∑ n-3 23.59 51.96 1 Diet without DDGS; 2Diet with 21% DDGS in DM.

SEM

P- Value

0.005 0.089 0.027 0.457 0.019 1.112 0.394 0.029 0.098 0.249 0.222 0.152 0.039 0.047 0.007 0.631 0.638 0.011 0.586 0.157 0.005 0.152 3.454

0.01 0.82 0.01 0.78 <0.01 0.55 0.37 0.92 0.91 0.13 0.03 0.06 0.27 0.57 1.00

Jo

ur

na

lP

re

-p

ro

of

Fatty acids

0.74 0.67 0.94 0.65 0.03 0.35 0.06 <0.01

Journal Pre-proof Table 5: Final body weight, average daily gain, dry matter intake, feed efficiency, hot carcass weight, subcutaneous fat thickness, loin eye area, initial and final pH from young bulls fed dried distillers grains with solubles (DDGS) or a diet without distillers grains with solubles (Control)

ro

Final BW (kg) ADG (kg/day) DM intake (kg/day) Feed efficiency Carcass traits Hot carcass weight (kg) 290 Fat thickness (mm) 5.6 2 Loin eye area (cm ) 77.4 1 2 Diet without DDGS; Diet with 21% DDGS in DM.

DDGS2 n = 40 546 1.21 10.63 0.109

of

Control1 n = 40 509 0.85 8.42 0.094

Performance

P- Value

11.6 0.042 0.277 0.003

0.01 <0.01 <0.01 0.01

7.14 0.21 1.64

0.01 0.08 0.12

lP

re

-p

320 6.2 81.1

SEM

Table 6: Chemical composition (%) of longissimus thoracis from young bulls fed dried

ur

(Control)

na

distillers grains with solubles (DDGS) or a diet without distillers grain with solubles

Jo

Control1 DDGS2 n = 40 n = 40 Moisture (%) 73.4 72.7 Protein (%) 22.1 22.7 Ether extract (%) 3.03 3.07 Ashes (%) 1.37 1.43 1 Diet without DDGS; 2Diet with 21% DDGS in DM. Item

SEM

P- Value

0.22 0.22 0.17 0.11

0.04 0.05 0.87 0.69

Journal Pre-proof Table 7: Composition (%) of main fatty acids in the muscle of young bulls fed dried distillers grains with solubles (DDGS) or a diet without distillers grains with solubles (Control) Control1 DDGS2 n = 40 n = 40 Lauric 0.07 0.06 Myristic 3.18 2.79 Pentadecanoic 0.31 0.26 Palmitic 27.1 25.6 Palmitoleic 3.59 3.6 Stearic 14.5 13.7 C18:1 t9 0.14 0.15 C18:1 t10 0.33 0.35 C18:1 t11 0.68 0.67 Oleic 38.33 38.97 Linoleic 3.57 6.43 CLA c9, t11 0.27 0.26 CLA t10, c12 0.09 0.14 α-linolenic 0.21 0.25 Arachidonic 0.81 1.14 ∑ Saturated 46.1 42.8 ∑ Unsaturated 52.9 56.3 ∑UFA/ ∑SFA 1.12 1.36 ∑ Monounsatured 47.4 48.6 ∑ Polyunsatured 5.55 8.67 ∑ n-3 0.26 0.3 ∑ n-6 4.54 7.58 ∑ n-6/ ∑ n-3 16.0 24.8 1 2 Diet without DDGS; Diet with 21% DDGS in DM.

SEM

P- Value

0.003 0.141 0.011 0.531 0.118 0.601 0.156 0.032 0.044 1.225 0.389 0.017 0.016 0.02 0.1 0.816 1.347 0.042 0.91 0.547 0.021 0.488 0.834

0.02 0.06 0.01 0.04 0.94 0.33 0.57 0.66 0.98 0.71 <0.01 0.43 0.03 0.15 0.03 <0.01 0.09 <0.01 0.37 <0.01 0.18 <0.01 <0.01

Jo

ur

na

lP

re

-p

ro

of

Fatty acids

Journal Pre-proof Figure 1: A- Lightness index (L*), B- redness (a*) and C- yellowness (b*) of meat from young bulls fed dried distillers grain with solubles (DDGS - 40 animals/treatment) or a diet without distillers grains with solubles (Control - 40 animals/treatment) over different aging times. Error bars represent SEM.

Figure 2: Lipid oxidation of beef from bulls fed dried distillers grain with solubles (DDGS -

of

40 animals/treatment) or a control diet (Control - 40 animals/treatment) over different retail

-p

ro

display times. Error bars represent SEM.

re

Figure 3: Fold change in gene expression in the muscle of bulls fed dried distillers grains with solubles (DDGS - 40 animals/treatment) or a control diet (Control - 40

Jo

ur

na

lP

animals/treatment). Error bars represent SEM.

Journal Pre-proof Conflict of interest statement

Jo

ur

na

lP

re

-p

ro

of

There is no conflict of interest associated with this work.

Figure 1

Figure 2

Figure 3