- Email: [email protected]
Petalonia improves glucose homeostasis in streptozotocin-induced diabetic mice
Biochemical and Biophysical Research Communications 373 (2008) 265–269
Contents lists available at ScienceDirect
Biochemical and Biophysical Research Communications journal homepage: www.elsevier.com/locate/ybbrc
Petalonia improves glucose homeostasis in streptozotocin-induced diabetic mice Seong-Il Kang a, Young-Jun Jin a, Hee-Chul Ko b, Soo-Youn Choi c, Joon-Ho Hwang c, Ilson Whang a, Moo-Han Kim a, Hye-Sun Shin a, Hyung-Bok Jeong a, Se-Jae Kim a,* a
Department of Life Science, Cheju National University, 66 Jejudaehakno, Ara-1 Dong, Jejusi, Jeju 690-756, Republic of Korea Department of Chemistry, Cheju National University, 66 Jejudaehakno, Ara-1 Dong, Jejusi, Jeju 690-756, Republic of Korea c Regional Innovation Center, Cheju National University, 66 Jejudaehakno, Ara-1 Dong, Jejusi, Jeju 690-756, Republic of Korea b
a r t i c l e
i n f o
Article history: Received 24 May 2008 Available online 13 June 2008
Keywords: Petalonia binghamiae Seaweed 3T3-L1 cells Adipocyte differentiation PPARc Streptozotocin-induced diabetic mice Insulin
a b s t r a c t The anti-diabetic potential of Petalonia binghamiae extract (PBE) was evaluated in vivo. Dietary administration of PBE to streptozotocin (STZ)-induced diabetic mice significantly lowered blood glucose levels and improved glucose tolerance. The mode of action by which PBE attenuated diabetes was investigated in vitro using 3T3-L1 cells. PBE treatment stimulated 3T3-L1 adipocyte differentiation as evidenced by increased triglyceride accumulation. At the molecular level, peroxisome proliferator-activated receptor c (PPARc) and terminal marker protein aP2, as well as the mRNA of GLUT4 were up-regulated by PBE. In mature adipocytes, PBE significantly stimulated the uptake of glucose and the expression of insulin receptor substrate-1 (IRS-1). Furthermore, PBE increased PPARc luciferase reporter gene activity in COS-1 cells. Taken together, these results suggest that the in vivo anti-diabetic effect of PBE is mediated by both insulin-like and insulin-sensitizing actions in adipocytes. Ó 2008 Elsevier Inc. All rights reserved.
Diabetes mellitus is a metabolic disorder affecting the metabolism of carbohydrates, fat, and protein. It is a leading cause of human death and afflicts an estimated 6% of the adult population in industrialized nations. The worldwide incidence of diabetes mellitus is expected to continue to grow by 6% per annum, potentially reaching 200–300 million cases in 2010 [1]. More than 90% of these cases are type 2 diabetics suffering from severe insulin resistance. Members of the peroxisome proliferator-activated receptor (PPAR) subfamily of nuclear receptors control many different target genes involved in both lipid metabolism and glucose homeostasis [2]. PPARc, a member of this subfamily of nuclear receptors, plays a pivotal role in adipose tissue differentiation and in the maintenance of adipocyte-specific functions, including lipid storage in white adipose tissue and energy dissipation in brown adipose tissue [3,4]. Furthermore, PPARc is required for the survival of differentiated adipocytes [5]. In addition, PPARc functions in glucose metabolism by improving insulin sensitivity, and thus it represents a molecular link between lipid and carbohydrate metabolism [6–8]. Thiazolidinediones (TZDs) are a class of anti-diabetic agents that selectively activate PPARc and increase insulin sensitivity [9,10].
* Corresponding author. Fax: +82 64 756 3541. E-mail address: [email protected] (S.-J. Kim). 0006-291X/$ - see front matter Ó 2008 Elsevier Inc. All rights reserved. doi:10.1016/j.bbrc.2008.06.015
Due to the adverse side effects associated with the therapeutic agents used for treatment of diabetes mellitus, there has been a growing interest in herbal remedies [11–13]. Since ancient times, people living in fishery areas have believed that the ingestion of edible brown algae could improve blood properties including glucose and lipid levels. The widely distributed Pacific brown alga Petalonia binghamiae (J. Agaradh) Vinogradova [14] is consumed as a traditional food only in fishery areas of Northeast Asia. Extracts of P. binghamiae have anti-oxidant properties [15]. Galactosyldiacylglycerol [16] and fucoxanthin-related compounds [17] isolated from P. binghamiae inhibit mammalian DNA polymerase a and exert suppressive properties on adipocyte differentiation in 3T3-L1 cells, respectively. However, the anti-diabetic properties of P. binghamiae remain essentially unknown. Here, we investigated the anti-diabetic potential of P. binghamiae extract (PBE) in vivo using streptozotocin (STZ)-induced diabetic mice. In addition, the molecular mode of action of PBE was investigated in vitro using murine 3T3-L1 cells. Materials and methods Reagents. Dulbecco’s modified Eagle’s medium (DMEM), fetal bovine serum (FBS), and penicillin/streptomycin were obtained from Gibco-BRL (Grand Island, NY, USA). Antibodies to prolifera-
266
S.-I. Kang et al. / Biochemical and Biophysical Research Communications 373 (2008) 265–269
tor-activated receptor gamma (PPARc), insulin receptor substrate1 (IRS-1), and fatty acid binding protein (FABP-A; aP2) were purchased from Santa Cruz Biotechnology (Santa Cruz, CA, USA). Trizol reagent and a Superscript III First-strand synthesis system kit were obtained from Invitrogen (Carlsbad, CA, USA). Phosphate buffered saline (pH 7.4, PBS), 3-isobutyl-1-methylxanthine, dexamethasone (DEX), insulin, and 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyl tetrazolium bromide (MTT) were obtained from Sigma Chemical Co. (St. Louis, MO, USA). All other reagents were purchased from Sigma unless otherwise noted. 2-Deoxy-D-[3H]glucose was obtained from Amersham Biosciences (Little Chalfont, Buckinghamshire, UK). Preparation of Petalonia binghamiae extract (PBE). Thalli of the brown alga P. binghamiae were collected from the coast of Jeju Island, Korea. Two kilograms of P. binghamiae dried power were extracted with 80% ethanol (20 L) at room temperature for 48 h. The procedure described above was repeated twice. The combined PBEs were concentrated on a rotary evaporator under reduced pressure and freeze-dried to a powder. PBE was dissolved in ethanol at a concentration of 100 mg/ml and stored at 20 °C for further use. Animals, induction of diabetes, and diets. The animal study protocol was approved by the Institutional Animal Care and Use Committee of Cheju National University. Male ICR mice (4 weeks of age; Orient Bio Inc-QC, Seoul, Korea) were purchased and adapted for 3 weeks under specific conditions of temperature (23 ± 2 °C), humidity (50 ± 2%), and lighting (lights on from 08:00 to 20:00). The animals were housed in plastic cages and given free access to drinking water and a basal diet (Harlan, Bemis, Vancouver, BC, Canada). The animals were given intraperitoneal (i.p.) injections of freshly prepared streptozotocin (STZ; 40 mg/kg in 0.01 M citrate buffer) for 5 days [18], while the normal control group was injected with the buffer only. Five days after injection, blood was collected from the tip of the tail vein, and the fasting glucose level was measured. Mice with fasting blood glucose levels above 180 mg/dl were deemed to be hyperglycemic. The normal control mice had normal glucose levels of less than 125 mg/dl. The STZ-induced diabetic mice were divided into three diet groups (n = 10) and fed one of three diets: (a) basal Harlan diet (diabetic control), (b) 0.5% PBE in Harlan, or (c) 1% PBE in Harlan. All diets were continued until the end of the experiment. The experimental diet was prepared by mixing PBE in a powdered basal Harlan diet at a concentration of 0.5 or 1%. Glucose tolerance test. Animals that were fed the experimental diets for 8 weeks were used for an intraperitoneal glucose tolerance test (i.p.GTT) according to the method described by Xie et al. [19]. On the test days, the animals were fasted for 4 h (starting from 09:00) followed by the i.p. administration of glucose (2 g/ kg). Blood glucose levels were determined in tail blood samples at 0, 30, 60, and 120 min after glucose administration. Measurement of fasting blood glucose levels, body weight, food intake, and water intake. Fasting blood glucose levels were measured at the beginning of the experiment and at 1-week intervals for 8 weeks. Blood was collected from the tip of the tail vein, and the level of fasting blood glucose was measured with Blood Glucose Monitoring System (Infopia, Seoul, Korea). The results were expressed in terms of mg/dl blood. The total amount of food and water intake by each group was recorded every week. Cell culture and differentiation. 3T3-L1 cells were obtained from the American Type Culture Collection (Rockville, MD, USA). Cells were cultured in 1% penicillin/streptomycin (PS)/DMEM containing 10% calf bovine serum (Gibco) at 37 °C in a 5% CO2 incubator. The differentiation of confluent cells was induced by 48 h of incubation with differentiation medium (MDI) containing 1% PS/DMEM, 10% FBS, 0.5 mM 3-isobutyl-1-methylxanthine (IBMX; Sigma), 1 lM DEX, and 1 lg/ml of insulin. The cells were then maintained in post-differentiation medium (1% PS/DMEM containing 10% FBS),
and the medium was replaced every 2 days. To examine the effects of PBE on the differentiation of preadipocytes to adipocytes, the cells were treated with differentiation medium excluding insulin (MD) in the presence of various concentrations of PBE. Differentiation, as measured by the expression of adipogenic markers and the appearance of lipid droplets, was completed on day 8. Oil Red O staining and quantification. After the induction of differentiation, cells were stained with Oil Red O [20]. Briefly, cells were washed twice with PBS and fixed with 3.7% formaldehyde (Sigma) in PBS for 1 h. The cells were then washed an additional three times with water, dried, and stained with Oil Red O for 1 h. The stained lipid droplets were dissolved in isopropanol containing 4% Nonidet P-40, and they were quantified by measuring the absorbance at 520 nm. The optical density of differentiated cells with MD was taken as 100% of the relative lipid content. The results were represented as the relative lipid content of each experimental group. Western blot analysis. The cells were washed with ice-cold PBS, collected, and centrifuged. The cell pellets were resuspended in lysis buffer [1 RIPA (Upstate Cell Signaling Solutions, Lake Placid, NY, USA), 1 mM phenylmethylsulfonylfluoride (PMSF), 1 mM NaVO4, 1 mM NaF, 1 lg/ml aprotinin, 1 lg/ml pepstatin, and 1 lg/ml leupeptin] and incubated on ice for 1 h. Cell debris was removed by microcentrifugation, and the protein concentration was determined using the Bio-Rad protein assay reagent (Bio-Rad Laboratories, Hercules, CA, USA). Cell lysates were subjected to 8, 10, and 15% SDS–polyacrylamide gel electrophoresis and transferred to polyvinylidene difluoride membranes. The membranes were blocked with a solution of 0.1% Tween 20/Tris-buffered saline containing 5% nonfat dry milk for 1 h at room temperature. After incubation overnight at 4 °C with the primary antibody, the membranes were incubated with the horseradish peroxidase-conjugated secondary antibody for 1 h at room temperature. Immunodetection was carried out using ECL Western blotting detection reagent (Amersham Biosciences). Total RNA extraction and reverse transcriptase-polymerase chain reaction (RT-PCR) analysis. Total RNA was isolated from cells using Trizol Reagent (Invitrogen). The RNA concentration was quantitated by measuring the absorbency at 260 and 280 nm. According to the protocol provided by the manufacturer, the RT reaction was performed using a Superscript III First-strand synthesis system kit (Invitrogen). One microgram of total RNA was reverse-transcribed into cDNA using Omniscript RT, Sensiscript RT, and primers. The sense primer sequence for GLUT4 was ACCATAGGAGCTG GTGTGGTCAAT, and the anti-sense primer sequence was TAAG GACCCATAGCATCCGCAACA. Beta-actin (sense: AGGCAAGAAGGA AGGCTGGAAA; anti-sense: ACCCAAGAAGGAAGGCTGGAAA) was used as an internal standard. Amplification was initiated at 50 °C for 30 min, followed by 24–34 cycles of denaturation at 94 °C for 30 s, annealing at the appropriate primer-pair annealing temperature for 1 min, and extension for at 72 °C for 1 min, followed by a final extension of 10 min at 72 °C. The RT-PCR products were electrophoresed on a 1.2% agarose gel and visualized by staining with ethidium bromide. Glucose uptake activity assay. Glucose uptake activity was analyzed by measuring the uptake of 2-deoxy-D-[3H] glucose (2-DG) (Amersham Biosciences) as described previously [21]. Briefly, the differentiated 3T3-L1 adipocytes grown in 12-well plates were washed twice with serum-free DMEM and incubated with 1 ml of the same medium at 37 °C for 2 h. The cells were washed three times with Krebs–Ringer–Heps (KRP) buffer and incubated with 0.9 ml KRP buffer at 37 °C for 30 min. Insulin or PBE was then added, and the adipocytes were incubated at 37 °C for 15 min. Glucose uptake was initiated by the addition of 0.1 ml KRP buffer containing 0.37 MBq/l 2-DG and 0.01 mmol/l glucose. After 15 min, glucose uptake was terminated by washing the cells three times
267
S.-I. Kang et al. / Biochemical and Biophysical Research Communications 373 (2008) 265–269
with cold PBS. The cells were lysed with 0.7 ml of 1% Triton X-100 at 37 °C for 20 min. The radioactivity retained by the cell lysates was determined using a scintillation counter (Tri-Carb 2700TR, Packard, Meriden, CT, USA). Luciferase gene reporter assay. COS-1 cells were grown in DMEM supplemented with 10% FBS. The cells were transiently cotransfected with a mixture of plasmids using Fugene-6 transfection reagent (Roche Diagnostics, Indianapolis, IN, USA). Transfection mixture contained the luciferase gene under control of three tandem PPAR response elements (PPRE), pCMX-mPPARc (a gift from Ronald M. Evans, The Salk Institute, La Jolla, USA), pRXRa. Rennila luciferase expression plasmid (pRL-TK) was cotransfected as the control for transfection efficiency. After the transfection (24 h),
the medium was replaced by DMEM with serum containing PBE or PBE plus troglitazone. Cells were lysed 24 h later, and the luciferase activities were measured using the Dual Luciferase Activity kit (Promega, Madison, WI, USA) according to manufacturer’s instruction. Relative luciferase activities were expressed as foldactivation relative to untreated control. Statistical analysis. Values are expressed as mean ± SD or SE. One-way analysis of variance (ANOVA) was used for multiple comparisons. Treatment effects were analyzed using the paired t-test or Duncan’s multiple range test using SPSS software. P < 0.05 was considered significant. Result and discussion Dietary administration of PBE improves hyperglycemia and glucose tolerance in STZ-induced diabetic mice The effects of the dietary administration of PBE on fasting glucose levels in diabetic mice were investigated in vivo. As shown in Fig. 1A, at the beginning of dietary supplement administration, the fasting blood glucose levels were 218 ± 30.5 mg/dl in the STZ-induced diabetic mice and 114 ± 9.0 mg/dl in the normal control mice injected with the buffer only. The glucose levels of the normal control group fed a diet lacking the PBE supplement remained virtually constant for 8 weeks (125 ± 11.8 mg/dl). The chronic dietary administration of PBE had a dose-dependent antidiabetic effect on STZ-induced diabetic mice. The blood glucose level of the 1% PBE-treated mice (250 ± 61.7 mg/dl) decreased significantly compared to that of the diabetic control mice (545 ± 19.8 mg/dl). The differences in body weight and food intake between the diabetic control and PBE groups were not significant, while the water intake decreased in a dose-dependent manner with the dietary administration of PBE (Table 1). Glucose tolerance in normal control, diabetic control, and 1% PBE-treated mice was evaluated by i.p.GTT after 8 weeks. As shown in Fig. 1B, the glucose tolerance of the 1% PBE-treated mice was improved compared to that of the diabetic control mice. The glucose levels of the 1% PBE-treated mice decreased from 30 min after glucose administration, as shown in the normal control mice. However, the diabetic control mice showed typical glucose intolerance. In addition to lowering blood glucose, the dietary administration of PBE lowered plasma triglyceride levels and increased plasma levels of high density lipoprotein cholesterol in STZ-induced diabetic mice (data not shown), indicating that PBE plays modulating roles in glucose and lipid homeostasis. This is the first report to demonstrate that PBE can be used to treat diabetes.
Fig. 1. PBE improves hyperglycemia (A) and glucose tolerance (B) in STZ-induced diabetic mice. The STZ-induced diabetic mice groups were fed a diet that did or did not include PBE for 8 weeks. Fasting blood glucose levels were measured at 1-week intervals for 8 weeks. Glucose tolerance testing was performed using animals that were fed the experimental diets for 8 weeks. The values were expressed as mean ± SE (n = 10). Mean separation was performed by Duncan’s multiple range test. Different letters indicate significant differences (P < 0.05).
PBE stimulates adipocyte differentiation by insulin-like properties in 3T3-L1 cells The adipogenic potential of PBE was assessed by inducing the differentiation of 3T3-L1 preadipocytes in the incomplete differentiation medium (MD; containing 3-isobutyl-1-methylxanthine and
Table 1 Body weight, food and water consumption after dietary administration of Petalonia binghamiae extract for 8 weeks in STZ-induced diabetic mice Body weight (g)
Normal control Diabetic control 0.5% PBE 1% PBE
Initial
Final
39.5 ± 1.0 36.8 ± 1.1 36.8 ± 0.6 37.1 ± 0.8
44.8 ± 0.8a 40.6 ± 0.8b 39.1 ± 1.0b 39.8 ± 0.9b
Food intake (g/mice/day)
Water intake (ml/mice/day)
6.1 ± 0.2a 13.1 ± 0.7b 11.6 ± 0.5b 11.5 ± 1.0b
10.0 ± 0.7a 59.4 ± 1.7d 49.8 ± 1.4c 33.1 ± 3.0b
The values were expressed as mean ± SE (n = 10). Mean separation was performed by Duncan’s multiple range test. Different letters indicate significant differences (P < 0.05)
268
S.-I. Kang et al. / Biochemical and Biophysical Research Communications 373 (2008) 265–269
dexamethasone, but insulin is replaced by PBE). As shown in Fig. 2, PBE stimulated the adipogenesis of 3T3-L1 preadipocytes in a dose-dependent manner. PBE induced the accumulation of lipid droplets (Fig. 2A) and increased the triglyceride content (Fig. 2B) in a dose-dependent manner during the differentiation of 3T3-L1 preadipocytes. PBE treatment induced the dose-dependent upregulation of PPARc, which is a master transcription factor involved in the regulation of adipogenic gene expression, and aP2, which is the marker of adipocyte differentiation (Fig. 2C). PBE treatment also resulted in a significant increase in GLUT4 mRNA expression (Fig. 2D). Importantly, PBE (50–500 mg/ml) did not affect viability of 3T3-L1 preadipocytes as determined by MTT assays (data not shown). We next investigated whether the action of PBE under hypoglycemic conditions affects the classical effect of insulin on glucose transport using 3T3-L1 adipocytes. Mature adipocytes were incubated in the presence of various concentrations of PBE for 15 min, and glucose transport was then measured by determining the rate of 2-DG uptake. PBE treatment induced a dose-dependent increase in the glucose transport rates, and the effect of PBE at a dose of 100 lg/ml was comparable to that of 100 nM insulin. However, the rosiglitazone treatment did not induce the glucose uptake activity (Fig. 3A). Consistent with this result, IRS-1 protein expression was up-regulated by PBE treatment similarly to that observed after treatment with 100 nM insulin (Fig. 3B). These results strongly suggest that PBE exerts anti-diabetic effects via insulinlike properties. PBE increases transcriptional activity of PPARc In addition to its insulin-like properties, whether PBE may represent a natural type PPARc ligand was investigated using a PPARc transactivation assay system (Fig. 4). Like troglitazone, PBE acti-
Fig. 3. PBE stimulates glucose uptake in 3T3-L1 adipocytes. (A) Mature adipocytes were incubated in 12-well plates for 20 min with insulin, PBE, and rosiglitazone (Rosi.) and then assayed for 2-deoxy-D-[3H]glucose uptake. The mean values of the results are shown with the SD (n = 3). (*P < 0.05 compared to untreated control). (B) Western blot of IRS-1. Differentiated 3T3-L1 adipocytes were treated with PBE (200 lg/ml) or INS (100 nM insulin) for the indicated time periods.
vated PPARc at a dose of 10 lg/ml. Furthermore, co-treatment with PBE and troglitazone resulted in dose-dependent synergistic PPARc
Fig. 2. PBE enhances the differentiation of adipocytes in 3T3-L1 cells. Cells were differentiated in the presence of PBE and MD differentiation medium (excluding insulin). (A) Differentiated adipocytes were stained with Oil Red O on day 8. (B) Lipid accumulation was assessed by the quantification of OD520 as described in the Materials and methods. DEX, 1 lM dexamethasone; IBMX, 0.5 mM isobutylmethylxanthine. The mean values of the results are shown with the SD (n = 3). (*P < 0.05 compared to positive control). (C) Western blot of PPARc and aP2. Proteins were prepared from 3T3-L1 cells on day 6. (D) RT-PCR analyses of GLUT4 mRNA. Total RNAs were prepared from 3T3-L1 cells on day 6.
S.-I. Kang et al. / Biochemical and Biophysical Research Communications 373 (2008) 265–269
269
References
Fig. 4. PBE increases transcriptional activity of PPARc. COS-1 cells were transfected as described in the Materials and methods. After transfection, cells were treated for a 24 h with PBE or troglitazone as positive control, and then assayed for their luciferase activity. The mean values of the results are shown with the SD (n = 3). The data shown are representative of three experiments. (*P < 0.05 compared to untreated control).
activation, indicating that PBE may act as a natural ligand to the agonistic effect of PPARc. Troglitazone, rosiglitazone, and pioglitazone are part of a class of thiazolidinedione (TZD) anti-diabetic agents that improve glucose utilization without insulin release. These compounds are not efficacious in the absence of insulin, as they work by enhancing the response of target tissues to the action of insulin [22]. In line with this result, rosiglitazone did not induce glucose uptake activity in the absence of insulin in our assay system. The molecular target of TZDs is PPARc, which is predominantly expressed in adipose tissue, and acts as an essential regulator of adipocyte differentiation and a modulator of fat cell function [23]. Thus, agonists of PPARc, including TZDs, stimulate adipogenesis and the expression of adipocyte-specific genes in fibroblasts, preadipocytes, or myoblasts that express PPARc endogenously or ectopically [23,24]. The identification of a significant PPARc activator or insulin receptor (IR) activator from P. binghamiae may provide the opportunity for the development of a novel class of anti-diabetic agents that are more effective and less toxic than those currently available. In conclusion, the dietary administration of PBE improved diabetes in an STZ-induced diabetic mice model. In addition, we demonstrated that PBE stimulated the differentiation of 3T3-L1 preadipocytes, as well as acting on cellular glucose uptake in mature adipocytes. PBE increase transcriptional activity of PPARc. Our results suggest that the in vivo anti-diabetic effect of PBE is mediated by both insulin-like and insulin sensitizing actions in adipocytes.
Acknowledgments This work was supported by a Research Grant for Regional Industry Technology Development (2006) and the Regional Innovation System Program of Ministry of Knowledge Economy, Korea.
[1] A.F. Amos, D.J. McCarty, P. Zimmet, The rising global burden of diabetes and its complications: estimates and projections by 2010, Diabet. Med. 14 (1997) S5–S85. [2] A.K. Agarwal, A. Garg, Genetic basis of lipodystrophies and management of metabolic complications, Annu. Rev. Med. 57 (2006) 297–311. [3] E.D. Rosen, C.J. Walkey, P. Puigserver, B.M. Spiegelman, Transcriptional regulation of adipogenesis, Genes Dev. 14 (2000) 1293–1307. [4] W. He, Y. Barak, A. Hevener, P. Olson, D. Liao, J. Le, M. Nelson, E. Ong, J.M. Olefsky, R.M. Evans, Adipose-specific peroxisome proliferator-activated receptor gamma knockout causes insulin resistance in fat and liver but not in muscle, Proc Natl. Acad. Sci. USA 100 (2003) 15712–15717. [5] T. Imai, R. Takakuwa, S. Marchand, E. Dentz, J.M. Bornert, N. Messaddeq, O. Wendling, M. Mark, B. Desvergne, W. Wahli, P. Chambon, D. Metzger, Peroxisome proliferator-activated receptor gamma is required in mature white and brown adipocytes for their survival in the mouse, Proc. Natl. Acad. Sci. USA 101 (2004) 4543–4547. [6] E.D. Rosen, P. Sarraf, A.E. Troy, G. Bradwin, K. Moore, D.S. Milstone, B.M. Spiegelman, R.M. Mortensen, PPAR gamma is required for the differentiation of adipose tissue in vivo and in vitro, Mol. Cell 4 (1999) 611–617. [7] Z. Wu, E.D. Rosen, R. Burn, S. Hauser, G. Adelmant, A.E. Troy, C. Mckeon, G.J. Darlington, B.M. Spiegelman, Cross-regulation of C/EBP alpha and PPAR gamma controls the transcriptional pathway of adipogenesis and insulin sensitivity, Mol. Cell 3 (1999) 151–158. [8] J. Rieusset, F. Touri, L. Michalik, P. Escher, B. Desvergne, E. Niesor, W. Wahli, A new selective peroxisome proliferator-activated receptor gamma antagonist with antiobesity and antidiabetic activity, Mol. Endocrinol. 16 (2002) 2628–2644. [9] A.B. Mayerson, R.S. Hundal, S. Dufour, V. Lebon, D. Befroy, G.W. Cline, S. Enockasson, S.E. Inzucchi, G.I. Shulman, K.F. Petersen, The effects of rosiglitazone on insulin sensitivity, lipolysis, and hepatic and skeletal muscle triglyceride content in patients with type 2 diabetes, Diabetes 51 (2002) 797–802. [10] H. Bays, L. Mandarino, R.A. DeFronze, Roles of the adipocyte, free fatty acids, and ectopic fat in pathogenesis of type 2 diabetes mellitus: peroxisomal proliferator-activated receptor agonists provide a rational therapeutic approach, J. Clin. Endocrinol. Metab. 89 (2004) 463–478. [11] C.J. Bailey, C. Day, Traditional plant medicines as treatments for diabetes, Diabetes Care 12 (1989) 553–564. [12] T. Matsui, I.A. Ogunwande, K.J.M. Abesundara, K. Matsumoto, Antihyperglycemic potential of natural products, Mini Rev. Med. Chem. 6 (2006) 109–120. [13] M. Hassan, C.E. Yazidi, J.-F. Landrier, D. Lairon, A. Margotat, M.-J. Amiot, Phloretin enhances adipocyte differentiation and adiponectin expression in 3T3-L1 cells, Biochem. Biophys. Res. Commun. 361 (2007) 208–213. [14] S. Segawa, Colored Illustrations of Seaweeds of Japan, Hoikusha Publishing, Osaka, 1996. pp. 37. [15] T. Kuda, T. Hishi, S. Maekawa, Antioxidant properties of dried product of ‘habanori’, an edible brown alga, Petalonia binghamiae (J. Agaradh) Vinogrdova, Food Chem. 98 (2006) 545–550. [16] Y. Mizushina, Y. Sugiyama, H. Yoshida, S. Hanashima, T. Yamzaki, S. Kamisuki, K. Ohta, M. Takemura, T. Yamaguchi, A. Matsukage, S. Yoshida, M. Saneyoshi, F. Sugawara, K. Sakagauchi, Galactosyldiacylglycerol, a mammalian DNA polymerase a-specific inhibitor from a sea alga, Petalonia binghamiae, Biol. Pharm. Bull. 24 (2001) 982–987. [17] K. Mori, T. Ooi, M. Hiraoka, N. Oka, H. Hamada, M. Tamuara, T. Kusumi, Fucoxanthin and its metabolites in edible brown algae cultivated in deep seawater, Mar. Drugs 2 (2004) 63–72. [18] T. Takamura, H. Ando, Y. Nagai, H. Yamashita, E. Nohara, K. Kobayashi, Pioglitazone prevents mice from multiple low-dose streptozotocin-induced insulitis and diabetes, Diabetes Res. Clin. Pract. 44 (1999) 107–114. [19] J.T. Xie, A. Wang, S. Mehendale, J. Wu, H.H. Aung, L. Dey, S. Qiu, C.S. Yuan, Antidiabetic effects of Gymnema yunnanense extract, Pharmacol. Res. 47 (2003) 323– 329. [20] M.J. Moreno-Aliaga, F. Matsumura, Endrin inhibits adipocyte differentiation by selectively altering the expression pattern of CCAAT/enhancer binding protein-alpha in 3T3-L1 cells, Mol. Pharmacol. 56 (1999) 91–101. [21] Y. Kang, H.Y. Kim, Glucose uptake-stimulatory activity of Amomi Semen in 3T3-L1 adipocytes, J. Ethnopharmacol. 92 (2004) 103–105. [22] B.B. Zhang, D.E. Moller, New approaches in treatment of type 2 diabetes, Curr. Opin. Chem. Biol. 4 (2000) 461–467. [23] B.B. Lowell, PPARgamma: an essential regulator of adipogenesis and modulator of fat cell function, Cell 99 (1999) 239–242. [24] B.M. Spiegelman, PPARc: adipogenic regulator and thiazolidinedione receptor, Diabetes 47 (1998) 507–514.
Contents lists available at ScienceDirect
Biochemical and Biophysical Research Communications journal homepage: www.elsevier.com/locate/ybbrc
Petalonia improves glucose homeostasis in streptozotocin-induced diabetic mice Seong-Il Kang a, Young-Jun Jin a, Hee-Chul Ko b, Soo-Youn Choi c, Joon-Ho Hwang c, Ilson Whang a, Moo-Han Kim a, Hye-Sun Shin a, Hyung-Bok Jeong a, Se-Jae Kim a,* a
Department of Life Science, Cheju National University, 66 Jejudaehakno, Ara-1 Dong, Jejusi, Jeju 690-756, Republic of Korea Department of Chemistry, Cheju National University, 66 Jejudaehakno, Ara-1 Dong, Jejusi, Jeju 690-756, Republic of Korea c Regional Innovation Center, Cheju National University, 66 Jejudaehakno, Ara-1 Dong, Jejusi, Jeju 690-756, Republic of Korea b
a r t i c l e
i n f o
Article history: Received 24 May 2008 Available online 13 June 2008
Keywords: Petalonia binghamiae Seaweed 3T3-L1 cells Adipocyte differentiation PPARc Streptozotocin-induced diabetic mice Insulin
a b s t r a c t The anti-diabetic potential of Petalonia binghamiae extract (PBE) was evaluated in vivo. Dietary administration of PBE to streptozotocin (STZ)-induced diabetic mice significantly lowered blood glucose levels and improved glucose tolerance. The mode of action by which PBE attenuated diabetes was investigated in vitro using 3T3-L1 cells. PBE treatment stimulated 3T3-L1 adipocyte differentiation as evidenced by increased triglyceride accumulation. At the molecular level, peroxisome proliferator-activated receptor c (PPARc) and terminal marker protein aP2, as well as the mRNA of GLUT4 were up-regulated by PBE. In mature adipocytes, PBE significantly stimulated the uptake of glucose and the expression of insulin receptor substrate-1 (IRS-1). Furthermore, PBE increased PPARc luciferase reporter gene activity in COS-1 cells. Taken together, these results suggest that the in vivo anti-diabetic effect of PBE is mediated by both insulin-like and insulin-sensitizing actions in adipocytes. Ó 2008 Elsevier Inc. All rights reserved.
Diabetes mellitus is a metabolic disorder affecting the metabolism of carbohydrates, fat, and protein. It is a leading cause of human death and afflicts an estimated 6% of the adult population in industrialized nations. The worldwide incidence of diabetes mellitus is expected to continue to grow by 6% per annum, potentially reaching 200–300 million cases in 2010 [1]. More than 90% of these cases are type 2 diabetics suffering from severe insulin resistance. Members of the peroxisome proliferator-activated receptor (PPAR) subfamily of nuclear receptors control many different target genes involved in both lipid metabolism and glucose homeostasis [2]. PPARc, a member of this subfamily of nuclear receptors, plays a pivotal role in adipose tissue differentiation and in the maintenance of adipocyte-specific functions, including lipid storage in white adipose tissue and energy dissipation in brown adipose tissue [3,4]. Furthermore, PPARc is required for the survival of differentiated adipocytes [5]. In addition, PPARc functions in glucose metabolism by improving insulin sensitivity, and thus it represents a molecular link between lipid and carbohydrate metabolism [6–8]. Thiazolidinediones (TZDs) are a class of anti-diabetic agents that selectively activate PPARc and increase insulin sensitivity [9,10].
* Corresponding author. Fax: +82 64 756 3541. E-mail address: [email protected] (S.-J. Kim). 0006-291X/$ - see front matter Ó 2008 Elsevier Inc. All rights reserved. doi:10.1016/j.bbrc.2008.06.015
Due to the adverse side effects associated with the therapeutic agents used for treatment of diabetes mellitus, there has been a growing interest in herbal remedies [11–13]. Since ancient times, people living in fishery areas have believed that the ingestion of edible brown algae could improve blood properties including glucose and lipid levels. The widely distributed Pacific brown alga Petalonia binghamiae (J. Agaradh) Vinogradova [14] is consumed as a traditional food only in fishery areas of Northeast Asia. Extracts of P. binghamiae have anti-oxidant properties [15]. Galactosyldiacylglycerol [16] and fucoxanthin-related compounds [17] isolated from P. binghamiae inhibit mammalian DNA polymerase a and exert suppressive properties on adipocyte differentiation in 3T3-L1 cells, respectively. However, the anti-diabetic properties of P. binghamiae remain essentially unknown. Here, we investigated the anti-diabetic potential of P. binghamiae extract (PBE) in vivo using streptozotocin (STZ)-induced diabetic mice. In addition, the molecular mode of action of PBE was investigated in vitro using murine 3T3-L1 cells. Materials and methods Reagents. Dulbecco’s modified Eagle’s medium (DMEM), fetal bovine serum (FBS), and penicillin/streptomycin were obtained from Gibco-BRL (Grand Island, NY, USA). Antibodies to prolifera-
266
S.-I. Kang et al. / Biochemical and Biophysical Research Communications 373 (2008) 265–269
tor-activated receptor gamma (PPARc), insulin receptor substrate1 (IRS-1), and fatty acid binding protein (FABP-A; aP2) were purchased from Santa Cruz Biotechnology (Santa Cruz, CA, USA). Trizol reagent and a Superscript III First-strand synthesis system kit were obtained from Invitrogen (Carlsbad, CA, USA). Phosphate buffered saline (pH 7.4, PBS), 3-isobutyl-1-methylxanthine, dexamethasone (DEX), insulin, and 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyl tetrazolium bromide (MTT) were obtained from Sigma Chemical Co. (St. Louis, MO, USA). All other reagents were purchased from Sigma unless otherwise noted. 2-Deoxy-D-[3H]glucose was obtained from Amersham Biosciences (Little Chalfont, Buckinghamshire, UK). Preparation of Petalonia binghamiae extract (PBE). Thalli of the brown alga P. binghamiae were collected from the coast of Jeju Island, Korea. Two kilograms of P. binghamiae dried power were extracted with 80% ethanol (20 L) at room temperature for 48 h. The procedure described above was repeated twice. The combined PBEs were concentrated on a rotary evaporator under reduced pressure and freeze-dried to a powder. PBE was dissolved in ethanol at a concentration of 100 mg/ml and stored at 20 °C for further use. Animals, induction of diabetes, and diets. The animal study protocol was approved by the Institutional Animal Care and Use Committee of Cheju National University. Male ICR mice (4 weeks of age; Orient Bio Inc-QC, Seoul, Korea) were purchased and adapted for 3 weeks under specific conditions of temperature (23 ± 2 °C), humidity (50 ± 2%), and lighting (lights on from 08:00 to 20:00). The animals were housed in plastic cages and given free access to drinking water and a basal diet (Harlan, Bemis, Vancouver, BC, Canada). The animals were given intraperitoneal (i.p.) injections of freshly prepared streptozotocin (STZ; 40 mg/kg in 0.01 M citrate buffer) for 5 days [18], while the normal control group was injected with the buffer only. Five days after injection, blood was collected from the tip of the tail vein, and the fasting glucose level was measured. Mice with fasting blood glucose levels above 180 mg/dl were deemed to be hyperglycemic. The normal control mice had normal glucose levels of less than 125 mg/dl. The STZ-induced diabetic mice were divided into three diet groups (n = 10) and fed one of three diets: (a) basal Harlan diet (diabetic control), (b) 0.5% PBE in Harlan, or (c) 1% PBE in Harlan. All diets were continued until the end of the experiment. The experimental diet was prepared by mixing PBE in a powdered basal Harlan diet at a concentration of 0.5 or 1%. Glucose tolerance test. Animals that were fed the experimental diets for 8 weeks were used for an intraperitoneal glucose tolerance test (i.p.GTT) according to the method described by Xie et al. [19]. On the test days, the animals were fasted for 4 h (starting from 09:00) followed by the i.p. administration of glucose (2 g/ kg). Blood glucose levels were determined in tail blood samples at 0, 30, 60, and 120 min after glucose administration. Measurement of fasting blood glucose levels, body weight, food intake, and water intake. Fasting blood glucose levels were measured at the beginning of the experiment and at 1-week intervals for 8 weeks. Blood was collected from the tip of the tail vein, and the level of fasting blood glucose was measured with Blood Glucose Monitoring System (Infopia, Seoul, Korea). The results were expressed in terms of mg/dl blood. The total amount of food and water intake by each group was recorded every week. Cell culture and differentiation. 3T3-L1 cells were obtained from the American Type Culture Collection (Rockville, MD, USA). Cells were cultured in 1% penicillin/streptomycin (PS)/DMEM containing 10% calf bovine serum (Gibco) at 37 °C in a 5% CO2 incubator. The differentiation of confluent cells was induced by 48 h of incubation with differentiation medium (MDI) containing 1% PS/DMEM, 10% FBS, 0.5 mM 3-isobutyl-1-methylxanthine (IBMX; Sigma), 1 lM DEX, and 1 lg/ml of insulin. The cells were then maintained in post-differentiation medium (1% PS/DMEM containing 10% FBS),
and the medium was replaced every 2 days. To examine the effects of PBE on the differentiation of preadipocytes to adipocytes, the cells were treated with differentiation medium excluding insulin (MD) in the presence of various concentrations of PBE. Differentiation, as measured by the expression of adipogenic markers and the appearance of lipid droplets, was completed on day 8. Oil Red O staining and quantification. After the induction of differentiation, cells were stained with Oil Red O [20]. Briefly, cells were washed twice with PBS and fixed with 3.7% formaldehyde (Sigma) in PBS for 1 h. The cells were then washed an additional three times with water, dried, and stained with Oil Red O for 1 h. The stained lipid droplets were dissolved in isopropanol containing 4% Nonidet P-40, and they were quantified by measuring the absorbance at 520 nm. The optical density of differentiated cells with MD was taken as 100% of the relative lipid content. The results were represented as the relative lipid content of each experimental group. Western blot analysis. The cells were washed with ice-cold PBS, collected, and centrifuged. The cell pellets were resuspended in lysis buffer [1 RIPA (Upstate Cell Signaling Solutions, Lake Placid, NY, USA), 1 mM phenylmethylsulfonylfluoride (PMSF), 1 mM NaVO4, 1 mM NaF, 1 lg/ml aprotinin, 1 lg/ml pepstatin, and 1 lg/ml leupeptin] and incubated on ice for 1 h. Cell debris was removed by microcentrifugation, and the protein concentration was determined using the Bio-Rad protein assay reagent (Bio-Rad Laboratories, Hercules, CA, USA). Cell lysates were subjected to 8, 10, and 15% SDS–polyacrylamide gel electrophoresis and transferred to polyvinylidene difluoride membranes. The membranes were blocked with a solution of 0.1% Tween 20/Tris-buffered saline containing 5% nonfat dry milk for 1 h at room temperature. After incubation overnight at 4 °C with the primary antibody, the membranes were incubated with the horseradish peroxidase-conjugated secondary antibody for 1 h at room temperature. Immunodetection was carried out using ECL Western blotting detection reagent (Amersham Biosciences). Total RNA extraction and reverse transcriptase-polymerase chain reaction (RT-PCR) analysis. Total RNA was isolated from cells using Trizol Reagent (Invitrogen). The RNA concentration was quantitated by measuring the absorbency at 260 and 280 nm. According to the protocol provided by the manufacturer, the RT reaction was performed using a Superscript III First-strand synthesis system kit (Invitrogen). One microgram of total RNA was reverse-transcribed into cDNA using Omniscript RT, Sensiscript RT, and primers. The sense primer sequence for GLUT4 was ACCATAGGAGCTG GTGTGGTCAAT, and the anti-sense primer sequence was TAAG GACCCATAGCATCCGCAACA. Beta-actin (sense: AGGCAAGAAGGA AGGCTGGAAA; anti-sense: ACCCAAGAAGGAAGGCTGGAAA) was used as an internal standard. Amplification was initiated at 50 °C for 30 min, followed by 24–34 cycles of denaturation at 94 °C for 30 s, annealing at the appropriate primer-pair annealing temperature for 1 min, and extension for at 72 °C for 1 min, followed by a final extension of 10 min at 72 °C. The RT-PCR products were electrophoresed on a 1.2% agarose gel and visualized by staining with ethidium bromide. Glucose uptake activity assay. Glucose uptake activity was analyzed by measuring the uptake of 2-deoxy-D-[3H] glucose (2-DG) (Amersham Biosciences) as described previously [21]. Briefly, the differentiated 3T3-L1 adipocytes grown in 12-well plates were washed twice with serum-free DMEM and incubated with 1 ml of the same medium at 37 °C for 2 h. The cells were washed three times with Krebs–Ringer–Heps (KRP) buffer and incubated with 0.9 ml KRP buffer at 37 °C for 30 min. Insulin or PBE was then added, and the adipocytes were incubated at 37 °C for 15 min. Glucose uptake was initiated by the addition of 0.1 ml KRP buffer containing 0.37 MBq/l 2-DG and 0.01 mmol/l glucose. After 15 min, glucose uptake was terminated by washing the cells three times
267
S.-I. Kang et al. / Biochemical and Biophysical Research Communications 373 (2008) 265–269
with cold PBS. The cells were lysed with 0.7 ml of 1% Triton X-100 at 37 °C for 20 min. The radioactivity retained by the cell lysates was determined using a scintillation counter (Tri-Carb 2700TR, Packard, Meriden, CT, USA). Luciferase gene reporter assay. COS-1 cells were grown in DMEM supplemented with 10% FBS. The cells were transiently cotransfected with a mixture of plasmids using Fugene-6 transfection reagent (Roche Diagnostics, Indianapolis, IN, USA). Transfection mixture contained the luciferase gene under control of three tandem PPAR response elements (PPRE), pCMX-mPPARc (a gift from Ronald M. Evans, The Salk Institute, La Jolla, USA), pRXRa. Rennila luciferase expression plasmid (pRL-TK) was cotransfected as the control for transfection efficiency. After the transfection (24 h),
the medium was replaced by DMEM with serum containing PBE or PBE plus troglitazone. Cells were lysed 24 h later, and the luciferase activities were measured using the Dual Luciferase Activity kit (Promega, Madison, WI, USA) according to manufacturer’s instruction. Relative luciferase activities were expressed as foldactivation relative to untreated control. Statistical analysis. Values are expressed as mean ± SD or SE. One-way analysis of variance (ANOVA) was used for multiple comparisons. Treatment effects were analyzed using the paired t-test or Duncan’s multiple range test using SPSS software. P < 0.05 was considered significant. Result and discussion Dietary administration of PBE improves hyperglycemia and glucose tolerance in STZ-induced diabetic mice The effects of the dietary administration of PBE on fasting glucose levels in diabetic mice were investigated in vivo. As shown in Fig. 1A, at the beginning of dietary supplement administration, the fasting blood glucose levels were 218 ± 30.5 mg/dl in the STZ-induced diabetic mice and 114 ± 9.0 mg/dl in the normal control mice injected with the buffer only. The glucose levels of the normal control group fed a diet lacking the PBE supplement remained virtually constant for 8 weeks (125 ± 11.8 mg/dl). The chronic dietary administration of PBE had a dose-dependent antidiabetic effect on STZ-induced diabetic mice. The blood glucose level of the 1% PBE-treated mice (250 ± 61.7 mg/dl) decreased significantly compared to that of the diabetic control mice (545 ± 19.8 mg/dl). The differences in body weight and food intake between the diabetic control and PBE groups were not significant, while the water intake decreased in a dose-dependent manner with the dietary administration of PBE (Table 1). Glucose tolerance in normal control, diabetic control, and 1% PBE-treated mice was evaluated by i.p.GTT after 8 weeks. As shown in Fig. 1B, the glucose tolerance of the 1% PBE-treated mice was improved compared to that of the diabetic control mice. The glucose levels of the 1% PBE-treated mice decreased from 30 min after glucose administration, as shown in the normal control mice. However, the diabetic control mice showed typical glucose intolerance. In addition to lowering blood glucose, the dietary administration of PBE lowered plasma triglyceride levels and increased plasma levels of high density lipoprotein cholesterol in STZ-induced diabetic mice (data not shown), indicating that PBE plays modulating roles in glucose and lipid homeostasis. This is the first report to demonstrate that PBE can be used to treat diabetes.
Fig. 1. PBE improves hyperglycemia (A) and glucose tolerance (B) in STZ-induced diabetic mice. The STZ-induced diabetic mice groups were fed a diet that did or did not include PBE for 8 weeks. Fasting blood glucose levels were measured at 1-week intervals for 8 weeks. Glucose tolerance testing was performed using animals that were fed the experimental diets for 8 weeks. The values were expressed as mean ± SE (n = 10). Mean separation was performed by Duncan’s multiple range test. Different letters indicate significant differences (P < 0.05).
PBE stimulates adipocyte differentiation by insulin-like properties in 3T3-L1 cells The adipogenic potential of PBE was assessed by inducing the differentiation of 3T3-L1 preadipocytes in the incomplete differentiation medium (MD; containing 3-isobutyl-1-methylxanthine and
Table 1 Body weight, food and water consumption after dietary administration of Petalonia binghamiae extract for 8 weeks in STZ-induced diabetic mice Body weight (g)
Normal control Diabetic control 0.5% PBE 1% PBE
Initial
Final
39.5 ± 1.0 36.8 ± 1.1 36.8 ± 0.6 37.1 ± 0.8
44.8 ± 0.8a 40.6 ± 0.8b 39.1 ± 1.0b 39.8 ± 0.9b
Food intake (g/mice/day)
Water intake (ml/mice/day)
6.1 ± 0.2a 13.1 ± 0.7b 11.6 ± 0.5b 11.5 ± 1.0b
10.0 ± 0.7a 59.4 ± 1.7d 49.8 ± 1.4c 33.1 ± 3.0b
The values were expressed as mean ± SE (n = 10). Mean separation was performed by Duncan’s multiple range test. Different letters indicate significant differences (P < 0.05)
268
S.-I. Kang et al. / Biochemical and Biophysical Research Communications 373 (2008) 265–269
dexamethasone, but insulin is replaced by PBE). As shown in Fig. 2, PBE stimulated the adipogenesis of 3T3-L1 preadipocytes in a dose-dependent manner. PBE induced the accumulation of lipid droplets (Fig. 2A) and increased the triglyceride content (Fig. 2B) in a dose-dependent manner during the differentiation of 3T3-L1 preadipocytes. PBE treatment induced the dose-dependent upregulation of PPARc, which is a master transcription factor involved in the regulation of adipogenic gene expression, and aP2, which is the marker of adipocyte differentiation (Fig. 2C). PBE treatment also resulted in a significant increase in GLUT4 mRNA expression (Fig. 2D). Importantly, PBE (50–500 mg/ml) did not affect viability of 3T3-L1 preadipocytes as determined by MTT assays (data not shown). We next investigated whether the action of PBE under hypoglycemic conditions affects the classical effect of insulin on glucose transport using 3T3-L1 adipocytes. Mature adipocytes were incubated in the presence of various concentrations of PBE for 15 min, and glucose transport was then measured by determining the rate of 2-DG uptake. PBE treatment induced a dose-dependent increase in the glucose transport rates, and the effect of PBE at a dose of 100 lg/ml was comparable to that of 100 nM insulin. However, the rosiglitazone treatment did not induce the glucose uptake activity (Fig. 3A). Consistent with this result, IRS-1 protein expression was up-regulated by PBE treatment similarly to that observed after treatment with 100 nM insulin (Fig. 3B). These results strongly suggest that PBE exerts anti-diabetic effects via insulinlike properties. PBE increases transcriptional activity of PPARc In addition to its insulin-like properties, whether PBE may represent a natural type PPARc ligand was investigated using a PPARc transactivation assay system (Fig. 4). Like troglitazone, PBE acti-
Fig. 3. PBE stimulates glucose uptake in 3T3-L1 adipocytes. (A) Mature adipocytes were incubated in 12-well plates for 20 min with insulin, PBE, and rosiglitazone (Rosi.) and then assayed for 2-deoxy-D-[3H]glucose uptake. The mean values of the results are shown with the SD (n = 3). (*P < 0.05 compared to untreated control). (B) Western blot of IRS-1. Differentiated 3T3-L1 adipocytes were treated with PBE (200 lg/ml) or INS (100 nM insulin) for the indicated time periods.
vated PPARc at a dose of 10 lg/ml. Furthermore, co-treatment with PBE and troglitazone resulted in dose-dependent synergistic PPARc
Fig. 2. PBE enhances the differentiation of adipocytes in 3T3-L1 cells. Cells were differentiated in the presence of PBE and MD differentiation medium (excluding insulin). (A) Differentiated adipocytes were stained with Oil Red O on day 8. (B) Lipid accumulation was assessed by the quantification of OD520 as described in the Materials and methods. DEX, 1 lM dexamethasone; IBMX, 0.5 mM isobutylmethylxanthine. The mean values of the results are shown with the SD (n = 3). (*P < 0.05 compared to positive control). (C) Western blot of PPARc and aP2. Proteins were prepared from 3T3-L1 cells on day 6. (D) RT-PCR analyses of GLUT4 mRNA. Total RNAs were prepared from 3T3-L1 cells on day 6.
S.-I. Kang et al. / Biochemical and Biophysical Research Communications 373 (2008) 265–269
269
References
Fig. 4. PBE increases transcriptional activity of PPARc. COS-1 cells were transfected as described in the Materials and methods. After transfection, cells were treated for a 24 h with PBE or troglitazone as positive control, and then assayed for their luciferase activity. The mean values of the results are shown with the SD (n = 3). The data shown are representative of three experiments. (*P < 0.05 compared to untreated control).
activation, indicating that PBE may act as a natural ligand to the agonistic effect of PPARc. Troglitazone, rosiglitazone, and pioglitazone are part of a class of thiazolidinedione (TZD) anti-diabetic agents that improve glucose utilization without insulin release. These compounds are not efficacious in the absence of insulin, as they work by enhancing the response of target tissues to the action of insulin [22]. In line with this result, rosiglitazone did not induce glucose uptake activity in the absence of insulin in our assay system. The molecular target of TZDs is PPARc, which is predominantly expressed in adipose tissue, and acts as an essential regulator of adipocyte differentiation and a modulator of fat cell function [23]. Thus, agonists of PPARc, including TZDs, stimulate adipogenesis and the expression of adipocyte-specific genes in fibroblasts, preadipocytes, or myoblasts that express PPARc endogenously or ectopically [23,24]. The identification of a significant PPARc activator or insulin receptor (IR) activator from P. binghamiae may provide the opportunity for the development of a novel class of anti-diabetic agents that are more effective and less toxic than those currently available. In conclusion, the dietary administration of PBE improved diabetes in an STZ-induced diabetic mice model. In addition, we demonstrated that PBE stimulated the differentiation of 3T3-L1 preadipocytes, as well as acting on cellular glucose uptake in mature adipocytes. PBE increase transcriptional activity of PPARc. Our results suggest that the in vivo anti-diabetic effect of PBE is mediated by both insulin-like and insulin sensitizing actions in adipocytes.
Acknowledgments This work was supported by a Research Grant for Regional Industry Technology Development (2006) and the Regional Innovation System Program of Ministry of Knowledge Economy, Korea.
[1] A.F. Amos, D.J. McCarty, P. Zimmet, The rising global burden of diabetes and its complications: estimates and projections by 2010, Diabet. Med. 14 (1997) S5–S85. [2] A.K. Agarwal, A. Garg, Genetic basis of lipodystrophies and management of metabolic complications, Annu. Rev. Med. 57 (2006) 297–311. [3] E.D. Rosen, C.J. Walkey, P. Puigserver, B.M. Spiegelman, Transcriptional regulation of adipogenesis, Genes Dev. 14 (2000) 1293–1307. [4] W. He, Y. Barak, A. Hevener, P. Olson, D. Liao, J. Le, M. Nelson, E. Ong, J.M. Olefsky, R.M. Evans, Adipose-specific peroxisome proliferator-activated receptor gamma knockout causes insulin resistance in fat and liver but not in muscle, Proc Natl. Acad. Sci. USA 100 (2003) 15712–15717. [5] T. Imai, R. Takakuwa, S. Marchand, E. Dentz, J.M. Bornert, N. Messaddeq, O. Wendling, M. Mark, B. Desvergne, W. Wahli, P. Chambon, D. Metzger, Peroxisome proliferator-activated receptor gamma is required in mature white and brown adipocytes for their survival in the mouse, Proc. Natl. Acad. Sci. USA 101 (2004) 4543–4547. [6] E.D. Rosen, P. Sarraf, A.E. Troy, G. Bradwin, K. Moore, D.S. Milstone, B.M. Spiegelman, R.M. Mortensen, PPAR gamma is required for the differentiation of adipose tissue in vivo and in vitro, Mol. Cell 4 (1999) 611–617. [7] Z. Wu, E.D. Rosen, R. Burn, S. Hauser, G. Adelmant, A.E. Troy, C. Mckeon, G.J. Darlington, B.M. Spiegelman, Cross-regulation of C/EBP alpha and PPAR gamma controls the transcriptional pathway of adipogenesis and insulin sensitivity, Mol. Cell 3 (1999) 151–158. [8] J. Rieusset, F. Touri, L. Michalik, P. Escher, B. Desvergne, E. Niesor, W. Wahli, A new selective peroxisome proliferator-activated receptor gamma antagonist with antiobesity and antidiabetic activity, Mol. Endocrinol. 16 (2002) 2628–2644. [9] A.B. Mayerson, R.S. Hundal, S. Dufour, V. Lebon, D. Befroy, G.W. Cline, S. Enockasson, S.E. Inzucchi, G.I. Shulman, K.F. Petersen, The effects of rosiglitazone on insulin sensitivity, lipolysis, and hepatic and skeletal muscle triglyceride content in patients with type 2 diabetes, Diabetes 51 (2002) 797–802. [10] H. Bays, L. Mandarino, R.A. DeFronze, Roles of the adipocyte, free fatty acids, and ectopic fat in pathogenesis of type 2 diabetes mellitus: peroxisomal proliferator-activated receptor agonists provide a rational therapeutic approach, J. Clin. Endocrinol. Metab. 89 (2004) 463–478. [11] C.J. Bailey, C. Day, Traditional plant medicines as treatments for diabetes, Diabetes Care 12 (1989) 553–564. [12] T. Matsui, I.A. Ogunwande, K.J.M. Abesundara, K. Matsumoto, Antihyperglycemic potential of natural products, Mini Rev. Med. Chem. 6 (2006) 109–120. [13] M. Hassan, C.E. Yazidi, J.-F. Landrier, D. Lairon, A. Margotat, M.-J. Amiot, Phloretin enhances adipocyte differentiation and adiponectin expression in 3T3-L1 cells, Biochem. Biophys. Res. Commun. 361 (2007) 208–213. [14] S. Segawa, Colored Illustrations of Seaweeds of Japan, Hoikusha Publishing, Osaka, 1996. pp. 37. [15] T. Kuda, T. Hishi, S. Maekawa, Antioxidant properties of dried product of ‘habanori’, an edible brown alga, Petalonia binghamiae (J. Agaradh) Vinogrdova, Food Chem. 98 (2006) 545–550. [16] Y. Mizushina, Y. Sugiyama, H. Yoshida, S. Hanashima, T. Yamzaki, S. Kamisuki, K. Ohta, M. Takemura, T. Yamaguchi, A. Matsukage, S. Yoshida, M. Saneyoshi, F. Sugawara, K. Sakagauchi, Galactosyldiacylglycerol, a mammalian DNA polymerase a-specific inhibitor from a sea alga, Petalonia binghamiae, Biol. Pharm. Bull. 24 (2001) 982–987. [17] K. Mori, T. Ooi, M. Hiraoka, N. Oka, H. Hamada, M. Tamuara, T. Kusumi, Fucoxanthin and its metabolites in edible brown algae cultivated in deep seawater, Mar. Drugs 2 (2004) 63–72. [18] T. Takamura, H. Ando, Y. Nagai, H. Yamashita, E. Nohara, K. Kobayashi, Pioglitazone prevents mice from multiple low-dose streptozotocin-induced insulitis and diabetes, Diabetes Res. Clin. Pract. 44 (1999) 107–114. [19] J.T. Xie, A. Wang, S. Mehendale, J. Wu, H.H. Aung, L. Dey, S. Qiu, C.S. Yuan, Antidiabetic effects of Gymnema yunnanense extract, Pharmacol. Res. 47 (2003) 323– 329. [20] M.J. Moreno-Aliaga, F. Matsumura, Endrin inhibits adipocyte differentiation by selectively altering the expression pattern of CCAAT/enhancer binding protein-alpha in 3T3-L1 cells, Mol. Pharmacol. 56 (1999) 91–101. [21] Y. Kang, H.Y. Kim, Glucose uptake-stimulatory activity of Amomi Semen in 3T3-L1 adipocytes, J. Ethnopharmacol. 92 (2004) 103–105. [22] B.B. Zhang, D.E. Moller, New approaches in treatment of type 2 diabetes, Curr. Opin. Chem. Biol. 4 (2000) 461–467. [23] B.B. Lowell, PPARgamma: an essential regulator of adipogenesis and modulator of fat cell function, Cell 99 (1999) 239–242. [24] B.M. Spiegelman, PPARc: adipogenic regulator and thiazolidinedione receptor, Diabetes 47 (1998) 507–514.