Peripheral neuropeptide Y differentially influences adipogenesis and lipolysis in chicks from lines selected for low or high body weight

Comparative Biochemistry and Physiology, Part A 213 (2017) 1–10

Contents lists available at ScienceDirect

Comparative Biochemistry and Physiology, Part A journal homepage: www.elsevier.com/locate/cbpa

Peripheral neuropeptide Y differentially influences adipogenesis and lipolysis in chicks from lines selected for low or high body weight☆

MARK

Lingbin Liua, Guoqing Wangb, Yang Xiaob, Steven L. Shippb, Paul B. Siegelb, Mark A. Clineb, Elizabeth R. Gilbertb,⁎ a b

Sichuan Agricultural University, Ya'an 625014, Sichuan, China Virginia Polytechnic Institute and State University, Department of Animal and Poultry Sciences, Blacksburg, Virginia 24061, United States

A R T I C L E I N F O

A B S T R A C T

Keywords: Adipogenesis Adipose Chicks Lipolysis Neuropeptide Y

Neuropeptide Y (NPY) stimulates appetite and promotes lipid deposition. We demonstrated a differential sensitivity in the food intake response to central NPY in chicks from lines selected for low (LWS) or high (HWS) body weight, but have not reported whether such differences exist in the periphery. At 5 days, LWS and HWS chicks were intraperitoneally injected with 0 (vehicle), 60, or 120 μg/kg BW NPY and subcutaneous adipose tissue and plasma were collected at 1, 3, 6, 12, and 24 h (n = 12). NPY injection increased glycerol-3-phosphate dehydrogenase (G3PDH) activity at 1 and 3 h and reduced plasma non-esterified fatty acids (NEFAs) at 1 and 12 h. G3PDH activity was greater in HWS than LWS while NEFAs were greater in LWS. At 1 h, peroxisome proliferatoractivated receptor gamma (PPARγ), CCAAT/enhancer binding protein (C/EBP)α, and microsomal triglyceride transfer protein (MTTP) mRNAs were reduced in NPY-injected chicks whereas NPY receptor 1 (NPYR1) was increased. Expression of stearoyl-CoA desaturase (SCD1) was increased by NPY at 1 h in HWS but not LWS. PPARγ (3 and 6 h), C/EBPβ (3 h), C/EBPα (6 h) and NPYR1 and 2 (24 h) mRNAs were greater in NPY- than vehicle-injected chicks. At several times, adipose triglyceride lipase, MTTP, perilipin 1, NPYR1, and NPYR2 mRNAs were greater in LWS than HWS, while expression of SCD1, glycerol-3-phosphate acyltransferase 3 and lipoprotein lipase was greater in HWS than LWS. Thus, NPY promotes fat deposition and inhibits lipolysis in chicks, with line differences indicative of greater rates of lipolysis in LWS and adipogenesis in HWS.

1. Introduction Maintaining energy balance in the body involves complex physiological processes that include factors that regulate energy intake via the central nervous system and energy storage and expenditure in peripheral organs such as the adipose tissue. One such factor is neuropeptide Y (NPY), a potent hunger-stimulating peptide produced by neurons in the arcuate nucleus of the hypothalamus (Zhang et al., 2014b). Neuropeptide Y also co-localizes with norepinephrine in sympathetic nerve terminals that project onto adipose tissue and is expressed by cells in the adipose tissue (Shipp et al., 2016b; Zhang et al., 2014b). As reviewed, NPY enhances adipogenesis and lipid deposition in adipose tissue, effects mediated via NPY receptor sub-type 2 (NPYR2), and may inhibit lipolysis via NPYR1 (Shipp et al., 2016b; Zhang et al., 2014b). We demonstrated that treatment with NPY promoted adipocyte differentiation and lipid deposition in cells isolated from the abdominal fat of

chickens (Shipp et al., 2016a; Zhang et al., 2015a), although effects on adipose tissue after injection into the chick have not been reported. Central injection of NPY increases food intake in birds and mammals (Clark et al., 1984; Kuenzel et al., 1987; Levine and Morley, 1984; Miner et al., 1989; Morley et al., 1987; Newmyer et al., 2013; Parrott et al., 1986; Richardson et al., 1995). We demonstrated a differential sensitivity in the food intake response to NPY in chicks from lines selected for low (LWS) or high (HWS) body weight where the LWS did not respond to centrally-injected NPY with increased food intake, although hypothalamic nucleus neuronal activation was similar between lines (Newmyer et al., 2013). Subsequent study revealed that when exposed to environmental stressors during the first 24 h post-hatch, LWS but not HWS chicks were non-responsive to the orexigenic effects of NPY (Yi et al., 2016). Expression of hypothalamic NPY was greater in LWS than HWS at 5 (Yi et al., 2016) and 90 (Zhang et al., 2013) days of age, and that non-stressed anorexic chicks responded to NPY with increased food

☆ Funding: This project was supported by Agriculture and Food Research Initiative Competitive Grant no. 2015-67015-23359 from the USDA National Institute of Food and Agriculture. This project was also supported by the Virginia Agricultural Experiment Station and the Hatch Program of the National Institute of Food and Agriculture, U.S. Department of Agriculture. ⁎ Corresponding author at: Department of Animal and Poultry Sciences, Virginia Tech, 175 West Campus Drive, 3200 Litton Reaves Hall, Blacksburg, VA 24061, United States. E-mail address: [email protected] (E.R. Gilbert).

http://dx.doi.org/10.1016/j.cbpa.2017.08.001 Received 9 June 2017; Received in revised form 1 August 2017; Accepted 2 August 2017 Available online 05 August 2017 1095-6433/ © 2017 Elsevier Inc. All rights reserved.

Comparative Biochemistry and Physiology, Part A 213 (2017) 1–10

L. Liu et al.

food consumed was recorded at each time and calculated as food intake as a percentage of body weight. Subcutaneous adipose tissue samples were submerged in RNAlater (Invitrogen, Carlsbad, CA), refrigerated overnight at 4 °C, and stored at − 20 °C until further analysis. Adipose tissue samples were also collected for measuring enzyme activity, as described below. Plasma samples were collected as described below for measurement of non-esterified fatty acids (NEFAs). Because of limitations in the number of cages and timing of sample collections, different hatches from the same flocks were used for each time point.

intake (Yi et al., 2016) demonstrates that the NPY system in LWS is differentially regulated. The LWS and HWS lines of chickens have resulted from long-term (> 60 generations) divergent selection for low or high juvenile (56 days of age) body weight, respectively (Dunnington et al., 2013; Rubin et al., 2010). There have been correlated responses in feeding behavior and body composition. The LWS are relatively lean and hypophagic, while the HWS are heavier and hyperphagic as juveniles (Dunnington and Siegel, 1996; Dunnington et al., 1986, 2013; Zelenka et al., 1988). The severely anorexic LWS chicks die shortly after resorption of the yolk sac, while those that survive show delayed sexual maturity (Zelenka et al., 1988). Juvenile HWS (56 days of age) are 10 times as fat (abdominal fat as a percentage of body weight) as their respective LWS counterparts (Burgener et al., 1981; Dunnington and Siegel, 1996; Dunnington et al., 1986; Katanbaf et al., 1988; Zhang et al., 2013). Regardless of the feeding state (fasted vs. fed), lipolysis was greater in the abdominal fat of 28-day old LWS than HWS chickens, which can partly explain the slower rate of fat accumulation in LWS chicks (Calabotta et al., 1985). At 56 days of age, there was greater citrate synthase activity (indicator of mitochondrial number), greater rates of fatty acid oxidation, and greater fatty acid oxidation efficiency in the abdominal fat of LWS than HWS (Zhang et al., 2014a). Administration of oral nutrient boluses was associated with minimal fat deposition in the LWS, which occurred primarily through hypertrophy, whereas adipose tissue expansion in the HWS was through a combination of hyperplasia and hypertrophy (Robey et al., 1988; Robey et al., 1992). Collectively, these studies suggest that LWS and HWS differ in energy metabolism in the adipose tissue and that differences in feeding behavior and adiposity could be related to differences in NPY signaling in associated tissues, such as the hypothalamus and adipose tissue, respectively. While we have investigated gene expression differences between the lines in the hypothalamus (Rice et al., 2014; Yi et al., 2015, 2016; Zhang et al., 2013, 2015b) and differential sensitivity in the food intake response to central NPY (Newmyer et al., 2013; Yi et al., 2016), we have not evaluated the adipose tissue response to NPY that might explain the differential development of adipose tissue and obesity in these lines that originated from a common founder population. Thus, the objective of this study was to evaluate effects of peripheral injection of NPY on adipose tissue physiology between 1 and 24 h post-injection in chicks from these lines that have the propensity to be anorexic or obese.

2.2. Glycerol-3-phosphate dehydrogenase (G3PDH) specific activity Approximately 0.1–0.2 g of each adipose tissue sample was transferred to a 2 mL tube containing 1 mL ice-cold lysis buffer (50 mM TrisCl, 1 mM EDTA, and 1 mM β-mercaptoethanol, pH 7.5) and a 5 mm stainless steel bead (Qiagen, Valencia, CA, USA) on ice. The method for assaying G3PDH specific activity was adapted from several studies (Bai et al., 2015; Lengi and Corl, 2010; Wise and Green, 1979; Zhang et al., 2015a). Tissues were physically disrupted with a Tissue Lyser II (Qiagen) for 2 × 2 min at 25 Hz. The lysates were then centrifuged at 12,000 × g at 4 °C for 30 min, and the supernatant used for measuring G3PDH activity and for determining total protein concentration. The G3PDH activity was measured for each sample in duplicate in assay buffer (100 mM triethanolamine-HCl, 2.5 mM EDTA, 0.12 mM NADH, 0.2 mM dihydroxyacetone phosphate, 0.1 mM β-mercaptoethanol, pH 7.5) in a total reaction volume of 200 μL in UV transparent plates (Corning, MA, USA) using a μQuant plate reader and KC Junior software (Bio-Tek, VT, USA). Absorbance was measured at 340 nm for 20 cycles at 25 °C and the maximum slope calculated from the absorbance data. Protein concentration was quantified with Bradford reagent (Sigma-Aldrich, MO, USA) using an Infinite M200 Pro multi-mode plate reader and Magellan software (Tecan, CA, USA). The maximum slope was normalized to the protein concentration to calculate specific activity, expressed as μmol/min mg. 2.3. Plasma NEFA concentrations Approximately 200 μL of blood was collected from the trunk of each chick via capillary blood collection tubes (Microvette®) immediately following euthanasia and decapitation. After collection, samples were centrifuged at 2000 x g at room temperature and plasma isolated. Plasma NEFA concentrations were measured using the NEFA-HR2 kit (Wako Diagnostics) according to the manufacturer's instructions. Absorbance was measured at 550 nm using an Infinite M200 Pro multimode plate reader (Tecan). Sample concentration was calculated using the following formula: Sample Concentration = Standard Concentration × (Sample Absorbance) / (Standard Absorbance). Units for the concentrations are reported as mEq/L.

2. Materials and methods 2.1. Animals Eggs obtained from age contemporary parents from S56 generation parental stocks that were reared at the Paul B. Siegel Poultry Research Center were incubated in the same machine. After hatch, chicks were group caged for 1 day and then transferred to individual cages in a room at 32 ± 1 °C and 50 ± 5% relative humidity and 24 h of light. All chicks had free access to a mash diet (21.5% crude protein and 3000 kcal ME/kg) and tap water. The individual cages allowed visual and auditory contact with each other. Chicks were handled twice daily to adapt to handling. All animal protocols were approved by the Institutional Animal Care and Use Committee at Virginia Tech. Using a randomized complete block design with body weight as the blocking factor within each line, chicks were assigned to treatment groups. At 5 days post-hatch, LWS and HWS chicks were intraperitoneally injected with 0 (equal volume of phosphate-buffered saline), 60, or 120 μg/kg BW chicken NPY (AnaSpec, San Jose, CA, USA; n = 12 per group per time point), and returned to their home cages with ad libitum access to food and water. Doses were based on rodent studies (Gelfo et al., 2011; Singer et al., 2013). At 1, 3, 6, 12, and 24 h post-injection, n = 12 chicks per group were euthanized, samples collected, and sex determined by gonadal inspection. The amount of

2.4. Total RNA isolation, reverse transcription, and real time PCR Tissues were homogenized in 1 mL Tri-Reagent (Molecular Research Center, Cincinnati, OH) using 5 mm stainless steel beads (Qiagen) and a Tissue Lyser II (Qiagen) for 2 × 2 min at 25 Hz. Total RNA was separated following the manufacturer's instructions (Tri-Reagent) and following the step of addition to 70% ethanol, samples were transferred to spin columns and further purified using the RNeasy Mini Kit (Qiagen) with the optional RNase-free DNase I (Qiagen) treatment. The total RNA samples were evaluated for integrity by agarose-formaldehyde gel electrophoresis and concentration and purity assessed by spectrophotometry at 260/280/230 nm with a Nanophotometer Pearl (IMPLEN, Westlake Village, CA, USA). First-strand cDNA was synthesized from 200 ng total RNA with a High Capacity cDNA Reverse Transcription Kit (Applied Biosystems, Carlsbad, CA, USA). Reactions were performed under the following conditions: 25 °C for 10 min, 37 °C for 120 min and 85 °C for 5 min. 2

Comparative Biochemistry and Physiology, Part A 213 (2017) 1–10

L. Liu et al.

Table 1 Primers used for real time PCR. Gene1

Accession no.

Sequence (forward/reverse)

PPARγ SREBP1 C/EBPα C/EBPβ PLN1 LPL NPY NPYR1 NPYR2 GPAT3 ACC1 AGPAT2 SCD1 FABP4 MTTP ATGL

NM_001001460.1 NM_204126.2 NM_001031459.1 NM_205253.2 NM_001127439.1 NM_205282.1 NM_205473.1 NM_001031535.1 NM_001031128.1 NM_001031145.1 NM_205505.1 XM_015279793.1 NM_204890.1 NM_204290.1 NM_001109784.2 NM_001113291

CACTGCAGGAACAGAACAAAGAA/TCCACAGAGCGAAACTGACATC CATCCATCAACGACAAGATCGT/CTCAGGATCGCCGACTTGTT CGCGGCAAATCCAAAAAG/GGCGCACGCGGTACTC GCCGCCCGCCTTTAAA/CCAAACAGTCCGCCTCGTAA GGAGGACGTGGCATGATGAC/GGCCCTTCCATTCTGCAA GACAGCTTGGCACAGTGCAA/CACCCATGGATCACCACAAA CATGCAGGGCACCATGAG/CAGCGACAAGGCGAAAGTC TAGCCATGTCCACCATGCA/GGGCTTGCCTGCTTTAGAGA TGCCTACACCCGCATATGG/GTTCCCTGCCCCAGGACTA CCCATAGATGCGATCATTTTGA/CGTGAACTTGGCCAACCAT CAGGTATCGCATCACTATAGGTAACAA/GTGAGCGCAGAATAGAAGGATCA GCCAAACACCGAAGGAACAT/CCATGGCATCCCCAGAGTT CAATGCCACCTGGCTAGTGA/CGGCCGATTGCCAAAC CAGAAGTGGGATGGCAAAGAG/CCAGCAGGTTCCCATCCA TGCTGGGAAGCATGTTGCT/CTACTAGCGGCATGGAAACGT GCCTCTGCGTAGGCCATGT/GCAGCCGGCGAAGGA

1 PPARγ: peroxisome proliferator-activated receptor gamma; SREBP1: sterol regulatory element-binding protein 1; C/EBPα: CCAAT/enhancer binding protein alpha; C/EBPβ: CCAAT/enhancer binding protein beta; PLIN1: perilipin 1; LPL: lipoprotein lipase; NPY: neuropeptide Y; NPY1 and 2 R: neuropeptide Y receptors 1 and 2, respectively; GPAT3: glycerol-3-phosphate acyltransferase 3; ACC1: acetyl-CoA carboxylase alpha; AGPAT2: 1-acylglycerol-3-phosphate O-acyltransferase 2; SCD1: stearoyl-CoA desaturase 1; FABP4: fatty acid binding protein 4; MTTP: microsomal triglyceride transfer protein; ATGL: adipose triglyceride lipase.

Table 2 Glycerol-3-phosphate dehydrogenase specific activity in subcutaneous adipose tissue1. Variables

1h

3h

6h

12 h

24 h

NPY treatment (μg/kg BW) 0 11.6 ± 0.69b 60 13.96 ± 0.73a 120 13.27 ± 0.93ab P-value 0.04

7.56 ± 0.58b 11.78 ± 1.53a 6.9 ± 0.77b 0.0009

11.01 ± 0.66 13.62 ± 0.68 12.93 ± 1 0.06

11.35 ± 1.74 10.62 ± 1.07 12.9 ± 1.22 0.4

10.57 ± 0.92 11.67 ± 1.38 12.82 ± 1.55 0.47

Genetic line HWS LWS P-Value

16.39 ± 0.57 9.25 ± 0.33 0.0001

10.27 ± 0.78 7.09 ± 0.89 0.003

12.6 ± 0.58 12.28 ± 0.78 0.97

13.47 ± 1.15 9.33 ± 0.78 0.007

12.23 ± 0.71 11.23 ± 1.33 0.53

T×L P-value

0.96

0.95

0.09

0.26

0.85

1

Results are expressed as means ± SEM. Different superscripts denote a difference at P < 0.05. On day 5 post-hatch, chicks from lines selected for low (LWS) or high (HWS) body weight were injected intraperitoneally with 0 (vehicle), 60, or 120 μg/kg BW chicken NPY and subcutaneous adipose tissue collected at 1, 3, 6, 12 and 24 h post-injection (n = 12 per group). The model included the main effects of NPY treatment (T) and genetic line (L), and the interaction between them (T × L). Each time point represents a different set of chicks.

sex and interactions involving sex were not significant for the traits that were measured, the statistical model included only the main effects of genetic line, NPY treatment and the interaction between them. Post hoc pairwise comparisons were performed with Tukey's test. All data are presented as least squares means ± SEM. Differences were considered significant at P < 0.05.

Primers for real time PCR were designed with Primer Express 3.0 software (Applied Biosystems), and validated for amplification efficiency before use (Table 1). Real-time PCR was performed in duplicate in 10 μL volume reactions that contained 5 μL Fast SYBR Green Master Mix (Applied Biosystems), 0.25 μL each of 5 μM forward and reverse primers, and 3 μL of 10-fold diluted cDNA using a 7500 Fast Real-Time PCR System (Applied Biosystems). The PCR was performed under the following conditions: 95 °C for 20 s and 40 cycles of 90 °C for 3 s plus 60 °C for 30 s. A dissociation step consisting of 95 °C for 15 s, 60 °C for 1 min, 95 °C for 15 s and 60 °C for 15 s was performed at the end of each PCR reaction to ensure amplicon specificity.

3. Results 3.1. Food intake and glycerol-3-phosphate dehydrogenase activity At 1 h post-injection, chicks that were injected with the lower and higher dose of NPY had consumed more food as a percentage of body weight (1.11 ± 0.18 and 1.08 ± 0.14, respectively) than those injected with vehicle (0.59 ± 0.12; P < 0.05). There were no treatment effects at other time points (data not shown). At all times the HWS had consumed approximately 3 times as much food as the LWS (P = 0.0001), although as a percentage of body weight there were no differences between lines or interactions of line and treatment on food intake (data not shown). Results for G3PDH activity are summarized in Table 2. At 1 (P = 0.04) and 3 (P = 0.0009) h post-injection, there were main effects of NPY treatment on G3PDH specific activity, where activity was greater in chicks injected with the lower dose of NPY than in chicks that received the vehicle. At 3 h, activity was greater in the adipose tissue of

2.5. Statistical analysis The real time PCR data were analyzed using the ΔΔCT method, where ΔCT = CT target gene − CT actin, and ΔΔCT = ΔCT target sample − ΔCT calibrator (Schmittgen and Livak, 2008). The average of the HWS vehicle-injected chicks at 1 h post-injection was used as the calibrator sample. The fold difference was calculated as 2− ΔΔCT. Normality of fold difference values was evaluated by the Univariate procedure of SAS, and Levene's test was used to evaluate heterogeneity of variances. Plasma NEFA concentrations, food intake, G3PDH specific activity values, and fold differences in mRNA were analyzed by ANOVA using the Glimmix procedure of SAS 9.2 (SAS Institute, Cary, NC). Because 3

Comparative Biochemistry and Physiology, Part A 213 (2017) 1–10

L. Liu et al.

Table 3 Plasma non-esterified fatty acid concentrations1. Variables

1h

3h

6h

12 h

24 h

NPY treatment (μg/kg BW) 0 60 120 P-value

0.41 ± 0.07a 0.23 ± 0.02b 0.27 ± 0.03b 0.03

0.33 ± 0.06 0.3 ± 0.04 0.37 ± 0.06 0.64

0.16 ± 0.01 0.19 ± 0.02 0.23 ± 0.03 0.13

0.23 ± 0.03a 0.16 ± 0.01b 0.19 ± 0.02ab 0.02

0.21 ± 0.03 0.19 ± 0.02 0.23 ± 0.03 0.47

Genetic line HWS LWS P-value

0.29 ± 0.05 0.32 ± 0.03 0.55

0.2 ± 0.01 0.45 ± 0.04 0.0001

0.15 ± 0.01 0.23 ± 0.02 0.003

0.14 ± 0.01 0.24 ± 0.03 0.0001

0.16 ± 0.01 0.27 ± 0.02 0.0003

T×L P-value

0.84

0.09

0.19

0.02

0.57

1 Results are expressed as means ± SEM. Different superscripts denote a difference at P < 0.05. On day 5 post-hatch, chicks from low (LWS) and high (HWS) weight-selected lines were injected intraperitoneally with 0 (vehicle), 60, or 120 μg/kg BW chicken NPY and tissues collected at 1, 3, 6, 12 and 24 h post-injection (n = 12 per group). Each time point represents a different set of chicks.

there was an effect of NPY dose on mRNA abundance of peroxisome proliferator-activated receptor gamma (PPARγ; P = 0.04), CCAAT/enhancer binding protein alpha (C/EBPα; P = 0.02), NPYR1 (P = 0.02), acetyl CoA carboxylase 1 (ACC1; P = 0.04), stearoyl CoA desaturase 1 (SCD1; P = 0.0009), and microsomal triglyceride transfer protein (MTTP; P = 0.04). PPARγ and C/EBPα were reduced in chicks that received the higher dose of NPY as compared to the vehicle-injected chicks, while NPYR1 was greater in chicks that received the higher dose of NPY than in the chicks that received the vehicle (Table 4). ACC1 mRNA was greater in chicks that received the lower dose of NPY than in chicks that received the higher dose, while SCD1 mRNA was greater in chicks that received the higher dose of NPY than in the other two groups. Expression of MTTP was greater in vehicle-injected than low NPY dose-injected chicks. There were effects of genetic line on expression of NPYR2 (P < 0.0001), NPYR1 (P < 0.0001), lipoprotein lipase (LPL; P = 0.01), glycerol-3-phosphate acyltransferase 3 (GPAT3; P < 0.0001), SCD1 (P < 0.0001), perilipin 1 (PLN1; P < 0.0001), MTTP (P = 0.02), and adipose triglyceride lipase (ATGL; P < 0.0001). The mRNA abundance of NPYR2, NPYR1, PLN1, MTTP, and ATGL was greater in LWS than HWS whereas expression of LPL, GPAT3, and SCD1 was greater in HWS than LWS. There was an interaction of genetic line and treatment on SCD1 mRNA (P = 0.002), where expression was similar among doses in LWS and was up-regulated in HWS chicks that received the higher dose of NPY (Fig. 2A). At 3 h post-injection, there was a main effect of NPY treatment on PPARγ (P = 0.04) and C/EBPβ (P = 0.02) mRNA (Table 5). PPARγ was greater in chicks that received the higher dose of NPY than in chicks that received the vehicle while C/EBPβ was greater in both NPY-treated groups than the control group. SREBP1 (P = 0.04), GPAT3 (P < 0.0001), and SCD1 (P < 0.0001) were greater in HWS than LWS, while C/EBPβ (P = 0.01) and ATGL (P = 0.006) mRNA was greater in LWS than HWS (Table 5). At 6 h post-injection, there were effects of NPY injection on the mRNA abundance of PPARγ (P = 0.04), where expression was greater in the adipose tissue of chicks injected with the higher dose of NPY than in vehicle-injected chicks, and C/EBPα (P = 0.005), where expression was greater in chicks that received the higher dose of NPY as compared to the other two treatment groups (Table 6). Quantities of C/EBPα (P = 0.04), GPAT3 (P = 0.0003), and SCD1 (P = 0.02) were greater in HWS than LWS chicks at 6 h post-injection. Expression of C/EBPβ (P < 0.0001), NPY (P = 0.04), NPYR2 (P < 0.0001), NPYR1 (P < 0.0001), ACC1 (P = 0.02), PLN1 (P < 0.0001), MTTP (P < 0.0001), and ATGL (P < 0.0001) was greater in LWS than HWS (Table 6). At 12 h post-injection there were no main effects of NPY dose on gene expression in adipose tissue but many differences between the genetic lines (Table 7). PPARγ (P = 0.01), SREBP1 (P = 0.005), C/

chicks injected with the lower dose than in chicks injected with the higher dose of NPY. By 6 h and thereafter there was no treatment effect. There was a main effect of genetic line on activity of G3PDH at 1 (P = 0.0001), 3 (P = 0.003), and 12 (P = 0.007) h post-injection, where activity was greater in HWS than LWS chicks. The interaction of genetic line and treatment was not significant at any of the time points. 3.2. Plasma non-esterified fatty acid concentrations Plasma NEFA concentration results are displayed in Table 3. There was an effect of NPY treatment on NEFA concentrations at 1 (P = 0.03) and 12 (P = 0.02) h post-injection. At 1 h post-injection, plasma NEFAs were reduced in chicks injected with either dose of NPY as compared to the vehicle, and at 12 h post-injection, NEFAs were greater in the vehicle-injected than 60 μg/kg NPY-injected chicks. Plasma NEFAs were greater in LWS than HWS chicks at 3 (P < 0.0001), 6 (P = 0.003), 12 (P = 0.0001), and 24 (P = 0.0003) h post-injection. There was an interaction of genetic line and NPY dose on NEFA concentrations at 12 h post-injection where concentrations were greater in LWS than HWS in the vehicle-injected group but not in the NPY-injected groups (Fig. 1). 3.3. mRNA abundance in subcutaneous adipose tissue The mRNA abundance results are summarized in Tables 4-8. Because there were so few two-way interactions of treatment and genetic line, the P-values for interactions are not displayed in the tables and significant interactions are indicated by footnotes in the respective tables and are shown graphically in Fig. 2. At 1 h post-injection (Table 4),

Fig. 1. Interaction of genetic line and neuropeptide Y (NPY) dose (P = 0.02) on plasma non-esterified fatty acid (NEFA) concentrations at 12 h post-injection in chicks from lines selected for low (LWS) or high (HWS) body weight. At 5 days post-hatch chicks were injected intraperitoneally with NPY and plasma collected at 12 h post-injection (n = 12 per group). Bars with unique letters are different, P < 0.05 (Tukey's test).

4

Comparative Biochemistry and Physiology, Part A 213 (2017) 1–10

L. Liu et al.

Table 4 mRNA abundance in adipose tissue at 1 h after NPY injection1. Gene2

PPARγ SREBP1 C/EBPα C/EBPβ NPY NPYR2 NPYR1 LPL ACC1 AGPAT2 SCD1 PLN1 MTTP ATGL FABP4 GPAT3

NPY treatment3 (μg/kg BW)

Line4

0

60

120

HWS

LWS

2.06 ± 0.51a 1.06 ± 0.14 1.01 ± 0.12a 3.25 ± 0.86 1.45 ± 0.19 2.24 ± 0.53 3.18 ± 0.82b 1.01 ± 0.12 1.04 ± 0.11ab 1.1 ± 0.09 0.08 ± 0.02b 1.52 ± 0.23 2.98 ± 0.67a 2.99 ± 0.39 1.16 ± 0.12 0.77 ± 0.12

1.58 ± 0.35a 1.33 ± 0.46 0.96 ± 0.13a 3.43 ± 0.85 1.17 ± 0.13 2.1 ± 0.3 4.89 ± 1.09ab 1 ± 0.1 1.31 ± 0.1a 1.31 ± 0.1 0.2 ± 0.04b 1.58 ± 0.22 1.29 ± 0.36b 2.52 ± 0.44 1.24 ± 0.1 0.7 ± 0.11

0.71 ± 0.17b 0.6 ± 0.05 0.62 ± 0.04b 5.06 ± 1.71 0.96 ± 0.09 2.64 ± 0.31 6.59 ± 1.35a 0.94 ± 0.1 0.98 ± 0.08b 1.16 ± 0.07 0.54 ± 0.2a 1.52 ± 0.21 1.56 ± 0.44ab 2.72 ± 0.34 1.26 ± 0.13 0.56 ± 0.09

1.27 ± 0.25 1.21 ± 0.31 0.91 ± 0.08 3.09 ± 0.75 1.06 ± 0.09 1.15 ± 0.1 1.87 ± 0.38 1.14 ± 0.09 1.17 ± 0.09 1.12 ± 0.07 0.52 ± 0.13 1.03 ± 0.03 1.21 ± 0.27 1.5 ± 0.15 1.13 ± 0.09 1.02 ± 0.09

1.69 0.78 0.82 4.73 1.32 3.39 8.72 0.83 1.05 1.25 0.03 2.03 2.63 3.99 1.31 0.33

± ± ± ± ± ± ± ± ± ± ± ± ± ± ± ±

0.39 0.1 0.1 1.17 0.14 0.25⁎⁎ 2.49⁎⁎ 0.08⁎ 0.07 0.07 0.01⁎⁎5 0.21⁎⁎ 0.51⁎ 0.31⁎⁎ 0.1 0.02⁎⁎

1 On day 5 post-hatch, chicks from lines selected for low (LWS) or high (HWS) body weight were injected intraperitoneally with 0 (vehicle), 60, or 120 μg/kg BW chicken NPY and tissues collected at 1 h post-injection (n = 12 per group). Each time point represents a different set of chicks. 2 PPARγ: peroxisome proliferator-activated receptor gamma; SREBP1: sterol regulatory element-binding protein 1; C/EBPα: CCAAT/enhancer binding protein alpha; C/EBPβ: CCAAT/ enhancer binding protein beta; NPY: neuropeptide Y; NPY1 and 2 R: neuropeptide Y receptors 1 and 2, respectively; LPL: lipoprotein lipase; FABP4: fatty acid binding protein 4; GPAT3: glycerol-3-phosphate acyltransferase 3; ACC1: acetyl-CoA carboxylase alpha; AGPAT2: 1-acylglycerol-3-phosphate O-acyltransferase 2; SCD1: stearoyl-CoA desaturase 1; PLIN1: perilipin 1; MTTP: microsomal triglyceride transfer protein; ATGL: adipose triglyceride lipase. 3 Main effect of NPY dose on mRNA abundance. Results are means ± SEM. Unique superscripts, P < 0.05, Tukey's test. 4 Main effect of genetic line on mRNA abundance. *, P < 0.05; **, P < 0.0001. 5 Two-way interaction of NPY dose and genetic line; see Fig. 2A.

4. Discussion

EBPα (P = 0.03), LPL (P < 0.0001), GPAT3 (P < 0.0001), and SCD1 (P < 0.0001) were greater in HWS than LWS, while NPYR2 (P = 0.001), NPYR1 (P = 0.001), MTTP (P < 0.0001), and ATGL (P < 0.0001) mRNAs were greater in LWS than HWS. There was an interaction of genetic line and NPY treatment on expression of NPY (Fig. 2B; P = 0.04) at 12 h post-injection where expression was greater in LWS than HWS chicks that received the lower dose of NPY whereas expression was similar in the lines for the other two treatment groups. At 24 h post-injection, NPYR1 and NPYR2 mRNAs were greater (P < 0.05) in chicks that received the higher dose of NPY than in the other two treatment groups (Table 8).

Our results describe how peripheral administration of NPY influences adipose tissue physiology in chicks that differ in their sensitivity in the food intake response to centrally-injected NPY. Enzyme activity, plasma NEFAs (as an indicator of lipolysis), and gene expression of adipogenesis and lipolysis-associated factors were measured in adipose tissue at 1, 3, 6, 12, and 24 h post-injection. The discussion in this paper will integrate results from several studies and therefore it is important to bear in mind differences in objectives among studies. Here the focus was on evaluating responses in subcutaneous fat, because it was the only depot in which a sufficient amount of fat could be obtained from

Table 5 mRNA abundance in adipose tissue at 3 h after NPY injection1. Gene2

PPARγ SREBP1 C/EBPα C/EBPβ NPY NPYR2 NPYR1 LPL ACC1 AGPAT2 SCD1 PLN1 MTTP ATGL FABP4 GPAT3

NPY treatment3 (μg/kg BW)

Line4

0

60

120

HWS

LWS

1.1 ± 0.17b 1.3 ± 0.22 1.32 ± 0.16 1.52 ± 0.2b 1.56 ± 0.17 1.47 ± 0.24 3.3 ± 0.63 1.25 ± 0.16 1.48 ± 0.18 1.88 ± 0.24 2.14 ± 0.69 1.59 ± 0.28 0.98 ± 0.21 1.56 ± 0.36 1.31 ± 0.2 0.98 ± 0.21

1.31 ± 0.17ab 1.18 ± 0.16 1.15 ± 0.12 2.26 ± 0.22a 1.5 ± 0.24 2.31 ± 0.49 4.47 ± 1 1.17 ± 0.13 1.55 ± 0.23 2.32 ± 0.36 0.95 ± 0.41 1.64 ± 0.28 1.49 ± 0.38 1.72 ± 0.36 1.15 ± 0.16 1.1 ± 0.21

1.96 ± 0.36a 1.4 ± 0.26 1.67 ± 0.21 2.28 ± 0.23a 1.58 ± 0.34 2.22 ± 0.45 7.93 ± 2.15 1.54 ± 0.23 1.66 ± 0.29 1.87 ± 0.24 2.55 ± 0.93 1.22 ± 0.2 1.7 ± 0.72 1.13 ± 0.17 1.3 ± 0.18 1.22 ± 0.29

1.64 ± 0.24 1.55 ± 0.18 0.81 ± 0.15 1.66 ± 0.14 1.74 ± 0.26 1.9 ± 0.35 4.12 ± 0.95 1.4 ± 0.15 1.69 ± 0.19 2.19 ± 0.26 3.56 ± 0.72 1.3 ± 0.21 1.02 ± 0.23 0.97 ± 0.22 1.21 ± 0.13 1.72 ± 0.22

1.23 ± 0.15 1.03 ± 0.14⁎ 0.66 ± 0.12 2.38 ± 0.2⁎⁎ 1.35 ± 0.14 2.07 ± 0.32 5.84 ± 1.18 1.21 ± 0.13 1.43 ± 0.2 1.85 ± 0.2 0.19 ± 0.08⁎⁎⁎ 1.67 ± 0.21 1.74 ± 0.5 1.95 ± 0.26⁎⁎ 1.3 ± 0.16 0.5 ± 0.07⁎⁎⁎

1 On day 5 post-hatch, chicks from lines selected for low (LWS) or high (HWS) body weight were injected intraperitoneally with 0 (vehicle), 60, or 120 μg/kg BW chicken NPY and tissues collected at 3 h post-injection (n = 12 per group). Each time point represents a different set of chicks. 2 See Table 4 for description of abbreviations. 3 Main effect of NPY dose on mRNA abundance. Results are means ± SEM. Unique superscripts, P < 0.05, Tukey's test. 4 Main effect of genetic line on mRNA abundance. *, P < 0.05; **, P < 0.01; ***, P < 0.0001.

5

Comparative Biochemistry and Physiology, Part A 213 (2017) 1–10

L. Liu et al.

Table 6 mRNA abundance in adipose tissue at 6 h after NPY injection1. Gene2

PPARγ SREBP1 C/EBPα C/EBPβ NPY NPYR2 NPYR1 LPL ACC1 AGPAT2 SCD1 PLN1 MTTP ATGL FABP4 GPAT3

NPY treatment3 (μg/kg BW)

Line4

0

60

120

HWS

LWS

0.57 ± 0.08b 0.35 ± 0.05 0.57 ± 0.08b 0.96 ± 0.19 3.48 ± 0.6 4.1 ± 0.7 18.35 ± 5.77 0.47 ± 0.07 1.23 ± 0.35 0.38 ± 0.03 0.09 ± 0.04 0.81 ± 0.14 2 ± 0.6 1.57 ± 0.21 0.74 ± 0.07 0.67 ± 0.15

0.64 ± 0.09ab 0.38 ± 0.04 0.57 ± 0.06b 0.94 ± 0.14 3.58 ± 0.47 6.78 ± 1.46 25.92 ± 7.2 0.51 ± 0.08 0.88 ± 0.11 0.42 ± 0.03 0.06 ± 0.03 0.82 ± 0.15 2.48 ± 0.56 1.61 ± 0.23 0.76 ± 0.09 0.52 ± 0.09

0.86 ± 0.08a 0.45 ± 0.05 0.86 ± 0.08a 0.8 ± 0.1 3.3 ± 0.37 6.13 ± 1.42 22.12 ± 5.68 0.72 ± 0.09 1.22 ± 0.17 0.35 ± 0.03 0.06 ± 0.02 0.95 ± 0.15 2.41 ± 0.55 1.17 ± 0.15 0.77 ± 0.08 0.46 ± 0.09

0.75 ± 0.06 0.42 ± 0.04 0.75 ± 0.06 0.5 ± 0.04 2.87 ± 0.27 2.79 ± 0.35 7.01 ± 0.77 0.65 ± 0.06 0.76 ± 0.08 0.35 ± 0.02 0.11 ± 0.03 0.51 ± 0.04 0.99 ± 0.17 1.01 ± 0.13 0.7 ± 0.06 0.79 ± 0.11

0.63 ± 0.08 0.37 ± 0.03 0.58 ± 0.06⁎ 1.3 ± 0.14⁎⁎⁎ 4.06 ± 0.49⁎ 8.42 ± 1.19⁎⁎⁎ 36.27 ± 5.99⁎⁎⁎ 0.49 ± 0.07 1.41 ± 0.23⁎ 0.41 ± 0.03 0.03 ± 0.01⁎ 1.22 ± 0.14⁎⁎⁎ 3.63 ± 0.56⁎⁎⁎ 1.89 ± 0.17⁎⁎⁎ 0.81 ± 0.07 0.31 ± 0.05⁎⁎

1 On day 5 post-hatch, chicks from lines selected for low (LWS) or high (HWS) body weight were injected intraperitoneally with 0 (vehicle), 60, or 120 μg/kg BW chicken NPY and tissues collected at 6 h post-injection (n = 12 per group). Each time point represents a different set of chicks. 2 See Table 4 for description of abbreviations. 3 Main effect of NPY dose on mRNA abundance. Results are means ± SEM. Unique superscripts, P < 0.05, Tukey's test. 4 Main effect of genetic line on mRNA abundance. *, P < 0.05; **, P < 0.01; ***, P < 0.0001.

nervous system-derived signals and post-absorptive peripheral signaling that affect metabolism might explain the greater rates of lipolysis in LWS, and hence the greater anti-lipolytic effect of NPY in LWS chicks, although similar differences in lipolysis have been reported (Calabotta et al., 1985). Because of differences in body composition (i.e., greater percentage of body fat in HWS), the relative amount of NPY per cell in the adipose tissue after injection may have also differed. Also, it is possible that due to differences in adipose tissue accumulation between the lines, the cellular composition of what was sampled might differ (e.g., greater proportion of blood vessels and connective tissue in LWS compared to HWS chicks). That genes encoding factors that are considered to be markers for adipogenesis (e.g., fatty acid binding protein 4; FABP4) were expressed similarly between the lines argues that results presented herein are indeed preadipocyteand adipocyte-specific.

LWS chicks, which are very lean, for downstream assays. Previous research with the HWS and LWS lines as well as those from other genetic backgrounds has revealed physiological differences among different anatomical depots of fat, namely the clavicular, subcutaneous, and abdominal (Bai et al., 2015; Zhang et al., 2014a) and among ages and between sexes in older chickens (Calabotta et al., 1983; Zhang et al., 2013, 2014a). Because of limitations in cages and sample sizes at hatch, not all time points could be evaluated within a single hatch, thus introducing a potential hatch effect as a source of error in the study although all conditions and source populations were identical among time points. A hatch effect and inherent differences in food intake (although not different in this study when expressed as a percentage of body weight) may explain why the same genes were not different between LWS and HWS at each time point evaluated. Additionally, the differences in food intake and consequential differences in central Table 7 mRNA abundance in adipose tissue at 12 h after NPY injection1. Gene2

PPARγ SREBP1 C/EBPα C/EBPβ NPY NPYR2 NPYR1 LPL ACC1 AGPAT2 SCD1 PLN1 MTTP ATGL FABP4 GPAT3

NPY treatment3 (μg/kg BW)

Line4

0

60

120

HWS

LWS

0.25 ± 0.04 0.48 ± 0.05 1.52 ± 0.37 1.07 ± 0.2 4.16 ± 0.44 4.7 ± 0.0.65 16.75 ± 3.08 1.97 ± 0.3 2.57 ± 0.3 0.85 ± 0.08 0.18 ± 0.07 0.99 ± 0.12 2.44 ± 0.5 1.23 ± 0.13 2.31 ± 0.19 0.45 ± 0.09

0.19 ± 0.02 0.41 ± 0.06 2.24 ± 0.61 0.82 ± 0.11 4.31 ± 0.61 4.63 ± 0.89 20.46 ± 5.66 1.73 ± 0.17 2.21 ± 0.21 0.88 ± 0.09 0.28 ± 0.11 1.08 ± 0.1 2.33 ± 0.59 1.61 ± 0.22 2.17 ± 0.15 0.38 ± 0.06

0.21 ± 0.03 0.6 ± 0.09 2.15 ± 0.59 1.18 ± 0.23 3.71 ± 0.55 4.97 ± 0.87 19.8 ± 4.5 1.87 ± 0.27 2.36 ± 0.24 0.92 ± 0.09 0.19 ± 0.06 1.2 ± 0.27 3.48 ± 0.96 2.02 ± 0.31 2.21 ± 0.19 0.41 ± 0.06

0.27 ± 0.03 0.6 ± 0.07 2.65 ± 0.51 0.86 ± 0.17 3.85 ± 0.37 3.34 ± 0.53 9.22 ± 1.38 2.59 ± 0.2 2.43 ± 0.2 0.9 ± 0.08 0.4 ± 0.09 1.03 ± 0.07 1.36 ± 0.24 1.11 ± 0.11 2.24 ± 0.15 0.62 ± 0.06

0.17 ± 0.02⁎ 0.39 ± 0.04⁎⁎ 1.29 ± 0.31⁎ 1.18 ± 0.13 4.27 ± 0.495 6.51 ± 0.73⁎⁎ 27.92 ± 4.32⁎⁎ 1.15 ± 0.13⁎⁎⁎ 2.35 ± 0.2 0.87 ± 0.06 0.04 ± 0⁎⁎⁎ 1.14 ± 0.19 4.04 ± 0.69⁎⁎ 2.09 ± 0.22⁎⁎⁎ 2.23 ± 0.14 0.22 ± 0.03⁎⁎⁎

1 On day 5 post-hatch, chicks from lines selected for low (LWS) or high (HWS) body weight were injected intraperitoneally with 0 (vehicle), 60, or 120 μg/kg BW chicken NPY and tissues collected at 12 h post-injection (n = 12 per group). Each time point represents a different set of chicks. 2 See Table 4 for description of abbreviations. 3 Main effect of NPY dose on mRNA abundance. Results are means ± SEM. 4 Main effect of genetic line on mRNA abundance. *, P < 0.05; **, P < 0.01; ***, P < 0.0001. 5 Two-way interaction of NPY dose and genetic line; see Fig. 2B.

6

Comparative Biochemistry and Physiology, Part A 213 (2017) 1–10

L. Liu et al.

Table 8 mRNA abundance in adipose tissue at 24 h after NPY injection1. Gene2

PPARγ SREBP1 C/EBPα C/EBPβ NPY NPYR2 NPYR1 LPL ACC1 AGPAT2 SCD1 PLN1 MTTP ATGL FABP4 GPAT3

NPY treatment3 (μg/kg BW)

Line4

0

60

120

HWS

LWS

0.77 ± 0.24 0.61 ± 0.08 0.21 ± 0.02 0.5 ± 0.15 2.48 ± 0.46 2.87 ± 0.62b 4.02 ± 1.02b 1.57 ± 0.21 0.8 ± 0.12 0.47 ± 0.07 0.26 ± 0.07 0.25 ± 0.11 1.5 ± 0.43 0.73 ± 0.12 4.31 ± 1.19 0.36 ± 0.04

0.87 ± 0.19 0.7 ± 0.1 0.21 ± 0.04 0.49 ± 0.09 2.23 ± 0.5 2.34 ± 0.33b 4.77 ± 1.07b 2.68 ± 0.78 0.73 ± 0.1 0.43 ± 0.07 0.18 ± 0.07 0.48 ± 0.21 2.55 ± 0.7 0.78 ± 0.16 3.49 ± 0.57 0.3 ± 0.05

0.58 ± 0.13 0.95 ± 0.19 0.24 ± 0.03 0.87 ± 0.3 2.81 ± 0.41 6.4 ± 1.21a 10.85 ± 3.2a 3.4 ± 0.76 1.02 ± 0.16 0.58 ± 0.1 0.13 ± 0.04 0.32 ± 0.1 3.09 ± 0.71 1.15 ± 0.19 3.38 ± 0.63 0.41 ± 0.07

0.84 ± 0.19 0.77 ± 0.11 0.23 ± 0.02 0.55 ± 0.11 2.47 ± 0.42 3.1 ± 0.5 4.66 ± 0.8 2.61 ± 0.51 0.84 ± 0.1 0.48 ± 0.05 0.24 ± 0.06 0.37 ± 0.14 2.42 ± 0.52 0.87 ± 0.09 4.02 ± 0.81 0.37 ± 0.04

0.63 0.71 0.21 0.69 2.53 4.45 8.46 2.39 0.86 0.51 0.14 0.32 2.31 0.89 3.49 0.34

± ± ± ± ± ± ± ± ± ± ± ± ± ± ± ±

0.12 0.1 0.02 0.2 0.32 0.85 2.32 0.52 0.1 0.08 0.03 0.09 0.51 0.16 0.61 0.05

1 On day 5 post-hatch, chicks from lines selected for low (LWS) or high (HWS) body weight were injected intraperitoneally with 0 (vehicle), 60, or 120 μg/kg BW chicken NPY and tissues collected at 24 h post-injection (n = 12 per group). Each time point represents a different set of chicks. 2 See Table 4 for description of abbreviations. 3 Main effect of NPY dose on mRNA abundance. Results are means ± SEM. Unique superscripts, P < 0.05, Tukey's test. 4 Main effect of genetic line on mRNA abundance.

compared to the wild-type mice (Park et al., 2014). Similarly, in 3T3-L1 preadipocytes that were induced to differentiate in the presence of 100 nM NPY there was increased expression of C/EBPα and PPARγ2 (Park et al., 2014), the same genes that were affected by NPY dose in the present study. PPARγ is considered to be the master regulator of adipocyte differentiation (Siersbaek et al., 2010). In the present study, PPARγ expression was greater in HWS than LWS at 3 and 12 h postinjection, and was affected by NPY treatment in both lines at 1, 3, and 6 h post-injection. In mouse 3T3-L1 cells, C/EBPβ expression is temporarily induced during preadipocyte proliferation and the later induction of C/EBPα coincides with a halt in preadipocyte proliferation and a strong activation of adipocyte differentiation-associated factors (Darlington et al., 1998). The changes in expression of transcription factors in response to NPY treatment in the present study were similar in cells from the stromal-vascular fraction (SVF) isolated from the abdominal fat of chicks, demonstrating that results from in vitro studies are representative of in vivo physiology. During the earlier stages of differentiation, there was a reduction in expression of transcription factors, with less C/EBPα and SREBP mRNA in NPY-treated cells at day 4 and less PPARγ at days 4 and 6 post-differentiation (Zhang et al., 2015a),

4.1. Adipogenic effects of NPY In general, most effects of NPY treatment were observed within the first 3 h post-injection and by 24 h essentially all effects had disappeared. Almost all gene expression effects were observed with the higher but not lower dose of NPY, while NEFAs and G3PDH activity were affected by the lower dose, suggesting that the higher dose produced a circulating concentration that was high and sufficiently sustained to mediate major transcriptional effects on the adipose tissue. Observed were obvious effects of NPY treatment that point to a role in promoting adipogenesis while inhibiting lipolysis in birds. The increase in G3PDH activity at 1 and 3 h, and decrease in plasma NEFAs at 1 and 12 h post-injection in NPY-treated chicks combined with changes in gene expression is indicative of an increase in triacylglycerol synthesis and reduction in lipolysis, respectively, the net effect being an increase in lipid available for storage in the adipocyte. The effects of NPY on lipid remodeling observed here were consistent with those in 6 month-old NPY−/− mice with less visceral and subcutaneous adipose tissue, reduced gonadal fat gene expression of C/ EBPα, PPARγ2, FABP4 and diacylglycerol O-acyltransferase 1, and increased serum free fatty acid concentrations after an overnight fast, as

Fig. 2. Interactions of genetic line and neuropeptide Y (NPY) treatment on A) stearoyl-CoA desaturase 1 (SCD1) mRNA at 1 h post-injection and B) NPY mRNA at 12 h post-injection. Chicks from lines selected for low (LWS) or high (HWS) body weight were injected intraperitonally with 1, 60, or 120 μg/kg BW chicken NPY (n = 12 per group) and subcutaneous adipose tissue was collected at the indicated times post-injection. Bars with unique letters are different, P < 0.05 (Tukey's test).

7

Comparative Biochemistry and Physiology, Part A 213 (2017) 1–10

L. Liu et al.

4.3. LWS and HWS chick adipose tissues differ in adipogenesis and lipolysis

similar to the reduction in PPARγ and C/EBPα observed at 1 h postinjection in our chicks treated with the higher dose of NPY. In cultured SVF cells, during the later stages of differentiation (day 8), there was increased expression of C/EBPβ and SREBP in NPY-treated cells (Shipp et al., 2016a). Similarly, in the present study, at 3 and 6 h post-injection, expression of PPARγ, C/EBPβ, and C/EBPα increased in the subcutaneous fat of NPY-treated chicks. These data suggest that during the first 6 h post-injection changes occur that result in increased adipogenesis and lipid synthesis, although the time scale in vivo for transcriptional changes to translate into changes in cellular proliferation and/or differentiation are unclear. Although there were parallels in NPY-induced gene expression in our in vitro and present in vivo study, it is also unclear how the doses compare between studies and it is important to bear in mind that the method of application likely contributed to the lag time to observe an effect. For example, in the in vitro study, NPY was continuously applied directly to precursor cells, whereas in the present study it was injected into the peritoneum. Therefore, it is unclear how much would have diffused into the adipose tissue and reached preadipocytes and adipocytes, and how the physiology of other cell types (including those that secrete NPY) would influence the effect of NPY. That expression of NPY receptors 1 and 2 were increased in NPY-treated chicks at 24 h postinjection suggests that NPY treatment has a positive feedback effect on its own system. In chicken adipose-tissue derived SVF cells that were treated with NPY, expression of NPY was decreased after 12 h of treatment (Shipp et al., 2016a) and increased at 2 and 6 days post-induction of differentiation (Zhang et al., 2015a), with no observable effects on expression of the receptor. While there were multiple parallels in NPY-induced transcriptional changes in the previous in vitro studies and present research, it should be noted that there were some genes influenced in the previous study (e.g., FABP4), that were not affected in the present study. There are several explanations for this, including that in vitro studies were conducted on isolated cells from Cobb-500 broilers, whereas in the present study NPY was injected into chicks from a different genetic background and effects of NPY are influenced by the physiological contribution of other cell types, or that time scales (hours in the present study vs. days in the in vitro studies) are not comparable. Expression of several factors associated with lipid metabolism and droplet formation was affected by NPY treatment, further supporting that NPY affects lipid remodeling in the adipocyte. Expression of MTTP was decreased by NPY treatment at 1 h. It associates with the lipid droplet and may play a role in formation in adipocytes although its exact function in this regard is unclear (Love et al., 2015). SCD1, a desaturase enzyme associated with fat synthesis (Flowers and Ntambi, 2008), was increased at 1 h post-injection. Changes in expression of these two lipid metabolism-associated factors are indicative of immediate changes in lipid remodeling induced by NPY, although mechanisms are unclear.

Line-specific differences in response to injection of NPY indicate a differential threshold sensitivity in the adipose tissue response to NPY. At 1 h, SCD1 mRNA was up-regulated in HWS but not LWS chicks that received the higher dose of NPY. SCD1 is a delta-9 desaturase that catalyzes the rate-limiting step in the synthesis of unsaturated fatty acids that serve as substrates for synthesis of complex lipids (Flowers and Ntambi, 2008). Elevated SCD1 activity in mammals is associated with an increase in fatty acid synthesis and reduction in fatty acid oxidation, and perhaps contributes to the development of obesity (Dobrzyn and Ntambi, 2005; Flowers and Ntambi, 2009). At all other time points except for 24 h, SCD1 mRNA was greater in HWS than LWS, implying a greater capacity for lipid deposition in HWS adipose tissue. Another obvious difference between HWS and LWS lines was the greater expression of GPAT3 mRNA in the former than latter at all but the last time point. GPAT3 encodes an enzyme that is highly expressed in adipose tissue and is involved in triacylglycerol synthesis, as reviewed (Yamashita et al., 2014). Overexpression in HEK 293 and COS-7 cells was associated with enhanced cellular rates of triacylglycerol synthesis and localization of GPAT3 to the membrane of the endoplasmic reticulum (Cao et al., 2006). During differentiation, GPAT3 mRNA abundance in 3T3-L1 cells increased 60-fold, consistent with its role in fat synthesis (Cao et al., 2006). In GPAT3−/− mice, total GPAT activity was reduced by 80%, demonstrating that GPAT3 is responsible for most of the GPAT activity in adipose tissue (Cao et al., 2014). The elevated expression of adipogenic transcription factors (C/EBPα, PPARγ, and SREBP1), GPAT3, SCD1, and activity of G3PDH in HWS adipose tissue may help explain the propensity of this line to rapidly accumulate adipose tissue after hatching and develop obesity as juveniles. Lipoprotein lipase was also more highly expressed in HWS than LWS at 1 and 12 h post-injection. LPL is the rate-limiting enzyme for fatty acid entry from the blood into adipocytes, although in rodents, do novo synthesis of fatty acids in adipose tissue can compensate for a lack of LPL activity (Weinstock et al., 1997). In chickens and other birds, the liver rather than adipose tissue is the main site of de novo lipid synthesis (Leveille et al., 1975; Shrago and Spennetta, 1976), thus LPL activity is essential for providing a steady supply of fatty acids from plasma lipoproteins. Therefore, the greater expression of LPL in HWS than LWS chicks may also help explain the accelerated lipid deposition that occurs in HWS chicks after hatch. Several lipid droplet and lipolysis-associated factors were more highly expressed in LWS than HWS chicks at multiple times. Microsomal triglyceride transfer protein is a lipid transfer protein with a high selectivity for triacylglycerols and cholesteryl esters that is expressed in adipocytes and associates with the lipid droplet, thought to play a role in lipid droplet turnover (Love et al., 2015). Perilipin 1, another lipid droplet-associated protein (Tansey et al., 2004), was also more highly expressed at several time points in LWS than HWS. Perilipin-1 associates exclusively with the outer surface of lipid droplets and its phosphorylation is required to facilitate dissociation and exposure of lipid droplets to lipases during the initiation of lipolysis (Fruhbeck et al., 2014). In PLN1−/− mice however, there was a hampered ability to trigger lipolysis, indicating that although PLN1 protects the lipids in the droplet from unregulated catabolism, it is also required to activate lipolysis, suggesting that it is also a lipolytic factor (Fruhbeck et al., 2014). Adipose triglyceride lipase is a rate-limiting enzyme that cleaves the first ester bond of a triacylglycerol in the lipid droplet during lipolysis (Villena et al., 2004; Zimmermann et al., 2004), thus greater expression in LWS than HWS could be associated with an increased capacity for lipolysis. C/EBPβ mRNA was consistently greater in LWS than HWS, and given that its expression is transiently induced during preadipocyte proliferation (Darlington et al., 1998), its greater expression may be indicative of reduced induction of adipocyte maturation. Greater expression of these factors in LWS than HWS suggests that

4.2. Anti-lipolytic effects of NPY The best known role of NPY in lipid remodeling is with respect to its inhibition of lipolysis. Injection of NPY inhibited serum deprivationinduced lipolysis in mouse 3T3-L1 cells, an effect that was blunted by treatment with a NPYR1 antagonist, BIB03304 (Park et al., 2014). Expression of NPYR1 was increased at 1 h and 24 h in the present study, which may have represented a feedback effect to increase the capacity for NPY signaling. Our plasma NEFA results suggest that NPY also inhibits lipolysis in birds. The lipolytic effect was line-specific at one time point. At 12 h, plasma NEFAs were reduced in NPY-treated chicks from the LWS but not HWS line, and LWS chicks expressed more NPYR1 than HWS, suggesting that LWS have a different threshold response to the lipolytic effects of NPY.

8

Comparative Biochemistry and Physiology, Part A 213 (2017) 1–10

L. Liu et al.

preadipocytes in vitro. J. Anim. Sci. 88, 1999–2008. Leveille, G.A., Romsos, D.R., Yeh, Y.-Y., O'Hea, E.K., 1975. Lipid biosynthesis in the chick. A consideration of site of synthesis, influence of diet and possible regulatory mechanisms. Poult. Sci. 54, 1075–1093. Levine, A.S., Morley, J.E., 1984. Neuropeptide Y: a potent inducer of consummatory behavior in rats. Peptides 5, 1025–1029. Love, J.D., Suzuki, T., Robinson, D.B., Harris, C.M., Johnson, J.E., Mohler, P.J., Jerome, W.G., Swift, L.L., 2015. Microsomal triglyceride transfer protein (MTP) associates with cytosolic lipid droplets in 3T3-L1 adipocytes. PLoS One 10, e0135598. Miner, J.L., Della-Fera, M.A., Paterson, J.A., Baile, C.A., 1989. Lateral cerebroventricular injection of neuropeptide Y stimulates feeding in sheep. Am. J. Phys. 257, R383–387. Morley, J.E., Levine, A.S., Gosnell, B.A., Kneip, J., Grace, M., 1987. Effect of neuropeptide Y on ingestive behaviors in the rat. Am. J. Phys. 252, R599–609. Newmyer, B.A., Nandar, W., Webster, R.I., Gilbert, E., Siegel, P.B., Cline, M.A., 2013. Neuropeptide Y is associated with changes in appetite-associated hypothalamic nuclei but not food intake in a hypophagic avian model. Behav. Brain Res. 236, 327–331. Park, S., Fujishita, C., Komatsu, T., Kim, S.E., Chiba, T., Mori, R., Shimokawa, I., 2014. NPY antagonism reduces adiposity and attenuates age-related imbalance of adipose tissue metabolism. FASEB J. 28, 5337–5348. Parrott, R.F., Heavens, R.P., Baldwin, B.A., 1986. Stimulation of feeding in the satiated pig by intracerebroventricular injection of neuropeptide Y. Physiol. Behav. 36, 523–525. Rice, B.B., Zhang, W., Bai, S., Siegel, P.B., Cline, M.A., Gilbert, E.R., 2014. Insulin-induced hypoglycemia associations with gene expression changes in liver and hypothalamus of chickens from lines selected for low or high body weight. Gen. Comp. Endocrinol. 208, 1–4. Richardson, R.D., Boswell, T., Raffety, B.D., Seeley, R.J., Wingfield, J.C., Woods, S.C., 1995. NPY increases food intake in white-crowned sparrows: effect in short and long photoperiods. Am. J. Phys. 268, R1418–1422. Robey, W.W., Cherry, J.A., Siegel, P.B., Van Krey, H.P., 1988. Hyperplastic response of adipose tissue to caloric overconsumption in sexually mature chickens. Poult. Sci. 67, 800–808. Robey, W.W., Van Krey, H.P., Cherry, J.A., Siegel, P.B., Bliss, B.A., 1992. Adipocyte dynamics in the retroperitioneal fat depot of genetically selected adult high- and lowweight line chickens. Arch. Gerflugelk 56, 68–72. Rubin, C.J., Zody, M.C., Eriksson, J., Meadows, J.R.S., Sherwood, E., Webster, M.T., Jiang, L., Ingman, M., Sharpe, T., Ka, S., Hallbook, F., Besnier, F., Carlborg, O., Bed'hom, B., Tixier-Boichard, M., Jensen, P., Siegel, P., Lindblad-Toh, K., Andersson, L., 2010. Whole-genome resequencing reveals loci under selection during chicken domestication. Nature 464 (587-U145). Schmittgen, T.D., Livak, K.J., 2008. Analyzing real-time PCR data by the comparative C(T) method. Nat. Protoc. 3, 1101–1108. Shipp, S.L., Cline, M.A., Gilbert, E.R., 2016a. Promotion of adipogenesis by neuropeptide Y during the later stages of chicken preadipocyte differentiation. Physiol. Rep. 4. Shipp, S.L., Cline, M.A., Gilbert, E.R., 2016b. Recent advances in the understanding of how neuropeptide Y and alpha-melanocyte stimulating hormone function in adipose physiology. Adipocyte 5, 333–350. Shrago, E., Spennetta, T., 1976. The carbon pathway for lipogenesis in isolated adipocytes from rat, guinea pig, and human adipose tissue. Am. J. Clin. Nutr. 29, 540–545. Siersbaek, R., Nielsen, R., Mandrup, S., 2010. PPARgamma in adipocyte differentiation and metabolism—novel insights from genome-wide studies. FEBS Lett. 584, 3242–3249. Singer, K., Morris, D.L., Oatmen, K.E., Wang, T., DelProposto, J., Mergian, T., Cho, K.W., Lumeng, C.N., 2013. Neuropeptide Y is produced by adipose tissue macrophages and regulates obesity-induced inflammation. PLoS One 8, e57929. Tansey, J.T., Sztalryd, C., Hlavin, E.M., Kimmel, A.R., Londos, C., 2004. The central role of perilipin a in lipid metabolism and adipocyte lipolysis. IUBMB Life 56, 379–385. Villena, J.A., Roy, S., Sarkadi-Nagy, E., Kim, K.H., Sul, H.S., 2004. Desnutrin, an adipocyte gene encoding a novel patatin domain-containing protein, is induced by fasting and glucocorticoids. J. Biol. Chem. 279, 47066–47075. Weinstock, P.H., LevakFrank, S., Hudgins, L.C., Radner, H., Friedman, J.M., Zechner, R., Breslow, J.L., 1997. Lipoprotein lipase controls fatty acid entry into adipose tissue, but fat mass is preserved by endogenous synthesis in mice deficient in adipose tissue lipoprotein lipase. Proc. Natl. Acad. Sci. U. S. A. 94, 10261–10266. Wise, L.S., Green, H., 1979. Participation of one isozyme of cytosolic glycerophosphate dehydrogenase in the adipose conversion of 3T3 cells. J. Biol. Chem. 254, 273–275. Yamashita, A., Hayashi, Y., Matsumoto, N., Nemoto-Sasaki, Y., Oka, S., Tanikawa, T., Sugiura, T., 2014. Glycerophosphate/acylglycerophosphate acyltransferases. Biology (Basel) 3, 801–830. Yi, J., Gilbert, E.R., Siegel, P.B., Cline, M.A., 2015. Fed and fasted chicks from lines divergently selected for low or high body weight have differential hypothalamic appetite-associated factor mRNA expression profiles. Behav. Brain Res. 286, 58–63. Yi, J., Delp, M.S., Gilbert, E.R., Siegel, P.B., Cline, M.A., 2016. Anorexia is associated with stress-dependent orexigenic responses to exogenous neuropeptide Y. J. Neuroendocrinol. 28. Zelenka, D.J., Dunnington, E.A., Cherry, J.A., Siegel, P.B., 1988. Anorexia and sexual maturity in female white rock chickens. I. Increasing the feed intake. Behav. Genet. 18, 383–387. Zhang, W., Sumners, L.H., Siegel, P.B., Cline, M.A., Gilbert, E.R., 2013. Quantity of glucose transporter and appetite-associated factor mRNA in various tissues after insulin injection in chickens selected for low or high body weight. Physiol. Genomics 45, 1084–1094. Zhang, S., McMillan, R.P., Hulver, M.W., Siegel, P.B., Sumners, L.H., Zhang, W., Cline, M.A., Gilbert, E.R., 2014a. Chickens from lines selected for high and low body weight show differences in fatty acid oxidation efficiency and metabolic flexibility in skeletal

LWS have a faster rate of lipolysis and lipid turnover in their adipose tissue, consistent with them also having greater NEFA concentrations. The NPY receptors were also more highly expressed in LWS than HWS at several times. It is unclear how this difference may affect functionality in adipose tissue given that the LWS chicks are leaner and more resistant to fat accumulation than the HWS. 5. Conclusions In conclusion, this is the first report of how exogenous NPY affects adipose tissue physiology in vivo in an avian species. Peripheral injection of NPY was associated with multiple physiological effects in the adipose tissue of LWS and HWS chicks, results suggesting that during the first 3 h post-injection there were enhanced rates of triacylglycerol synthesis and reduced lipolysis in adipocytes in subcutaneous adipose tissue. Results also demonstrate that the anorexic LWS chicks have greater lipolytic capacity and express more NPY and receptor mRNA in subcutaneous adipose tissue and perhaps have a greater sensitivity to the anti-lipolytic effects of exogenous NPY, while the HWS chicks have a greater propensity to synthesize lipids and express more triacylglycerol synthesis-associated factors in adipose tissue and are more sensitive to the adipogenic effects of NPY. These results thus provide insights on the mechanisms underlying effects of NPY on adipose tissue and differential physiology in chicks from lines that are predisposed to be anorexic or obese. References Bai, S., Wang, G., Zhang, W., Zhang, S., Rice, B.B., Cline, M.A., Gilbert, E.R., 2015. Broiler chicken adipose tissue dynamics during the first two weeks post-hatch. Comp. Biochem. Physiol. A Mol. Integr. Physiol. 189, 115–123. Burgener, J.A., Cherry, J.A., Siegel, P.B., 1981. The association between sartorial fat and fat deposition in meat-type chickens. Poult. Sci. 60, 54–62. Calabotta, D.F., Cherry, J.A., Siegel, P.B., Gregory, E.M., 1983. Lipogenesis and lipolysis in normal and dwarf chickens from lines selected for high and low body weight. Poult. Sci. 62, 1830–1837. Calabotta, D.F., Cherry, J.A., Siegel, P.B., Jones, D.E., 1985. Lipogenesis and lipolysis in fed and fasted chicks from high and low body weight lines. Poult. Sci. 64, 700–704. Cao, J., Li, J.L., Li, D., Tobin, J.F., Gimeno, R.E., 2006. Molecular identification of microsomal acyl-CoA:glycerol-3-phosphate acyltransferase, a key enzyme in de novo triacylglycerol synthesis. Proc. Natl. Acad. Sci. U. S. A. 103, 19695–19700. Cao, J.S., Perez, S., Goodwin, B., Lin, Q.C., Peng, H.B., Qadri, A., Zhou, Y.J., Clark, R.W., Perreault, M., Tobin, J.F., Gimeno, R.E., 2014. Mice deleted for GPAT3 have reduced GPAT activity in white adipose tissue and altered energy and cholesterol homeostasis in diet-induced obesity. Am. J. Physiol. Endocrinol. Metab. 306, E1176–E1187. Clark, J.T., Kalra, P.S., Crowley, W.R., Kalra, S.P., 1984. Neuropeptide Y and human pancreatic polypeptide stimulate feeding behavior in rats. Endocrinology 115, 427–429. Darlington, G.J., Ross, S.E., MacDougald, O.A., 1998. The role of C/EBP genes in adipocyte differentiation. J. Biol. Chem. 273, 30057–30060. Dobrzyn, A., Ntambi, J.M., 2005. Stearoyl-CoA desaturase as a new drug target for obesity treatment. Obes. Rev. 6, 169–174. Dunnington, E.A., Siegel, P.B., 1996. Long-term divergent selection for eight-week body weight in white Plymouth rock chickens. Poult. Sci. 75, 1168–1179. Dunnington, E.A., Siegel, P.B., Cherry, J.A., Jones, D.E., Zelenka, D.J., 1986. Physiological traits in adult female chickens after selection and relaxation of selection for 8-week body weight. J. Anim. Breed. Genet. 103, 51–58. Dunnington, E.A., Honaker, C.F., McGilliard, M.L., Siegel, P.B., 2013. Phenotypic responses of chickens to long-term, bidirectional selection for juvenile body weight—historical perspective. Poult. Sci. 92, 1724–1734. Flowers, M.T., Ntambi, J.M., 2008. Role of stearoyl-coenzyme a desaturase in regulating lipid metabolism. Curr. Opin. Lipidol. 19, 248–256. Flowers, M.T., Ntambi, J.M., 2009. Stearoyl-CoA desaturase and its relation to highcarbohydrate diets and obesity. Biochim. Biophys. Acta 1791, 85–91. Fruhbeck, G., Mendez-Gimenez, L., Fernandez-Formoso, J.A., Fernandez, S., Rodriguez, A., 2014. Regulation of adipocyte lipolysis. Nutr. Res. Rev. 27, 63–93. Gelfo, F., De Bartolo, P., Tirassa, P., Croce, N., Caltagirone, C., Petrosini, L., Angelucci, F., 2011. Intraperitoneal injection of neuropeptide Y (NPY) alters neurotrophin rat hypothalamic levels: implications for NPY potential role in stress-related disorders. Peptides 32, 1320–1323. Katanbaf, M.N., Dunnington, E.A., Siegel, P.B., 1988. Allomorphic relationships from hatching to 56 days in parental lines and F1 crosses of chickens selected 27 generations for high or low body weight. Growth Dev. Aging 52, 11–21. Kuenzel, W.J., Douglass, L.W., Davison, B.A., 1987. Robust feeding following central administration of neuropeptide Y or peptide YY in chicks, Gallus domesticus. Peptides 8, 823–828. Lengi, A.J., Corl, B.A., 2010. Factors influencing the differentiation of bovine

9

Comparative Biochemistry and Physiology, Part A 213 (2017) 1–10

L. Liu et al.

B.J., Cline, M.A., Gilbert, E.R., 2015b. Hypothalamic differences in expression of genes involved in monoamine synthesis and signaling pathways after insulin injection in chickens from lines selected for high and low body weight. Neurogenetics 16, 133–144. Zimmermann, R., Strauss, J.G., Haemmerle, G., Schoiswohl, G., Birner-Gruenberger, R., Riederer, M., Lass, A., Neuberger, G., Eisenhaber, F., Hermetter, A., Zechner, R., 2004. Fat mobilization in adipose tissue is promoted by adipose triglyceride lipase. Science 306, 1383–1386.

muscle and white adipose tissue. Int. J. Obes. 38, 1374–1382. Zhang, W., Cline, M.A., Gilbert, E.R., 2014b. Hypothalamus-adipose tissue crosstalk: neuropeptide Y and the regulation of energy metabolism. Nutr. Metab. (Lond.) 11, 27. Zhang, W., Bai, S., Liu, D., Cline, M.A., Gilbert, E.R., 2015a. Neuropeptide Y promotes adipogenesis in chicken adipose cells in vitro. Comp. Biochem. Physiol. A Mol. Integr. Physiol. 181, 62–70. Zhang, W., Kim, S., Settlage, R., McMahon, W., Sumners, L.H., Siegel, P.B., Dorshorst,

10