Perinatal fluoxetine exposure results in social deficits and reduced monoamine oxidase gene expression in mice

Brain Research xxx (xxxx) xxx–xxx

Contents lists available at ScienceDirect

Brain Research journal homepage: www.elsevier.com/locate/brainres

Research report

Perinatal fluoxetine exposure results in social deficits and reduced monoamine oxidase gene expression in mice C.M. Bonda,c, J.C. Johnsona,c, V. Chaudharyb, E.M. McCarthya, M.L. McWhorterb,c, ⁎ N.S. Woehrlea,c, a

Department of Psychology, Wittenberg University, Springfield, OH 45501, United States Department of Biology, Wittenberg University, Springfield, OH 45501, United States c Neuroscience Program, Wittenberg University, Springfield, OH 45501, United States b

H I GH L IG H T S

antidepressant exposure disrupts sociability and reduces preference for social novelty in mice. • Perinatal antidepressant-induced social deficits are exhibited by juvenile mice, and persist into young adulthood. • Perinatal • Reduced monoamine oxidase gene expression is found in the brains of mice exposed to antidepressant perinatally.

A R T I C LE I N FO

A B S T R A C T

Keywords: Sociability Social novelty-seeking Fluoxetine Selective serotonin reuptake inhibitor Monoamine oxidase Pregnancy

Perinatal antidepressant drug exposure increases risk for autism spectrum disorder, yet the molecular and neurobehavioral effects of maternal antidepressant drug use on offspring remain poorly understood. In this study, we administered the selective serotonin reuptake inhibitor (SSRI) fluoxetine non-invasively to female mice throughout gestation and early lactation, and then examined social interaction behaviors in offspring. In addition, we measured whole brain gene expression levels of monoamine oxidase A (MAOA), the primary metabolizing enzyme for serotonin. We found deficits in sociability and social novelty-seeking behavior in the juvenile offspring of SSRI-treated mice, and these behaviors persisted into young adulthood. Furthermore, we found decreased MAOA expression in the brains of offspring of SSRI-treated mice. Our findings suggest that exposure to antidepressants during the prenatal and early postnatal period may negatively affect social development. Moreover, reduced MAOA expression may play a role in the mechanistic pathway linking SSRI exposure and behavioral deficits symptomatic of autism.

1. Introduction Major depressive disorder affects 10–20% of pregnant women (Gavin et al., 2005; Oberlander et al., 2006), and perinatal antidepressant drug use has increased steadily over the past 20 years (Alwan et al., 2011; Cooper et al., 2007; Wichman et al., 2008). Currently, 8.7% of pregnant American women fill antidepressant prescriptions (Cooper et al., 2007), and approximately 80% are for selective serotonin reuptake inhibitors (SSRIs; Huybrechts et al., 2013; Mitchell et al., 2011). SSRIs bind to the serotonin transporter (5-HTT) and block reuptake of serotonin, thereby elevating serotonin levels in the synaptic cleft. SSRIs readily cross the placental and blood brain barriers, and are excreted in breast milk (Heikkine et al., 2002; Kim et al., 2006; Rampono et al., 2009), and may therefore alter ⁎

neurodevelopment during the gestational and early postnatal periods. Studies suggest that prenatal SSRI exposure increases risk for structural neuroteratogenic effects (Reefhuis et al., 2015) as well as neurodevelopmental disorders (Man et al., 2015). For example, a recent study found an 87% increased chance of autism spectrum disorder in the offspring of women who used antidepressants during pregnancy. Moreover, risk for autism increased when the type of antidepressant was an SSRI (Boukhris and Berard, 2015). However, estimates of risk can be confounded with maternal depression, and longitudinal research in humans is limited due to ethical and time constraints. Discontinuation of antidepressants during pregnancy can lead to relapse of depression symptoms (Cohen et al., 2006; Yonkers et al., 2011), and thus rodent studies are needed to examine the risks associated with perinatal antidepressant exposure.

Corresponding author at: Department of Psychology, Wittenberg University, 225. N Fountain Ave, Springfield, OH 45501-0720, United States. E-mail address: [email protected] (N.S. Woehrle).

https://doi.org/10.1016/j.brainres.2019.06.001 Received 4 January 2019; Received in revised form 28 May 2019; Accepted 1 June 2019 0006-8993/ © 2019 Elsevier B.V. All rights reserved.

Please cite this article as: C.M. Bond, et al., Brain Research, https://doi.org/10.1016/j.brainres.2019.06.001

Brain Research xxx (xxxx) xxx–xxx

C.M. Bond, et al.

Fig. 1. Schematic drawing of the three-chambered social test (TCST) apparatus.

(Bourke et al., 2014). Moreover, MAOA knockout mice exhibit lower levels of 5-HTT throughout the brain (Chen et al., 2017; Evrard et al., 2002), hyperserotonemia (Cases et al., 1995), and autism-like behavior (Bortolato et al., 2013a). In humans, changes in MAOA gene expression have been linked to autism (Cohen et al., 2003; Davis et al., 2008; Tassone et al., 2011; Yoo et al., 2009). Despite substantial evidence linking MAOA and 5-HTT separately to social impairment, a dearth of studies exist investigating the relationship between serotonin transporter functioning and MAOA activity in facilitating social behavior. Here, we examined social interaction behavior and whole brain MAOA gene expression in the offspring of mice administered the SSRI fluoxetine throughout gestation and early lactation. We tested mice in the three-chambered social test (TCST) as juveniles and again as young adults. Gene expression was measured using droplet digital PCR (ddPCR).

Previous animal studies point to a causal relationship between perinatal antidepressant exposure and social interaction ability (Coyle and Singer, 1975; Rodriguez Echandia and Broitman, 1983). Social avoidance and reduced interest in novel social settings are characteristic features of neuropsychiatric conditions such as autism and social anxiety disorder (APA, 2013), and the presence of similar traits in mice can be measured using the three-chambered social test (TCST; Fig. 1; Crawley, 2004, 2007; Moy et al., 2004, 2007; Nadler et al., 2004). Recently, adult mice exposed to SSRI in utero were found to exhibit reduced sociability and social novelty-seeking on the TCST (Maloney et al., 2018; Zahra et al., 2018). Yet, autism is typically reliably diagnosed in children by age 2 (Randall et al., 2018), and autism-like disruptions to communicative behaviors in mice prenatally exposed to SSRI have been documented as early as postnatal day 5 (P5; Maloney et al., 2018). No studies to our knowledge currently exist examining TCST social behaviors in the juvenile offspring of mice administered SSRI during pregnancy. Studies do show disrupted juvenile play behavior and reduced preference for social interaction in animals directly administered antidepressant during the neonatal period (Khatri et al., 2014; Olivier et al., 2011a; Rodriguez-Porcel et al., 2011; Simpson et al., 2011; Zimmerberg and Germeyan, 2015). Yet, one study found increased social interaction in rodents administered SSRI during the first postnatal week (Ko et al., 2014). Such contradictory results may be due to differing drug administration schedules. Studies are needed that closely mimic the human conditions surrounding perinatal antidepressant exposure, including in offspring exposed to antidepressant throughout gestation and lactation. The molecular events underlying disruptions in social interaction following perinatal SSRI exposure remain unclear. However, the role of serotonin in prenatal and postnatal brain development is well documented (Booij et al., 2015; Lauder, 1990; Migliarini et al., 2013). Furthermore, abnormality in the serotonergic system is thought to play a role in disorders characterized by social deficits. For example, the capacity of the brain to synthesize serotonin develops atypically in children with autism (Chandana et al., 2005; Chugani et al., 1997, 1999). Moreover, hyperserotonemia is found in a subset of autism patients and within families of autistic children (Abramson et al., 1989; Cook et al., 1990; Leboyer et al., 1999; Leventhal et al., 1990; Piven et al., 1991). In rodent studies, neonatal SSRI exposure reduces expression of 5-HTT and of the rate-limiting serotonin synthetic enzyme tryptophan hydroxylase (TPH; Maciag et al., 2006; Weaver et al., 2010). Thus, a plausible mechanistic pathway through which perinatal SSRI exposure causes social deficits in offspring includes alterations in serotonin synthesis and degradation. Monoamine oxidase A (MAOA), an enzyme expressed in the outer mitochondrial membrane that plays a key role in the degradation of monoamines, can regulate the synthesis, transfer, and decomposition of serotonin. We hypothesized that chronic low intracellular levels of serotonin during prenatal and early postnatal development due to SSRI exposure results in decreased MAOA expression. Recent work showed that MAOA inhibition during the prenatal and early postnatal period produces long-lasting impairment of serotonin functioning in offspring

2. Results 2.1. Three-chambered social test 2.1.1. Three-week old mice A significant stranger × drug interaction [F(1,25) = 4.82; p = 0.038; ƞ2 = 0.67] and post hoc tests revealed that vehicle-sired mice spent significantly more time in the chamber containing stranger 1 than in the empty chamber [F(1,8) = 17.32; corrected p = 0.003; d = 0.56], whereas fluoxetine-sired mice did not exhibit a chamber preference (Fig. 2a). Furthermore, fluoxetine-sired mice spent less time with stranger 1 (corrected p = 0.0236; d = −0.67) and more time in the empty chamber (corrected p = 0.019; d = 0.71) compared to vehiclesired mice (Fig. 2a). Finally, fluoxetine exposure significantly reduced the percentage of total session time spent in the chamber containing stranger 1 [t(1, 25) = 2.07; p = 0.0492; d = −0.82] (Fig. 2a). A significant stranger × drug interaction [F(1,25) = 10.34; p = 0.004; ƞ2 = 0.68] and post hoc tests revealed that vehicle-sired mice spent significantly more time in the chamber containing novel stranger 2 than in the chamber containing now-familiar stranger 1 [F (1,8) = 17.45; corrected p = 0.003; d = 1.5], whereas fluoxetine-sired mice did not exhibit a chamber preference (Fig. 2c). Furthermore, fluoxetine-sired mice spent less time with stranger 2 (corrected p = 0.001; d = −0.99) and more time with stranger 1 (corrected p = 0.001; d = 0.97) compared to vehicle-sired mice (Fig. 2c). Finally, fluoxetine exposure significantly reduced the percentage of total session time spent in the chamber containing stranger 2 [t(1,25) = 3.27; p = 0.003; d = −1.3] (Fig. 2d). 2.1.2. Six-week old mice A significant stranger × drug interaction [F(1,25) = 9.20; p = 0.006; ƞ2 = 0.59] and post hoc tests revealed that vehicle-sired mice spent significantly more time in the chamber containing stranger 1 than in the empty chamber [F(1,9) = 9.42; corrected p = 0.013; d = 1.75], whereas fluoxetine-sired mice did not exhibit a chamber preference (Fig. 3a). Furthermore, fluoxetine-sired mice spent less time 2

Brain Research xxx (xxxx) xxx–xxx

C.M. Bond, et al.

Fig. 2. TCST behavior in 3-week-old mice. Vehicle-sired mice (n = 9) exhibited significant pro-social behavior by spending more time with stranger 1 than the empty chamber, while fluoxetine-sired mice (n = 18) did not exhibit a chamber preference (a). Fluoxetine-sired mice spent less time with stranger 1 and more time in the empty chamber compared to vehicle-sired mice (a). Fluoxetine exposure reduced the percentage of total session time spent with stranger 1 (b). Vehicle-sired mice (n = 9) also exhibited significant preference for social novelty by spending more time with the novel stranger 2 compared to the now-familiar stranger 1, while fluoxetine-sired mice (n = 18) did not exhibit a chamber preference (c). Fluoxetine-sired mice spent less time with stranger 2 and more time with stranger 1 compared to vehicle-sired mice (c). Fluoxetine exposure reduced the percentage of total session time spent with stranger 2 (d). Data are presented as the mean ± SEM. *Significant difference within group. #Significant difference between groups.

with stranger 1 (corrected p = 0.0001; d = −1.18) and more time in the empty chamber (corrected p = 0.006; d = 0.83) compared to vehiclesired mice (Fig. 3a). Finally, fluoxetine exposure significantly reduced the percentage of total session time spent in the chamber containing stranger 1 [t(1,25) = 3.44; p = 0.002; d = −1.29] (Fig. 3b). A significant stranger × drug interaction [F(1,24) = 17.27; p = 0.0004; ƞ2 = 0.6] and post hoc tests revealed that vehicle-sired mice spent significantly more time in the chamber containing novel stranger 2 than in the chamber containing now-familiar stranger 1 [F (1,9) = 32.55; corrected p = 0.0003; d = 2.72], whereas fluoxetinesired mice did not exhibit a chamber preference (Fig. 3c). Furthermore, fluoxetine-sired mice spent less time with stranger 2 (corrected p = 0.0003; d = −1.23) and more time with stranger 1 (corrected p = 0.0001; d = 1.07) compared to vehicle-sired mice (Fig. 3c). Finally, fluoxetine exposure significantly reduced the percentage of total session time spent in the chamber containing stranger 2 [t(1,24) = 4.51; p = 0.0001; d = −1.88] (Fig. 3d).

(Fig. 4b). However, a main effect of age on total distance traveled was found [F(1,26) = 50.30; p = 0.0001; d = 2.19], such that mice exhibited significantly greater locomotor activity at 6 weeks of age compared to 3 weeks of age. 2.3. MAOA expression Expression of MAOA mRNA was examined by ddPCR in whole brain extracts of 3 week-old mice exposed perinatally to vehicle or fluoxetine (Fig. 5). Expression is shown as relative fluorescence units (RFU) normalized to peptidylprolyl isomerase A (PPIA), a housekeeping gene (Lemma et al., 2016). MAOA expression in the brains of fluoxetine-sired mice was decreased by 55.4% compared to brains of vehicle-sired mice [t(14) = 2.15; p = 0.048; d = −0.69]. 3. Discussion In this study, we show that perinatal SSRI exposure induces social interaction deficits in mice while altering the expression of MAOA, a gene implicated in the etiology of autism. Specifically, we found decreased sociability and social novelty-seeking in the offspring of mice exposed to fluoxetine during the pregnancy-lactation period. Fluoxetine-induced social deficits were exhibited by juveniles, and

2.2. Open field test No effect of fluoxetine exposure was found on total distance traveled in the open field. Thus, overall locomotion did not differ between vehicle-sired and fluoxetine-sired mice at 3 weeks (Fig. 4a) or 6 weeks 3

Brain Research xxx (xxxx) xxx–xxx

C.M. Bond, et al.

Fig. 3. TCST behavior in 6-week-old mice. Vehicle-sired mice (n = 10) exhibited significant pro-social behavior by spending more time with stranger 1 than the empty chamber, while fluoxetine-sired mice (n = 17) did not demonstrate a chamber preference (a). Fluoxetine-sired mice spent less time with stranger 1 and more time in the empty chamber compared to vehicle-sired mice (a). Fluoxetine exposure reduced the percentage of total session time spent with stranger 1 (b). Vehiclesired mice (n = 10) also exhibited significant preference for social novelty by spending more time with the novel stranger 2 compared to the now-familiar stranger 1, while fluoxetine-sired mice (n = 16) did not exhibit a chamber preference (c). Fluoxetine-sired mice spent less time with stranger 2 and more time with stranger 1 compared to vehicle-sired mice (c). Fluoxetine exposure reduced the percentage of total session time spent with stranger 2 (d). Data are presented as the mean ± SEM. *Significant difference within group. #Significant difference between groups.

persisted into young adulthood. In addition, we found decreased MAOA gene expression in the juvenile brains of fluoxetine-sired mice. These findings provide insight to the link between perinatal antidepressant exposure and risk for autism in humans, and suggest that SSRIs may affect neurodevelopment during gestation and lactation via a pathway involving MAOA. Our behavioral results are consistent with work showing that perinatal SSRI exposure alters various forms of social behavior in rodents (for review, see Bourke et al., 2014). Yet, research on perinatal SSRI exposure and sociability is lacking, as previous studies involving social interaction tests in which stimulus mice freely roam the test chamber are limited in ability to distinguish sociability from aggressive displays (Gemmel et al., 2017; Olivier et al., 2011b; Svirsky et al., 2016). Moreover, increased MAOA gene expression is found in the brains of mice exhibiting pathological aggression (Marquez et al., 2013), whereas we show decreased MAOA expression in mice exhibiting social approach deficits. Thus, valid measures of social affiliation and social memory in animals are needed to draw conclusions about the neurochemical events underlying autism risk following antidepressant exposure. The three chambered social test (TCST) we administered in our study is widely used to measure sociability and preference for social novelty in rodents (Crawley, 2004, 2007; Moy et al., 2004, 2007;

Fig. 4. Total distance travelled in an open field. No effects of fluoxetine exposure were found on overall locomotion. Animals (n = 10 vehicle-sired; n = 18 fluoxetine-sired) exhibited increased locomotion at six weeks compared to three-weeks of age. Data are presented as the mean ± SEM. *p = 0.0001.

4

Brain Research xxx (xxxx) xxx–xxx

C.M. Bond, et al.

factors previously implicated in social development. Moreover, these findings are consistent with studies showing that MAOA knockout mice exhibit impaired social behaviors (Bortolato et al., 2013a), which are partially rescued by early postnatal administration of a serotonin synthesis inhibitor (Bortolato et al., 2013b). Sociability and social novelty-seeking deficits on the TCST, as shown here, have been suggested to putatively model the social symptoms of autism (McFarlane et al., 2008; Radyushkin et al., 2009; Veenstra-VanderWeele et al., 2012), and thus our findings suggest caution in prescribing antidepressants to women during the perinatal period. Indeed, several studies have confirmed increased risk for autism with maternal antidepressant drug use (Boukhris et al., 2016; Croen et al., 2011; Gentile, 2015; Gidaya et al., 2014; Harrington et al., 2014; Man et al., 2015; Rai et al., 2013; Weisskopf et al., 2015). However, in several studies the increased autism risk with antidepressant use did not reach statistical significance (Clements et al., 2015; Hviid et al., 2013; Sorensen et al., 2013). Moreover, the benefits of antidepressants for depressed pregnant women may, in many cases, outweigh potential risks (Bourke et al., 2014; Weisskopf et al., 2015). In particular, maternal stress resulting from depression can negatively affect fetal development (Dipietro, 2012; Kinney et al., 2008; Rakers et al., 2017). Given that antidepressants are likely to remain widely used (Lopez and Murray, 1998), investigations of their long-term effects on neurodevelopment in humans are needed. Our study design did not allow for investigation of critical periods in the relationship between maternal antidepressant use and offspring social deficits. We exposed mice to antidepressant throughout gestation and early lactation in order to mimic maternal antidepressant drug use in humans. Women are not typically prescribed SSRIs during only one perinatal period, perhaps due to the delay in onset of SSRI therapeutic effects (Jakubovski et al., 2016). Moreover, we did not investigate sex differences in this study; female offspring were used exclusively due to an under-abundance of male pups in SSRI cages. However, clear differences between males and females with autism have been difficult to identify, and evidence for distinct etiologies for the two sexes is lacking. Instead, studies suggest that females require a greater etiologic load to manifest autistic behavioral impairment such as social deficits (Robinson et al., 2013). This hypothetical protective effect of female sex (Skuse, 2000) should make it more difficult to detect autism-related effects in animal model studies using females. Finally, alternative explanations for our findings include effects of rearing conditions on offspring behavior. For example, drug group could not be decoupled from dam or litter in our study, and yet maternal behavior is known to influence various outcomes in rodent offspring (Francis et al., 1999; Pedersen et al., 2011; Priebe et al., 2005). However, effects of maternal behavior on social approach remain unclear. Paternal behavior also may have influence our results. Male breeders had access to fluoxetine in the drinking water during the mating period, and a recent study of cocaine use in rats suggests that paternal drug use during breeding can impact offspring behavior (Wimmer et al., 2017). However, paternal antidepressant use has been found not to increase risk for social deficits in offspring (Viktorin et al., 2018; Yang et al., 2017), limiting drug-related epigenetic remodeling explanations for our findings. In summary, our findings show that perinatal exposure to SSRI results in social approach deficits and decreased MAOA gene expression in mice. These findings provide insight to human studies showing association between neurodevelopmental disorder and exposure to antidepressants during the pregnancy-lactation period. Moreover, expression of the MAOA gene may play a role in the mechanistic pathway linking SSRI exposure and behavioral deficits symptomatic of autism. Future studies should examine the interplay between the activities of 5HTT and MAOA in processes underlying social development.

Fig. 5. MAOA expression. Whole brain extracts of mice perinatally exposed to fluoxetine (n = 8) showed a 55.4% decrease in MAOA gene expression compared to vehicle-exposed mice (n = 8). MAOA mRNA gene expression was determined by droplet digital PCR (ddPCR) in 3 week-old mice and normalized to PPIA, a housekeeping gene. Data are presented as the mean ± SEM. *p = 0.048.

Nadler et al., 2004), and recent studies document TCST deficits in adult mice exposed to SSRI in utero (Maloney et al., 2018; Zahra et al., 2018). We expand these findings by showing that mice perinatally exposed to SSRI exhibit social deficits on the TCST during the juvenile period, at an age aligned with the point in human development when autism is typically diagnosed (Randall et al., 2018). Furthermore, we show that these social deficits in juvenile mice persist into young adulthood and are accompanied by changes in MAOA gene expression. SSRI animal studies typically use a model of daily injections to investigate effects on offspring (Bourke et al., 2014; Svirsky et al., 2016). Yet, gestational stress is associated with increased risk of neurodevelopmental disorder in humans (Kinney et al., 2008), as well as increased prevalence of social interaction deficits in rats (Beversdorf et al., 2018; Schneider and Przewlocki, 2005). Moreover, daily injections result in bolus effects that may lead to toxic fetal serum concentrations of SSRI (DeVane and Simpkins, 1985). In contrast, human exposure leads to steadier and lower peak serum concentrations (Bourke et al., 2014). We delivered SSRI to pregnant and lactating mice via drinking water in our study, and show that social deficits result from perinatal SSRI exposure even when the gestational stress associated with daily injections is avoided. Prenatal SSRI exposure is associated with social withdrawal in 3year-old children (Oberlander et al., 2010), and yet SSRIs improve social interactions in children with autism. Thus, a paradoxical relationship seems to exist between SSRIs and social behavior, whereby SSRIs may be detrimental in the prenatal and early postnatal environment but potentially beneficial later in life. An understanding of the interactions between genetic and environmental factors in social development may be necessary to explain such findings (Hertz-Picciotto et al., 2006). For example, polymorphisms of MAOA interact with fluoxetine to influence metabolic profiles in juvenile monkeys in a way thought to be relevant to fluoxetine’s effects on underlying autism pathology (He et al., 2014). Moreover, MAOA allelic variants which confer low catalytic activity are associated with the severity of social impairments in autism (Cohen et al., 2003, 2007; Davis et al., 2008; Yirmiya et al., 2002). Our findings show that reduced MAOA gene expression results from SSRI exposure in the prenatal and early postnatal environment, and is associated with deficits in sociability and social novelty-seeking behavior. Thus, low MAOA levels may provide a link between genetic and environmental 5

Brain Research xxx (xxxx) xxx–xxx

C.M. Bond, et al.

4. Experimental procedure

mice in the videos. Duration of time spent in each interaction chamber was recorded during a habituation session and each of the two test sessions. Entry into a chamber required all four paws to cross the partition threshold. Each video was scored by two separate experimenters and results greater than ten seconds apart were rescored. Results less than ten seconds apart were averaged prior to statistical analysis. Intraclass correlation coefficients (ICC) revealed the interrater reliability to be high for both sociability (ICC = 0.90) and social novelty (ICC = 0.92) trials.

4.1. Animals Adult C57BL/6 mice (Jackson Laboratories, Bar Harbor, ME) were pair-mated in order to produce offspring for behavioral testing at 3weeks and 6-weeks of age (n = 10 vehicle-sired; n = 18 fluoxetinesired), and separately for gene expression studies at 3-weeks of age (n = 8 per group). Male breeders were removed the day a vaginal plug was detected in the female. Litter sizes were not statistically different between vehicle-treated (7–8 mice/litter) and fluoxetine-treated (6–8 mice/litter) cages. However, only female offspring were included in the study due to a high female:male sex ratio of pups resulting in too few male offspring born into fluoxetine-treated cages. At weaning, mice were group-housed (4–5 mice/cage) in same-sex, same-drug cages. Average weight did not differ between groups at 3 weeks (vehicle = 8.9 g, fluoxetine = 8.4 g) or 6 weeks (vehicle = 17.2 g, fluoxetine = 16.6 g) of age. Mice were maintained in a temperature-controlled colony room with a 12:12 light/dark schedule. All testing took place during the light cycle. Animals had ad libitum access to food and water throughout the study. All work was carried out in accordance with Institutional Animal Care and Use Committee approval and National Institutes of Health Laboratory Animal Care Guidelines.

4.3.2. Open field test Total distance travelled was recorded in a 42 cm × 42 cm × 30 cm Plexiglas box (Omnitech Electronics, Columbus, OH) equipped with infrared beams which, when broken, automatically recorded the animal’s coordinates in space along x, y, and z axes. 4.4. Behavioral testing procedure Each TCST trial began with the test mouse placed in the neutral chamber. Removable doors were lifted to begin a two-minute habituation period which allowed the mouse to explore all three chambers while both stimulus cages remained empty. The test mouse was then placed back in the neutral chamber, and an unfamiliar sex- and agematched C57BL/6 mouse (stranger 1) that was previously habituated to the apparatus was placed in one of the stimulus cages. The stimulus cage in which this stranger mouse was placed was systematically alternated between trials. A ten-minute sociability session ensued in which the test mouse was allowed to explore all three chambers, and thus had the choice between the stranger mouse and an empty chamber. The test mouse was then placed back in the neutral chamber, and a second stranger mouse (stranger 2) was placed in the empty stimulus cage. A ten-minute preference for social novelty test ensued in which the test mouse was allowed to explore all three chambers, and thus had the choice between the first, already-investigated mouse (stranger 1) and the novel unfamiliar mouse (stranger 2). Duration of time spent in each chamber during habituation, sociability, and preference for social novelty test sessions was recorded. Finally, the test mouse was placed in the open field test and locomotor behavior was recorded for ten minutes. Each behavioral testing apparatus was cleaned between test subjects with a 70% ethanol solution. Mice were tested once at 3 weeks and again at 6 weeks old.

4.2. Chemicals Fluoxetine HCl (Tocris Biosciences, Minneapolis, MN) was administered in the drinking water of breeding cages at a concentration of 120 mg/L to achieve a 15 mg/kg/day dose (Dulawa et al., 2004; Shanahan et al., 2009). This dose produces serum concentrations in mice within the clinically relevant range for humans (Dulawa et al., 2004). Fetal central nervous system exposure to fluoxetine in mice is similar to that of the pregnant dam (Capello et al., 2011). Breeding females received fluoxetine from the start of pair-mating through P14. Thus, offspring were exposed to fluoxetine in utero from conception through birth, and postnatally (via breast milk) from birth until P14. Male breeders were exposed to fluoxetine during breeding, but did not remain in the cage during pregnancy and lactation. Fluoxetine was delivered via the drinking water in order to limit the bolus effects and stress associated with daily injections (Bourke et al., 2014; DeVane and Simpkins, 1985). Drinking water bottles contained long nozzles extending approximately 2 in. beyond wire cage-tops and resting a minimum of 4 in. from the cage floor. Thus, fluoxetine water was reachable only by adult mice. P14 is the age just before pups begin to consume food and water, and thus we avoided direct drug exposure in the pups. Drinking water bottles were changed twice weekly, at which time volume of water consumption was recorded for each fluoxetine-treated cage. Average daily volume of fluoxetine water intake for each cage was as follows—behavioral study: 3.1 ml, 3.3 ml, 3.3 ml; gene expression study: 3.2 ml, 3.4 ml.

4.5. Droplet digital PCR 4.5.1. RNA isolation Mice were euthanized by decapitation at 3 weeks old. Brains were excised, snap-frozen in RNAlater (Thermo Fisher Scientific, Waltham, MA) and stored at −80°C until RNA extraction. Trizol RNA isolation was performed according to manufacturer's protocols (Thermo Fisher Scientific) except where noted. 1 ml of Trizol was used for every 20 mg of brain tissue to be homogenized by motorized pestle. After a 5 min incubation at RT, 200 μl chloroform was added followed by vigorous agitation and RT incubation for 3 min. The aqueous layer resulting from centrifugation at 12,000×g for 15 min at 4°C was then added to an RNeasy column according to manufacturer’s instructions (Qiagen). After binding to the column, RNA was washed with 700 μl of RW1 buffer then 500 μl RPE buffer twice. RNA was eluted with RNase-free water and stored at −80°C. Concentration of RNA samples was determined by NanoDrop OneC spectrophotometer (Thermo Fisher Scientific).

4.3. Apparati 4.3.1. Three-chambered social test Sociability and preference for social novelty were tested using methods previously described (Crawley, 2004; DeLorey et al., 2008; Lawson et al., 2016). The TCST apparatus (based on DeLorey et al., 2008; Fig. 1) consisted of a three-chambered rectangular box made from clear polycarbonate (66 cm long × 12 cm wide × 18 cm high). A neutral chamber (10 cm long) was flanked by two interaction chambers (each 20 cm long) with dividing walls that contained removable doors. A wire mesh fence separated each of the interaction chambers from an adjacent stimulus cage (8 cm long), which contained an unfamiliar mouse (stranger mouse) or was empty. All test sessions were recorded using a digital camera with aerial view of the TCST apparatus. Experimenters blind to condition subsequently scored the behavior of

4.5.2. cDNA synthesis To remove any contaminating genomic DNA, RNA samples were treated with TURBO DNase (Ambion) according to manufacturer’s protocol. 2 μl of RNA and random hexamers were used to generate cDNA using AMV-cDNA synthesis kit (Invitrogen, Carlsbad, CA). 6

Brain Research xxx (xxxx) xxx–xxx

C.M. Bond, et al.

4.6.3. ddPCR Results were analyzed using the QuantaSoft analysis software, based on Poisson statistics (BioRad). Data are illustrated as Relative Fluorescence Units (RFU) of MAOA normalized to PPIA (peptidylprolyl isomerase A), and a t-test was performed with drug treatment (vehicle or fluoxetine) as a between-subjects factor. cDNA synthesis and ddPCR procedures were followed according to published protocols (Iyer et al., 2017).

4.5.3. Quantification of MAOA mRNA MAOA mRNA (MGC: 27811) levels were determined using droplet digital PCR (ddPCR, BioRad). The following MAOA primers and probes were used: Forward primer 5′-GGGCGGTACAAGGGTCTGTT-3′; Reverse primer 5′-ACGTCGAACATGTGGCCTGT-3′; FAM probe 5′-/56-FAM/ CCCAAACCA/ZEN/TGACGGATCTGGAGAAGCCC/3IABkFQ-3′. Peptidylprolyl isomerase A (PPIA; MGI: 97749) quantification was used as a reference gene to normalize MAOA mRNA levels. The following PPIA primers and probes were used: Forward primer 5′-GTCAACCCC ACCGTGTTCTT-3′; Reverse primer 5′-TTGGAACTTTGTCTGCAA ACA-3′; HEX probe 5′-CTTGGGCCGCGTCT-3′. All primers and probes were synthesized by Integrated DNA Technologies (IDT). To quantify MAOA, individual PCR reactions for each brain cDNA sample were performed. Each reaction used 1 μl of corresponding brain cDNA, 250 nM MAOA probe, 900 nM forward and reverse primers, and 10 μl of 2× ddPCR supermix without dUTP (BioRad) with water adjusting the final total volume to 20 μl. To quantify PPIA, the individual PCR reactions were setup identically except that only 0.01 μl of corresponding brain cDNA was used and PPIA forward and reverse primers and probe was used. Technical replicates were also performed. These reactions were transferred to an 8-row droplet digital generator cartridge (BioRad) to which 70 μl of droplet generation oil was added. The cartridge was then placed in the QX100 droplet generator (BioRad). The machine generates ∼17,000–20,000 droplets per sample so the PCR occurs as individual PCR reactions in droplets. The droplets were then transferred to a 96-well plate and placed in a conventional PCR machine and cycled under standard conditions: 95°C for 10 min followed by 40 cycles of 94°C for 30 s, 60°C for 1 min and a final step of 98°C for 10 min. After PCR amplification, the fluorescence was read by the QX200 droplet reader (BioRad). Thus, ddPCR is an end-point quantification.

References Abramson, R.K., et al., 1989. Elevated blood serotonin in autistic probands and their firstdegree relatives. J. Autism Dev. Disord. 19, 397–407. Alwan, S., et al., 2011. Patterns of antidepressant medication use among pregnant women in a United States population. J. Clin. Pharmacol. 51, 264–270. APA, 2013. Diagnostic and Statistical Manual of Mental Disorders: DSM-5, Vol. American Psychiatric Association, Washington, D.C. Beversdorf, D.Q., Stevens, H.E., Jones, K.L., 2018. Prenatal stress, maternal immune dysregulation, and their association with autism spectrum disorders. Curr. Psychiatry Rep. 20, 76. Booij, L., et al., 2015. Genetic and early environmental influences on the serotonin system: consequences for brain development and risk for psychopathology. J. Psychiatry Neurosci. 40, 5–18. Bortolato, M., et al., 2013a. Monoamine oxidase A and A/B knockout mice display autistic-like features. Int. J. Neuropsychopharmacol. 16, 869–888. Bortolato, M., et al., 2013b. Early postnatal inhibition of serotonin synthesis results in long-term reductions of perseverative behaviors, but not aggression, in MAO A-deficient mice. Neuropharmacology 75, 223–232. Boukhris, T., et al., 2016. Antidepressant use during pregnancy and the risk of autism spectrum disorder in children. JAMA Pediatr. 170, 117–124. Boukhris, T., Berard, A., 2015. Selective serotonin reuptake inhibitor use during pregnancy and the risk of autism spectrum disorders: a review. J. Pediatr. Genet. 4, 84–93. Bourke, C.H., Stowe, Z.N., Owens, M.J., 2014. Prenatal antidepressant exposure: clinical and preclinical findings. Pharmacol. Rev. 66, 435–465. Capello, C.F., et al., 2011. Serotonin transporter occupancy in rats exposed to serotonin reuptake inhibitors in utero or via breast milk. J. Pharmacol. Exp. Ther. 339, 275–285. Cases, O., et al., 1995. Aggressive behavior and altered amounts of brain serotonin and norepinephrine in mice lacking MAOA. Science 268, 1763–1766. Chandana, S.R., et al., 2005. Significance of abnormalities in developmental trajectory and asymmetry of cortical serotonin synthesis in autism. Int. J. Dev. Neurosci. 23, 171–182. Chen, K., et al., 2017. Altered gene expression in early postnatal monoamine oxidase A knockout mice. Brain Res. 1669, 18–26. Chugani, D.C., et al., 1997. Altered serotonin synthesis in the dentatothalamocortical pathway in autistic boys. Ann. Neurol. 42, 666–669. Chugani, D.C., et al., 1999. Developmental changes in brain serotonin synthesis capacity in autistic and nonautistic children. Ann. Neurol. 45, 287–295. Clements, C.C., et al., 2015. Prenatal antidepressant exposure is associated with risk for attention-deficit hyperactivity disorder but not autism spectrum disorder in a large health system. Mol. Psychiatry 20, 727–734. Cohen, I.L., et al., 2003. Association of autism severity with a monoamine oxidase A functional polymorphism. Clin. Genet. 64, 190–197. Cohen, L.S., et al., 2006. Relapse of major depression during pregnancy in women who maintain or discontinue antidepressant treatment. JAMA 295, 499–507. Cohen, D., et al., 2007. Brief report: visual-spatial deficit in a 16-year-old girl with maternally derived duplication of proximal 15q. J. Autism Dev. Disord. 37, 1585–1591. Cook Jr, E.H., et al., 1990. Autistic children and their first-degree relatives: relationships between serotonin and norepinephrine levels and intelligence. J. Neuropsychiatry Clin. Neurosci. 2, 268–274. Cooper, W.O., et al., 2007. Increasing use of antidepressants in pregnancy. Am. J. Obstet. Gynecol. 196 (544), e1–e5. Coyle, I.R., Singer, G., 1975. The interactive effects of prenatal imipramine exposure and postnatal rearing conditions on behaviour and histology. Psychopharmacologia 44, 253–256. Crawley, J.N., 2004. Designing mouse behavioral tasks relevant to autistic-like behaviors. Ment. Retard. Dev. Disabil. Res. Rev. 10, 248–258. Crawley, J.N., 2007. Mouse behavioral assays relevant to the symptoms of autism. Brain Pathol. 17, 448–459. Croen, L.A., et al., 2011. Antidepressant use during pregnancy and childhood autism spectrum disorders. Arch. Gen. Psychiatry 68, 1104–1112. Davis, L.K., et al., 2008. Cortical enlargement in autism is associated with a functional VNTR in the monoamine oxidase A gene. Am. J. Med. Genet. B Neuropsychiatr. Genet. 147B, 1145–1151. DeLorey, T.M., et al., 2008. Gabrb3 gene deficient mice exhibit impaired social and exploratory behaviors, deficits in non-selective attention and hypoplasia of cerebellar vermal lobules: a potential model of autism spectrum disorder. Behav. Brain Res. 187, 207–220. DeVane, C.L., Simpkins, J.W., 1985. Pharmacokinetics of imipramine and its major metabolites in pregnant rats and their fetuses following a single dose. Drug Metab. Dispos. 13, 438–442.

4.6. Statistical method 4.6.1. Three-chambered social test Separate overall ANOVAs for 3-week and 6-week old mice, with drug treatment (vehicle or fluoxetine) as a between-subjects factor, were applied to sociability and social novelty-seeking measures. Sociability was analyzed by comparing duration of time spent in the chamber with “stranger 1” to duration spent in the empty chamber, and preference for social novelty was analyzed by comparing duration spent in the chamber with “stranger 1” to duration spent with “stranger 2.” A preference was defined as mice spending significantly more time in one chamber than another. Significant interactions were resolved using post-hoc ANOVAs with the Bonferroni correction for within-subject factors and/or Newman Keuls post hoc tests for between-subjects factors. In addition, Shapiro-Wilk test results indicated normal distribution (p > 0.05) of sociability and social novelty-seeking data. Therefore, independent-samples t-tests were conducted to compare percent total session time spent with stranger 1 (sociability) or stranger 2 (social novelty) between drug groups. Significance was set at p < 0.05, and effect sizes (Cohen’s d or Eta squared) were calculated for each study. One 3-week old vehicle-treated mouse and one 6-week old fluoxetine-treated mouse were removed from TCST data analysis due to exhibiting innate chamber preference, as defined by a duration > 2 SD above the group mean for either interaction chamber during the habituation session. Experimenter error leading to incomplete video recording led to the exclusion of one 6-week old fluoxetine-treated mouse from preference for social novelty data analysis. 4.6.2. Open field test A repeated-measures ANOVA with drug treatment (vehicle or fluoxetine) as a between-subjects factor and age (3 weeks or 6 weeks) as a within-subject factor was applied to total distance traveled in an open field. Significance was set at p < 0.05. 7

Brain Research xxx (xxxx) xxx–xxx

C.M. Bond, et al.

Oberlander, T.F., et al., 2010. Prenatal effects of selective serotonin reuptake inhibitor antidepressants, serotonin transporter promoter genotype (SLC6A4), and maternal mood on child behavior at 3 years of age. Arch. Pediatr. Adolesc. Med. 164, 444–451. Olivier, J.D., et al., 2011a. The age-dependent effects of selective serotonin reuptake inhibitors in humans and rodents: a review. Prog. Neuropsychopharmacol. Biol. Psychiatry 35, 1400–1408. Olivier, J.D., et al., 2011b. Fluoxetine administration to pregnant rats increases anxietyrelated behavior in the offspring. Psychopharmacology (Berl) 217, 419–432. Pedersen, C.A., et al., 2011. Variations in maternal behavior in C57BL/6J Mice: behavioral comparisons between adult offspring of high and low pup-licking mothers. Front. Psychiatry 2, 42. Piven, J., et al., 1991. Platelet serotonin, a possible marker for familial autism. J. Autism Dev. Disord. 21, 51–59. Priebe, K., et al., 2005. Maternal influences on adult stress and anxiety-like behavior in C57BL/6J and BALB/cJ mice: a cross-fostering study. Dev. Psychobiol. 47, 398–407. Radyushkin, K., et al., 2009. Neuroligin-3-deficient mice: model of a monogenic heritable form of autism with an olfactory deficit. Genes Brain Behav. 8, 416–425. Rai, D., et al., 2013. Parental depression, maternal antidepressant use during pregnancy, and risk of autism spectrum disorders: population based case-control study. BMJ 346, f2059. Rakers, F., et al., 2017. Transfer of maternal psychosocial stress to the fetus. Neurosci. Biobehav. Rev. https://doi.org/10.1016/j.neubiorev.2017.02.019. Rampono, J., et al., 2009. Placental transfer of SSRI and SNRI antidepressants and effects on the neonate. Pharmacopsychiatry 42, 95–100. Randall, M., et al., 2018. Diagnostic tests for autism spectrum disorder (ASD) in preschool children. Cochrane Database Syst. Rev. 7, CD009044. Reefhuis, J., et al., 2015. Specific SSRIs and birth defects: Bayesian analysis to interpret new data in the context of previous reports. BMJ 351, h3190. Robinson, E.B., et al., 2013. Examining and interpreting the female protective effect against autistic behavior. Proc. Natl. Acad. Sci. U.S.A. 110, 5258–5262. Rodriguez Echandia, E.L., Broitman, S.T., 1983. Effect of prenatal and postnatal exposure to therapeutic doses of chlorimipramine on emotionality in the rat. Psychopharmacology (Berl) 79, 236–241. Rodriguez-Porcel, F., et al., 2011. Neonatal exposure of rats to antidepressants affects behavioral reactions to novelty and social interactions in a manner analogous to autistic spectrum disorders. Anat. Rec. (Hoboken) 294, 1726–1735. Schneider, T., Przewlocki, R., 2005. Behavioral alterations in rats prenatally exposed to valproic acid: animal model of autism. Neuropsychopharmacology 30, 80–89. Shanahan, N.A., et al., 2009. Chronic reductions in serotonin transporter function prevent 5-HT1B-induced behavioral effects in mice. Biol. Psychiatry 65, 401–408. Simpson, K.L., et al., 2011. Perinatal antidepressant exposure alters cortical network function in rodents. Proc. Natl. Acad. Sci. U.S.A. 108, 18465–18470. Skuse, D.H., 2000. Imprinting, the X-chromosome, and the male brain: explaining sex differences in the liability to autism. Pediatr. Res. 47, 9–16. Sorensen, M.J., et al., 2013. Antidepressant exposure in pregnancy and risk of autism spectrum disorders. Clin. Epidemiol. 5, 449–459. Svirsky, N., Levy, S., Avitsur, R., 2016. Prenatal exposure to selective serotonin reuptake inhibitors (SSRI) increases aggression and modulates maternal behavior in offspring mice. Dev. Psychobiol. 58, 71–82. Tassone, F., et al., 2011. MAOA, DBH, and SLC6A4 variants in CHARGE: a case-control study of autism spectrum disorders. Autism Res. 4, 250–261. Veenstra-VanderWeele, J., et al., 2012. Autism gene variant causes hyperserotonemia, serotonin receptor hypersensitivity, social impairment and repetitive behavior. Proc. Natl. Acad. Sci. U.S.A. 109, 5469–5474. Viktorin, A., et al., 2018. Paternal use of antidepressants and offspring outcomes in Sweden: nationwide prospective cohort study. BMJ 361, k2233. Weaver, K.J., et al., 2010. Neonatal exposure to citalopram selectively alters the expression of the serotonin transporter in the hippocampus: dose-dependent effects. Anat. Rec. (Hoboken) 293, 1920–1932. Weisskopf, E., et al., 2015. Risk-benefit balance assessment of SSRI antidepressant use during pregnancy and lactation based on best available evidence. Expert Opin. Drug Saf. 14, 413–427. Wichman, C.L., et al., 2008. Recent trends in selective serotonin reuptake inhibitor use in pregnancy. J. Clin. Psychopharmacol. 28, 714–716. Wimmer, M.E., et al., 2017. Paternal cocaine taking elicits epigenetic remodeling and memory deficits in male progeny. Mol. Psychiatry 22, 1641–1650. Yang, F., et al., 2017. Risk of autism spectrum disorder in offspring following paternal use of selective serotonin reuptake inhibitors before conception: a population-based cohort study. BMJ Open 7, e016368. Yirmiya, N., et al., 2002. Family-based and population study of a functional promoterregion monoamine oxidase A polymorphism in autism: possible association with IQ. Am. J. Med. Genet. 114, 284–287. Yonkers, K.A., et al., 2011. Does antidepressant use attenuate the risk of a major depressive episode in pregnancy? Epidemiology 22, 848–854. Yoo, H.J., et al., 2009. Family- and population-based association studies of monoamine oxidase A and autism spectrum disorders in Korean. Neurosci. Res. 63, 172–176. Zahra, A., et al., 2018. Memantine rescues prenatal citalopram exposure-induced striatal and social abnormalities in mice. Exp. Neurol. 307, 145–154. Zimmerberg, B., Germeyan, S.C., 2015. Effects of neonatal fluoxetine exposure on behavior across development in rats selectively bred for an infantile affective trait. Dev. Psychobiol. 57, 141–152.

Dipietro, J.A., 2012. Maternal stress in pregnancy: considerations for fetal development. J. Adolesc. Health 51, S3–S8. Dulawa, S.C., et al., 2004. Effects of chronic fluoxetine in animal models of anxiety and depression. Neuropsychopharmacology 29, 1321–1330. Evrard, A., et al., 2002. Altered regulation of the 5-HT system in the brain of MAO-A knock-out mice. Eur. J. Neurosci. 15, 841–851. Francis, D., et al., 1999. Nongenomic transmission across generations of maternal behavior and stress responses in the rat. Science 286, 1155–1158. Gavin, N.I., et al., 2005. Perinatal depression: a systematic review of prevalence and incidence. Obstet. Gynecol. 106, 1071–1083. Gemmel, M., et al., 2017. Perinatal fluoxetine effects on social play, the HPA system, and hippocampal plasticity in pre-adolescent male and female rats: Interactions with pregestational maternal stress. Psychoneuroendocrinology 84, 159–171. Gentile, S., 2015. Prenatal antidepressant exposure and the risk of autism spectrum disorders in children. Are we looking at the fall of Gods? J. Affect Disord. 182, 132–137. Gidaya, N.B., et al., 2014. In utero exposure to selective serotonin reuptake inhibitors and risk for autism spectrum disorder. J. Autism Dev. Disord. 44, 2558–2567. Harrington, R.A., et al., 2014. Prenatal SSRI use and offspring with autism spectrum disorder or developmental delay. Pediatrics 133, e1241–e1248. He, Y., et al., 2014. Identifying individual differences of fluoxetine response in juvenile rhesus monkeys by metabolite profiling. Transl. Psychiatry 4, e478. Heikkine, T., Ekblad, U., Laine, K., 2002. Transplacental transfer of citalopram, fluoxetine and their primary demethylated metabolites in isolated perfused human placenta. BJOG 109, 1003–1008. Hertz-Picciotto, I., et al., 2006. The CHARGE study: an epidemiologic investigation of genetic and environmental factors contributing to autism. Environ. Health Perspect. 114, 1119–1125. Huybrechts, K.F., et al., 2013. National trends in antidepressant medication treatment among publicly insured pregnant women. Gen. Hosp. Psychiatry 35, 265–271. Hviid, A., Melbye, M., Pasternak, B., 2013. Use of selective serotonin reuptake inhibitors during pregnancy and risk of autism. N. Engl. J. Med. 369, 2406–2415. Iyer, C.C., et al., 2017. SMN blood levels in a porcine model of spinal muscular atrophy. J. Neuromuscul. Dis. 4, 59–66. Jakubovski, E., et al., 2016. Systematic review and meta-analysis: dose-response relationship of selective serotonin reuptake inhibitors in major depressive disorder. Am. J. Psychiatry 173, 174–183. Khatri, N., et al., 2014. Lasting neurobehavioral abnormalities in rats after neonatal activation of serotonin 1A and 1B receptors: possible mechanisms for serotonin dysfunction in autistic spectrum disorders. Psychopharmacology (Berl) 231, 1191–1200. Kim, J., et al., 2006. Stereoselective disposition of fluoxetine and norfluoxetine during pregnancy and breast-feeding. Br. J. Clin. Pharmacol. 61, 155–163. Kinney, D.K., et al., 2008. Prenatal stress and risk for autism. Neurosci. Biobehav. Rev. 32, 1519–1532. Ko, M.C., et al., 2014. Long-term consequences of neonatal fluoxetine exposure in adult rats. Dev. Neurobiol. 74, 1038–1051. Lauder, J.M., 1990. Ontogeny of the serotonergic system in the rat: serotonin as a developmental signal. Ann. N.Y. Acad. Sci. 600, 297–313 discussion 314. Lawson, S.K., Gray, A.C., Woehrle, N.S., 2016. Effects of oxytocin on serotonin 1B agonistinduced autism-like behavior in mice. Behav. Brain Res. 314, 52–64. Leboyer, M., et al., 1999. Whole blood serotonin and plasma beta-endorphin in autistic probands and their first-degree relatives. Biol. Psychiatry 45, 158–163. Lemma, S., et al., 2016. Identification and validation of housekeeping genes for gene expression analysis of cancer stem cells. PLoS One 11, e0149481. Leventhal, B.L., et al., 1990. Relationships of whole blood serotonin and plasma norepinephrine within families. J. Autism Dev. Disord. 20, 499–511. Lopez, A.D., Murray, C.C., 1998. The global burden of disease, 1990–2020. Nat. Med. 4, 1241–1243. Maciag, D., et al., 2006. Neonatal antidepressant exposure has lasting effects on behavior and serotonin circuitry. Neuropsychopharmacology 31, 47–57. Maloney, S.E., et al., 2018. Examining the reversibility of long-term behavioral disruptions in progeny of maternal ssRI exposure. eNeuro 5. Man, K.K., et al., 2015. Exposure to selective serotonin reuptake inhibitors during pregnancy and risk of autism spectrum disorder in children: a systematic review and meta-analysis of observational studies. Neurosci. Biobehav. Rev. 49, 82–89. Marquez, C., et al., 2013. Peripuberty stress leads to abnormal aggression, altered amygdala and orbitofrontal reactivity and increased prefrontal MAOA gene expression. Transl. Psychiatry 3, e216. McFarlane, H.G., et al., 2008. Autism-like behavioral phenotypes in BTBR T+tf/J mice. Genes Brain Behav. 7, 152–163. Migliarini, S., et al., 2013. Lack of brain serotonin affects postnatal development and serotonergic neuronal circuitry formation. Mol. Psychiatry 18, 1106–1118. Mitchell, A.A., et al., 2011. Medication use during pregnancy, with particular focus on prescription drugs: 1976–2008. Am. J. Obstet. Gynecol. 205 (51), e1–e8. Moy, S.S., et al., 2004. Sociability and preference for social novelty in five inbred strains: an approach to assess autistic-like behavior in mice. Genes Brain Behav. 3, 287–302. Moy, S.S., et al., 2007. Mouse behavioral tasks relevant to autism: phenotypes of 10 inbred strains. Behav. Brain Res. 176, 4–20. Nadler, J.J., et al., 2004. Automated apparatus for quantitation of social approach behaviors in mice. Genes Brain Behav. 3, 303–314. Oberlander, T.F., et al., 2006. Neonatal outcomes after prenatal exposure to selective serotonin reuptake inhibitor antidepressants and maternal depression using population-based linked health data. Arch. Gen. Psychiatry 63, 898–906.

8