- Email: [email protected]
Perinatal exposure to PTU delays switching from NR2B to NR2A subunits of the NMDA receptor in the rat cerebellum
NeuroToxicology 27 (2006) 284–290
Perinatal exposure to PTU delays switching from NR2B to NR2A subunits of the NMDA receptor in the rat cerebellum Kumiko Kobayashi *, Ryozo Tsuji, Takafumi Yoshioka, Terumasa Mino, Takaki Seki Environmental Health Science Laboratory, Sumitomo Chemical Co., Ltd., Osaka, Japan Received 27 September 2005; accepted 21 November 2005 Available online 4 January 2006
Abstract Certain kinds of developmental neurotoxicants are considered to act by affecting the levels of thyroid hormones, which are essential for the brain development of both humans and experimental animals. Hypothyroidism experimentally induced in rats with propylthiouracil (PTU) offers a useful animal model for developmental neurotoxicity. The purpose of the present study was to clarify developmental alterations in gene expression caused by PTU in this model, with the focus on eight genes implicated in neural network formation or synaptic functions, such as the brain-derived neurotrophic factor (BDNF) and NMDA receptors 2A/2B. First, we measured the developmental profile of gene expression in vehicle-dosed rat cerebellum by quantitative RT-PCR and then examined the effects of PTU on mRNA levels on postnatal day (PND) 22, when most of the cerebellar structures in mature animals are already formed. PTU induced up-regulation of NR2B mRNA and down-regulation of NR2A and BDNF mRNAs in the cerebellum on PND 22, but there were no changes in the other genes (growth associated protein-43, L1, neuronal cell adhesion molecule, synaptophysin, post synaptic density-95). Examination of the effects of PTU on maturation of NMDAR subunits (NR2A/NR2B) demonstrated changes in relative expression on PND 14, but not on PND 4, with recovery after maturation. The profile of NMDAR subunits in vehicle-dosed rats showed a shift from NR2B to NR2A during development. These results suggest PTU can delay this switching from NR2B to NR2A subunits in the maturation of NMDA receptors. # 2005 Elsevier Inc. All rights reserved. Keywords: PTU; Hypothyroidism; Development; NMDA receptors
1. Introduction Social concerns are increasing for the effects of chemical substances in the environment on the nervous system of children, since the developing brain is vulnerable, and prone to impairment. Agents affecting thyroid hormone levels are especially hazardous, since thyroid hormones are essential for brain development (Zoeller et al., 2002). In a series of studies of hypothyroid rats treated with PTU, in the perinatal period, behavioral abnormalities of offspring were observed that persisted into adulthood (Schalock et al., 1979; Goldey et al., 1995). In our previous work, it was shown that E-maze learning
* Corresponding author. Tel.: +81 6 6466 5335; fax: +81 6 6466 5443. E-mail address: [email protected] (K. Kobayashi). 0161-813X/$ – see front matter # 2005 Elsevier Inc. All rights reserved. doi:10.1016/j.neuro.2005.11.008
deficiency, hyperactivity and altered auditory startle responses, were accompanied by alterations in gene expression in the hippocampus and cerebral cortex during the period of neural network formation (Kobayashi et al., 2005). In the present study, we focused on the effects of PTU on gene expression in the cerebellum. Since the cerebellum develops postnatally (Altman, 1982), it is a good model system to study the mechanism of developmental neurotoxicity caused by perinatal exposure to PTU. Its relatively simple circuitry facilitates histological identification of neuronal types, and there have been numerous studies of effect of hypothyroidism on neurological structure in the cerebellum. Thus, reduction of dendritic arborization of Purkinje cellsand their synaptogenesis with granule cell axons, delayed proliferation and migration of granule cells, delayed myelination, and changes in synaptic connection between
K. Kobayashi et al. / NeuroToxicology 27 (2006) 284–290
cerebellar neurons and afferent neuronal fibers have all been documented (Balazs et al., 1971; Nicholson and Altman, 1972a,b,c; Hajos et al., 1973). The influence of hypothyroidism on cerebellar gene expression has aleady been assessed for several genes, including myelin basic protein (MBP), proteolipidic protein (PLP), myelin-associated/oligodendrocytic basic protein (MOBP), 3-fucosyl-N-acetyl-lactosamine antigen (CD15), glial fibrillary acidic protein (GFAP), apoptotic genes Bcl-2, Bcl-XL, and Bax and neurotrophic factors such as brain-derived neurotrophic factor (BDNF), and neurotrophin (NT)-3 (Barradas et al., 2001; Koibuchi et al., 2001; Singh et al., 2003; Li et al., 2004). Altered expression of genes responsible for neural network formation including some of the examples listed above, is suspected to prevent accurate neuronal network formation and result in behavioral deficits after maturation. In the present study, we investigated the effects of PTU on the expression of gene implicated in neuronal growth and synaptic function; NMDA receptor subunits (NR2A and NR2B), PSD95, synaptophysin, L1, NCAM, BDNF, and GAP-43. As a result, we found that the perinatal exposure to PTU caused increase of NR2B mRNA expression and decrease of NR2A and BDNF mRNA expression on postnatal days (PNDs) 14 and 22, pointing to a delay in switching from NR2B to NR2A during development. Our results suggest that this delayed switching is involved in the developmental neurotoxicity of PTU. 2. Methods 2.1. Animals All experiments were performed in accordance with the Guide for Animal Care and Use of Sumitomo Chemical Co., Ltd. Pregnant SD (CD)IGS rats were purchased from Charles River Japan, Inc. (Shiga, Japan) on gestation day 8–10; the breeding day was GD 0. Eleven pregnant rats per group were assigned based upon body weights on GD 17 and orally given vehicle (controls) or propylthiouracil (PTU) at 0.4, 1.0 or 2.5 mg/kg daily from GD 18 to postnatal day (PND) 21. Methylcellulose #400 dissolved at a concentration of 0.5% (w/ v) in water for injection (Fuso Pharmaceutical Industries, Inc., Osaka, Japan) was used as the vehicle. The day of birth was
285
designated PND 0 and litters were culled to eight pups on PND 4. Pups were weaned on PND 28 (because preliminary studies indicated that pups treated with high doses of PTU were not ready to feed on their own), and male pups were then housed two per cage until the end of the experiment. The animals were maintained in a barrier-system animal room throughout the study. The air was changed 10 times or more per hour with a ventilation system, and a 12-hour lighting cycle (8:00–20:00 lights on) was in operation. The temperature and relative humidity in the room were maintained at 24 2 8C and 55 15%, respectively. Animals were housed in suspended aluminum cages with stainless steel wire-mesh fronts and floors (W224 mm D419 mm H 200 mm, Yamato Scientific Co., Ltd., Tokyo, Japan). Trays with nesting material (Alfa dry1, Shepherd Specialty Papers Inc., Boston, USA) were put in place during lactation period. Drinking water and food (CRF-1, Oriental Yeast Co., Ltd., Tokyo, Japan) were available ad libitum. 2.2. TaqMan quantitative RT-PCR assays Six male pups (1 per litter) per group were killed by decapitation on PNDs 4, 14 and 22 and at the age of 9 weeks. The brains were immediately removed and each cerebellum was dissected out on ice according to the method of Glowinski and Iversen (1966). The brain tissues were frozen in liquid nitrogen and stored at 80 8C until the day of assay. Total RNA was extracted from the whole cerebellum using ISOGEN (Nippon Gene, Tokyo, Japan) according to the manufacture’s protocol and an aliquot (200 ng) was used for reverse transcription, performed with a TaqMan Reverse Transcription kit (Applied Biosystems, Chiba, Japan). For NR2A/NR2B, GAP-43, BDNF, L1, NCAM, synaptophysin, PSD-95 and G3PDH, the primers and the TaqMan probes for each gene (detailed in Table 1) were employed in separate tubes. RT-PCR was carried out with the ABI 5700 Sequence Detection System (Applied Biosystems, Chiba, Japan) using the following thermal cycling parameters: 50 8C for 2 min and 95 8C for 10 min, followed by 40 two step cycles of 95 8C for 15 s and 60 8C for 1 min. Relative mRNA volumes were calculated using data for G3PDH as an internal control. In the control group, all genes were quantified on PNDs 4, 14, 22 and at the age of 9 weeks. In the PTU treated groups, NR2A, NR2B and
Table 1 Primer and prove sets used in the RT-PCR
NR2A NR2B GAP-43 BDNF L1 NCAM Synaptophysin PSD-95 G3PDH
Forward primer
Reverse primer
TaqMan prove
CCAAGGCTAGCATGGTTTTACAT GGAGACATCCGATCGAATCAA ACGGAAGCTAGCCTGAAT TTTG GGTGATGCTCAGCAGTCA AGTG TGCTCTCTTACCATCCCTTGGA AGCCATGGAACTAGAGGAGCAA TGTGCCAACAAGACGGAGAGT AAGTTCCGCTCCAGA AACGA GCTGCCTTCTCTTGTGACAAAGT
GAAGGCTTTTGATTTGAGGAGGTT AGCGACCTGTATGGCAAGTTCT GCTGTGCTGTATGAGAAGAACCA TGCGGCATCCAGGTAATTTT GCTGGAAGCGGTACTGTAGATCA TCGAGTCCACGATGCCTTTT GAGTAGTCCCCAACCAGGAAGA CTCCAGTTCGCTGAACACAGACT CTCAGCCTTGACTGTGCCATT
TGTCCCTCAAAGTCAGGAAACTCTTAG TGGCCACTGTAGCGGTCACTCTTGAA CCTCCGGTTTGACACCATCTTGTTCAATC CTTTGGAGCCTCCTCTGCTCTTTCTGCT AGCTCCGGACTCATAATCTCACCAACCTCA AGAACGTCCACCCGAAACATCAGCAGT TGTACTTTGATGCACCCTCCTGCGTCA CATGCGAGCTATGAGCACCATAAGCCA TGTTCCAGTATGATTCTACCCACGGCAAG
286
K. Kobayashi et al. / NeuroToxicology 27 (2006) 284–290
BDNF were quantified on PNDs 4, 14, 22 and at the age of 9 weeks, and the other genes on PND 22. 2.3. Statistical analysis Data are expressed as mean S.D.s. Statistical analysis was performed with the Dunnett’s test. P-values <0.05 were considered statistically significant. 3. Results 3.1. Developmental profile of cerebellar gene expression in vehicle-dosed animals Before examining the effects of PTU, we first examined the developmental profiles of expression of the targeted genes in the vehicle-dosed rats, categorized into the following three types (Fig. 1). (1) The first group, exemplified by BDNF, PSD95, and NR2A, showed gradual monotonic increase in expression as developmental proceeded. Expression of BDNF and PSD-95 mRNA was low on PND 4 and 14, then gradually increased to the adult level. NR2A mRNA was barely detected on PND 4, and then the expression level increased gradually until reaching the adult level on PND 22. (2) The second group, L1, NCAM, and NR2B, showed gradual monotonic decrease in
expression with development. L1 and NCAM mRNAs were expressed at their highest levels on PND 4, with rapid decrease until PND 14, then further decrease into adulthood. Expression of NR2B mRNA was high on PND 4, then decreased gradually until reaching the level of adulthood on PND 22. (3) The third group, constituted by GAP-43 and synaptophysin, showed a transient peak of expression around PND 14, and a gradual decrease thereafter. 3.2. Effects of perinatal exposure to PTU on cerebellar gene expression To examine the effects of PTU, pregnant rats were exposed to PTU from E18 to PND 21 by daily oral administration at 0.4, 1.0, or 2.5 mg/kg. Hypothyroidism was confirmed by measuring thyroid hormone levels (T3, T4) and body weights in our previous study (Kobayashi et al., 2005). Reduced thyroid hormones (T3, T4) were observed at 1.0 and 2.5 mg/kg on PND 22, and retarded pups body weights were also observed at 1.0 and 2.5 mg/kg on PND 22, which persisted into adulthood. In addition, obvious behavioral changes as reported in hypothyroidism were observed at doses of 1.0 and 2.5 mg/kg (Kobayashi et al., 2005). Among the genes tested in this study, three, namely BDNF, NR2A, and NR2B, showed altered expression in PTU-treated rats on PND 22 (Fig. 2). Expression of NR2A
Fig. 1. Developmental mRNA expression of the selected genes in the cerebellum of vehicle-dosed rat pups. Total RNA was extracted from the rat cerebellum on PNDs 4, 14 and 22 and at the age of 9 weeks, and quantified by RT-PCR. Data are mean S.D.s (n = 6), normalized to the level of G3PDH mRNA.
K. Kobayashi et al. / NeuroToxicology 27 (2006) 284–290
287
Fig. 2. Effects of perinatal exposure to PTU on expression of the selected genes in the cerebellum on PND 22. PTU was administered to dams from gestation day 18th to postpartum day 21st at doses of 0.4, 1.0 and 2.5 mg/kg. NR2B mRNA was increased by PTU, whereas NR2A and BDNF mRNAs were decreased. Expression of other genes was not different from the control case. Data are mean S.D.s (n = 6). (*, **): Significantly different from the control at p < 0.05, 0.01, respectively.
and BDNF was decreased in PTU-treated rats at doses of 1.0 and 2.5 mg/kg. In contrast, expression of NR2B was significantly increased. Expression of the other five genes (GAP-43, L1, NCAM, synaptophysin and PSD-95) in PTUtreated rats did not significantly differ from the control case at any of the doses of PTU tested (Fig. 3). 3.3. Effects of perinatal exposure to PTU on development of NMDA receptors and BDNF To determine the effects of PTU on the developmental profile of NMDA receptors and BDNF, expression was examined on PNDs 4, 14 and 22 and at the age of 9 weeks (Fig. 3). Regarding NMDA receptors, there were no differences in subunit expression between PTU-treated and control groups on PND 4, but we found PTU upregulated NR2B mRNA expression while downregulating NR2A mRNA on PNDs 14 and 22 in comparison with controls. The changes on PND 14 were most prevalent and recovery was evident at the age of 9 weeks. Expression of BDNF mRNA was also affected by PTU on PNDs 14 and 22, with recovery by week 9.
4. Discussion In our previous investigation, we showed that perinatal exposure to PTU at doses which causing behavioral changes in adulthood altered the expression levels of GAP-43 and M1 in the cerebral cortex and the hippocampus, respectively (Kobayashi et al., 2005). In the present study, we found that PTU increased the expression of NR2B, while decreasing that of NR2A and BDNF in the cerebellum during development. The expression changes might be specific to the cerebellum, since that of NR2B and BDNF mRNAs was not observed in the cerebral cortex and the hippocampus (Kobayashi et al., 2005). Altered expression of NMDA receptor subunits in the cerebellum seemed to result from a delay in developmental switching from NR2B to NR2A. The thyroid hormone levels, decrease during perinatal exposure to PTU, but return to normal by adulthood in our previous study (Kobayashi et al., 2005). We found here that the expression levels of NR2A, NR2B, and BDNF were altered during the exposure to PTU, but returned to the normal levels by 9 weeks of age. Therefore, the expression levels of NR2A, NR2B, and BDNF may correlate with the levels of thyroid hormones.
288
K. Kobayashi et al. / NeuroToxicology 27 (2006) 284–290
Fig. 3. Developmental effects of perinatal exposure to PTU on NR2A, NR2B and BDNF mRNA expression. In the control group, NR2A and NR2B mRNAs were developmentally regulated. NR2A expression was low on PND 4 and substantially increased at later stages, whereas NR2B expression was high on PND 4 and gradually decreased. PTU repressed the developmental up-regulation of NR2A expression and down-regulation of NR2B from PND 14 to PND 22 (a, b). Expression of BDNF mRNA was decreased by PTU on PND 14 and 22, but had recovered by adulthood (c). Data are mean S.D.s (n = 6). (*, **) Significantly different from the control at p < 0.05, 0.01, respectively.
Since consensus binding sites for thyroid hormone receptors have not been identified in the promoter regions of the encoding genes so far, direct regulation by thyroid hormones may not be involved. However, the BDNF promoter contains a binding site for estrogen receptors (Sohrabji et al., 1995), expression of which can be directly regulated by thyroid hormones (Fujimoto et al., 2004). Furthermore, NR2A promoter regions contain binding sites for the Sp1 transcription factor (Liu et al., 2003), which is also potentially regulated by estrogen receptors (Schultz et al., 2005). Therefore, thyroid hormone levels might indirectly regulate BDNF and NR2A. In addition, it has reported that BDNF enhances NMDA receptor maturation (Small et al., 1998), so that changes NMDA receptor subunit composition brought about by PTU might be due to its effects on BDNF. Although thyroid hormone levels might indirectly modulate gene expression changes, further studies are needed to ascertain this possibility. We found that BDNF mRNA was decreased on PNDs 14 and 22, consistent with the report of Koibuchi et al. (2001). BDNF is known to have many cellular functions; it navigates growth cones during axon guidance and regulates neurite growth, neuronal survival, and synaptic plasticity (Wozniak, 1993; Lu and Chow, 1999; Binder and Scharfman, 2004). Decreased levels of BDNF might interfere with all these processes of neural development, and cause substantial defects such as immature Purkinje cells with reduced dendritic arborization or immature granule cells, as reported in hypothyroid rats. The observed changes in the levels of NR2A and NR2B were limited to PNDs 14–21. During this period, two types of developmental events in the cerebellum could be potentially affected by altered expression of NMDA receptor subunits:
granule cell migration from the external granular layer (EGL) into the internal granular layer (IGL) and synapse formation between mossy fibers and granule cell dendrites. Granule cell migration starts from the early postnatal period (PND 3), and finishes by PND 21 (Altman, 1972), granule cells starting to express NMDA receptors during this period (Farrant et al., 1994). The developmental switching from NR2B to NR2A subunits, results in acceleration of NMDAR mediated EPSCs (excitatory postsynaptic currents) (Feldmeyer and Cull-Candy, 1996; Takahashi et al., 1996). Thus, the delayed switching of NMDAR subunits caused by PTU could change the intracellular concentration of Ca2+ and impair granule cell migration (Komuro and Rakic, 1993). In fact, perinatal hypothyroidism is known to cause delayed migration of granule cells. Synapses formed between mossy fibers and granule cell dendrites are glutamatergic, and are reported to feature NMDA receptor dependent LTP (long-term potentiation) (Sola et al., 2004). In other systems, LTP was shown to stabilize the synapses where it occurs, while weakening other synapses. In addition, induction of LTP has been suggested to result in the growth of dendritic filopodia and new spine formation (Nikonenko et al., 2003). Therefore, NMDAR-dependent LTP could play a role in stabilizing and pruning synapses to build up functional circuits. Different NMDA receptor subunits might have different consequences for synaptic strength. For example, NR2A and NR2B appear to have different effects regarding induction of LTP (Massey et al., 2004; Liu et al., 2004). Therefore, the delayed switching of NMDA receptor subunits from NR2B to NR2A might impair the appropriate formation of functional circuits between mossy fiber and
K. Kobayashi et al. / NeuroToxicology 27 (2006) 284–290
granule cell dendrites. In turn, this might change the overall level of neural activity in the cerebellum and sequentially affect activity-dependent process such as dendritic arborization or synapse formation by other neurons. Major symptoms in hypothyroidism are not limited to the above-mentioned morphological changes, but also include altered functions of neural circuits that result in various neurobehavioral deficits, including reduced motor coordination (Sankar et al., 1994; Bargagna et al., 2000). Several lines of evidence suggest roles NMDA receptors in establishment of motor coordination. For example, an abnormal proportion of NMDA receptor subunits during cerebellar development is reported to cause loss of granule cells and subsequent motor impairment in adult animals (Schlett et al., 2004). NMDA receptor blockade during the critical period (PNDs 15–16) causes clear detrimental effects (Kakizawa et al., 2000). Therefore, precise regulation of the timing of NMDA receptor subunit switching during cerebellar development is important for the proper acquisition of behavior mediated by cerebellar function. However, further studies are needed to clarify the causal relationship between PTU-induced delay of NMDA receptor developments and morphological or functional effects, such as impairment of granule cell migration, activity-dependent neuronal network formation or motor coordination. Investigation of the critical window of PTU on brain development is also helpful to understand thyroid effects on brain development. In the present study, we demonstrated change in the NMDA receptor subunit composition to be one of most sensitive effects in PTU-treated rats, many other genes not being affected. Alcohol, which is a developmental neurotoxicant, is also reported to cause alteration in the NMDA receptor subunit composition during development and subsequent behavioral abnormalities (Snell et al., 2001). In conclusion, PTU can delay switching from NR2B to NR2A subunits and decrease BDNF mRNA expression in the cerebellum during development. This may prevent proper development of the cytoarchitecture, neural circuits and neurobehavior. Acknowledgements We wish to express our appreciation to Ms. Haruyo Akune for expert technical assistance. We also thank all members of the Environmental Health Science Laboratory of Sumitomo Chemical Co., Ltd. for their invaluable support. References Altman J. Morphological development of the rat cerebellum and some of its mechanisms. Exp Brain Res 1982;6:8–49. Altman J. Postnatal development of the cerebellar cortex in the rat. II. Phase in the maturation of Purkinje cells and of the molecular layer. J Comp Neurol 1972;145:399–464. Balazs R, Brooksbandk BWL. Patel AJ, Johnson AL, Wilson DA. Incorporation of 35S sulfate into brain constituents during development and the effects of thyroid hormone on myelination.. Brain Res 1971;30:273–93. Bargagna S, Canepa G, Costagli C, Dinetti D, Marcheschi M, Millepiedi S, Montanelli L, Pinchera A, Chiovato L. Neuropsychological follow-up in
289
early-treated congenital hypothyroidism: a problem-oriented approach. Thyroid 2000;10:243–9. Barradas PC, Vieira RS, De Freitas MS. Selective effect of hypothyroidism on expression of myelin markers during development. J Neurosci Res 2001;66: 254–61. Binder DK, Scharfman HE. Brain-derived neurotrophic factor. Growth Factors 2004;22:123–31. Farrant M, Feldmeyer D, Takahashi T, Cull-Candy SG. NMDA receptor channel diversity in the developing cerebellum. Nature 1994;368:335–9. Feldmeyer D, Cull-Candy S. Functional consequences of changes in NMDA receptor subunit expression during development. J Neurocytol 1996;25: 857–67. Fujimoto N, Jinno N, Kitamura S. Activation of estrogen response element dependent transcription by thyroid hormone with increase in estrogen receptor levels in a rat pituitary cell line. J Endcrinol 2004;181:77–83. Goldey ES, Kehn LS, Rehnberg GL, Crofton KM. Effects of developmental hypothyroidism on auditory and motor function in the rat. Toxicol Appl Pharmacol 1995;135:67–76. Glowinski J, Iversen LL. Regional studies of catecholamines in the rat brain-I. The disposition of 3H-norepinephrin, 3H-dopamine and 3H-dopa in various regions of the brain. J Neurochem 1966;13:655–69. Hajos F, Patel AJ, Balazs R. Effect of thyroid deficiency on the synaptic organization of the rat cerebellar cortex. Brain Res 1973;50:387–401. Kakizawa S, Yamasaki M, Watanabe M, Kano M. Critical period for activitydependent synapse elimination in developing cerebellum. J Neurosci 2000; 20:4954–61. Kobayashi K, Tsuji R, Yoshioka T, Kushida M, Yabushita S, Sasaki M, Mino T, Seki T. Effects of hypothyroidism induced by perinatal exposure to PTU on rat behavior and synaptic gene expression. Toxicology 2005;212:135–47. Koibuchi N, Yamaoka S, Chin WW. Effect of altered thyroid status on neurotrophin gene expression during postnatal development of the mouse cerebellum. Thyroid 2001;11(3):205–10. Komuro H, Rakic P. Modulation of neuronal migration by NMDA receptors. Science 1993;260:95–7. Li GH, Post J, Koibuchi N, Sajdel-Sulkowska EM. Impact of thyroid hormone deficiency on the developing CNS: cerebellar glial and neuronal protein expression in rat neonates exposed to antithyroid drug propylthiouracil. Cerebellum 2004;3(2):100–6. Liu A, Zhuang Z, Hoffman PW, Bai Guang. Functional analysis of the rat N-Methyl-D-aspartate receptor 2A promoter. J Biol Chem 2003;278: 26423–34. Liu X, Murray K, Jones E. Switching of NMDA receptor 2A and 2B subunits at thalamic and cortical synapses during early postnatal development. J Neurosci 2004;24:8885–95. Lu B, Chow A. Neurotrophins and hippocampal synaptic transmission and plasticity. J Neurosci Res 1999;58:76–87. Massey PV, Johnson BE, Moult PR, Auberson YP, Brown MW, Molnar E, Collingridge GL, Bashir ZI. Differential roles of NR2A and NR2B-containing NMDA receptors in cortical long-term potentiation and long-term depression. J Neurosci 2004;24:7821–8. Nicholson JL, Altman J. The effects of early hypo- and hyperthyroidism on the development of the rat cerebellar cortex. II. Synaptogenesis in the molecular layer. Brain Res 1972a;44:25–36. Nicholson JL, Altman J. Synaptogenesis in the rat cerebellum: effects of early hypo- and hyperthyroidism. Science 1972b;176:530–2. Nicholson JL, Altman J. The effects of early hypo- and hyperthyroidism on development of rat cerebellar cortex. I. Cell proliferation and differentiation. Brain Res 1972c;44:13–23. Nikonenko I, Jourdain P, Muller D. Presynaptic remodeling contributes to activity-dependent synaptogensesis. J Neurosci 2003;23:8498–505. Sankar R, Rai B, Pulger T, Sankar G, Srinivasan T, Srinivasan L, Pandav CS. Intellectual and motor functions in school children from severely iodine deficient region in Sikkim. Indian J Pediatr 1994;61:231–6. Schalock RL, Brown WJ, Smith RL. Long- term effects of propylthiouracilinduced neonatal hypothyroidism. Developmental Psychobiol 1979;12(3): 187–99. Schlett K, Pieri I, Metzger F, Marchetti L, Steigerwald F, Dere E, Kirilly D, Tarnok K, Barabas B, Varga A, Gerspach J, Huston J, Pfizenmaier K, Kohr
290
K. Kobayashi et al. / NeuroToxicology 27 (2006) 284–290
G, Eisel U. Long-term NR2B expression in the cerebellum alters granule cell development and leads to NR2A down-regulation and motor deficits. Mol Cell Neurosci 2004;27:215–26. Schultz JR, Petz LN, Nardulli AM. Cell-and ligand- specific regulation of promoters containing activator protein-1 and SP1 sites by estrogen receptors alpha and beta. J Biol Chem 2005;280:347–54. Small DL, Murray CL, Mealing GAR. Poulter MO, Buchan AM, Morley P. Brain derived neurotrophic factor induction of N-methyl-D-aspartate receptor subunit NR2A expression in cultured rat cortical neurons. Neurosci Lett 1998;252:211–4. Snell LD, Bhave SV, Tabakoff B, Hoffman PL. Chronic ethanol exposure delays the ‘ developmental switch’ of the NMDA receptor 2A and 2B subunits in cultured cerebellar granule neurons. J Neurochem 2001;78:396–405. Sohrabji F, Miranda RCG. Toran-Allerand CD. Identification of a putative estrogen response element in the gene encoding brain-derived neurotrophic factor. Proc Natl Acad Sci USA 1995;92:11110–4.
Sola E, Prestori F, Rossi P, Taglietti V, D’Angelo E. Increased neurotransmitter release during long-term potentiation at mossy fibre-granule cell synapses in rat cerebellum. J Physiol 2004;557:843–61. Singh R, Upadhyay G, Kumar S, Kapoor A, Kumar A, Tiwari M, Godbole MM. Hypothyroidism alters the expression of Bcl-2 family genes to induce enhanced apoptosis in the developing cerebellum. J Endocrinol 2003; 176:39–46. Takahashi T, Feldmeyer D, Suzuki N, Onodera K, Cull-Candy SG, Sakimura K, Mishina M. Functional correlation of NMDA receptor e subunits expression with the properties of single-channel and synaptic currents in the developing cerebellum. J Neurosci 1996;16:4376–82. Wozniak W. Brain-derived neurotrophic factor (BDNF): role in neuronal development and survival. Folia Morpho (Warsz) 1993;52:173–81. Zoeller RT, Dowling ALS. Herzig CTA. Iannacone EA, Gauger KJ, Bansal R. Thyroid hormone, brain development, and the environment. Env Hlth Perspect 2002;110(3):355–61.
Perinatal exposure to PTU delays switching from NR2B to NR2A subunits of the NMDA receptor in the rat cerebellum Kumiko Kobayashi *, Ryozo Tsuji, Takafumi Yoshioka, Terumasa Mino, Takaki Seki Environmental Health Science Laboratory, Sumitomo Chemical Co., Ltd., Osaka, Japan Received 27 September 2005; accepted 21 November 2005 Available online 4 January 2006
Abstract Certain kinds of developmental neurotoxicants are considered to act by affecting the levels of thyroid hormones, which are essential for the brain development of both humans and experimental animals. Hypothyroidism experimentally induced in rats with propylthiouracil (PTU) offers a useful animal model for developmental neurotoxicity. The purpose of the present study was to clarify developmental alterations in gene expression caused by PTU in this model, with the focus on eight genes implicated in neural network formation or synaptic functions, such as the brain-derived neurotrophic factor (BDNF) and NMDA receptors 2A/2B. First, we measured the developmental profile of gene expression in vehicle-dosed rat cerebellum by quantitative RT-PCR and then examined the effects of PTU on mRNA levels on postnatal day (PND) 22, when most of the cerebellar structures in mature animals are already formed. PTU induced up-regulation of NR2B mRNA and down-regulation of NR2A and BDNF mRNAs in the cerebellum on PND 22, but there were no changes in the other genes (growth associated protein-43, L1, neuronal cell adhesion molecule, synaptophysin, post synaptic density-95). Examination of the effects of PTU on maturation of NMDAR subunits (NR2A/NR2B) demonstrated changes in relative expression on PND 14, but not on PND 4, with recovery after maturation. The profile of NMDAR subunits in vehicle-dosed rats showed a shift from NR2B to NR2A during development. These results suggest PTU can delay this switching from NR2B to NR2A subunits in the maturation of NMDA receptors. # 2005 Elsevier Inc. All rights reserved. Keywords: PTU; Hypothyroidism; Development; NMDA receptors
1. Introduction Social concerns are increasing for the effects of chemical substances in the environment on the nervous system of children, since the developing brain is vulnerable, and prone to impairment. Agents affecting thyroid hormone levels are especially hazardous, since thyroid hormones are essential for brain development (Zoeller et al., 2002). In a series of studies of hypothyroid rats treated with PTU, in the perinatal period, behavioral abnormalities of offspring were observed that persisted into adulthood (Schalock et al., 1979; Goldey et al., 1995). In our previous work, it was shown that E-maze learning
* Corresponding author. Tel.: +81 6 6466 5335; fax: +81 6 6466 5443. E-mail address: [email protected] (K. Kobayashi). 0161-813X/$ – see front matter # 2005 Elsevier Inc. All rights reserved. doi:10.1016/j.neuro.2005.11.008
deficiency, hyperactivity and altered auditory startle responses, were accompanied by alterations in gene expression in the hippocampus and cerebral cortex during the period of neural network formation (Kobayashi et al., 2005). In the present study, we focused on the effects of PTU on gene expression in the cerebellum. Since the cerebellum develops postnatally (Altman, 1982), it is a good model system to study the mechanism of developmental neurotoxicity caused by perinatal exposure to PTU. Its relatively simple circuitry facilitates histological identification of neuronal types, and there have been numerous studies of effect of hypothyroidism on neurological structure in the cerebellum. Thus, reduction of dendritic arborization of Purkinje cellsand their synaptogenesis with granule cell axons, delayed proliferation and migration of granule cells, delayed myelination, and changes in synaptic connection between
K. Kobayashi et al. / NeuroToxicology 27 (2006) 284–290
cerebellar neurons and afferent neuronal fibers have all been documented (Balazs et al., 1971; Nicholson and Altman, 1972a,b,c; Hajos et al., 1973). The influence of hypothyroidism on cerebellar gene expression has aleady been assessed for several genes, including myelin basic protein (MBP), proteolipidic protein (PLP), myelin-associated/oligodendrocytic basic protein (MOBP), 3-fucosyl-N-acetyl-lactosamine antigen (CD15), glial fibrillary acidic protein (GFAP), apoptotic genes Bcl-2, Bcl-XL, and Bax and neurotrophic factors such as brain-derived neurotrophic factor (BDNF), and neurotrophin (NT)-3 (Barradas et al., 2001; Koibuchi et al., 2001; Singh et al., 2003; Li et al., 2004). Altered expression of genes responsible for neural network formation including some of the examples listed above, is suspected to prevent accurate neuronal network formation and result in behavioral deficits after maturation. In the present study, we investigated the effects of PTU on the expression of gene implicated in neuronal growth and synaptic function; NMDA receptor subunits (NR2A and NR2B), PSD95, synaptophysin, L1, NCAM, BDNF, and GAP-43. As a result, we found that the perinatal exposure to PTU caused increase of NR2B mRNA expression and decrease of NR2A and BDNF mRNA expression on postnatal days (PNDs) 14 and 22, pointing to a delay in switching from NR2B to NR2A during development. Our results suggest that this delayed switching is involved in the developmental neurotoxicity of PTU. 2. Methods 2.1. Animals All experiments were performed in accordance with the Guide for Animal Care and Use of Sumitomo Chemical Co., Ltd. Pregnant SD (CD)IGS rats were purchased from Charles River Japan, Inc. (Shiga, Japan) on gestation day 8–10; the breeding day was GD 0. Eleven pregnant rats per group were assigned based upon body weights on GD 17 and orally given vehicle (controls) or propylthiouracil (PTU) at 0.4, 1.0 or 2.5 mg/kg daily from GD 18 to postnatal day (PND) 21. Methylcellulose #400 dissolved at a concentration of 0.5% (w/ v) in water for injection (Fuso Pharmaceutical Industries, Inc., Osaka, Japan) was used as the vehicle. The day of birth was
285
designated PND 0 and litters were culled to eight pups on PND 4. Pups were weaned on PND 28 (because preliminary studies indicated that pups treated with high doses of PTU were not ready to feed on their own), and male pups were then housed two per cage until the end of the experiment. The animals were maintained in a barrier-system animal room throughout the study. The air was changed 10 times or more per hour with a ventilation system, and a 12-hour lighting cycle (8:00–20:00 lights on) was in operation. The temperature and relative humidity in the room were maintained at 24 2 8C and 55 15%, respectively. Animals were housed in suspended aluminum cages with stainless steel wire-mesh fronts and floors (W224 mm D419 mm H 200 mm, Yamato Scientific Co., Ltd., Tokyo, Japan). Trays with nesting material (Alfa dry1, Shepherd Specialty Papers Inc., Boston, USA) were put in place during lactation period. Drinking water and food (CRF-1, Oriental Yeast Co., Ltd., Tokyo, Japan) were available ad libitum. 2.2. TaqMan quantitative RT-PCR assays Six male pups (1 per litter) per group were killed by decapitation on PNDs 4, 14 and 22 and at the age of 9 weeks. The brains were immediately removed and each cerebellum was dissected out on ice according to the method of Glowinski and Iversen (1966). The brain tissues were frozen in liquid nitrogen and stored at 80 8C until the day of assay. Total RNA was extracted from the whole cerebellum using ISOGEN (Nippon Gene, Tokyo, Japan) according to the manufacture’s protocol and an aliquot (200 ng) was used for reverse transcription, performed with a TaqMan Reverse Transcription kit (Applied Biosystems, Chiba, Japan). For NR2A/NR2B, GAP-43, BDNF, L1, NCAM, synaptophysin, PSD-95 and G3PDH, the primers and the TaqMan probes for each gene (detailed in Table 1) were employed in separate tubes. RT-PCR was carried out with the ABI 5700 Sequence Detection System (Applied Biosystems, Chiba, Japan) using the following thermal cycling parameters: 50 8C for 2 min and 95 8C for 10 min, followed by 40 two step cycles of 95 8C for 15 s and 60 8C for 1 min. Relative mRNA volumes were calculated using data for G3PDH as an internal control. In the control group, all genes were quantified on PNDs 4, 14, 22 and at the age of 9 weeks. In the PTU treated groups, NR2A, NR2B and
Table 1 Primer and prove sets used in the RT-PCR
NR2A NR2B GAP-43 BDNF L1 NCAM Synaptophysin PSD-95 G3PDH
Forward primer
Reverse primer
TaqMan prove
CCAAGGCTAGCATGGTTTTACAT GGAGACATCCGATCGAATCAA ACGGAAGCTAGCCTGAAT TTTG GGTGATGCTCAGCAGTCA AGTG TGCTCTCTTACCATCCCTTGGA AGCCATGGAACTAGAGGAGCAA TGTGCCAACAAGACGGAGAGT AAGTTCCGCTCCAGA AACGA GCTGCCTTCTCTTGTGACAAAGT
GAAGGCTTTTGATTTGAGGAGGTT AGCGACCTGTATGGCAAGTTCT GCTGTGCTGTATGAGAAGAACCA TGCGGCATCCAGGTAATTTT GCTGGAAGCGGTACTGTAGATCA TCGAGTCCACGATGCCTTTT GAGTAGTCCCCAACCAGGAAGA CTCCAGTTCGCTGAACACAGACT CTCAGCCTTGACTGTGCCATT
TGTCCCTCAAAGTCAGGAAACTCTTAG TGGCCACTGTAGCGGTCACTCTTGAA CCTCCGGTTTGACACCATCTTGTTCAATC CTTTGGAGCCTCCTCTGCTCTTTCTGCT AGCTCCGGACTCATAATCTCACCAACCTCA AGAACGTCCACCCGAAACATCAGCAGT TGTACTTTGATGCACCCTCCTGCGTCA CATGCGAGCTATGAGCACCATAAGCCA TGTTCCAGTATGATTCTACCCACGGCAAG
286
K. Kobayashi et al. / NeuroToxicology 27 (2006) 284–290
BDNF were quantified on PNDs 4, 14, 22 and at the age of 9 weeks, and the other genes on PND 22. 2.3. Statistical analysis Data are expressed as mean S.D.s. Statistical analysis was performed with the Dunnett’s test. P-values <0.05 were considered statistically significant. 3. Results 3.1. Developmental profile of cerebellar gene expression in vehicle-dosed animals Before examining the effects of PTU, we first examined the developmental profiles of expression of the targeted genes in the vehicle-dosed rats, categorized into the following three types (Fig. 1). (1) The first group, exemplified by BDNF, PSD95, and NR2A, showed gradual monotonic increase in expression as developmental proceeded. Expression of BDNF and PSD-95 mRNA was low on PND 4 and 14, then gradually increased to the adult level. NR2A mRNA was barely detected on PND 4, and then the expression level increased gradually until reaching the adult level on PND 22. (2) The second group, L1, NCAM, and NR2B, showed gradual monotonic decrease in
expression with development. L1 and NCAM mRNAs were expressed at their highest levels on PND 4, with rapid decrease until PND 14, then further decrease into adulthood. Expression of NR2B mRNA was high on PND 4, then decreased gradually until reaching the level of adulthood on PND 22. (3) The third group, constituted by GAP-43 and synaptophysin, showed a transient peak of expression around PND 14, and a gradual decrease thereafter. 3.2. Effects of perinatal exposure to PTU on cerebellar gene expression To examine the effects of PTU, pregnant rats were exposed to PTU from E18 to PND 21 by daily oral administration at 0.4, 1.0, or 2.5 mg/kg. Hypothyroidism was confirmed by measuring thyroid hormone levels (T3, T4) and body weights in our previous study (Kobayashi et al., 2005). Reduced thyroid hormones (T3, T4) were observed at 1.0 and 2.5 mg/kg on PND 22, and retarded pups body weights were also observed at 1.0 and 2.5 mg/kg on PND 22, which persisted into adulthood. In addition, obvious behavioral changes as reported in hypothyroidism were observed at doses of 1.0 and 2.5 mg/kg (Kobayashi et al., 2005). Among the genes tested in this study, three, namely BDNF, NR2A, and NR2B, showed altered expression in PTU-treated rats on PND 22 (Fig. 2). Expression of NR2A
Fig. 1. Developmental mRNA expression of the selected genes in the cerebellum of vehicle-dosed rat pups. Total RNA was extracted from the rat cerebellum on PNDs 4, 14 and 22 and at the age of 9 weeks, and quantified by RT-PCR. Data are mean S.D.s (n = 6), normalized to the level of G3PDH mRNA.
K. Kobayashi et al. / NeuroToxicology 27 (2006) 284–290
287
Fig. 2. Effects of perinatal exposure to PTU on expression of the selected genes in the cerebellum on PND 22. PTU was administered to dams from gestation day 18th to postpartum day 21st at doses of 0.4, 1.0 and 2.5 mg/kg. NR2B mRNA was increased by PTU, whereas NR2A and BDNF mRNAs were decreased. Expression of other genes was not different from the control case. Data are mean S.D.s (n = 6). (*, **): Significantly different from the control at p < 0.05, 0.01, respectively.
and BDNF was decreased in PTU-treated rats at doses of 1.0 and 2.5 mg/kg. In contrast, expression of NR2B was significantly increased. Expression of the other five genes (GAP-43, L1, NCAM, synaptophysin and PSD-95) in PTUtreated rats did not significantly differ from the control case at any of the doses of PTU tested (Fig. 3). 3.3. Effects of perinatal exposure to PTU on development of NMDA receptors and BDNF To determine the effects of PTU on the developmental profile of NMDA receptors and BDNF, expression was examined on PNDs 4, 14 and 22 and at the age of 9 weeks (Fig. 3). Regarding NMDA receptors, there were no differences in subunit expression between PTU-treated and control groups on PND 4, but we found PTU upregulated NR2B mRNA expression while downregulating NR2A mRNA on PNDs 14 and 22 in comparison with controls. The changes on PND 14 were most prevalent and recovery was evident at the age of 9 weeks. Expression of BDNF mRNA was also affected by PTU on PNDs 14 and 22, with recovery by week 9.
4. Discussion In our previous investigation, we showed that perinatal exposure to PTU at doses which causing behavioral changes in adulthood altered the expression levels of GAP-43 and M1 in the cerebral cortex and the hippocampus, respectively (Kobayashi et al., 2005). In the present study, we found that PTU increased the expression of NR2B, while decreasing that of NR2A and BDNF in the cerebellum during development. The expression changes might be specific to the cerebellum, since that of NR2B and BDNF mRNAs was not observed in the cerebral cortex and the hippocampus (Kobayashi et al., 2005). Altered expression of NMDA receptor subunits in the cerebellum seemed to result from a delay in developmental switching from NR2B to NR2A. The thyroid hormone levels, decrease during perinatal exposure to PTU, but return to normal by adulthood in our previous study (Kobayashi et al., 2005). We found here that the expression levels of NR2A, NR2B, and BDNF were altered during the exposure to PTU, but returned to the normal levels by 9 weeks of age. Therefore, the expression levels of NR2A, NR2B, and BDNF may correlate with the levels of thyroid hormones.
288
K. Kobayashi et al. / NeuroToxicology 27 (2006) 284–290
Fig. 3. Developmental effects of perinatal exposure to PTU on NR2A, NR2B and BDNF mRNA expression. In the control group, NR2A and NR2B mRNAs were developmentally regulated. NR2A expression was low on PND 4 and substantially increased at later stages, whereas NR2B expression was high on PND 4 and gradually decreased. PTU repressed the developmental up-regulation of NR2A expression and down-regulation of NR2B from PND 14 to PND 22 (a, b). Expression of BDNF mRNA was decreased by PTU on PND 14 and 22, but had recovered by adulthood (c). Data are mean S.D.s (n = 6). (*, **) Significantly different from the control at p < 0.05, 0.01, respectively.
Since consensus binding sites for thyroid hormone receptors have not been identified in the promoter regions of the encoding genes so far, direct regulation by thyroid hormones may not be involved. However, the BDNF promoter contains a binding site for estrogen receptors (Sohrabji et al., 1995), expression of which can be directly regulated by thyroid hormones (Fujimoto et al., 2004). Furthermore, NR2A promoter regions contain binding sites for the Sp1 transcription factor (Liu et al., 2003), which is also potentially regulated by estrogen receptors (Schultz et al., 2005). Therefore, thyroid hormone levels might indirectly regulate BDNF and NR2A. In addition, it has reported that BDNF enhances NMDA receptor maturation (Small et al., 1998), so that changes NMDA receptor subunit composition brought about by PTU might be due to its effects on BDNF. Although thyroid hormone levels might indirectly modulate gene expression changes, further studies are needed to ascertain this possibility. We found that BDNF mRNA was decreased on PNDs 14 and 22, consistent with the report of Koibuchi et al. (2001). BDNF is known to have many cellular functions; it navigates growth cones during axon guidance and regulates neurite growth, neuronal survival, and synaptic plasticity (Wozniak, 1993; Lu and Chow, 1999; Binder and Scharfman, 2004). Decreased levels of BDNF might interfere with all these processes of neural development, and cause substantial defects such as immature Purkinje cells with reduced dendritic arborization or immature granule cells, as reported in hypothyroid rats. The observed changes in the levels of NR2A and NR2B were limited to PNDs 14–21. During this period, two types of developmental events in the cerebellum could be potentially affected by altered expression of NMDA receptor subunits:
granule cell migration from the external granular layer (EGL) into the internal granular layer (IGL) and synapse formation between mossy fibers and granule cell dendrites. Granule cell migration starts from the early postnatal period (PND 3), and finishes by PND 21 (Altman, 1972), granule cells starting to express NMDA receptors during this period (Farrant et al., 1994). The developmental switching from NR2B to NR2A subunits, results in acceleration of NMDAR mediated EPSCs (excitatory postsynaptic currents) (Feldmeyer and Cull-Candy, 1996; Takahashi et al., 1996). Thus, the delayed switching of NMDAR subunits caused by PTU could change the intracellular concentration of Ca2+ and impair granule cell migration (Komuro and Rakic, 1993). In fact, perinatal hypothyroidism is known to cause delayed migration of granule cells. Synapses formed between mossy fibers and granule cell dendrites are glutamatergic, and are reported to feature NMDA receptor dependent LTP (long-term potentiation) (Sola et al., 2004). In other systems, LTP was shown to stabilize the synapses where it occurs, while weakening other synapses. In addition, induction of LTP has been suggested to result in the growth of dendritic filopodia and new spine formation (Nikonenko et al., 2003). Therefore, NMDAR-dependent LTP could play a role in stabilizing and pruning synapses to build up functional circuits. Different NMDA receptor subunits might have different consequences for synaptic strength. For example, NR2A and NR2B appear to have different effects regarding induction of LTP (Massey et al., 2004; Liu et al., 2004). Therefore, the delayed switching of NMDA receptor subunits from NR2B to NR2A might impair the appropriate formation of functional circuits between mossy fiber and
K. Kobayashi et al. / NeuroToxicology 27 (2006) 284–290
granule cell dendrites. In turn, this might change the overall level of neural activity in the cerebellum and sequentially affect activity-dependent process such as dendritic arborization or synapse formation by other neurons. Major symptoms in hypothyroidism are not limited to the above-mentioned morphological changes, but also include altered functions of neural circuits that result in various neurobehavioral deficits, including reduced motor coordination (Sankar et al., 1994; Bargagna et al., 2000). Several lines of evidence suggest roles NMDA receptors in establishment of motor coordination. For example, an abnormal proportion of NMDA receptor subunits during cerebellar development is reported to cause loss of granule cells and subsequent motor impairment in adult animals (Schlett et al., 2004). NMDA receptor blockade during the critical period (PNDs 15–16) causes clear detrimental effects (Kakizawa et al., 2000). Therefore, precise regulation of the timing of NMDA receptor subunit switching during cerebellar development is important for the proper acquisition of behavior mediated by cerebellar function. However, further studies are needed to clarify the causal relationship between PTU-induced delay of NMDA receptor developments and morphological or functional effects, such as impairment of granule cell migration, activity-dependent neuronal network formation or motor coordination. Investigation of the critical window of PTU on brain development is also helpful to understand thyroid effects on brain development. In the present study, we demonstrated change in the NMDA receptor subunit composition to be one of most sensitive effects in PTU-treated rats, many other genes not being affected. Alcohol, which is a developmental neurotoxicant, is also reported to cause alteration in the NMDA receptor subunit composition during development and subsequent behavioral abnormalities (Snell et al., 2001). In conclusion, PTU can delay switching from NR2B to NR2A subunits and decrease BDNF mRNA expression in the cerebellum during development. This may prevent proper development of the cytoarchitecture, neural circuits and neurobehavior. Acknowledgements We wish to express our appreciation to Ms. Haruyo Akune for expert technical assistance. We also thank all members of the Environmental Health Science Laboratory of Sumitomo Chemical Co., Ltd. for their invaluable support. References Altman J. Morphological development of the rat cerebellum and some of its mechanisms. Exp Brain Res 1982;6:8–49. Altman J. Postnatal development of the cerebellar cortex in the rat. II. Phase in the maturation of Purkinje cells and of the molecular layer. J Comp Neurol 1972;145:399–464. Balazs R, Brooksbandk BWL. Patel AJ, Johnson AL, Wilson DA. Incorporation of 35S sulfate into brain constituents during development and the effects of thyroid hormone on myelination.. Brain Res 1971;30:273–93. Bargagna S, Canepa G, Costagli C, Dinetti D, Marcheschi M, Millepiedi S, Montanelli L, Pinchera A, Chiovato L. Neuropsychological follow-up in
289
early-treated congenital hypothyroidism: a problem-oriented approach. Thyroid 2000;10:243–9. Barradas PC, Vieira RS, De Freitas MS. Selective effect of hypothyroidism on expression of myelin markers during development. J Neurosci Res 2001;66: 254–61. Binder DK, Scharfman HE. Brain-derived neurotrophic factor. Growth Factors 2004;22:123–31. Farrant M, Feldmeyer D, Takahashi T, Cull-Candy SG. NMDA receptor channel diversity in the developing cerebellum. Nature 1994;368:335–9. Feldmeyer D, Cull-Candy S. Functional consequences of changes in NMDA receptor subunit expression during development. J Neurocytol 1996;25: 857–67. Fujimoto N, Jinno N, Kitamura S. Activation of estrogen response element dependent transcription by thyroid hormone with increase in estrogen receptor levels in a rat pituitary cell line. J Endcrinol 2004;181:77–83. Goldey ES, Kehn LS, Rehnberg GL, Crofton KM. Effects of developmental hypothyroidism on auditory and motor function in the rat. Toxicol Appl Pharmacol 1995;135:67–76. Glowinski J, Iversen LL. Regional studies of catecholamines in the rat brain-I. The disposition of 3H-norepinephrin, 3H-dopamine and 3H-dopa in various regions of the brain. J Neurochem 1966;13:655–69. Hajos F, Patel AJ, Balazs R. Effect of thyroid deficiency on the synaptic organization of the rat cerebellar cortex. Brain Res 1973;50:387–401. Kakizawa S, Yamasaki M, Watanabe M, Kano M. Critical period for activitydependent synapse elimination in developing cerebellum. J Neurosci 2000; 20:4954–61. Kobayashi K, Tsuji R, Yoshioka T, Kushida M, Yabushita S, Sasaki M, Mino T, Seki T. Effects of hypothyroidism induced by perinatal exposure to PTU on rat behavior and synaptic gene expression. Toxicology 2005;212:135–47. Koibuchi N, Yamaoka S, Chin WW. Effect of altered thyroid status on neurotrophin gene expression during postnatal development of the mouse cerebellum. Thyroid 2001;11(3):205–10. Komuro H, Rakic P. Modulation of neuronal migration by NMDA receptors. Science 1993;260:95–7. Li GH, Post J, Koibuchi N, Sajdel-Sulkowska EM. Impact of thyroid hormone deficiency on the developing CNS: cerebellar glial and neuronal protein expression in rat neonates exposed to antithyroid drug propylthiouracil. Cerebellum 2004;3(2):100–6. Liu A, Zhuang Z, Hoffman PW, Bai Guang. Functional analysis of the rat N-Methyl-D-aspartate receptor 2A promoter. J Biol Chem 2003;278: 26423–34. Liu X, Murray K, Jones E. Switching of NMDA receptor 2A and 2B subunits at thalamic and cortical synapses during early postnatal development. J Neurosci 2004;24:8885–95. Lu B, Chow A. Neurotrophins and hippocampal synaptic transmission and plasticity. J Neurosci Res 1999;58:76–87. Massey PV, Johnson BE, Moult PR, Auberson YP, Brown MW, Molnar E, Collingridge GL, Bashir ZI. Differential roles of NR2A and NR2B-containing NMDA receptors in cortical long-term potentiation and long-term depression. J Neurosci 2004;24:7821–8. Nicholson JL, Altman J. The effects of early hypo- and hyperthyroidism on the development of the rat cerebellar cortex. II. Synaptogenesis in the molecular layer. Brain Res 1972a;44:25–36. Nicholson JL, Altman J. Synaptogenesis in the rat cerebellum: effects of early hypo- and hyperthyroidism. Science 1972b;176:530–2. Nicholson JL, Altman J. The effects of early hypo- and hyperthyroidism on development of rat cerebellar cortex. I. Cell proliferation and differentiation. Brain Res 1972c;44:13–23. Nikonenko I, Jourdain P, Muller D. Presynaptic remodeling contributes to activity-dependent synaptogensesis. J Neurosci 2003;23:8498–505. Sankar R, Rai B, Pulger T, Sankar G, Srinivasan T, Srinivasan L, Pandav CS. Intellectual and motor functions in school children from severely iodine deficient region in Sikkim. Indian J Pediatr 1994;61:231–6. Schalock RL, Brown WJ, Smith RL. Long- term effects of propylthiouracilinduced neonatal hypothyroidism. Developmental Psychobiol 1979;12(3): 187–99. Schlett K, Pieri I, Metzger F, Marchetti L, Steigerwald F, Dere E, Kirilly D, Tarnok K, Barabas B, Varga A, Gerspach J, Huston J, Pfizenmaier K, Kohr
290
K. Kobayashi et al. / NeuroToxicology 27 (2006) 284–290
G, Eisel U. Long-term NR2B expression in the cerebellum alters granule cell development and leads to NR2A down-regulation and motor deficits. Mol Cell Neurosci 2004;27:215–26. Schultz JR, Petz LN, Nardulli AM. Cell-and ligand- specific regulation of promoters containing activator protein-1 and SP1 sites by estrogen receptors alpha and beta. J Biol Chem 2005;280:347–54. Small DL, Murray CL, Mealing GAR. Poulter MO, Buchan AM, Morley P. Brain derived neurotrophic factor induction of N-methyl-D-aspartate receptor subunit NR2A expression in cultured rat cortical neurons. Neurosci Lett 1998;252:211–4. Snell LD, Bhave SV, Tabakoff B, Hoffman PL. Chronic ethanol exposure delays the ‘ developmental switch’ of the NMDA receptor 2A and 2B subunits in cultured cerebellar granule neurons. J Neurochem 2001;78:396–405. Sohrabji F, Miranda RCG. Toran-Allerand CD. Identification of a putative estrogen response element in the gene encoding brain-derived neurotrophic factor. Proc Natl Acad Sci USA 1995;92:11110–4.
Sola E, Prestori F, Rossi P, Taglietti V, D’Angelo E. Increased neurotransmitter release during long-term potentiation at mossy fibre-granule cell synapses in rat cerebellum. J Physiol 2004;557:843–61. Singh R, Upadhyay G, Kumar S, Kapoor A, Kumar A, Tiwari M, Godbole MM. Hypothyroidism alters the expression of Bcl-2 family genes to induce enhanced apoptosis in the developing cerebellum. J Endocrinol 2003; 176:39–46. Takahashi T, Feldmeyer D, Suzuki N, Onodera K, Cull-Candy SG, Sakimura K, Mishina M. Functional correlation of NMDA receptor e subunits expression with the properties of single-channel and synaptic currents in the developing cerebellum. J Neurosci 1996;16:4376–82. Wozniak W. Brain-derived neurotrophic factor (BDNF): role in neuronal development and survival. Folia Morpho (Warsz) 1993;52:173–81. Zoeller RT, Dowling ALS. Herzig CTA. Iannacone EA, Gauger KJ, Bansal R. Thyroid hormone, brain development, and the environment. Env Hlth Perspect 2002;110(3):355–61.