- Email: [email protected]
Performance of a pilot-scale sewage treatment: An up-flow anaerobic sludge blanket (UASB) and a down-flow hanging sponge (DHS) reactors combined system by sulfur-redox reaction process under low-temperature conditions
Bioresource Technology 102 (2011) 753–757
Contents lists available at ScienceDirect
Bioresource Technology journal homepage: www.elsevier.com/locate/biortech
Performance of a pilot-scale sewage treatment: An up-flow anaerobic sludge blanket (UASB) and a down-flow hanging sponge (DHS) reactors combined system by sulfur-redox reaction process under low-temperature conditions Masanobu Takahashi a,b,⇑, Takashi Yamaguchi a, Yoshiharu Kuramoto c, Akihiro Nagano d, Satoshi Shimozaki e, Haruhiko Sumino f, Nobuo Araki g, Shinichi Yamazaki h, Shuji Kawakami a, Hideki Harada b a
Department of Environmental System Engineering, Nagaoka University of Technology, 1603-1, Kami-tomioka, Nagaoka, Niigata 940-2188, Japan Department of Civil Engineering, Environmental Protection Engineering, Tohoku University, 6-6-06 Aoba-ku, Aramaki, Sendai, Miyagi 980-8579, Japan c Hiroshima Prefectural Technology Research Institute West Region Industrial Research Center, 2-10-1, Aga-minami, Kure, Hiroshima 737-0004, Japan d Technical Research and Development Division, Sanki Engineering Co., Ltd., 1742-7 Shimotsuruma, Yamato, Kanagawa 242-0001, Japan e New Product and Business Planning Office, Kotobuki Engineering and Manufacturing Co., Ltd., 1-2-43, Hiro-shirotake, Kure, Hiroshima 737-0144, Japan f Department of Civil Engineering, Gifu National College of Technology, 2236-2 Kamimakuwa, Motosu, Gifu 501-0495, Japan g Department of Civil Engineering, Nagaoka National College of Technology, 888 Nishi-Katakai, Nagaoka, Niigata 940-8532, Japan h Department of Civil Engineering, Kochi National College of Technology, 200-1 Monobe-otsu, Nangoku, Kochi 783-8508, Japan b
a r t i c l e
i n f o
Article history: Received 12 May 2010 Received in revised form 23 August 2010 Accepted 23 August 2010 Available online 26 August 2010 Keywords: Actual sewage UASB DHS Sulfur-redox reaction
a b s t r a c t Performance of a wastewater treatment system utilizing a sulfur-redox reaction of microbes was investigated using a pilot-scale reactor that was fed with actual sewage. The system consisted of an up-flow anaerobic sludge blanket (UASB) reactor and a down-flow hanging sponge (DHS) reactor with a recirculation line. Consequently, the total CODCr (465 ± 147 mg L1; total BOD of 207 ± 68 mg L1) at the influent was reduced (70 ± 14 mg L1; total BOD of 9 ± 2 mg L1) at the DHS effluent under the conditions of an overall hydraulic retention time of 12 h, a recirculation ratio of 2, and a low-sewage temperature of 7.0 ± 2.8 °C. A microbial analysis revealed that sulfate-reducing bacteria contributed to the degradation of organic matter in the UASB reactor even in low temperatures. The utilized sulfur-redox reaction is applicable for low-strength wastewater treatment under low-temperature conditions. Ó 2010 Elsevier Ltd. All rights reserved.
1. Introduction An up-flow anaerobic sludge blanket (UASB) method has been represented as the core technology for an anaerobic wastewater treatment method, widely used for the treatment of medium and high organic strength wastewater. Recently, it has been applied to low-strength wastewater because of advantages such as energy saving and low excess sludge (Yoochatchaval et al., 2008; Syutsubo et al., 2008). Sato et al. (2007) revealed that UASB could be the most suitable option in terms of expenses and treatment efficiency for sewage treatment in the warm regions of India. However, for sewage treatment under low-temperature, the performance of the anaerobic methanogenic process for the anaerobic treatment method tends to degrade because methanogenic activity is suspended (Uemura and Harada, 2000; Yamaguchi et al., 2006). Therefore, it ⇑ Corresponding author at: Department of Environmental System Engineering, Nagaoka University of Technology, 1603-1, Kami-tomioka, Nagaoka, Niigata 9402188, Japan. Tel./fax: +81 258 47 9612. E-mail address: [email protected] (M. Takahashi). 0960-8524/$ - see front matter Ó 2010 Elsevier Ltd. All rights reserved. doi:10.1016/j.biortech.2010.08.081
is necessary to improve the quality of water and polish up the anaerobically treated effluent using a post-treatment system. Lettinga and others reported that the anaerobic filter and the anaerobic hybrid system achieved 70% of COD removal efficiency in the hydraulic retention time (HRT) of 12 h at 13 °C (Elmitwalli et al., 2001, 2002, 2003). Álvarez et al. (2008) reported that the two-stage anaerobic system achieved 49–65% of COD removal efficiency in the hydraulic retention time (HRT) of 9.3–16.9 h at 21–14 °C. Mahmoud et al. (2004, 2008) proposed sludge control by the combination of a UASB and a digester unit, which enhanced sludge stabilization and the generation of active methanogenic sludge that was to be recirculated to the UASB reactor. We proposed low-strength wastewater treatment process that can be used under low-temperature conditions. The process consisted of a UASB reactor as an anaerobic pre-treatment unit and a down-flow hanging sponge (DHS) reactor as an aerobic posttreatment unit with a recirculation line. In the sulfur-redox process, organic matter was degraded by sulfate-reducing bacteria (SRB) which produced sulfide. The sulfide, one of the COD compound, is oxidized to sulfate by sulfur-oxidizing bacteria (SOB).
754
M. Takahashi et al. / Bioresource Technology 102 (2011) 753–757
The DHS reactor is a novel technology that was developed by the Harada Research Group, Japan. The DHS reactor (cube-type DHS) achieved high COD removal efficiency of 90% in the HRT of 10.7 h at 15 °C (Tawfik et al., 2006). Bungo et al. (2004) and Yamaguchi et al. (2006) reported that 90% of the fed artificial wastewater was degraded in the sulfur-redox UASB/DHS system at 8 °C in the HRT of 12 h. In addition, it appeared that using sulfur-redox reaction, the UASB and the aerated fixed bed system could be applied to actual sewage treatment under low-temperature conditions as well (Sumino et al., 2007). This study examined the performance of the UASB/DHS system for treating actual sewage in ambient low-temperature conditions and a microbial community and focused on the contribution of the sulfur-redox reaction.
2. Methods 2.1. Experimental setup Fig. 1 shows the schematic diagram of the experimental setup of a pilot-scale sewage treatment system, which was installed at the Higashi-Hiroshima city wastewater treatment center, Japan. The system consisted of a denitrification (DN) reactor (1.40 m3), a UASB reactor (8.40 m3), a DHS reactor (13.87 m3), and sand filtration (1.00 m3) with a recirculation line. The treatment flow was as follows: sewage was passed through a 5-mm-mesh screen device and pretreated by a DN reactor and a UASB reactor. The UASB effluent was post-treated by a DHS reactor under aerobic conditions and subsequently became the final effluent after passing through the sand filtration. A pipeline was used in the system for recirculation from the bottom part of the DHS reactor to the influent point of the DN reactor (i.e., the influent point for sewage), from where the sand-filtrated washing water containing suspended sludge (SS) and the reproduced sulfate were returned. The media used in the DN reactor were sponge sheets of polyurethane foams fixed to both the surfaces of the boards, oriented vertically. The DN media filling rate was 21% of the DN reactor volume. Also, the media used in the DHS reactor were sponge cubes of polyurethane foams inserted in the net ring of the polypropylene foams, packed randomly. The DHS media filling rate was 31% of the DHS reactor volume. The air inside the DHS reactor was ventilated using a fan that was located at the upper part of the reactor. As to seeding sludge, the UASB reactor was inoculated with mesophilic granular sludge (3.9 m3) from a food processing
wastewater treatment plant. And in the DHS reactor activated sludge (0.06 m3) from a municipal sewage treatment plant was used. 2.2. Microbial activity batch test of the UASB sludge The specific methane-producing activities (MPA) and sulfatereducing activities (SRA) of the retained sludge in the UASB reactor were measured by a serum vial test. The test sludge was taken from a reactor vertical height of 1.0 m (top height, 5.0 m). This sludge was compulsorily disintegrated in an anaerobic medium, which was composed of phosphorus buffer, trace elements, reducing agent, and redox indicator. An acetate solution (2000 mg-COD L1 in the vial) or hydrogen gas (H2/CO2 (v/v) = 80/20%, 1.4 atm) was used as the respective test substrate. In the SRA test, sodium sulfate solution (200 mg-S L1 in the vial) and chloroform solution (5 mg L1 in the vial) were added to the SRA test vials to stop methane production. All vials were incubated in a rotary shaker (radius = 4 cm, 120 rpm) at 35 °C. A detailed procedure of the activity test is mentioned elsewhere (Yamaguchi et al., 1997). Each activity was determined twice by vial tests. 2.3. Fluorescence in situ hybridization (FISH) method Oligonucleotide probes for complementary specific regions of 16S rRNA were used in this study, namely, SRB385 (50 CGGCGTCGCTGCGTCAGG 30 ) specific for sulfate-reducing bacteria including most species of d-class purple bacteria (Amann et al., 1990) and Dsbb660 (50 GAATTCCACTTTCCCCTCTG 30 ) specific for the genus Desulfobulbus (Devereux et al., 1992). The probes were 50 labeled with tetramethylrhodamine-isothyocyanate (TRITC) using an amino linker. The protocol for in situ hybridization, described by Amann (1995), was used with some minor modifications. The hybridization buffer contained 0.9 M NaCl, 20 mM Tris–HCl (pH 7.2), 0.1% sodium dodecyl sulfate (SDS), and 25% Block Ace (Snow Brand Milk Products, Japan). Formamide was added at a final concentration of 10% for SRB385 and 20% for Dsbb660 to ensure optimal hybridization stringency. Hybridization was performed for 2 h at a hybridization temperature of 45 °C. Subsequently, a washing step was performed for 20 min at 47 °C with the hybridization buffer, without using probes. The granular sections were examined with fluorescence microscopy (Olympus BX-60-FLA) with a filter set: WIG (G-excitation for TRITC). 2.4. Chemical analysis Gas composition for MPA test was measured by a thermal conductivity detector (TCD) gas chromatograph (Shimadzu GC-8A, Unibeads-C 60/80 mesh, Col. Temp. 150 °C, Carrier pressure: 1.5 atm, Ar). Sulfate was determined by an ion chromatograph (CDD-6A, Simadzu, Shimpack IC-A1, Col. Temp. 40 °C, mobile phase 2.5 mM of potassium hydrogen phthalate). Volatile fatty acids (VFAs) were analyzed by an HPLC system chromatograph (RI-2031plus, Jasco, Aminex HPX-87H, Col. Temp. 65 °C, mobile phase 5 mM of sulfuric acid). The other analyses depended on the standard method published by Japan Sewage Works Association (1997). 3. Results and discussion 3.1. Reactor performance
Fig. 1. Schematic diagram of a pilot-scale sewage treatment UASB/DHS system.
Fig. 2 shows the time course of the sewage temperature, SS, and total CODCr over 900 days. The system was operated under ambient temperature conditions, and the daily average influent sewage
755
M. Takahashi et al. / Bioresource Technology 102 (2011) 753–757 Table 1 Overview of performance during summer and winter seasons. Season Days
Summer 679–884
Winter 885–970
23.3 (4.2) 14 2 103 (23)
7.0 (2.8) 12 2 140 (29)
COD/SO2 4 S(–)
2.3 (0.9)
1.5 (0.4)
Concentrations (mg-L1) SS Sewage Anaerobic inf. UASB eff. DHS eff.
403 (188) 176 (73) 37 (18) 45 (30)
257 (98) 125 (31) 38 (6) 49 (14)
Total CODCr Sewage Anaerobic inf. UASB eff. DHS eff.
599 (244) 250 (90) 94 (39) 68 (75)
465 (147) 216 (48) 102 (13) 70 (14)
Total BOD Sewage Anaerobic inf. UASB eff. DHS eff.
225 (72) 84 (27) 41 (15) 8 (6)
207 (68) 81 (22) 43 (7) 9 (2)
Total nitrogen Sewage Anaerobic inf. DHS eff.
59 (14) 37 (7) 25 (7)
54 (7) 41 (7) 34 (6)
Removal (%) DHS eff. vs. sewage SS Total CODCr Total BOD Total nitrogen
88 88 97 56
79 84 95 38
UASB eff. vs. anaerobic inf. SS Total CODCr Total BOD
77 (10) 60 (15) 50 (19)
68 (8) 51 (10) 44 (11)
DHS eff. vs. anaerobic inf. SS Total CODCr Total BOD
74 (16) 76 (9) 91 (6)
60 (13) 66 (8) 89 (3)
Operating conditions Sewage temperature (°C) HRT (h) Recirc. ratio l SO2 4 (mg-S L )
Fig. 2. Time course of sewage temperature SS and total CODCr concentration during treatment in UASB/DHS system. 1
temperature ranged between 2.6–30.2 °C. For SS, 280 ± 177 mg L of sewage SS was removed to 36 ± 14 mg L1 of UASB effluent and 48 ± 28 mg L1 of DHS effluent. The sand filtration decreased to less than 10 mg L1. The captured SS of the sand filtration flowed into the recirculation line to the denitrification reactor. During the operational period, the process performance was stable as indicated by the following COD values: 463 ± 225 mg L1 of influent total CODCr, 95 ± 29 mg L1 of UASB effluent, and 70 ± 53 mg L1 of DHS effluent. Table 1 presents the process performance during the summer and winter seasons after 679 days. The mean sewage temperature in each period was 23.3 °C and 7.0 °C, respectively. In addition, the mean inflow of sulfate was 103 mg-S L1 and 140 mg-S L1, respectively. The recirculation ratio (recirculation volume/sewage inflow volume) was fixed at 2. In the summer season, the average removal efficiency of DHS effluent vs. sewage was 88% of SS and CODCr and 97% of BOD. On the other hand, in the winter season, the average removal efficiency of DHS effluent vs. sewage was as high as 79% of SS, 84% of CODCr, and 95% of BOD. For nitrogen removal, the final effluent was of superior quality with respect to high nitrification removal efficiency of 56% in the summer season. The efficiency achieved was almost the theoretical maximum nitrogen removal efficiency, that is, 67% of influent nitrogen at recirculation ratio 2. 3.2. Sludge volume index (SVI) and activities of methanogenic archaebacterium and sulfate-reducing bacteria (SRA) of the UASBretained sludge Fig. 3(a) shows the sewage temperature and sludge volume index, SVI, of the UASB-retained sludge. During the operation, SVI was maintained at less than 50 mL g1 although the sewage temperature varied seasonally within the range of 28–5 °C. This high sedimentarity caused high-retained sludge concentration in the UASB.
(9) (14) (2) (11)
(7) (5) (1) (8)
( ), standard deviation.
Fig. 3(b) presents the changes in the MPA and SRA of the UASB-retained sludge, assessed at 35 °C. The MPA of seed sludge of the hydrogen utilization and the acetate utilization was 1.35 g-COD g-VSS1 day1 and 0.33 g-COD g-VSS1 day1, respectively. Hydrogen utilization MPA sharply decreased till 326 days and became constant at around 0.04 g-COD g-VSS1 day1 after 609 days. Acetate utilization MPA sharply decreased till 158 days and then increased and decreased with a seasonal variation of less than 0.10 g-COD g-VSS1 day1. The SRA of seed sludge of the hydrogen and acetate utilization was 0.07 g-COD g-VSS1 day1 and 0.03 g-COD g-VSS1 day1, respectively. Hydrogen utilization SRA was enhanced under the con1 dition of 2.3–1.5 COD/SO2 day1 of 4 -S ratio, and 0.14 g-COD g-VSS SRA on the 934th day exceeded the MPA greatly. Acetate utilization SRA increased at a level of less than 0.04 g-COD g-VSS1 day1 in the winter season. Similar results were observed by Chou et al. (2008); they reported that SRB tend to out-compete methanogenic archaebacterium if the influent COD/SO2 4 -S ratio was maintained at less than 3.9. Fig. 4 shows the relationship between the SRA/MPA ratio and the sewage temperature owing to the operating hysteresis, which rearranges the data in Fig. 3. For hydrogen utilization, the ratio
756
M. Takahashi et al. / Bioresource Technology 102 (2011) 753–757
Fig. 3. Changes at 35 °C in MPA and SRA of sludge retained in UASB reactor. (a) Sewage temperature and sludge volume index (SVI) of UASB sludge bed and (b) raw data of changes in MPA and SRA.
increased to 3.6. For acetate degradation, the ratio was within 1; the ratio tended to increase under low-sewage temperature conditions. For the contribution of SRB, it was found that the SRB could maintain metabolic activity even under low-temperature conditions. MPA tended to decrease with a decrease in temperature. It was reported that MPA becomes almost inactive at temperatures as low as less than 10 °C, but SRA holds a relatively higher level to remove organic matter (Sumino et al., 2007; Yamaguchi et al., 2006). Similar results were observed by Lew et al. (2009); they reported FISH results which show that methanogenic archaebacterium dominated at all temperatures studied, a slight decrease in methanogenic archaebacterium with the decrease in temperature was observed, from 76% at 20 °C to 68% at 10 °C. 3.3. UASB and DHS profiles Fig. 5(a) and (b) shows the UASB profiles of CODCr, sulfate, sulfide, and oxidation–reduction potential (ORP) on the 624th day of the operation. The UASB retained the sludge hold up by a
Fig. 5. UASB profiles. UASB profiles of (a) CODCr components and (b) sulfate, sulfide, ORP.
height of about 2.0 m. The retained-sludge concentration was 17–33 g-MLVSS L1 (22–44 g-MLSS L1) within the sludge bed portion. The soluble CODCr concentration increased with an increase in acetate, propionate, and sulfide in the sludge bed portion. The ORP in the bed portion was less than 300 mV. The influent sulfate concentration was 115 mg-S L1, and the CODCr/SO24 (g-COD g-S1) ratio was 1.84. The influent sulfate was completely reduced to sulfide by SRB in the sludge bed portion. The produced soluble sulfide concentration was 90 mg-S L1. The produced sulfide concentration was estimated as 180 mg L1 of CODCr removal; it achieved 85% of the influent CODCr level, 212 mg L1. The DHS profiles of MLVSS, MLSS, CODCr, dissolved oxygen (DO), sulfate and sulfide were analyzed on the 624th day of the operation. The retained-sludge concentration was 19–25 g-MLVSS L1 (27–34 g-MLSS L1) within the DHS height. The proposed system was able to perform under low-temperature conditions because of the fact that both the UASB and DHS reactors maintained the
Fig. 4. Relationship between SRA/MPA ratio and sewage temperature owing to operating hysteresis. (a) H2/CO2 substrate and (b) acetate substrate.
M. Takahashi et al. / Bioresource Technology 102 (2011) 753–757
concentrations of biomass as high as 30 ± 6 g-MLVSS L1 (average of the whole period). The total CODCr removal ratio in DHS was 34%, and the concentration of the effluent was 104 mg L1. The DO concentration was greater than 4 mg L1 in the flow-down direction at a height of 0.8 m. The produced sulfide in the UASB was completely reproduced to sulfate by the SOB, which inhabited the retained sludge and the physical oxidation by a height of 0.8 m in the flow-down direction. 3.4. Observation of a microbe contributing to sulfur-redox reaction FISH analysis revealed that SRB contributed to organic matter degradation in the UASB reactor. An oligonucleotide probe, Thio840, for FISH was newly designed for the Thiobacillus group, specifically. Approximately 7% of DAPI stained the total cells in the biofilter sludge hybridized with the probe Thio840 (data not shown). On the other hand, in DHS reactor, SOB grew sufficiently and sulfide was oxidized to sulfate. The sulfur-oxidizing activity of the retained sludge in DHS was evaluated to be 1.5 g-COD g-VSS1 day1 as oneorder higher than SRAs estimated by the vial-activity test; thiosulfate as an electron donor fed the test-vial bottles with oxygen as an electron acceptor. 4. Conclusions A pilot-scale sewage treatment system using UASB/DHS, operating at HRT of 12 h and recirculation ratio of 2 for over 900 days, performed organic matter removal with high efficiencies of 79% of SS, 84% of CODCr, and 95% of BOD, and nitrogen removal at 38% of the theoretical level under low temperatures such as 7.0 ± 2.8 °C. The SRA/MPA ratio increased at low temperatures. A sulfur-redox reaction collaborating with SRB and SOB, particularly for Thiobacillus species in the system, was found to effect the removal of organic matter under low temperatures. Acknowledgements This study was conducted as a project at the Hiroshima Prefectural Institute of Industrial Science and Technology. We received cooperation from Higashi-Hiroshima city, especially in the establishment of the UASB/DHS system. References Álvarez, J.A., Armstrong, E., Gómez, M., Soto, M., 2008. Anaerobic treatment of lowstrength municipal wastewater by a two-stage pilot plant under psychrophilic conditions. Bioresour. Technol. 99, 7051–7062. Amann, R.I., Binder, B.J., Olson, R.J., Chisholm, S.W., Devereux, R., Stahl, D.A., 1990. Combination of 16S rRNA-targeted oligonucleotide probes with flow cytometry
757
for analyzing mixed microbial populations. Appl. Environ. Microbiol. 56, 1919–1925. Amann, R.I., 1995. In situ identification of micro-organisms by whole cell hybridization with rRNA-targeted nucleic acid probes. Molecular Microbial Ecology Manual. Kluwer Academic Publishers, The Netherlands. 3.3.6, pp. 1–15. Bungo, Y., Yamamoto, T., Ono, S., Yamaguchi, T., Sumino, H., Nagano, A., Araki, N., Yamazaki, S., Harada, H., 2004. Low strength wastewater treatment under low temperature condition by the novel sulfur redox action process consisting of an UASB and an aerobic reactor. Proc. Int. Conf. Anaerobic Digestion 4, 2325–2326. Chou, H.H., Huang, J.S., Chen, W.G., Ohara, R., 2008. Competitive reaction kinetics of sulfate-reducing bacteria and methanogenic bacteria in anaerobic filters. Bioresour. Technol. 99, 8061–8067. Devereux, R., Kane, M.D., Winfreyand, J., Stahl, D.A., 1992. Genus-and group-specific hybridization probes for determinative and environmental studies of sulfatereducing bacteria. Syst. Appl. Microbiol. 15, 601–609. Elmitwalli, T.A., Zeeman, G., Lettinga, G., 2001. Anaerobic treatment of domestic sewage at low temperature. Water Sci. Technol. 44 (4), 33–40. Elmitwalli, T.A., Oahn, K.L.T., Zeeman, G., Lettinga, G., 2002. Treatment of domestic sewage in a two-step anaerobic filter/anaerobic hybrid system at low temperature. Water Res. 36 (9), 2225–2232. Elmitwalli, T.A., van Lier, J., Zeeman, G., Lettinga, G., 2003. Treatment of domestic sewage at low temperature in a two-anaerobic step system followed by a trickling filter. Water Sci. Technol. 48 (11/12), 199–206. Japan Sewage Works Association, 1997. Japanese standard testing methods for sewage, Japan Sewage Works Association (in Japanese). Lew, B., Tarre, S., Beliavski, M., Green, M., 2009. Anaerobic degradation pathway and kinetics of domestic wastewater at low temperatures. Bioresour. Technol. 100, 6155–6162. Mahmoud, N., Zeeman, G., Gijzen, H., Lettinga, G., 2004. Anaerobic sewage treatment in a one-stage UASB reactor and a combined UASB-Digester system. Water Res. 38, 2348–2358. Mahmoud, N., Zeeman, G., van Lier, J., 2008. Adapting UASB technology for sewage treatment in Palestina and Jordan. Water Sci. Technol. 57 (3), 361–366. Sato, N., Okubo, T., Onodera, T., Lalit, K.A., Ohashi, A., Harada, H., 2007. Economic evaluation of sewage treatment processes in India. J. Environ. Manage. 84, 447–460. Sumino, H., Takahashi, M., Yamaguchi, T., Kenichi, A., Araki, N., Yamazaki, S., Shimozaki, S., Nagano, A., Nishio, N., 2007. Feasibility study of a pilot-scale sewage treatment system combining an up-flow anaerobic sludge blanket (UASB) and an aerated fixed bed (AFB) reactor at ambient temperature. Bioresour. Technol. 98, 177–182. Syutsubo, K., Yoochatchaval, W., Yoshida, H., Nishiyama, K., Okawara, M., Sumino, H., Araki, N., Harada, H., Ohashi, A., 2008. Changes of microbial characteristics of retained sludge during low-temperature operation of an EGSB reactor for lowstrength wastewater treatment. Water Sci. Technol. 57 (2), 277–281. Tawfik, A., Ohashi, A., Harada, H., 2006. Sewage treatment in a combined up-flow anaerobic sludge blanket (UASB)-down-flow hanging sponge (DHS) system. Biochem. Eng. J. 29, 210–219. Uemura, S., Harada, H., 2000. Treatment of sewage by a UASB reactor under moderate to low temperature conditions. Bioresour. Technol. 72, 275–282. Yamaguchi, T., Harada, H., Tseng, I.-Cheng., 1997. Competitive exclusion of methane-producing bacteria by sulfate-reducing bacteria in anaerobic degradation of long-chain fatty acids. Proc. Int. Conf. Anaerobic Digestion 2, 362–370. Yamaguchi, T., Bungo, Y., Takahashi, M., Sumino, H., Nagano, A., Araki, N., Imai, T., Yamazaki, S., Harada, H., 2006. Low strength wastewater treatment under low temperature conditions by a novel sulfur redox action process. Water Sci. Technol. 53 (6), 99–105. Yoochatchaval, W., Nishiyama, K., Okawara, M., Ohashi, A., Harada, H., Syutsubo, K., 2008. Influence of effluent-recirculation condition on the process performance of EGSB reactor for treating of low strength wastewater. Water Sci. Technol. 57 (6), 869–873.
Contents lists available at ScienceDirect
Bioresource Technology journal homepage: www.elsevier.com/locate/biortech
Performance of a pilot-scale sewage treatment: An up-flow anaerobic sludge blanket (UASB) and a down-flow hanging sponge (DHS) reactors combined system by sulfur-redox reaction process under low-temperature conditions Masanobu Takahashi a,b,⇑, Takashi Yamaguchi a, Yoshiharu Kuramoto c, Akihiro Nagano d, Satoshi Shimozaki e, Haruhiko Sumino f, Nobuo Araki g, Shinichi Yamazaki h, Shuji Kawakami a, Hideki Harada b a
Department of Environmental System Engineering, Nagaoka University of Technology, 1603-1, Kami-tomioka, Nagaoka, Niigata 940-2188, Japan Department of Civil Engineering, Environmental Protection Engineering, Tohoku University, 6-6-06 Aoba-ku, Aramaki, Sendai, Miyagi 980-8579, Japan c Hiroshima Prefectural Technology Research Institute West Region Industrial Research Center, 2-10-1, Aga-minami, Kure, Hiroshima 737-0004, Japan d Technical Research and Development Division, Sanki Engineering Co., Ltd., 1742-7 Shimotsuruma, Yamato, Kanagawa 242-0001, Japan e New Product and Business Planning Office, Kotobuki Engineering and Manufacturing Co., Ltd., 1-2-43, Hiro-shirotake, Kure, Hiroshima 737-0144, Japan f Department of Civil Engineering, Gifu National College of Technology, 2236-2 Kamimakuwa, Motosu, Gifu 501-0495, Japan g Department of Civil Engineering, Nagaoka National College of Technology, 888 Nishi-Katakai, Nagaoka, Niigata 940-8532, Japan h Department of Civil Engineering, Kochi National College of Technology, 200-1 Monobe-otsu, Nangoku, Kochi 783-8508, Japan b
a r t i c l e
i n f o
Article history: Received 12 May 2010 Received in revised form 23 August 2010 Accepted 23 August 2010 Available online 26 August 2010 Keywords: Actual sewage UASB DHS Sulfur-redox reaction
a b s t r a c t Performance of a wastewater treatment system utilizing a sulfur-redox reaction of microbes was investigated using a pilot-scale reactor that was fed with actual sewage. The system consisted of an up-flow anaerobic sludge blanket (UASB) reactor and a down-flow hanging sponge (DHS) reactor with a recirculation line. Consequently, the total CODCr (465 ± 147 mg L1; total BOD of 207 ± 68 mg L1) at the influent was reduced (70 ± 14 mg L1; total BOD of 9 ± 2 mg L1) at the DHS effluent under the conditions of an overall hydraulic retention time of 12 h, a recirculation ratio of 2, and a low-sewage temperature of 7.0 ± 2.8 °C. A microbial analysis revealed that sulfate-reducing bacteria contributed to the degradation of organic matter in the UASB reactor even in low temperatures. The utilized sulfur-redox reaction is applicable for low-strength wastewater treatment under low-temperature conditions. Ó 2010 Elsevier Ltd. All rights reserved.
1. Introduction An up-flow anaerobic sludge blanket (UASB) method has been represented as the core technology for an anaerobic wastewater treatment method, widely used for the treatment of medium and high organic strength wastewater. Recently, it has been applied to low-strength wastewater because of advantages such as energy saving and low excess sludge (Yoochatchaval et al., 2008; Syutsubo et al., 2008). Sato et al. (2007) revealed that UASB could be the most suitable option in terms of expenses and treatment efficiency for sewage treatment in the warm regions of India. However, for sewage treatment under low-temperature, the performance of the anaerobic methanogenic process for the anaerobic treatment method tends to degrade because methanogenic activity is suspended (Uemura and Harada, 2000; Yamaguchi et al., 2006). Therefore, it ⇑ Corresponding author at: Department of Environmental System Engineering, Nagaoka University of Technology, 1603-1, Kami-tomioka, Nagaoka, Niigata 9402188, Japan. Tel./fax: +81 258 47 9612. E-mail address: [email protected] (M. Takahashi). 0960-8524/$ - see front matter Ó 2010 Elsevier Ltd. All rights reserved. doi:10.1016/j.biortech.2010.08.081
is necessary to improve the quality of water and polish up the anaerobically treated effluent using a post-treatment system. Lettinga and others reported that the anaerobic filter and the anaerobic hybrid system achieved 70% of COD removal efficiency in the hydraulic retention time (HRT) of 12 h at 13 °C (Elmitwalli et al., 2001, 2002, 2003). Álvarez et al. (2008) reported that the two-stage anaerobic system achieved 49–65% of COD removal efficiency in the hydraulic retention time (HRT) of 9.3–16.9 h at 21–14 °C. Mahmoud et al. (2004, 2008) proposed sludge control by the combination of a UASB and a digester unit, which enhanced sludge stabilization and the generation of active methanogenic sludge that was to be recirculated to the UASB reactor. We proposed low-strength wastewater treatment process that can be used under low-temperature conditions. The process consisted of a UASB reactor as an anaerobic pre-treatment unit and a down-flow hanging sponge (DHS) reactor as an aerobic posttreatment unit with a recirculation line. In the sulfur-redox process, organic matter was degraded by sulfate-reducing bacteria (SRB) which produced sulfide. The sulfide, one of the COD compound, is oxidized to sulfate by sulfur-oxidizing bacteria (SOB).
754
M. Takahashi et al. / Bioresource Technology 102 (2011) 753–757
The DHS reactor is a novel technology that was developed by the Harada Research Group, Japan. The DHS reactor (cube-type DHS) achieved high COD removal efficiency of 90% in the HRT of 10.7 h at 15 °C (Tawfik et al., 2006). Bungo et al. (2004) and Yamaguchi et al. (2006) reported that 90% of the fed artificial wastewater was degraded in the sulfur-redox UASB/DHS system at 8 °C in the HRT of 12 h. In addition, it appeared that using sulfur-redox reaction, the UASB and the aerated fixed bed system could be applied to actual sewage treatment under low-temperature conditions as well (Sumino et al., 2007). This study examined the performance of the UASB/DHS system for treating actual sewage in ambient low-temperature conditions and a microbial community and focused on the contribution of the sulfur-redox reaction.
2. Methods 2.1. Experimental setup Fig. 1 shows the schematic diagram of the experimental setup of a pilot-scale sewage treatment system, which was installed at the Higashi-Hiroshima city wastewater treatment center, Japan. The system consisted of a denitrification (DN) reactor (1.40 m3), a UASB reactor (8.40 m3), a DHS reactor (13.87 m3), and sand filtration (1.00 m3) with a recirculation line. The treatment flow was as follows: sewage was passed through a 5-mm-mesh screen device and pretreated by a DN reactor and a UASB reactor. The UASB effluent was post-treated by a DHS reactor under aerobic conditions and subsequently became the final effluent after passing through the sand filtration. A pipeline was used in the system for recirculation from the bottom part of the DHS reactor to the influent point of the DN reactor (i.e., the influent point for sewage), from where the sand-filtrated washing water containing suspended sludge (SS) and the reproduced sulfate were returned. The media used in the DN reactor were sponge sheets of polyurethane foams fixed to both the surfaces of the boards, oriented vertically. The DN media filling rate was 21% of the DN reactor volume. Also, the media used in the DHS reactor were sponge cubes of polyurethane foams inserted in the net ring of the polypropylene foams, packed randomly. The DHS media filling rate was 31% of the DHS reactor volume. The air inside the DHS reactor was ventilated using a fan that was located at the upper part of the reactor. As to seeding sludge, the UASB reactor was inoculated with mesophilic granular sludge (3.9 m3) from a food processing
wastewater treatment plant. And in the DHS reactor activated sludge (0.06 m3) from a municipal sewage treatment plant was used. 2.2. Microbial activity batch test of the UASB sludge The specific methane-producing activities (MPA) and sulfatereducing activities (SRA) of the retained sludge in the UASB reactor were measured by a serum vial test. The test sludge was taken from a reactor vertical height of 1.0 m (top height, 5.0 m). This sludge was compulsorily disintegrated in an anaerobic medium, which was composed of phosphorus buffer, trace elements, reducing agent, and redox indicator. An acetate solution (2000 mg-COD L1 in the vial) or hydrogen gas (H2/CO2 (v/v) = 80/20%, 1.4 atm) was used as the respective test substrate. In the SRA test, sodium sulfate solution (200 mg-S L1 in the vial) and chloroform solution (5 mg L1 in the vial) were added to the SRA test vials to stop methane production. All vials were incubated in a rotary shaker (radius = 4 cm, 120 rpm) at 35 °C. A detailed procedure of the activity test is mentioned elsewhere (Yamaguchi et al., 1997). Each activity was determined twice by vial tests. 2.3. Fluorescence in situ hybridization (FISH) method Oligonucleotide probes for complementary specific regions of 16S rRNA were used in this study, namely, SRB385 (50 CGGCGTCGCTGCGTCAGG 30 ) specific for sulfate-reducing bacteria including most species of d-class purple bacteria (Amann et al., 1990) and Dsbb660 (50 GAATTCCACTTTCCCCTCTG 30 ) specific for the genus Desulfobulbus (Devereux et al., 1992). The probes were 50 labeled with tetramethylrhodamine-isothyocyanate (TRITC) using an amino linker. The protocol for in situ hybridization, described by Amann (1995), was used with some minor modifications. The hybridization buffer contained 0.9 M NaCl, 20 mM Tris–HCl (pH 7.2), 0.1% sodium dodecyl sulfate (SDS), and 25% Block Ace (Snow Brand Milk Products, Japan). Formamide was added at a final concentration of 10% for SRB385 and 20% for Dsbb660 to ensure optimal hybridization stringency. Hybridization was performed for 2 h at a hybridization temperature of 45 °C. Subsequently, a washing step was performed for 20 min at 47 °C with the hybridization buffer, without using probes. The granular sections were examined with fluorescence microscopy (Olympus BX-60-FLA) with a filter set: WIG (G-excitation for TRITC). 2.4. Chemical analysis Gas composition for MPA test was measured by a thermal conductivity detector (TCD) gas chromatograph (Shimadzu GC-8A, Unibeads-C 60/80 mesh, Col. Temp. 150 °C, Carrier pressure: 1.5 atm, Ar). Sulfate was determined by an ion chromatograph (CDD-6A, Simadzu, Shimpack IC-A1, Col. Temp. 40 °C, mobile phase 2.5 mM of potassium hydrogen phthalate). Volatile fatty acids (VFAs) were analyzed by an HPLC system chromatograph (RI-2031plus, Jasco, Aminex HPX-87H, Col. Temp. 65 °C, mobile phase 5 mM of sulfuric acid). The other analyses depended on the standard method published by Japan Sewage Works Association (1997). 3. Results and discussion 3.1. Reactor performance
Fig. 1. Schematic diagram of a pilot-scale sewage treatment UASB/DHS system.
Fig. 2 shows the time course of the sewage temperature, SS, and total CODCr over 900 days. The system was operated under ambient temperature conditions, and the daily average influent sewage
755
M. Takahashi et al. / Bioresource Technology 102 (2011) 753–757 Table 1 Overview of performance during summer and winter seasons. Season Days
Summer 679–884
Winter 885–970
23.3 (4.2) 14 2 103 (23)
7.0 (2.8) 12 2 140 (29)
COD/SO2 4 S(–)
2.3 (0.9)
1.5 (0.4)
Concentrations (mg-L1) SS Sewage Anaerobic inf. UASB eff. DHS eff.
403 (188) 176 (73) 37 (18) 45 (30)
257 (98) 125 (31) 38 (6) 49 (14)
Total CODCr Sewage Anaerobic inf. UASB eff. DHS eff.
599 (244) 250 (90) 94 (39) 68 (75)
465 (147) 216 (48) 102 (13) 70 (14)
Total BOD Sewage Anaerobic inf. UASB eff. DHS eff.
225 (72) 84 (27) 41 (15) 8 (6)
207 (68) 81 (22) 43 (7) 9 (2)
Total nitrogen Sewage Anaerobic inf. DHS eff.
59 (14) 37 (7) 25 (7)
54 (7) 41 (7) 34 (6)
Removal (%) DHS eff. vs. sewage SS Total CODCr Total BOD Total nitrogen
88 88 97 56
79 84 95 38
UASB eff. vs. anaerobic inf. SS Total CODCr Total BOD
77 (10) 60 (15) 50 (19)
68 (8) 51 (10) 44 (11)
DHS eff. vs. anaerobic inf. SS Total CODCr Total BOD
74 (16) 76 (9) 91 (6)
60 (13) 66 (8) 89 (3)
Operating conditions Sewage temperature (°C) HRT (h) Recirc. ratio l SO2 4 (mg-S L )
Fig. 2. Time course of sewage temperature SS and total CODCr concentration during treatment in UASB/DHS system. 1
temperature ranged between 2.6–30.2 °C. For SS, 280 ± 177 mg L of sewage SS was removed to 36 ± 14 mg L1 of UASB effluent and 48 ± 28 mg L1 of DHS effluent. The sand filtration decreased to less than 10 mg L1. The captured SS of the sand filtration flowed into the recirculation line to the denitrification reactor. During the operational period, the process performance was stable as indicated by the following COD values: 463 ± 225 mg L1 of influent total CODCr, 95 ± 29 mg L1 of UASB effluent, and 70 ± 53 mg L1 of DHS effluent. Table 1 presents the process performance during the summer and winter seasons after 679 days. The mean sewage temperature in each period was 23.3 °C and 7.0 °C, respectively. In addition, the mean inflow of sulfate was 103 mg-S L1 and 140 mg-S L1, respectively. The recirculation ratio (recirculation volume/sewage inflow volume) was fixed at 2. In the summer season, the average removal efficiency of DHS effluent vs. sewage was 88% of SS and CODCr and 97% of BOD. On the other hand, in the winter season, the average removal efficiency of DHS effluent vs. sewage was as high as 79% of SS, 84% of CODCr, and 95% of BOD. For nitrogen removal, the final effluent was of superior quality with respect to high nitrification removal efficiency of 56% in the summer season. The efficiency achieved was almost the theoretical maximum nitrogen removal efficiency, that is, 67% of influent nitrogen at recirculation ratio 2. 3.2. Sludge volume index (SVI) and activities of methanogenic archaebacterium and sulfate-reducing bacteria (SRA) of the UASBretained sludge Fig. 3(a) shows the sewage temperature and sludge volume index, SVI, of the UASB-retained sludge. During the operation, SVI was maintained at less than 50 mL g1 although the sewage temperature varied seasonally within the range of 28–5 °C. This high sedimentarity caused high-retained sludge concentration in the UASB.
(9) (14) (2) (11)
(7) (5) (1) (8)
( ), standard deviation.
Fig. 3(b) presents the changes in the MPA and SRA of the UASB-retained sludge, assessed at 35 °C. The MPA of seed sludge of the hydrogen utilization and the acetate utilization was 1.35 g-COD g-VSS1 day1 and 0.33 g-COD g-VSS1 day1, respectively. Hydrogen utilization MPA sharply decreased till 326 days and became constant at around 0.04 g-COD g-VSS1 day1 after 609 days. Acetate utilization MPA sharply decreased till 158 days and then increased and decreased with a seasonal variation of less than 0.10 g-COD g-VSS1 day1. The SRA of seed sludge of the hydrogen and acetate utilization was 0.07 g-COD g-VSS1 day1 and 0.03 g-COD g-VSS1 day1, respectively. Hydrogen utilization SRA was enhanced under the con1 dition of 2.3–1.5 COD/SO2 day1 of 4 -S ratio, and 0.14 g-COD g-VSS SRA on the 934th day exceeded the MPA greatly. Acetate utilization SRA increased at a level of less than 0.04 g-COD g-VSS1 day1 in the winter season. Similar results were observed by Chou et al. (2008); they reported that SRB tend to out-compete methanogenic archaebacterium if the influent COD/SO2 4 -S ratio was maintained at less than 3.9. Fig. 4 shows the relationship between the SRA/MPA ratio and the sewage temperature owing to the operating hysteresis, which rearranges the data in Fig. 3. For hydrogen utilization, the ratio
756
M. Takahashi et al. / Bioresource Technology 102 (2011) 753–757
Fig. 3. Changes at 35 °C in MPA and SRA of sludge retained in UASB reactor. (a) Sewage temperature and sludge volume index (SVI) of UASB sludge bed and (b) raw data of changes in MPA and SRA.
increased to 3.6. For acetate degradation, the ratio was within 1; the ratio tended to increase under low-sewage temperature conditions. For the contribution of SRB, it was found that the SRB could maintain metabolic activity even under low-temperature conditions. MPA tended to decrease with a decrease in temperature. It was reported that MPA becomes almost inactive at temperatures as low as less than 10 °C, but SRA holds a relatively higher level to remove organic matter (Sumino et al., 2007; Yamaguchi et al., 2006). Similar results were observed by Lew et al. (2009); they reported FISH results which show that methanogenic archaebacterium dominated at all temperatures studied, a slight decrease in methanogenic archaebacterium with the decrease in temperature was observed, from 76% at 20 °C to 68% at 10 °C. 3.3. UASB and DHS profiles Fig. 5(a) and (b) shows the UASB profiles of CODCr, sulfate, sulfide, and oxidation–reduction potential (ORP) on the 624th day of the operation. The UASB retained the sludge hold up by a
Fig. 5. UASB profiles. UASB profiles of (a) CODCr components and (b) sulfate, sulfide, ORP.
height of about 2.0 m. The retained-sludge concentration was 17–33 g-MLVSS L1 (22–44 g-MLSS L1) within the sludge bed portion. The soluble CODCr concentration increased with an increase in acetate, propionate, and sulfide in the sludge bed portion. The ORP in the bed portion was less than 300 mV. The influent sulfate concentration was 115 mg-S L1, and the CODCr/SO24 (g-COD g-S1) ratio was 1.84. The influent sulfate was completely reduced to sulfide by SRB in the sludge bed portion. The produced soluble sulfide concentration was 90 mg-S L1. The produced sulfide concentration was estimated as 180 mg L1 of CODCr removal; it achieved 85% of the influent CODCr level, 212 mg L1. The DHS profiles of MLVSS, MLSS, CODCr, dissolved oxygen (DO), sulfate and sulfide were analyzed on the 624th day of the operation. The retained-sludge concentration was 19–25 g-MLVSS L1 (27–34 g-MLSS L1) within the DHS height. The proposed system was able to perform under low-temperature conditions because of the fact that both the UASB and DHS reactors maintained the
Fig. 4. Relationship between SRA/MPA ratio and sewage temperature owing to operating hysteresis. (a) H2/CO2 substrate and (b) acetate substrate.
M. Takahashi et al. / Bioresource Technology 102 (2011) 753–757
concentrations of biomass as high as 30 ± 6 g-MLVSS L1 (average of the whole period). The total CODCr removal ratio in DHS was 34%, and the concentration of the effluent was 104 mg L1. The DO concentration was greater than 4 mg L1 in the flow-down direction at a height of 0.8 m. The produced sulfide in the UASB was completely reproduced to sulfate by the SOB, which inhabited the retained sludge and the physical oxidation by a height of 0.8 m in the flow-down direction. 3.4. Observation of a microbe contributing to sulfur-redox reaction FISH analysis revealed that SRB contributed to organic matter degradation in the UASB reactor. An oligonucleotide probe, Thio840, for FISH was newly designed for the Thiobacillus group, specifically. Approximately 7% of DAPI stained the total cells in the biofilter sludge hybridized with the probe Thio840 (data not shown). On the other hand, in DHS reactor, SOB grew sufficiently and sulfide was oxidized to sulfate. The sulfur-oxidizing activity of the retained sludge in DHS was evaluated to be 1.5 g-COD g-VSS1 day1 as oneorder higher than SRAs estimated by the vial-activity test; thiosulfate as an electron donor fed the test-vial bottles with oxygen as an electron acceptor. 4. Conclusions A pilot-scale sewage treatment system using UASB/DHS, operating at HRT of 12 h and recirculation ratio of 2 for over 900 days, performed organic matter removal with high efficiencies of 79% of SS, 84% of CODCr, and 95% of BOD, and nitrogen removal at 38% of the theoretical level under low temperatures such as 7.0 ± 2.8 °C. The SRA/MPA ratio increased at low temperatures. A sulfur-redox reaction collaborating with SRB and SOB, particularly for Thiobacillus species in the system, was found to effect the removal of organic matter under low temperatures. Acknowledgements This study was conducted as a project at the Hiroshima Prefectural Institute of Industrial Science and Technology. We received cooperation from Higashi-Hiroshima city, especially in the establishment of the UASB/DHS system. References Álvarez, J.A., Armstrong, E., Gómez, M., Soto, M., 2008. Anaerobic treatment of lowstrength municipal wastewater by a two-stage pilot plant under psychrophilic conditions. Bioresour. Technol. 99, 7051–7062. Amann, R.I., Binder, B.J., Olson, R.J., Chisholm, S.W., Devereux, R., Stahl, D.A., 1990. Combination of 16S rRNA-targeted oligonucleotide probes with flow cytometry
757
for analyzing mixed microbial populations. Appl. Environ. Microbiol. 56, 1919–1925. Amann, R.I., 1995. In situ identification of micro-organisms by whole cell hybridization with rRNA-targeted nucleic acid probes. Molecular Microbial Ecology Manual. Kluwer Academic Publishers, The Netherlands. 3.3.6, pp. 1–15. Bungo, Y., Yamamoto, T., Ono, S., Yamaguchi, T., Sumino, H., Nagano, A., Araki, N., Yamazaki, S., Harada, H., 2004. Low strength wastewater treatment under low temperature condition by the novel sulfur redox action process consisting of an UASB and an aerobic reactor. Proc. Int. Conf. Anaerobic Digestion 4, 2325–2326. Chou, H.H., Huang, J.S., Chen, W.G., Ohara, R., 2008. Competitive reaction kinetics of sulfate-reducing bacteria and methanogenic bacteria in anaerobic filters. Bioresour. Technol. 99, 8061–8067. Devereux, R., Kane, M.D., Winfreyand, J., Stahl, D.A., 1992. Genus-and group-specific hybridization probes for determinative and environmental studies of sulfatereducing bacteria. Syst. Appl. Microbiol. 15, 601–609. Elmitwalli, T.A., Zeeman, G., Lettinga, G., 2001. Anaerobic treatment of domestic sewage at low temperature. Water Sci. Technol. 44 (4), 33–40. Elmitwalli, T.A., Oahn, K.L.T., Zeeman, G., Lettinga, G., 2002. Treatment of domestic sewage in a two-step anaerobic filter/anaerobic hybrid system at low temperature. Water Res. 36 (9), 2225–2232. Elmitwalli, T.A., van Lier, J., Zeeman, G., Lettinga, G., 2003. Treatment of domestic sewage at low temperature in a two-anaerobic step system followed by a trickling filter. Water Sci. Technol. 48 (11/12), 199–206. Japan Sewage Works Association, 1997. Japanese standard testing methods for sewage, Japan Sewage Works Association (in Japanese). Lew, B., Tarre, S., Beliavski, M., Green, M., 2009. Anaerobic degradation pathway and kinetics of domestic wastewater at low temperatures. Bioresour. Technol. 100, 6155–6162. Mahmoud, N., Zeeman, G., Gijzen, H., Lettinga, G., 2004. Anaerobic sewage treatment in a one-stage UASB reactor and a combined UASB-Digester system. Water Res. 38, 2348–2358. Mahmoud, N., Zeeman, G., van Lier, J., 2008. Adapting UASB technology for sewage treatment in Palestina and Jordan. Water Sci. Technol. 57 (3), 361–366. Sato, N., Okubo, T., Onodera, T., Lalit, K.A., Ohashi, A., Harada, H., 2007. Economic evaluation of sewage treatment processes in India. J. Environ. Manage. 84, 447–460. Sumino, H., Takahashi, M., Yamaguchi, T., Kenichi, A., Araki, N., Yamazaki, S., Shimozaki, S., Nagano, A., Nishio, N., 2007. Feasibility study of a pilot-scale sewage treatment system combining an up-flow anaerobic sludge blanket (UASB) and an aerated fixed bed (AFB) reactor at ambient temperature. Bioresour. Technol. 98, 177–182. Syutsubo, K., Yoochatchaval, W., Yoshida, H., Nishiyama, K., Okawara, M., Sumino, H., Araki, N., Harada, H., Ohashi, A., 2008. Changes of microbial characteristics of retained sludge during low-temperature operation of an EGSB reactor for lowstrength wastewater treatment. Water Sci. Technol. 57 (2), 277–281. Tawfik, A., Ohashi, A., Harada, H., 2006. Sewage treatment in a combined up-flow anaerobic sludge blanket (UASB)-down-flow hanging sponge (DHS) system. Biochem. Eng. J. 29, 210–219. Uemura, S., Harada, H., 2000. Treatment of sewage by a UASB reactor under moderate to low temperature conditions. Bioresour. Technol. 72, 275–282. Yamaguchi, T., Harada, H., Tseng, I.-Cheng., 1997. Competitive exclusion of methane-producing bacteria by sulfate-reducing bacteria in anaerobic degradation of long-chain fatty acids. Proc. Int. Conf. Anaerobic Digestion 2, 362–370. Yamaguchi, T., Bungo, Y., Takahashi, M., Sumino, H., Nagano, A., Araki, N., Imai, T., Yamazaki, S., Harada, H., 2006. Low strength wastewater treatment under low temperature conditions by a novel sulfur redox action process. Water Sci. Technol. 53 (6), 99–105. Yoochatchaval, W., Nishiyama, K., Okawara, M., Ohashi, A., Harada, H., Syutsubo, K., 2008. Influence of effluent-recirculation condition on the process performance of EGSB reactor for treating of low strength wastewater. Water Sci. Technol. 57 (6), 869–873.