- Email: [email protected]
Periodontal regeneration with multi-layered periodontal ligament-derived cell sheets in a canine model
Biomaterials 30 (2009) 2716–2723
Contents lists available at ScienceDirect
Biomaterials journal homepage: www.elsevier.com/locate/biomaterials
Periodontal regeneration with multi-layered periodontal ligament-derived cell sheets in a canine model Takanori Iwata a, Masayuki Yamato a, Hiroaki Tsuchioka b,1, Ryo Takagi a, Shigeki Mukobata c, Kaoru Washio a, Teruo Okano a, *, Isao Ishikawa a a b c
Institute of Advanced Biomedical Engineering and Science, Tokyo Women’s Medical University, 8-1 Kawada-cho, Shinjuku-ku, Tokyo 162-8666, Japan Section of Periodontology, Department of Hard Tissue Engineering, Tokyo Medical and Dental University Graduate School, 1-5-45 Yushima, Bunkyo-ku, Tokyo 113-8549, Japan CellSeed Inc., 33-8 Wakamatsu-cho, Shinjuku-ku, Tokyo 162-0056, Japan
a r t i c l e i n f o
a b s t r a c t
Article history: Received 29 December 2008 Accepted 19 January 2009 Available online 7 February 2009
Periodontal regeneration has been challenged with chemical reagents and/or biological approaches, however, there is still no sufficient technique that can regenerate complete periodontium, including alveolar bone, cementum, and well-oriented collagen fibers. The purpose of this study was to examine multi-layered sheets of periodontal ligament (PDL)-derived cells for periodontal regeneration. Canine PDL cells were isolated enzymatically and expanded in vitro. The cell population contained cells capable of making single cell-derived colonies at an approximately 20% frequency. Expression of mRNA of periodontal marker genes, S100 calcium binding protein A4 and periostin, was observed. Alkaline phosphatase activity and gene expression of both osteoblastic/cementoblastic and periodontal markers were upregulated by osteoinductive medium. Then, three-layered PDL cell sheets supported with woven polyglycolic acid were transplanted to dental root surfaces having three-wall periodontal defects in an autologous manner, and bone defects were filled with porous b-tricalcium phosphate. Cell sheet transplantation regenerated both new bone and cementum connecting with well-oriented collagen fibers, while only limited bone regeneration was observed in control group where cell sheet transplantation was eliminated. These results suggest that PDL cells have multiple differentiation properties to regenerate periodontal tissues comprising hard and soft tissues. PDL cell sheet transplantation should prove useful for periodontal regeneration in clinical settings. Ó 2009 Elsevier Ltd. All rights reserved.
Keywords: Temperature-responsive culture surfaces Periodontal ligament cells b-tricalcium phosphate
1. Introduction Periodontitis is inflammation around teeth with alveolar bone loss, and can lead to tooth loss. Recent studies indicate that periodontitis is associated with not only oral diseases but also a number of systemic diseases such as adverse pregnancy outcomes, cardiovascular disease, stroke, pulmonary disease, and diabetes [1]. Once bone loss occurred, connective tissues between alveolar bone and tooth root, Sharpey’s fibers, are degenerated and never regenerate spontaneously. Then, epithelial down-growth progresses into periodontal pockets between them. These are often observed even after the pocket reduction procedures were
* Corresponding author. Tel.: þ81 3 5367 9945x6201; fax: þ81 3 5359 6046. E-mail address: [email protected] (T. Okano). 1 Present address: Tsuchioka Dental Clinic, 4-7-3-2F Minami-Yawata, Ichikawashi, Chiba, 272-0023, Japan. 0142-9612/$ – see front matter Ó 2009 Elsevier Ltd. All rights reserved. doi:10.1016/j.biomaterials.2009.01.032
performed [2]. Periodontal regeneration, which needs regeneration of both hard and soft tissues, has been the challenge for decades because of the complexity of periodontal tissues. A number of treatments including guided tissue regeneration, bone grafting and enamel matrix derivatives were examined in animal models as well as clinical settings, however satisfied regeneration was hardly observed [3,4]. Recent studies suggest that stromal cells capable of regeneration of cementum, bone, and periodontal ligament (PDL) exist in the periodontal tissue [5,6]. Transplantation of PDL-derived cells is reported to regenerate periodontal tissue in animal models [7–9]. We also reported that PDL cell sheet can regenerate cementum and periodontal ligament in rats [10–12] and dogs [13]. In the first study, human PDL cells cultured in Dulbecco’s Modified Eagle Medium (D-MEM) with ascorbic acid (AA) enhanced periodontal regeneration in an athymic rat model [10]. Following study showed human PDL cells cultured in a-Minimum Essential Medium (aMEM) with osteoinductive reagents, which contained not only AA
T. Iwata et al. / Biomaterials 30 (2009) 2716–2723
B
A
(bp)
2717
A
C
B
400
200
ALP activity (nmol/µg DNA/min)
C
1.2 1
*
*
*
Dog1
Dog2
Dog3
Dog4
0.8 0.6 0.4 0.2 0
D
*
6
10
Relative gene expression / B2M
8
4
6 4
induction(-)
2
2
induction(+) 0
0 Dog1
Dog2
Dog3
Dog4
6
Dog1
Dog2
Dog3
Dog4
4 S100A4
4
POSTN
3 2
2
1
0
0 Dog1
E
OCN
BSP
Dog2
Dog3
F
Dog4
Dog1
Dog2
Dog3
Dog4
G
Fig. 1. Morphology and characteristics of canine periodontal ligament (PDL)-derived cells and construction of three-layered cell sheets. (A) Morphology of a single cell-derived colony of canine PDL cells. Cells were spread at the clonal density and pictures were taken after 7-day culture period. (bar, 500 mm) (B) Messenger RNA expressions of GAPDH (A), S100A4 (B), and periostin (C) in cultures of canine PDL cells. (C) ALP activity of individual canine PDL cells with (þ) or without () induction of osteoinductive supplements (100 mg/ ml AA, 10 mM bGP, and 10 nM Dex) for 5 days. Data are means SD of three culture wells. *Statistically significant difference (p < 0.05). (D) Effect of osteoinductive supplements on the gene expression of osteoblastic/cementoblastic and periodontal markers. After individual canine PDL cells were treated with (þ) or without () osteoinductive supplements (100 mg/ml AA, 10 mM bGP, and 10 nM Dex), the gene expression at day 5 was analyzed by real-time PCR. Data are means SD of three independent experiments. (E) Morphology of canine PDL cell sheet just before the transplantation. Cells were cultured in osteoinductive medium for 5 days. (bar, 500 mm) (F) Macro image of canine three-layered PDL cell sheets supported by woven PGA. (G) Hematoxylin and eosin staining of three-layered PDL cell sheets. (bar, 50 mm).
2718
T. Iwata et al. / Biomaterials 30 (2009) 2716–2723
but also b-glycerophosphate (bGP) and dexamethasone (Dex), induced thicker cementum than that cultured in a-MEM only [12], suggesting osteoinductive reagents might be effective to create thick cementum on denuded root surfaces. Another study also demonstrated that three-layered human PDL cell sheets cultured in osteoinductive medium regenerated thick cementum including Sharpey’s fibers in a rat back model [11]. In a canine model, we showed periodontal regeneration using a monolayered canine PDL cell sheet reinforced with hyaluronan. However its success rate was 60% (3 out of 5) and bone regeneration was limited [13]. In the present study, we utilized and modified cell sheet-based periodontal regeneration using three-layered cell sheets derived from PDL tissue. Canine PDL cells are characterized, expanded in vitro, and transplanted into periodontal defects with porous b-tricalcium phosphate (bTCP) in dogs, then histometric measurements and radio-graphic examinations were performed after 6-weekhealing period. 2. Materials and methods All experimental protocols were approved by the animal welfare committee of Tokyo Women’s Medical University. 2.1. PDL cell culture Four beagle dogs (10 kg, male) were intramuscularly injected with 0.04 mg/kg atropine and 15 mg/kg ketamine for anesthetic premedication, then subjected to intravenous injection of 2.5 mg/kg propofol. An endotracheal tube was inserted and anesthesia was maintained with sevoflurane and nitrous oxide inhalation. Local anesthesia was performed with 2% lidocaine hydrochloride containing epinephrine at a concentration of 1:80000 (Xylocaine, Fujisawa, Osaka, Japan). All mandibular premolars of four dogs were extracted and the wounds were sutured 5 weeks before transplantation. Extracted teeth were rinsed with a-MEM (Invitrogen, Carlsbad, CA) containing 100 units/ml penicillin and 100 mg/ml streptomycin (Invitrogen) for 3 min 5 times. PDL tissues were gently separated from the surface of the mid-third of root, then dispersed with 3 mg/mL collagenase type I (Worthington Biochem, Freehold, NJ) in a-MEM for 45 min at 37 C. Single cell suspensions were obtained by passing cells through a 70-mm strainer (Falcon, BD Labware, Franklin Lakes, NJ), and seeded at the clonal density, which was less than 1000 cells per 35-mm PrimariaÔ culture dish (Falcon). Single cell-derived colonies were cultured in complete medium (a-MEM supplemented with 100 units/ml penicillin and 100 mg/ml streptomycin containing 10% fetal bovine serum (Moregate Biotech, Queensland Australia) at 37 C in a humidified atmosphere of 95% air and 5% CO2. The cells were harvested with 0.25% trypsin and 1 mM ethylenediamine tetraacetic acid (EDTA, Invitrogen) at 37 C for 3 min, and then counted with a hemocytometer to determine the number of cells at passage 0. 2.2. Colony-forming assay Cells at passage 1 were plated at a density of 100 cells/60 cm2 dish, and cultured in complete medium for 14 days, and stained with 0.5% crystal violet in methanol for 5 min as previously described by Nimura et al.[14]. The cells were washed twice with distilled water, and the number of colonies was counted. Colonies less than 2 mm in diameter and/or faintly stained were ignored. 2.3. Alkaline phosphatase (ALP) activity Cells were plated onto 96-well plates at a density of 1 104 cells/well and cultured in complete medium for 48 h, then medium was changed to complete medium with or without osteoinductive supplements, 100 mg/ml AA (WAKO, Tokyo, Japan), 10 mM bGP (Sigma–Aldrich, St. Louis, MO), and 10 nM Dex (Wako). After 5 additional days of culture, cells were washed once with Dulbecco’s phosphate buffered saline (Invitrogen), and ALP activity was evaluated after the incubation with 10 mM p-nitrophenylphosphate as a substrate in 100 mM 2-amino-2-methyl-1, 3-propanediol-HCl buffer (pH 10.0) containing 5 mM MgCl2 for 5 min at 37 C. The addition of NaOH quenched the reaction, and the absorbance at 405 nm was read on a plate reader (Bio-Rad Model 450, Hercules, CA, USA) and normalized by DNA content. 2.4. Isolation of RNA and the polymerase chain reaction (PCR) Total RNA was isolated with QIA shredder and RNeasy Mini Kit (QIAGEN, Valencia, CA) according to the manufacture’s instruction. Thereafter, cDNA was synthesized from 1 mg of the total RNA using Superscript 3 (Invitrogen). The PCR reactions with AccuPrimeÔ SuperMix I (Invitrogen) proceeded as follows: 2 min of denaturation at
95 C, followed by 30 cycles consisting of denaturation at 95 C for 15 s, primer annealing at 55 C for 30 s, and elongation at 68 C for 30 s. The final elongation was at 68 C for 5 min. PCR primers were designed based upon canine mRNA sequences in the GenBank database. The primer pairs were as follows: GAPDH (GenBank Accession no. NM_001003142, 336 bp; sense 50 -TTACTCCTTGGAGGCCATGT, antisense 50 AACGGGAAGCTCACTGGCAT), S100A4 NP_001003161, 184 bp; sense 50 -GGAperiostin GAAGGCTCTGGATGTGA, antisense 50 -TCTGTTGCTGTCCAAGTTGC), XM_534490, 245 bp, sense 50 -TCAAAGAAATCCCCATGACTG, antisense 50 -CACAGGCACTCCATCAATGA). The PCR products were resolved by electrophoresis on a 2% agarose gel stained with ethidium bromide. 2.5. Quantitative real-time polymerase chain reaction (PCR) Cells were plated onto 35 mm dishes at a density of 3 104 cells/dish. After 2day period, the medium was replaced to complete medium with or without osteoinductive supplements, 100 mg/ml AA, 10 mM bGP, and 10 nM Dex. Additional 5 days of culture, total RNA was isolated with QIA shredder and RNeasy Plus Mini Kit (QIAGEN) according to the manufacture’s instruction. Thereafter, cDNA was synthesized from 500 ng of the total RNA using SuperScriptÒ VILOÔ cDNA Synthesis Kit (Invitrogen). Real-time PCR was performed in triplicate using the specific primers-probe for bone sialoprotein (BSP, Applied Biosystems, Foster City, CA. ABI assay number: Cf02689784_m1), osteocalcin (OCN, Cf02623891_g1), S100 calcium binding protein A4 (S100A4, Cf02622009_m1), periostin (POSTN, Cf02633583_m1), or beta-2-microglobulin (B2M, Cf02659077_m1), and analyzed by the Applied Biosystems 7300 Real-Time PCR System (Applied Biosystems). The mean fold changes in gene expression relative to B2M were calculated using the values obtained from untreated canine PDL cells of each dog as a calibrator by means of 2DDCT method [15]. All analyses were done in triplicate and the results were confirmed by two independent experiments. 2.6. Cell sheet transplantation After 5-week period of healing and cell culture, 3-wall infrabony defects (5 5 4 mm in depth, mesio-distal width, and bucco-lingual width, respectively) were created surgically on the mesial side of bilateral mandibular first molars (Fig. 2A and B). Root cementum was removed completely with curettes and conditioning with 19% EDTA (Sigma–Aldrich) was performed for 2 min to enhance the cell attachment [16]. Canine PDL cells at passage 3 were seeded on temperatureresponsive culture dishes (35 mm in diameter, UpCellÒ, CellSeed, Tokyo, Japan) at a cell density of 3 104 cells/dish, and cultured in complete medium supplement with 100 mg/mL AA for 3 days. We chose this initial density because these cells were sometimes detached from the dish surfaces when they reached overconfluency. Then, culture medium was changed to osteoinductive medium supplement with 100 mg/ml AA, 10 mM bGP, and 10 nM Dex, and cells were cultured additional 2 days to reach overconfluency. For cell sheet harvest, temperature was reduced to room temperature, then culture medium was aspirated and a wet sheet of woven polyglycolic acid (PGA) (NeoveilÒ, PGA Felt-Sheet Type, 0.15 mm in thickness: Gunze, Tokyo, Japan) was placed on the apical surface of cells. In the present study, woven PGA approved for clinical use by Ministry of Health, Labour and Welfare of Japan was employed as a carrier, because of its advantages of cell sheet handling and biocompatibility. Since PGA sheets stuck cell sheets detached from the dish surfaces within several seconds, PGA sheets together with cell sheets were harvested by peeling them from the dishes with forceps. This procedure was repeated two more times, and finally layering of three PDL cell sheets was achieved within 2 min (see Supplementary video). Three-layered was chosen based on a previous study [11] and the thickness of transplant to avoid necrosis [17]. Three-layered PDL cell sheets supported by PGA sheets were trimmed to the size of defects, and applied to the exposed root surfaces in the experimental group, while only PGA sheets were applied in the control group. Infrabony defects were filled with porous bTCP (OsferionÒ, Olympus Terumo Biomaterials, Tokyo, Japan) (Fig. 2C). Finally, gingival flaps were re-positioned and sutured. Post-surgical managements involved antibiotics (Penicillin G, 200,000 units) daily for 3 days, a soft diet, and topical application of 2% solution of chlorhexidine (HibitaneÒ concentrate, Sumitomo, Osaka, Japan) twice a week until the end of experiments. The sutures were removed 2 weeks after surgery. 2.7. Quantitative and histological evaluation of periodontal tissue regeneration At 6 weeks after transplantation, all animals were sacrificed. Surgical sites were dissected, fixed in 10% neutral buffered formalin (Wako), and subjected to microcomputed tomography (mCT) analyses with SkyScan 1076 (Skyscan, Kontich, Belgium). Then, samples were decalcified in Plank-Rychro solution (WAKO) for 6 weeks, routinely processed into 6-mm thick paraffin-embedded sections, stained with hematoxylin–eosin (HE) or Azan, and observed under a microscope (Eclipse E800, Nikon, Tokyo, Japan). Sections were also observed by polarizing microscopy and differential interference contrast microscopy. Histometric and morphometric analyses were performed with a software (Photoshop, Adobe, San Jose, CA). Three sections approximately 60 mm apart were selected from the most central area of defects, identified by micro-CT analysis and the size of the root canal. The mean
T. Iwata et al. / Biomaterials 30 (2009) 2716–2723 value of each histometric parameter was calculated for each site. The following parameters were measured by two calibrated examiners who were blinded to the experimental conditions. (i) New bone height (%): distance between apical extension of root planing and coronal extension of new alveolar bone along the planed root was divided by defect height: distance between apical extension of root planing and cemento-enamel junction (CEJ). (ii) Apical extension of the junctional epithelium (mm): the distance between the apical extension of the junctional epithelium and CEJ. (iii) Cementum regeneration (%): the distance between the apical extent of root planing and the coronal extent of newly formed cementum and cementum-like deposit on the denuded root surface was divided by defect height. (iv) Periodontal score: each specimen was scored as outlined by Wikesjo et al. [18] at the apical extent of newly formed bone. The mean SD (n ¼ 4) was shown, and significance was evaluated using Student t-test.
2719
between bone and cementum in the control group (Fig. 5A&C). There were significant differences in bone regeneration, cementum regeneration, and periodontal score between the experimental group and the control group (Table 1).
3. Results Primary canine PDL cells were seeded at an extremely low-cell density in order to select cells having high replicative potential. Seven days after plating, numerous colonies were formed, and each cell in the colonies resembled fibroblasts or mesenchymal stromal cells in morphology (Fig. 1A). Colony-forming efficiency was 15–25% at passage 1 (data not shown). RT-PCR revealed that these cells expressed known PDL-specific markers of S100A4 [19,20] and periostin [21] (Fig. 1B). ALP activity of each canine PDL cells was enhanced by osteoinductive medium with statistical significance (Fig. 1C), and the mRNA expression of both osteoblastic/cementoblastic markers (BSP and OCN) and periodontal markers (S100A4 and POSTN) was also upregulated by osteoinductive medium in a 5day-period of induction (Fig. 1D). Canine PDL cells at passage 3 were cultured in osteoinductive medium for 5 days before transplantation. After reaching overconfluency (Fig. 1E), three-layered PDL cell sheets were constructed with thin PGA sheets (Fig. 1F and Supplemental video). Since adhesion between cell sheets were relatively weak when these constructs were subjected to histological processing immediately after layering of three cell sheets, each cell sheet and PGA sheet were detached during the processing (Fig. 1G). The thickness of three-layered cell sheets was around 50 mm. Schematic illustration of artificial periodontal defects and threelayered cell sheets transplantation was shown in Fig. 2A. Periodontal defects were surgically created (Fig. 2B), then three-layered PDL cell sheets were set onto the surfaces of dental roots. Threewall infrabony defects were filled with porous bTCP (Fig. 2C). Healing occurred uneventfully and no intense inflammatory reaction was observed during the whole period. No visible adverse reactions including root exposure, infection and suppuration were observed until the time point of sacrifice 6 weeks after surgery. 2D images of Micro-CT analysis demonstrated that almost 50% of bone filling was observed in the control group (Fig. 3A). In contrast, complete bone filling with an appropriate space of periodontal ligament was observed in the experimental group (Fig. 3B). Periodontal defect was still observed in a 3D virtual model after 6week-healing period in the control group (Fig. 3C). On the other hand, completely bone filled alveolar ridge was seen in the experimental group (Fig. 3D). From the histometric analysis, there was no significant difference in the apical extension of the junctional epithelium between the experimental group and the control group (Fig. 4 and Table 1). Ankylosis was not observed in any samples. Complete periodontal regeneration with both of newly formed bone and cementum connecting with well-oriented collagen fibers were observed only in all of the experimental group (Fig. 4B), whereas limited bone regeneration with poor-oriented periodontal fibers were seen in the control group (Fig. 4A). Higher magnification revealed ligament-like tissues were observed adjacent to the newly formed bone and cementum in Azan staining (Fig. 5B), which was further confirmed by the presence of unique collagen fibers when the tissue was visualized under polarized light (Fig. 5D) in the experimental group. Such connective tissues were not observed
Fig. 2. Three-wall infrabony defect in dog. (A) Schematic illustration of artificial periodontal defects and three-layered cell sheets transplantation. After three-wall bone defect was created, root surface was curetted to remove all periodontal ligament and cementum. Then, three-layered PDL cell sheets supported by woven PGA were transplanted to the root surface. Note cell sheets were directly attached to the naked surface. (B) After the flap was raised, 3-wall infrabony defects (5 5 4 mm, depth, mesio-distal width, and bucco-lingual width, respectively) were surgically created on the mesial side of bilateral mandibular first molars of dogs. (C) Three-layered PDL cell sheets were trimmed and applied to the mechanically and chemically planed root surface. After transplantation of cell sheets, porous bTCP (OsferionÒ) was filled in the infrabony defect.
2720
T. Iwata et al. / Biomaterials 30 (2009) 2716–2723
Fig. 3. Micro-CT analysis of periodontal defects after 6-week period of healing. (A, B) 2D image of the 3-wall defect transplanted with bTCP (A) or three-layered PDL cell sheets/bTCP (B). Triangle indicates cement-enamel junction (CEJ) of bilateral mandibular first molars of dog. (bar, 1 mm) (C, D) 3D virtual model of the 3-wall defect transplanted with bTCP (C) or three-layered PDL cell sheets/bTCP (D). After the 6 week of healing period, micro-CT analysis was performed and images were reconstructed with VG max software.
4. Discussion In the present study, we successfully expanded primary canine PDL cells in vitro and fabricated transplantable constructs composing three-layered PDL cell sheets and a PGA sheet as a supporter. Because of the limited initial adhesion of primary canine PDL cells [13], PrimariaÔ culture dish was utilized to promote cell adhesion. By reducing seeding cell density as reported previously [14] with some modifications, highly proliferative PDL cells were selected. In the present study, primary PDL cells were enzymatically isolated. These cells were higher in proliferative capacity and smaller in cell size than those cells isolated by an explant method, implying that enzymatic digestion can facilitate rapid cell expansion with stromal or progenitor phenotypes (data not shown). Despite intensive research efforts, no definitive markers specific to PDL cells have not been shown. Among these candidates reported previously, gene expression of S100A4 [19,20] and periostin [21] were examined and both genes were expressed by isolated PDL cells in the present study. PDL tissues are very unique because they are never calcified spontaneously even they are located in a close gap between two types of hard tissues, bone and cementum. Duarte et al. proposed that S100A4 can be a negative regulator of mineralization in PDL tissues [19,20]. Periostin that is known to be strongly expressed in PDL tissues [21] is suggested to be essential for the integrity and function of PDL [22]. In addition, we investigated the differentiation capacity of canine PDL cells. We confirmed the capacities of osteoblastic/ cementoblastic differentiation in each canine PDL cells from the results of both ALP activity and gene expression, suggesting culture
of 5-day-period with osteoinductive medium can induce cytodifferentiation of each canine PDL cells with varying degrees. Considering the previous studies which demonstrated that PDL cells cultured with osteoinductive medium could regenerate newly formed cementum-like tissues [11,12], we cultured PDL cells with osteoinductive medium then transplanted into periodontal defects. In this study, we first utilized a poly (vinylidine difluoride) membrane for the transfer of cell sheets onto teeth root surfaces and the membrane was recovered after the transfer as previously described [23]. In this case, transplanted cell sheets were hardly seen on the teeth root surfaces, because the colour was similar among cell sheets and root surfaces. This shortcoming might hamper reliable and reproducible transplantation of cell sheets, since the attachment of cell sheets onto hard tissue surfaces is weaker than that onto soft tissues. Therefore, we considered to use hyaluronan membrane [13], that were co-transplanted with cell sheets in the next study. We performed periodontal regeneration with monolayered PDL cell sheet combined with hyaluronan in a canine dehiscence defects. However, the success rate was 60% (3 of 5 dogs) and authors concluded that it may be due to the low cell sheet stability on the denuded root surface [13]. Thus, we need a definite method for delivery and stability of cell sheet transplant with a safe biomaterial which is approved for clinical settings. In addition, this hyaluronan membrane was fabricated in house, and wasn’t approved for clinical use by Ministry of Health, Labour and Welfare of Japan. Since our final goal is its clinical application, we finally selected a commercially available material, PGA membrane, which is already approved for clinical use. The PGA membrane facilitated quick fabrication of transplantable constructs of three-
T. Iwata et al. / Biomaterials 30 (2009) 2716–2723
2721
Fig. 4. Photomicrographs of contralateral defect sites receiving bTCP (A) and PDL cell sheets/bTCP (B). Note functionally well-oriented periodontal fibers with newly formed bone are seen only in the experimental group (B) (bar, 1 mm; Azan staining).
Table 1 Histometric analysis of periodontal regeneration of 3-wall defects.
Junctional epithelium (mm) Bone regeneration (%) Cementum regeneration (%) Periodontal score (1–5)
Cell Sheet (n ¼ 4)
Negative Control (n ¼ 4)
p-value
0.01 0.12 76.95 5.08 78.22 5.50 4.63 0.25
0.19 0.51 52.74 14.34 47.69 11.10 3.50 0.41
0.47 0.035* 0.012* 0.0030*
Group means SD. n ¼ number of sites. * Statistically significant difference (p < 0.05).
layered cell sheets, and was co-transplanted with the constructs onto the teeth root surface. These improvements of cell sheet handling encouraged us to promote PDL cell sheet transplantation. Furthermore, PGA did not cause any significant harmful side effects such as remarkable inflammation during 6 weeks of healing period in all dogs. Recently, it was reported that tenocytes cultured on PGA scaffolds regenerated a complex extensor tendon structure even in vitro, and showed further maturation after transplantation in vivo [24], suggesting that PGA might be also suitable for the regeneration of tendon/ligament-like structures. Finally, we successively demonstrated alveolar bone regeneration with proper oriented periodontal ligament and cementum in the experimental group, which was not observed in our previous studies [10,12,13]. In the control group, we also observed alveolar bone regeneration from the bottom side of defects which might be induced by bTCP, which have shown favorable biocompatibility, osteoconduction and resorption properties [25]. In contrast, bone regeneration of the upper site of the defects was hardly seen in the control group, suggesting transplanted PDL cell sheets might promote bone regeneration in the upper site of defects in the experimental group. It
may be possible that bTCP have osteoinductive effects on PDL cells and also useful for alveolar bone regeneration as previously described [26]. 5. Conclusion Transplantable multi-layered PDL cell sheets were successfully fabricated with woven PGA and the combination use with porous bTCP induced the true periodontal regeneration, including alveolar bone, cementum and well-oriented fibers at the same time. Acknowledgements The authors thank Drs. Michihiko Usui, Noriko Kawakatsu, Hiroyuki Aoki, Kazuto Sakai, Reiko Yashiro, Tatsuya Akizuki, and Ikufumi Sato for their assistance. This study was supported by Formation of Innovation Center for Fusion of Advanced Technologies in the Special Coordination Funds for Promoting Science and Technology from the Ministry of Education, Culture, Sports, Science and Technology (MEXT), Japan.
2722
T. Iwata et al. / Biomaterials 30 (2009) 2716–2723
Fig. 5. Higher magnification of Fig. 4 (A, C: bTCP, B, D: PDL cell sheets/bTCP). Complete periodontal regeneration, functionally well-oriented periodontal fibers connecting with both newly formed cementum and bone (arrowhead), is observed in the experimental group by Azan staining (B) and by polarized light (D). In contrast, such well-oriented fibers are not observed in the control group (A and C) (bar, 500 mm).
Appendix Figures with essential colour discrimination. Parts of the majority of the figures in this article are difficult to interpret in black and white. The full colour images can be found in the on-line version, at doi:10.1016/j.biomaterials.2009.01.032. Appendix. Supplementary material Supplementary material can be found, in the online version, at doi:10.1016/j.biomaterials.2009.01.032. References [1] Pihlstrom BL, Michalowicz BS, Johnson NW. Periodontal diseases. Lancet 2005;366:1809–20. [2] Caton J, Nyman S, Zander H. Histometric evaluation of periodontal surgery. II. Connective tissue attachment levels after four regenerative procedures. J Clin Periodontol 1980;7:224–31. [3] Esposito M, Grusovin MG, Coulthard P, Worthington HV. Enamel matrix derivative (Emdogain) for periodontal tissue regeneration in intrabony defects. Cochrane Database Syst Rev 2005. CD003875. [4] Bartold PM, Xiao Y, Lyngstaadas SP, Paine ML, Snead ML. Principles and applications of cell delivery systems for periodontal regeneration. Periodontology 2000;2006(41):123–35. [5] Seo BM, Miura M, Gronthos S, Bartold PM, Batouli S, Brahim J, et al. Investigation of multipotent postnatal stem cells from human periodontal ligament. Lancet 2004;364:149–55. [6] Nagatomo K, Komaki M, Sekiya I, Sakaguchi Y, Noguchi K, Oda S, et al. Stem cell properties of human periodontal ligament cells. J Periodont Res 2006;41:303–10. [7] Nakahara T, Nakamura T, Kobayashi E, Kuremoto K, Matsuno T, Tabata Y, et al. In situ tissue engineering of periodontal tissues by seeding with periodontal ligament-derived cells. Tissue Eng 2004;10:537–44. [8] Liu Y, Zheng Y, Ding G, Fang D, Zhang C, Bartold PM, et al. Periodontal ligament stem cell-mediated treatment for periodontitis in miniature swine. Stem Cells 2008;26:1065–73.
[9] Sonoyama W, Liu Y, Fang D, Yamaza T, Seo BM, Zhang C, et al. Mesenchymal stem cell-mediated functional tooth regeneration in swine. PLoS ONE 2006;1:e79. [10] Hasegawa M, Yamato M, Kikuchi A, Okano T, Ishikawa I. Human periodontal ligament cell sheets can regenerate periodontal ligament tissue in an athymic rat model. Tissue Eng 2005;11:469–78. [11] Flores MG, Hasegawa M, Yamato M, Takagi R, Okano T, Ishikawa I. Cementum– periodontal ligament complex regeneration using the cell sheet technique. J Periodont Res 2008;43:364–71. [12] Flores MG, Yashiro R, Washio K, Yamato M, Okano T, Ishikawa I. Periodontal ligament cell sheet promotes periodontal regeneration in athymic rats. J Clin Periodontol 2008;35:1066–72. [13] Akizuki T, Oda S, Komaki M, Tsuchioka H, Kawakatsu N, Kikuchi A, et al. Application of periodontal ligament cell sheet for periodontal regeneration: a pilot study in beagle dogs. J Periodont Res 2005;40:245–51. [14] Nimura A, Muneta T, Koga H, Mochizuki T, Suzuki K, Makino H, et al. Increased proliferation of human synovial mesenchymal stem cells with autologous human serum: comparisons with bone marrow mesenchymal stem cells and with fetal bovine serum. Arthritis Rheum 2008;58:501–10. [15] Livak KJ, Schmittgen TD. Analysis of relative gene expression data using real-time quantitative PCR and the 2(T) (-Delta Delta C) method. Methods 2001;25:402–8. [16] Maruyama H, Aoki A, Sasaki KM, Takasaki AA, Iwasaki K, Ichinose S, et al. The effect of chemical and/or mechanical conditioning on the Er:YAG laser-treated root cementum: analysis of surface morphology and periodontal ligament fibroblast attachment. Lasers Surg Med 2008;40:211–22. [17] Shimizu T, Sekine H, Yang J, Isoi Y, Yamato M, Kikuchi A, et al. Polysurgery of cell sheet grafts overcomes diffusion limits to produce thick, vascularized myocardial tissues. FASEB J 2006;20:708–10. [18] Wikesjo UM, Sorensen RG, Kinoshita A, Jian Li X, Wozney JM. Periodontal repair in dogs: effect of recombinant human bone morphogenetic protein-12 (rhBMP-12) on regeneration of alveolar bone and periodontal attachment. J Clin Periodontol 2004;31:662–70. [19] Duarte WR, Iimura T, Takenaga K, Ohya K, Ishikawa I, Kasugai S. Extracellular role of S100A4 calcium-binding protein in the periodontal ligament. Biochem Biophys Res Commun 1999;255:416–20. [20] Kato C, Kojima T, Komaki M, Mimori K, Duarte WR, Takenaga K, et al. S100A4 inhibition by RNAi up-regulates osteoblast related genes in periodontal ligament cells. Biochem Biophys Res Commun 2005;326:147–53. [21] Horiuchi K, Amizuka N, Takeshita S, Takamatsu H, Katsuura M, Ozawa H, et al. Identification and characterization of a novel protein, periostin, with restricted expression to periosteum and periodontal ligament and increased
T. Iwata et al. / Biomaterials 30 (2009) 2716–2723 expression by transforming growth factor beta. J Bone Miner Res 1999;14: 1239–49. [22] Rios HF, Ma D, Xie Y, Giannobile WV, Bonewald LF, Conway SJ, et al. Periostin is essential for the integrity and function of the periodontal ligament during occlusal loading in mice. J Periodontol 2008;79:1480–90. [23] Ohki T, Yamato M, Murakami D, Takagi R, Yang J, Namiki H, et al. Treatment of oesophageal ulcerations using endoscopic transplantation of tissue-engineered autologous oral mucosal epithelial cell sheets in a canine model. Gut 2006;55:1704–10.
2723
[24] Wang B, Liu W, Zhang Y, Jiang Y, Zhang WJ, Zhou G, et al. Engineering of extensor tendon complex by an ex vivo approach. Biomaterials 2008;29: 2954–61. [25] Gaasbeek RD, Toonen HG, van Heerwaarden RJ, Buma P. Mechanism of bone incorporation of beta-TCP bone substitute in open wedge tibial osteotomy in patients. Biomaterials 2005;26:6713–9. [26] Yamauchi K, Takahashi T, Funaki K, Yamashita Y. Periosteal expansion osteogenesis using highly purified beta-tricalcium phosphate blocks: a pilot study in dogs. J Periodontol 2008;79:999–1005.
Contents lists available at ScienceDirect
Biomaterials journal homepage: www.elsevier.com/locate/biomaterials
Periodontal regeneration with multi-layered periodontal ligament-derived cell sheets in a canine model Takanori Iwata a, Masayuki Yamato a, Hiroaki Tsuchioka b,1, Ryo Takagi a, Shigeki Mukobata c, Kaoru Washio a, Teruo Okano a, *, Isao Ishikawa a a b c
Institute of Advanced Biomedical Engineering and Science, Tokyo Women’s Medical University, 8-1 Kawada-cho, Shinjuku-ku, Tokyo 162-8666, Japan Section of Periodontology, Department of Hard Tissue Engineering, Tokyo Medical and Dental University Graduate School, 1-5-45 Yushima, Bunkyo-ku, Tokyo 113-8549, Japan CellSeed Inc., 33-8 Wakamatsu-cho, Shinjuku-ku, Tokyo 162-0056, Japan
a r t i c l e i n f o
a b s t r a c t
Article history: Received 29 December 2008 Accepted 19 January 2009 Available online 7 February 2009
Periodontal regeneration has been challenged with chemical reagents and/or biological approaches, however, there is still no sufficient technique that can regenerate complete periodontium, including alveolar bone, cementum, and well-oriented collagen fibers. The purpose of this study was to examine multi-layered sheets of periodontal ligament (PDL)-derived cells for periodontal regeneration. Canine PDL cells were isolated enzymatically and expanded in vitro. The cell population contained cells capable of making single cell-derived colonies at an approximately 20% frequency. Expression of mRNA of periodontal marker genes, S100 calcium binding protein A4 and periostin, was observed. Alkaline phosphatase activity and gene expression of both osteoblastic/cementoblastic and periodontal markers were upregulated by osteoinductive medium. Then, three-layered PDL cell sheets supported with woven polyglycolic acid were transplanted to dental root surfaces having three-wall periodontal defects in an autologous manner, and bone defects were filled with porous b-tricalcium phosphate. Cell sheet transplantation regenerated both new bone and cementum connecting with well-oriented collagen fibers, while only limited bone regeneration was observed in control group where cell sheet transplantation was eliminated. These results suggest that PDL cells have multiple differentiation properties to regenerate periodontal tissues comprising hard and soft tissues. PDL cell sheet transplantation should prove useful for periodontal regeneration in clinical settings. Ó 2009 Elsevier Ltd. All rights reserved.
Keywords: Temperature-responsive culture surfaces Periodontal ligament cells b-tricalcium phosphate
1. Introduction Periodontitis is inflammation around teeth with alveolar bone loss, and can lead to tooth loss. Recent studies indicate that periodontitis is associated with not only oral diseases but also a number of systemic diseases such as adverse pregnancy outcomes, cardiovascular disease, stroke, pulmonary disease, and diabetes [1]. Once bone loss occurred, connective tissues between alveolar bone and tooth root, Sharpey’s fibers, are degenerated and never regenerate spontaneously. Then, epithelial down-growth progresses into periodontal pockets between them. These are often observed even after the pocket reduction procedures were
* Corresponding author. Tel.: þ81 3 5367 9945x6201; fax: þ81 3 5359 6046. E-mail address: [email protected] (T. Okano). 1 Present address: Tsuchioka Dental Clinic, 4-7-3-2F Minami-Yawata, Ichikawashi, Chiba, 272-0023, Japan. 0142-9612/$ – see front matter Ó 2009 Elsevier Ltd. All rights reserved. doi:10.1016/j.biomaterials.2009.01.032
performed [2]. Periodontal regeneration, which needs regeneration of both hard and soft tissues, has been the challenge for decades because of the complexity of periodontal tissues. A number of treatments including guided tissue regeneration, bone grafting and enamel matrix derivatives were examined in animal models as well as clinical settings, however satisfied regeneration was hardly observed [3,4]. Recent studies suggest that stromal cells capable of regeneration of cementum, bone, and periodontal ligament (PDL) exist in the periodontal tissue [5,6]. Transplantation of PDL-derived cells is reported to regenerate periodontal tissue in animal models [7–9]. We also reported that PDL cell sheet can regenerate cementum and periodontal ligament in rats [10–12] and dogs [13]. In the first study, human PDL cells cultured in Dulbecco’s Modified Eagle Medium (D-MEM) with ascorbic acid (AA) enhanced periodontal regeneration in an athymic rat model [10]. Following study showed human PDL cells cultured in a-Minimum Essential Medium (aMEM) with osteoinductive reagents, which contained not only AA
T. Iwata et al. / Biomaterials 30 (2009) 2716–2723
B
A
(bp)
2717
A
C
B
400
200
ALP activity (nmol/µg DNA/min)
C
1.2 1
*
*
*
Dog1
Dog2
Dog3
Dog4
0.8 0.6 0.4 0.2 0
D
*
6
10
Relative gene expression / B2M
8
4
6 4
induction(-)
2
2
induction(+) 0
0 Dog1
Dog2
Dog3
Dog4
6
Dog1
Dog2
Dog3
Dog4
4 S100A4
4
POSTN
3 2
2
1
0
0 Dog1
E
OCN
BSP
Dog2
Dog3
F
Dog4
Dog1
Dog2
Dog3
Dog4
G
Fig. 1. Morphology and characteristics of canine periodontal ligament (PDL)-derived cells and construction of three-layered cell sheets. (A) Morphology of a single cell-derived colony of canine PDL cells. Cells were spread at the clonal density and pictures were taken after 7-day culture period. (bar, 500 mm) (B) Messenger RNA expressions of GAPDH (A), S100A4 (B), and periostin (C) in cultures of canine PDL cells. (C) ALP activity of individual canine PDL cells with (þ) or without () induction of osteoinductive supplements (100 mg/ ml AA, 10 mM bGP, and 10 nM Dex) for 5 days. Data are means SD of three culture wells. *Statistically significant difference (p < 0.05). (D) Effect of osteoinductive supplements on the gene expression of osteoblastic/cementoblastic and periodontal markers. After individual canine PDL cells were treated with (þ) or without () osteoinductive supplements (100 mg/ml AA, 10 mM bGP, and 10 nM Dex), the gene expression at day 5 was analyzed by real-time PCR. Data are means SD of three independent experiments. (E) Morphology of canine PDL cell sheet just before the transplantation. Cells were cultured in osteoinductive medium for 5 days. (bar, 500 mm) (F) Macro image of canine three-layered PDL cell sheets supported by woven PGA. (G) Hematoxylin and eosin staining of three-layered PDL cell sheets. (bar, 50 mm).
2718
T. Iwata et al. / Biomaterials 30 (2009) 2716–2723
but also b-glycerophosphate (bGP) and dexamethasone (Dex), induced thicker cementum than that cultured in a-MEM only [12], suggesting osteoinductive reagents might be effective to create thick cementum on denuded root surfaces. Another study also demonstrated that three-layered human PDL cell sheets cultured in osteoinductive medium regenerated thick cementum including Sharpey’s fibers in a rat back model [11]. In a canine model, we showed periodontal regeneration using a monolayered canine PDL cell sheet reinforced with hyaluronan. However its success rate was 60% (3 out of 5) and bone regeneration was limited [13]. In the present study, we utilized and modified cell sheet-based periodontal regeneration using three-layered cell sheets derived from PDL tissue. Canine PDL cells are characterized, expanded in vitro, and transplanted into periodontal defects with porous b-tricalcium phosphate (bTCP) in dogs, then histometric measurements and radio-graphic examinations were performed after 6-weekhealing period. 2. Materials and methods All experimental protocols were approved by the animal welfare committee of Tokyo Women’s Medical University. 2.1. PDL cell culture Four beagle dogs (10 kg, male) were intramuscularly injected with 0.04 mg/kg atropine and 15 mg/kg ketamine for anesthetic premedication, then subjected to intravenous injection of 2.5 mg/kg propofol. An endotracheal tube was inserted and anesthesia was maintained with sevoflurane and nitrous oxide inhalation. Local anesthesia was performed with 2% lidocaine hydrochloride containing epinephrine at a concentration of 1:80000 (Xylocaine, Fujisawa, Osaka, Japan). All mandibular premolars of four dogs were extracted and the wounds were sutured 5 weeks before transplantation. Extracted teeth were rinsed with a-MEM (Invitrogen, Carlsbad, CA) containing 100 units/ml penicillin and 100 mg/ml streptomycin (Invitrogen) for 3 min 5 times. PDL tissues were gently separated from the surface of the mid-third of root, then dispersed with 3 mg/mL collagenase type I (Worthington Biochem, Freehold, NJ) in a-MEM for 45 min at 37 C. Single cell suspensions were obtained by passing cells through a 70-mm strainer (Falcon, BD Labware, Franklin Lakes, NJ), and seeded at the clonal density, which was less than 1000 cells per 35-mm PrimariaÔ culture dish (Falcon). Single cell-derived colonies were cultured in complete medium (a-MEM supplemented with 100 units/ml penicillin and 100 mg/ml streptomycin containing 10% fetal bovine serum (Moregate Biotech, Queensland Australia) at 37 C in a humidified atmosphere of 95% air and 5% CO2. The cells were harvested with 0.25% trypsin and 1 mM ethylenediamine tetraacetic acid (EDTA, Invitrogen) at 37 C for 3 min, and then counted with a hemocytometer to determine the number of cells at passage 0. 2.2. Colony-forming assay Cells at passage 1 were plated at a density of 100 cells/60 cm2 dish, and cultured in complete medium for 14 days, and stained with 0.5% crystal violet in methanol for 5 min as previously described by Nimura et al.[14]. The cells were washed twice with distilled water, and the number of colonies was counted. Colonies less than 2 mm in diameter and/or faintly stained were ignored. 2.3. Alkaline phosphatase (ALP) activity Cells were plated onto 96-well plates at a density of 1 104 cells/well and cultured in complete medium for 48 h, then medium was changed to complete medium with or without osteoinductive supplements, 100 mg/ml AA (WAKO, Tokyo, Japan), 10 mM bGP (Sigma–Aldrich, St. Louis, MO), and 10 nM Dex (Wako). After 5 additional days of culture, cells were washed once with Dulbecco’s phosphate buffered saline (Invitrogen), and ALP activity was evaluated after the incubation with 10 mM p-nitrophenylphosphate as a substrate in 100 mM 2-amino-2-methyl-1, 3-propanediol-HCl buffer (pH 10.0) containing 5 mM MgCl2 for 5 min at 37 C. The addition of NaOH quenched the reaction, and the absorbance at 405 nm was read on a plate reader (Bio-Rad Model 450, Hercules, CA, USA) and normalized by DNA content. 2.4. Isolation of RNA and the polymerase chain reaction (PCR) Total RNA was isolated with QIA shredder and RNeasy Mini Kit (QIAGEN, Valencia, CA) according to the manufacture’s instruction. Thereafter, cDNA was synthesized from 1 mg of the total RNA using Superscript 3 (Invitrogen). The PCR reactions with AccuPrimeÔ SuperMix I (Invitrogen) proceeded as follows: 2 min of denaturation at
95 C, followed by 30 cycles consisting of denaturation at 95 C for 15 s, primer annealing at 55 C for 30 s, and elongation at 68 C for 30 s. The final elongation was at 68 C for 5 min. PCR primers were designed based upon canine mRNA sequences in the GenBank database. The primer pairs were as follows: GAPDH (GenBank Accession no. NM_001003142, 336 bp; sense 50 -TTACTCCTTGGAGGCCATGT, antisense 50 AACGGGAAGCTCACTGGCAT), S100A4 NP_001003161, 184 bp; sense 50 -GGAperiostin GAAGGCTCTGGATGTGA, antisense 50 -TCTGTTGCTGTCCAAGTTGC), XM_534490, 245 bp, sense 50 -TCAAAGAAATCCCCATGACTG, antisense 50 -CACAGGCACTCCATCAATGA). The PCR products were resolved by electrophoresis on a 2% agarose gel stained with ethidium bromide. 2.5. Quantitative real-time polymerase chain reaction (PCR) Cells were plated onto 35 mm dishes at a density of 3 104 cells/dish. After 2day period, the medium was replaced to complete medium with or without osteoinductive supplements, 100 mg/ml AA, 10 mM bGP, and 10 nM Dex. Additional 5 days of culture, total RNA was isolated with QIA shredder and RNeasy Plus Mini Kit (QIAGEN) according to the manufacture’s instruction. Thereafter, cDNA was synthesized from 500 ng of the total RNA using SuperScriptÒ VILOÔ cDNA Synthesis Kit (Invitrogen). Real-time PCR was performed in triplicate using the specific primers-probe for bone sialoprotein (BSP, Applied Biosystems, Foster City, CA. ABI assay number: Cf02689784_m1), osteocalcin (OCN, Cf02623891_g1), S100 calcium binding protein A4 (S100A4, Cf02622009_m1), periostin (POSTN, Cf02633583_m1), or beta-2-microglobulin (B2M, Cf02659077_m1), and analyzed by the Applied Biosystems 7300 Real-Time PCR System (Applied Biosystems). The mean fold changes in gene expression relative to B2M were calculated using the values obtained from untreated canine PDL cells of each dog as a calibrator by means of 2DDCT method [15]. All analyses were done in triplicate and the results were confirmed by two independent experiments. 2.6. Cell sheet transplantation After 5-week period of healing and cell culture, 3-wall infrabony defects (5 5 4 mm in depth, mesio-distal width, and bucco-lingual width, respectively) were created surgically on the mesial side of bilateral mandibular first molars (Fig. 2A and B). Root cementum was removed completely with curettes and conditioning with 19% EDTA (Sigma–Aldrich) was performed for 2 min to enhance the cell attachment [16]. Canine PDL cells at passage 3 were seeded on temperatureresponsive culture dishes (35 mm in diameter, UpCellÒ, CellSeed, Tokyo, Japan) at a cell density of 3 104 cells/dish, and cultured in complete medium supplement with 100 mg/mL AA for 3 days. We chose this initial density because these cells were sometimes detached from the dish surfaces when they reached overconfluency. Then, culture medium was changed to osteoinductive medium supplement with 100 mg/ml AA, 10 mM bGP, and 10 nM Dex, and cells were cultured additional 2 days to reach overconfluency. For cell sheet harvest, temperature was reduced to room temperature, then culture medium was aspirated and a wet sheet of woven polyglycolic acid (PGA) (NeoveilÒ, PGA Felt-Sheet Type, 0.15 mm in thickness: Gunze, Tokyo, Japan) was placed on the apical surface of cells. In the present study, woven PGA approved for clinical use by Ministry of Health, Labour and Welfare of Japan was employed as a carrier, because of its advantages of cell sheet handling and biocompatibility. Since PGA sheets stuck cell sheets detached from the dish surfaces within several seconds, PGA sheets together with cell sheets were harvested by peeling them from the dishes with forceps. This procedure was repeated two more times, and finally layering of three PDL cell sheets was achieved within 2 min (see Supplementary video). Three-layered was chosen based on a previous study [11] and the thickness of transplant to avoid necrosis [17]. Three-layered PDL cell sheets supported by PGA sheets were trimmed to the size of defects, and applied to the exposed root surfaces in the experimental group, while only PGA sheets were applied in the control group. Infrabony defects were filled with porous bTCP (OsferionÒ, Olympus Terumo Biomaterials, Tokyo, Japan) (Fig. 2C). Finally, gingival flaps were re-positioned and sutured. Post-surgical managements involved antibiotics (Penicillin G, 200,000 units) daily for 3 days, a soft diet, and topical application of 2% solution of chlorhexidine (HibitaneÒ concentrate, Sumitomo, Osaka, Japan) twice a week until the end of experiments. The sutures were removed 2 weeks after surgery. 2.7. Quantitative and histological evaluation of periodontal tissue regeneration At 6 weeks after transplantation, all animals were sacrificed. Surgical sites were dissected, fixed in 10% neutral buffered formalin (Wako), and subjected to microcomputed tomography (mCT) analyses with SkyScan 1076 (Skyscan, Kontich, Belgium). Then, samples were decalcified in Plank-Rychro solution (WAKO) for 6 weeks, routinely processed into 6-mm thick paraffin-embedded sections, stained with hematoxylin–eosin (HE) or Azan, and observed under a microscope (Eclipse E800, Nikon, Tokyo, Japan). Sections were also observed by polarizing microscopy and differential interference contrast microscopy. Histometric and morphometric analyses were performed with a software (Photoshop, Adobe, San Jose, CA). Three sections approximately 60 mm apart were selected from the most central area of defects, identified by micro-CT analysis and the size of the root canal. The mean
T. Iwata et al. / Biomaterials 30 (2009) 2716–2723 value of each histometric parameter was calculated for each site. The following parameters were measured by two calibrated examiners who were blinded to the experimental conditions. (i) New bone height (%): distance between apical extension of root planing and coronal extension of new alveolar bone along the planed root was divided by defect height: distance between apical extension of root planing and cemento-enamel junction (CEJ). (ii) Apical extension of the junctional epithelium (mm): the distance between the apical extension of the junctional epithelium and CEJ. (iii) Cementum regeneration (%): the distance between the apical extent of root planing and the coronal extent of newly formed cementum and cementum-like deposit on the denuded root surface was divided by defect height. (iv) Periodontal score: each specimen was scored as outlined by Wikesjo et al. [18] at the apical extent of newly formed bone. The mean SD (n ¼ 4) was shown, and significance was evaluated using Student t-test.
2719
between bone and cementum in the control group (Fig. 5A&C). There were significant differences in bone regeneration, cementum regeneration, and periodontal score between the experimental group and the control group (Table 1).
3. Results Primary canine PDL cells were seeded at an extremely low-cell density in order to select cells having high replicative potential. Seven days after plating, numerous colonies were formed, and each cell in the colonies resembled fibroblasts or mesenchymal stromal cells in morphology (Fig. 1A). Colony-forming efficiency was 15–25% at passage 1 (data not shown). RT-PCR revealed that these cells expressed known PDL-specific markers of S100A4 [19,20] and periostin [21] (Fig. 1B). ALP activity of each canine PDL cells was enhanced by osteoinductive medium with statistical significance (Fig. 1C), and the mRNA expression of both osteoblastic/cementoblastic markers (BSP and OCN) and periodontal markers (S100A4 and POSTN) was also upregulated by osteoinductive medium in a 5day-period of induction (Fig. 1D). Canine PDL cells at passage 3 were cultured in osteoinductive medium for 5 days before transplantation. After reaching overconfluency (Fig. 1E), three-layered PDL cell sheets were constructed with thin PGA sheets (Fig. 1F and Supplemental video). Since adhesion between cell sheets were relatively weak when these constructs were subjected to histological processing immediately after layering of three cell sheets, each cell sheet and PGA sheet were detached during the processing (Fig. 1G). The thickness of three-layered cell sheets was around 50 mm. Schematic illustration of artificial periodontal defects and threelayered cell sheets transplantation was shown in Fig. 2A. Periodontal defects were surgically created (Fig. 2B), then three-layered PDL cell sheets were set onto the surfaces of dental roots. Threewall infrabony defects were filled with porous bTCP (Fig. 2C). Healing occurred uneventfully and no intense inflammatory reaction was observed during the whole period. No visible adverse reactions including root exposure, infection and suppuration were observed until the time point of sacrifice 6 weeks after surgery. 2D images of Micro-CT analysis demonstrated that almost 50% of bone filling was observed in the control group (Fig. 3A). In contrast, complete bone filling with an appropriate space of periodontal ligament was observed in the experimental group (Fig. 3B). Periodontal defect was still observed in a 3D virtual model after 6week-healing period in the control group (Fig. 3C). On the other hand, completely bone filled alveolar ridge was seen in the experimental group (Fig. 3D). From the histometric analysis, there was no significant difference in the apical extension of the junctional epithelium between the experimental group and the control group (Fig. 4 and Table 1). Ankylosis was not observed in any samples. Complete periodontal regeneration with both of newly formed bone and cementum connecting with well-oriented collagen fibers were observed only in all of the experimental group (Fig. 4B), whereas limited bone regeneration with poor-oriented periodontal fibers were seen in the control group (Fig. 4A). Higher magnification revealed ligament-like tissues were observed adjacent to the newly formed bone and cementum in Azan staining (Fig. 5B), which was further confirmed by the presence of unique collagen fibers when the tissue was visualized under polarized light (Fig. 5D) in the experimental group. Such connective tissues were not observed
Fig. 2. Three-wall infrabony defect in dog. (A) Schematic illustration of artificial periodontal defects and three-layered cell sheets transplantation. After three-wall bone defect was created, root surface was curetted to remove all periodontal ligament and cementum. Then, three-layered PDL cell sheets supported by woven PGA were transplanted to the root surface. Note cell sheets were directly attached to the naked surface. (B) After the flap was raised, 3-wall infrabony defects (5 5 4 mm, depth, mesio-distal width, and bucco-lingual width, respectively) were surgically created on the mesial side of bilateral mandibular first molars of dogs. (C) Three-layered PDL cell sheets were trimmed and applied to the mechanically and chemically planed root surface. After transplantation of cell sheets, porous bTCP (OsferionÒ) was filled in the infrabony defect.
2720
T. Iwata et al. / Biomaterials 30 (2009) 2716–2723
Fig. 3. Micro-CT analysis of periodontal defects after 6-week period of healing. (A, B) 2D image of the 3-wall defect transplanted with bTCP (A) or three-layered PDL cell sheets/bTCP (B). Triangle indicates cement-enamel junction (CEJ) of bilateral mandibular first molars of dog. (bar, 1 mm) (C, D) 3D virtual model of the 3-wall defect transplanted with bTCP (C) or three-layered PDL cell sheets/bTCP (D). After the 6 week of healing period, micro-CT analysis was performed and images were reconstructed with VG max software.
4. Discussion In the present study, we successfully expanded primary canine PDL cells in vitro and fabricated transplantable constructs composing three-layered PDL cell sheets and a PGA sheet as a supporter. Because of the limited initial adhesion of primary canine PDL cells [13], PrimariaÔ culture dish was utilized to promote cell adhesion. By reducing seeding cell density as reported previously [14] with some modifications, highly proliferative PDL cells were selected. In the present study, primary PDL cells were enzymatically isolated. These cells were higher in proliferative capacity and smaller in cell size than those cells isolated by an explant method, implying that enzymatic digestion can facilitate rapid cell expansion with stromal or progenitor phenotypes (data not shown). Despite intensive research efforts, no definitive markers specific to PDL cells have not been shown. Among these candidates reported previously, gene expression of S100A4 [19,20] and periostin [21] were examined and both genes were expressed by isolated PDL cells in the present study. PDL tissues are very unique because they are never calcified spontaneously even they are located in a close gap between two types of hard tissues, bone and cementum. Duarte et al. proposed that S100A4 can be a negative regulator of mineralization in PDL tissues [19,20]. Periostin that is known to be strongly expressed in PDL tissues [21] is suggested to be essential for the integrity and function of PDL [22]. In addition, we investigated the differentiation capacity of canine PDL cells. We confirmed the capacities of osteoblastic/ cementoblastic differentiation in each canine PDL cells from the results of both ALP activity and gene expression, suggesting culture
of 5-day-period with osteoinductive medium can induce cytodifferentiation of each canine PDL cells with varying degrees. Considering the previous studies which demonstrated that PDL cells cultured with osteoinductive medium could regenerate newly formed cementum-like tissues [11,12], we cultured PDL cells with osteoinductive medium then transplanted into periodontal defects. In this study, we first utilized a poly (vinylidine difluoride) membrane for the transfer of cell sheets onto teeth root surfaces and the membrane was recovered after the transfer as previously described [23]. In this case, transplanted cell sheets were hardly seen on the teeth root surfaces, because the colour was similar among cell sheets and root surfaces. This shortcoming might hamper reliable and reproducible transplantation of cell sheets, since the attachment of cell sheets onto hard tissue surfaces is weaker than that onto soft tissues. Therefore, we considered to use hyaluronan membrane [13], that were co-transplanted with cell sheets in the next study. We performed periodontal regeneration with monolayered PDL cell sheet combined with hyaluronan in a canine dehiscence defects. However, the success rate was 60% (3 of 5 dogs) and authors concluded that it may be due to the low cell sheet stability on the denuded root surface [13]. Thus, we need a definite method for delivery and stability of cell sheet transplant with a safe biomaterial which is approved for clinical settings. In addition, this hyaluronan membrane was fabricated in house, and wasn’t approved for clinical use by Ministry of Health, Labour and Welfare of Japan. Since our final goal is its clinical application, we finally selected a commercially available material, PGA membrane, which is already approved for clinical use. The PGA membrane facilitated quick fabrication of transplantable constructs of three-
T. Iwata et al. / Biomaterials 30 (2009) 2716–2723
2721
Fig. 4. Photomicrographs of contralateral defect sites receiving bTCP (A) and PDL cell sheets/bTCP (B). Note functionally well-oriented periodontal fibers with newly formed bone are seen only in the experimental group (B) (bar, 1 mm; Azan staining).
Table 1 Histometric analysis of periodontal regeneration of 3-wall defects.
Junctional epithelium (mm) Bone regeneration (%) Cementum regeneration (%) Periodontal score (1–5)
Cell Sheet (n ¼ 4)
Negative Control (n ¼ 4)
p-value
0.01 0.12 76.95 5.08 78.22 5.50 4.63 0.25
0.19 0.51 52.74 14.34 47.69 11.10 3.50 0.41
0.47 0.035* 0.012* 0.0030*
Group means SD. n ¼ number of sites. * Statistically significant difference (p < 0.05).
layered cell sheets, and was co-transplanted with the constructs onto the teeth root surface. These improvements of cell sheet handling encouraged us to promote PDL cell sheet transplantation. Furthermore, PGA did not cause any significant harmful side effects such as remarkable inflammation during 6 weeks of healing period in all dogs. Recently, it was reported that tenocytes cultured on PGA scaffolds regenerated a complex extensor tendon structure even in vitro, and showed further maturation after transplantation in vivo [24], suggesting that PGA might be also suitable for the regeneration of tendon/ligament-like structures. Finally, we successively demonstrated alveolar bone regeneration with proper oriented periodontal ligament and cementum in the experimental group, which was not observed in our previous studies [10,12,13]. In the control group, we also observed alveolar bone regeneration from the bottom side of defects which might be induced by bTCP, which have shown favorable biocompatibility, osteoconduction and resorption properties [25]. In contrast, bone regeneration of the upper site of the defects was hardly seen in the control group, suggesting transplanted PDL cell sheets might promote bone regeneration in the upper site of defects in the experimental group. It
may be possible that bTCP have osteoinductive effects on PDL cells and also useful for alveolar bone regeneration as previously described [26]. 5. Conclusion Transplantable multi-layered PDL cell sheets were successfully fabricated with woven PGA and the combination use with porous bTCP induced the true periodontal regeneration, including alveolar bone, cementum and well-oriented fibers at the same time. Acknowledgements The authors thank Drs. Michihiko Usui, Noriko Kawakatsu, Hiroyuki Aoki, Kazuto Sakai, Reiko Yashiro, Tatsuya Akizuki, and Ikufumi Sato for their assistance. This study was supported by Formation of Innovation Center for Fusion of Advanced Technologies in the Special Coordination Funds for Promoting Science and Technology from the Ministry of Education, Culture, Sports, Science and Technology (MEXT), Japan.
2722
T. Iwata et al. / Biomaterials 30 (2009) 2716–2723
Fig. 5. Higher magnification of Fig. 4 (A, C: bTCP, B, D: PDL cell sheets/bTCP). Complete periodontal regeneration, functionally well-oriented periodontal fibers connecting with both newly formed cementum and bone (arrowhead), is observed in the experimental group by Azan staining (B) and by polarized light (D). In contrast, such well-oriented fibers are not observed in the control group (A and C) (bar, 500 mm).
Appendix Figures with essential colour discrimination. Parts of the majority of the figures in this article are difficult to interpret in black and white. The full colour images can be found in the on-line version, at doi:10.1016/j.biomaterials.2009.01.032. Appendix. Supplementary material Supplementary material can be found, in the online version, at doi:10.1016/j.biomaterials.2009.01.032. References [1] Pihlstrom BL, Michalowicz BS, Johnson NW. Periodontal diseases. Lancet 2005;366:1809–20. [2] Caton J, Nyman S, Zander H. Histometric evaluation of periodontal surgery. II. Connective tissue attachment levels after four regenerative procedures. J Clin Periodontol 1980;7:224–31. [3] Esposito M, Grusovin MG, Coulthard P, Worthington HV. Enamel matrix derivative (Emdogain) for periodontal tissue regeneration in intrabony defects. Cochrane Database Syst Rev 2005. CD003875. [4] Bartold PM, Xiao Y, Lyngstaadas SP, Paine ML, Snead ML. Principles and applications of cell delivery systems for periodontal regeneration. Periodontology 2000;2006(41):123–35. [5] Seo BM, Miura M, Gronthos S, Bartold PM, Batouli S, Brahim J, et al. Investigation of multipotent postnatal stem cells from human periodontal ligament. Lancet 2004;364:149–55. [6] Nagatomo K, Komaki M, Sekiya I, Sakaguchi Y, Noguchi K, Oda S, et al. Stem cell properties of human periodontal ligament cells. J Periodont Res 2006;41:303–10. [7] Nakahara T, Nakamura T, Kobayashi E, Kuremoto K, Matsuno T, Tabata Y, et al. In situ tissue engineering of periodontal tissues by seeding with periodontal ligament-derived cells. Tissue Eng 2004;10:537–44. [8] Liu Y, Zheng Y, Ding G, Fang D, Zhang C, Bartold PM, et al. Periodontal ligament stem cell-mediated treatment for periodontitis in miniature swine. Stem Cells 2008;26:1065–73.
[9] Sonoyama W, Liu Y, Fang D, Yamaza T, Seo BM, Zhang C, et al. Mesenchymal stem cell-mediated functional tooth regeneration in swine. PLoS ONE 2006;1:e79. [10] Hasegawa M, Yamato M, Kikuchi A, Okano T, Ishikawa I. Human periodontal ligament cell sheets can regenerate periodontal ligament tissue in an athymic rat model. Tissue Eng 2005;11:469–78. [11] Flores MG, Hasegawa M, Yamato M, Takagi R, Okano T, Ishikawa I. Cementum– periodontal ligament complex regeneration using the cell sheet technique. J Periodont Res 2008;43:364–71. [12] Flores MG, Yashiro R, Washio K, Yamato M, Okano T, Ishikawa I. Periodontal ligament cell sheet promotes periodontal regeneration in athymic rats. J Clin Periodontol 2008;35:1066–72. [13] Akizuki T, Oda S, Komaki M, Tsuchioka H, Kawakatsu N, Kikuchi A, et al. Application of periodontal ligament cell sheet for periodontal regeneration: a pilot study in beagle dogs. J Periodont Res 2005;40:245–51. [14] Nimura A, Muneta T, Koga H, Mochizuki T, Suzuki K, Makino H, et al. Increased proliferation of human synovial mesenchymal stem cells with autologous human serum: comparisons with bone marrow mesenchymal stem cells and with fetal bovine serum. Arthritis Rheum 2008;58:501–10. [15] Livak KJ, Schmittgen TD. Analysis of relative gene expression data using real-time quantitative PCR and the 2(T) (-Delta Delta C) method. Methods 2001;25:402–8. [16] Maruyama H, Aoki A, Sasaki KM, Takasaki AA, Iwasaki K, Ichinose S, et al. The effect of chemical and/or mechanical conditioning on the Er:YAG laser-treated root cementum: analysis of surface morphology and periodontal ligament fibroblast attachment. Lasers Surg Med 2008;40:211–22. [17] Shimizu T, Sekine H, Yang J, Isoi Y, Yamato M, Kikuchi A, et al. Polysurgery of cell sheet grafts overcomes diffusion limits to produce thick, vascularized myocardial tissues. FASEB J 2006;20:708–10. [18] Wikesjo UM, Sorensen RG, Kinoshita A, Jian Li X, Wozney JM. Periodontal repair in dogs: effect of recombinant human bone morphogenetic protein-12 (rhBMP-12) on regeneration of alveolar bone and periodontal attachment. J Clin Periodontol 2004;31:662–70. [19] Duarte WR, Iimura T, Takenaga K, Ohya K, Ishikawa I, Kasugai S. Extracellular role of S100A4 calcium-binding protein in the periodontal ligament. Biochem Biophys Res Commun 1999;255:416–20. [20] Kato C, Kojima T, Komaki M, Mimori K, Duarte WR, Takenaga K, et al. S100A4 inhibition by RNAi up-regulates osteoblast related genes in periodontal ligament cells. Biochem Biophys Res Commun 2005;326:147–53. [21] Horiuchi K, Amizuka N, Takeshita S, Takamatsu H, Katsuura M, Ozawa H, et al. Identification and characterization of a novel protein, periostin, with restricted expression to periosteum and periodontal ligament and increased
T. Iwata et al. / Biomaterials 30 (2009) 2716–2723 expression by transforming growth factor beta. J Bone Miner Res 1999;14: 1239–49. [22] Rios HF, Ma D, Xie Y, Giannobile WV, Bonewald LF, Conway SJ, et al. Periostin is essential for the integrity and function of the periodontal ligament during occlusal loading in mice. J Periodontol 2008;79:1480–90. [23] Ohki T, Yamato M, Murakami D, Takagi R, Yang J, Namiki H, et al. Treatment of oesophageal ulcerations using endoscopic transplantation of tissue-engineered autologous oral mucosal epithelial cell sheets in a canine model. Gut 2006;55:1704–10.
2723
[24] Wang B, Liu W, Zhang Y, Jiang Y, Zhang WJ, Zhou G, et al. Engineering of extensor tendon complex by an ex vivo approach. Biomaterials 2008;29: 2954–61. [25] Gaasbeek RD, Toonen HG, van Heerwaarden RJ, Buma P. Mechanism of bone incorporation of beta-TCP bone substitute in open wedge tibial osteotomy in patients. Biomaterials 2005;26:6713–9. [26] Yamauchi K, Takahashi T, Funaki K, Yamashita Y. Periosteal expansion osteogenesis using highly purified beta-tricalcium phosphate blocks: a pilot study in dogs. J Periodontol 2008;79:999–1005.