- Email: [email protected]
PGC-1α prevents mitochondrial dysfunction and ameliorates mesangial cell injury in diabetic rats
Molecular and Cellular Endocrinology 413 (2015) 1e12
Contents lists available at ScienceDirect
Molecular and Cellular Endocrinology journal homepage: www.elsevier.com/locate/mce
Activation of FoxO1/ PGC-1a prevents mitochondrial dysfunction and ameliorates mesangial cell injury in diabetic rats Lina Wu a, b, Qingzhu Wang a, Feng Guo a, Yingni Zhou a, b, Hongfei Ji a, b, Fei Liu a, Xiaojun Ma a, Yanyan Zhao a, Guijun Qin a, * a b
Division of Endocrinology, Department of Internal Medicine, The First Affiliated Hospital of Zhengzhou University, Zhengzhou 450052, China Institute of Clinical Medicine, The First Affiliated Hospital of Zhengzhou University, Zhengzhou 450052, China
a r t i c l e i n f o
a b s t r a c t
Article history: Received 30 November 2014 Received in revised form 18 May 2015 Accepted 4 June 2015 Available online 27 June 2015
The generation of hyperglycemia-induced mitochondrial reactive oxygen species (ROS) is a key event in diabetic nephropathy development. The forkhead-box class O1 (FoxO1) and peroxisome proliferatoractivated receptor g co-activator 1a (PGC-1a) proteins are implicated in oxidative stress. We investigated the in vivo association of FoxO1 and PGC-1a in renal cortices from streptozotocin-induced diabetic rats and in rat kidney mesangial cells (MCs) treated with high glucose, in vitro. High-glucose induced FoxO1 inhibition was associated with decreased PGC-1a expression in MCs. These changes were accompanied by mitochondrial dysfunction and increased ROS generation. However, constitutive FoxO1 activation increased PGC-1a expression and partially reversed these changes, which were significantly decreased by the treatment of PGC-1a-small interfering RNA. We identified PGC-1a as a direct FoxO1 transcriptional target by chromatin immunoprecipitation. In addition, lentiviral-mediated FoxO1 overexpression in diabetic-rat kidneys significantly increased PGC-1a, NRF-1, and Mfn2 expression, and decreased malondialdehyde production and proteinuria. These data suggest that FoxO1/PGC-1a activation protected rats against high-glucose-induced MC injury by attenuating mitochondrial dysfunction and cellular ROS production. © 2015 Elsevier Ireland Ltd. All rights reserved.
Keywords: Diabetic nephropathy Forkhead box class O1 Peroxisome proliferator-activated receptor g co-activator 1a Oxidative stress
1. Introduction Diabetic nephropathy (DN) is a major complication of both type 1 and type 2 diabetes mellitus and the most common cause of endstage renal disease. Multiple lines of evidence indicate that increased oxidant stress is a main pathophysiological factor leading to the development of DN (Brownlee, 2005; Forbes et al., 2008; Ha et al., 2008). It is now thought that the mitochondrial electrontransport system is a major source of reactive oxygen species (ROS) overproduction in diabetes and diabetes-associated complications (Susztak et al., 2006; Afanas'ev, 2010; Hall and Unwin,
Abbreviations: DN, diabetic nephropathy; FoxO1, forkhead-box class O1; HG, high glucose; MC, mesangial cell; MDA, malondialdehyde; Mfn2, mitofusin 2; NRF1, nuclear respiratory factor-1; PGC-1a, peroxisome proliferator-activated receptor g co-activator 1a; ROS, reactive oxygen species; STZ, streptozotocin. * Corresponding author. Division of Endocrinology, Department of Internal Medicine, The First Affiliated Hospital, Zhengzhou University, 40 Daxue Road, Zhengzhou 450052, China. E-mail address: [email protected] (G. Qin). http://dx.doi.org/10.1016/j.mce.2015.06.007 0303-7207/© 2015 Elsevier Ireland Ltd. All rights reserved.
2007) and that high glucose (HG) may induce excessive ROS production and mitochondrial dysfunction (Hsieh et al., 2002). Thus, the regulation of aberrant ROS levels may be a promising approach for treating DN. The peroxisome proliferator-activated receptor g co-activator 1a (PGC-1a) protein is a transcriptional coactivator identified as an upstream regulator of mitochondrial function and oxidative metabolism (Liang and Ward, 2006). PGC-1a is abundantly expressed in tissues and organs with high metabolic rates, such as brown adipose tissue, liver, skeletal muscles, and kidney (Rasbach and Schnellmann, 2007). PGC-1a overexpression in vascular endothelial cells reduced ROS accumulation, prevented mitochondrial dysfunction, and reduced apoptotic cell death occurring in response to high-glucose conditions (Valle et al., 2005). The increase in PGC-1a activity caused by silent mating type information regulation 2 homolog 1 (SIRT1) resulted in a robust induction of genes involved in mitochondrial functions and protection against ROS in both muscle and brown adipose tissue of mice fed a high-fat diet (Lagouge et al., 2006). Restored expression of the mitochondrial biogenesis factor PGC-1a promotes recovery after acute
2
L. Wu et al. / Molecular and Cellular Endocrinology 413 (2015) 1e12
kidney injury during systemic inflammation in mice (Tran et al., 2011). In addition, upregulation of PGC-1a by SIRT1 prevented aldosterone-induced mitochondrial malfunction and inhibited podocyte injury in vitro and in aldosterone-infused mice in vivo; endogenous PGC-1a may be important for maintaining mitochondrial function in podocytes under normal conditions (Yuan et al., 2012). Recently forkhead-box class O proteins (FoxOs) have been shown to function together with PGC-1a to regulate mitochondrial oxidative stress. FoxOs are key transcription factors that dominate the regulation of biological processes, including the cell cycle, cell death, differentiation, metabolism, apoptosis, and oxidative stress (Sedding, 2008; Essers et al., 2005). FoxOs stimulate PGC-1 promoter activity via interaction with insulin-response elements (IREs) in HepG2 cells (Daitoku et al., 2003). FOXO3a is a direct transcriptional regulator of a group of oxidation-protection genes and that this regulation requires PGC-1a, and FoxO3a/PGC-1a regulates the expression of genes associated with protection against oxidative stress in the vascular endothelium (Olmos et al., 2009). Notably, overexpression of the constitutively nuclear form of FoxO1 inhibited insulin-induced suppression of PGC-1a gene transcription, and mutations of 3 IREs abolish or blunt activity of the PGC-1a promoter (Hong et al., 2011). Furthermore, we showed recently that FoxO1 expression and activity significantly decreased in the kidneys of DN rats and in rat kidney MCs in response to high-glucose conditions (Wu et al., 2012a; Liu et al., 2014). However, the protective roles of FoxO1 and PGC-1a against oxidative stress in the kidneys during DN have not been characterized. In this study, we showed that FoxO1 can serve as a direct transcriptional regulator of oxidative stress-protection genes in rat kidney MCs. We also showed that FoxO1/PGC-1a activation protected against high glucose-induced MCs injury by preventing mitochondrial dysfunction and reducing the accumulation of ROS, both in vivo and in vitro. 2. Materials and methods 2.1. Reagents and antibodies Streptozotocin (STZ) was supplied by Sigma (Saint Louis, MO, USA). The following antibodies were used: rabbit anti-FoxO1 and anti-PGC-1a (Abcam, Cambridge, UK); rabbit anti-phospho-FoxO1 (Ser256, Cell Signaling Technology, Danvers, MA, USA); rabbit anti-NRF-1 and anti-Mfn2 (Santa Cruz Biotechnology, Santa Cruz, CA); rabbit anti-GAPDH and anti-b-actin (CWBIO, Beijing, PRC); and rabbit anti-Collagen IV and anti-Fibronectin (Bioss, Beijing, PRC). 2.2. Cell culture and lentiviral-vector infections The rat MC line HBZY-1 was obtained from the Cell Culture Centre of Institute of Biomedicine and Health (Guangzhou, PRC) and immediately expanded and frozen, such that fresh cells from the same batch could be thawed every 3e4 months from a frozen vial. The cells were cultured as previously described (Kolavennu et al., 2008). Briefly, the MCs were maintained in Dulbecco's modified Eagle's medium (Invitrogen, USA) supplemented with 10% fetal bovine serum (Gibco, USA) at 37 C in an atmosphere containing 5% CO2. The cells were treated with indicated concentrations of glucose. Lentiviral vectors expressing a constitutively active form of FoxO1 (CA-FoxO1), FoxO1-specific small interfering RNA (siRNA-FoxO1), or a siRNA against PGC-1a (siRNA-PGC-1a) (GenePharma Co., Shanghai, PRC) were introduced into cells via standard infections at a multiplicity of infection of 100 for 24 h. An empty lentiviral vector (LV-NC) (GenePharma Co., Shanghai, PRC) was used as a negative control.
2.3. Animal experiments Eight-week-old, male SpragueeDawley rats (220 ± 20 g) were purchased from the Experimental Animal Center of Henan Province. All animal studies were approved by the Animal Care and Use Committee of the First Affiliated Hospital of Zhengzhou University (No. 41003100001173) and fully complied with the university guidelines for the care and use of laboratory animals. All rats were maintained on a 12-h lightedark cycle in a temperature-controlled room (25 C). Diabetes was induced by a single intraperitoneal injection of 60 mg/kg STZ (dissolved in fresh 0.05 M citrate buffer, pH 4.5; Sigma, USA) after fasting for 12 h. Blood glucose was measured to validate the induction of diabetes (>16.7 mmol/L) at 72 h after STZ injection. Rats that received an injection of diluent buffer alone served as normal control group (NG, n ¼ 8). Diabetic rats were randomly divided into 3 groups: the diabetic group (DM, n ¼ 8), the diabetes with LV-CA-FoxO1 group (CA-FoxO1, n ¼ 8), and diabetes with LV-NC group (LV-NC, n ¼ 8). Diabetic rats were anesthetized by intraperitoneal injection of 10% chloral hydrate (4 mL/kg) after fasting for 12 h. During surgery, a 1e2-cm-long incision was made at a costal spinal angle in the right back to expose the right kidney of rats, followed by the injection of 100 mL LV-CA-FoxO1 or LV-NC into the renal cortex at several sites, whereas rats in the DM group were injected with an equal volume of saline. Then muscle and skin were sutured. At 8 weeks postinjection, a 24-h urine sample from each rat was collected for the determination of 24-h urinary protein and urinary albumin quantities. Subsequently, the rats were anesthetized with pentobarbital sodium (50 mg/kg body wt), and blood was collected from the orbital vein for blood glucose, serum creatinine, and blood urea nitrogen measurements. Kidney weight/body weight ratios were measured after sacrifice. The renal cortex at the injection site was cut into small pieces (1 mm3) and fixed in 4% pre-cooling glutaraldehyde in preparation for electron-microscopy examination. Cortices were fixed in 4% paraformaldehyde for hematoxylin and eosin staining and immunohistochemistry. The remaining kidney cortex was removed as described (Xu et al., 2006) and rapidly preserved in liquid nitrogen for subsequent experiments. 2.4. Reverse-transcriptase quantitative PCR (RT-qPCR) analysis Total RNA from cultured MCs and renal cortices was extracted using the Trizol Reagent (TaKaRa Bio, Shiga, Japan) according to the manufacturer's instructions and reverse-transcribed into cDNA using the cDNA Synthesis Kit (TOYOBO, Japan). The cDNAs were then quantified by real-time PCR using the ABI 7500FAST System (Foster City, CA), the KOD SYBR Green qPCR Mix Kit (TOYOBO, Japan), and appropriate primers. Relative gene expression levels were normalized to GAPDH expression. Primers were obtained from Sangon Biotech Co., Ltd. (Shanghai, PRC), and all primer information is shown in Table 1. The PCR amplification conditions used were 98 C for 2 min, followed by 40 cycles of 98 C for 10 s, 60 C for 10 s, and 68 C for 30 s. 2.5. Western blot analysis Total protein in MCs and renal cortical tissues was extracted with a protein extraction reagent (Thermo, USA), according to the manufacturer's instructions. Western blotting was performed as described previously (Puthanveetil et al., 2010). The primary antibodies used were: anti-FoxO1 (1:1000), anti-phospho-FoxO1 (1:750), anti-PGC-1a (1:1000), anti-NRF-1 (1:250), anti-Mfn2 (1:200), anti-GAPDH (1:1000) and anti-b-actin (1:1000). After incubation with an appropriate secondary antibody, the western blots were visualized using the ECL Western Blotting Substrate
L. Wu et al. / Molecular and Cellular Endocrinology 413 (2015) 1e12
3
Table 1 Sequences of primers used for quantitative RT-PCR analysis. Gene symbol
Forward primer (50 e30 )
Reverse primer (50 e30 )
Product length
FoxO1 PGC-1a NRF-1 Mfn2 GAPDH
CAGCAAATCAAGTTATGGAGGA TGGAGCAATAAAGCAAAGAGC TTGATGGACACTTGGGTAGC GACTGGATTGTGCCGATGAC GCCACTCAGAAGACTCTGGA
TATCATTGTGGGGAGGAGAGTC GTGTGAGGAGGGTCATCGTT GCCAGAAGGACTGAAAGCAG CAGAAGAGGAGGAGGCTTGA GTTCAGCTCTGGGATGACCT
95 bp 104 bp 108 bp 100 bp 129 bp
(Thermo Scientific, USA). Relative protein levels were quantitated using Gel-Pro Analyzer 4.0 software. 2.6. Immunofluorescence analysis Immunofluorescence staining was performed as described previously (Wu et al., 2012b). Briefly, MCs were seeded into chamber slides and incubated for 24 h. The MCs were then fixed in 4% paraformaldehyde solution for 20 min, permeabilized with 0.25% Triton X-100 for 15 min, and blocked with 1% BSA for 30 min, with each step performed at room temperature. After incubation with an anti-FoxO1 antibody (diluted 1:250) or an anti-PGC-1a antibody (diluted 1:300) at 4 C overnight, the MCs were incubated for 1 h at room temperature with a Cy3-labeled secondary antibody (diluted 1:500) and stained with DAPI for 2 min. The distribution and subcellular localization of target proteins were examined under an IX71 fluorescent microscope (Olympus, Japan). Densitometric analysis was performed using Image Pro Plus software, version 6.0.
dichlorofluorescein diacetate (DCFH-DA) (Beyotime, PRC) as described previously (Guo et al., 2010). Briefly, the cells were trypsinized, resuspended, and incubated at 37 C for 20 min with DCFH-DA at a final concentration of 10 mmol/L. Fluorescence intensities were analyzed by flow cytometry using excitation/emission wavelengths of 488/525 nm, respectively. 2.10. Measurement of malondialdehyde (MDA) concentrations Renal cortex MDA levels were quantified using the Lipid Peroxidation MDA Assay Kit (Beyotime Institute of Biotechnology, Jiangsu, PRC), according to the manufacturer's protocol and as described in our previous report (Wu et al., 2012a). 2.11. Immunohistochemistry Paraffin sections of rat kidneys were prepared by a conventional method and treated as we described previously (Wu et al., 2012a). The working concentrations of the anti-Collagen IV and antiFibronectin antibodies were 1:100 and 1:200, respectively.
2.7. Chromatin immunoprecipitation assays 2.12. Light and electron microscopy Chromatin immunoprecipitation assays were conducted using EZ-ChIP kit (Millipore, USA) according to the manufacturer's instructions. Chromatin immunoprecipitation was performed as described previously (Lin et al., 2012). The MCs were infected with the empty-vector lentivirus (LV-NC) or the constitutively active FoxO1 (CA-FoxO1) lentivirus under a HG condition (25 mM glucose). After treatment, cells were fixed in formaldehyde for 10 min at room temperature, after which they were lysed and sonicated. Soluble chromatin was co-immunoprecipitated with a polyclonal FoxO1 antibody (Abcam, Cambridge, UK) or an isotypematched IgG (negative control). De-cross-linked DNA samples were subjected to PCR amplification using a forward primer (50 -AGCCTATGAGAGCCATGGAA-30 ) and a reverse primer (50 -GGTCAACCAAACAGCCTCAT-30 ), which target the rat PGC-1a promoter in the region containing IREs. Precipitated DNA fragments were analyzed by qPCR. In addition, the PCR products were analyzed by electrophoresis in a 4% agarose gel. The activities of the PGC-1a promoter were averaged from the values obtained with 3 independent replicates.
Kidney pathology in hematoxylin and eosin-stained sections was examined by light microscopy. Renal cortices of kidneys were cut into small pieces (1 mm3) and treated as described in our previous report (Wu et al., 2012a). The ultrastructure of renal cortex tissue was observed with an H-7500 transmission electron microscope (Hitachi, Japan). 2.13. Statistics Data were analyzed with SPSS software, version 18.0 (IBM, Endicott, NY, USA). All data are presented as the mean ± S.E. Comparisons among more than 2 groups were assessed with 1-way analysis of variance, followed by Bonferroni's test, and p < 0.05 was considered to be statistically significant. 3. Results 3.1. HG inhibited FoxO1 activity, and FoxO1 overexpression reversed HG-dependent PGC-1a downregulation in HG-treated MCs
2.8. Mitochondrial membrane potential The mitochondrial membrane potential of MCs was monitored using JC-1. Briefly, cells were trypsinized, resuspended, and incubated in the dark with JC-1 for 20 min at 37 C. The cells were then washed with JC-1 washing buffer, and the fluorescence was viewed with an IX71 fluorescent microscope. The relative mitochondrial membrane potential was calculated using the ratios of red/green fluorescence densities. 2.9. Measurement of intracellular ROS Intracellular ROS production was measured using 20 ,70 -
FoxO1 and PGC-1a serve important roles in regulating oxidative stress. To verify the relationship between FoxO1 activity and PGC1a expression in MCs, we analyzed the expression of FoxO1 and PGC-1a stimulation with HG (25 mM glucose) in cultured MCs. Although FoxO1 expression did not differ in MCs from the NG and HG groups (Fig. 1A), the p-FoxO1/total-FoxO1 ratio under the HG condition significantly increased compared to that observed following incubation with 5.6 mM glucose (Fig. 1B). Similarly, the mRNA and protein levels of PGC-1a were significantly decreased in HG-treated MCs compared with control cells (Fig. 1C and D). To determine the effect of FoxO1 on PGC-1a expression, constitutively active FoxO1 or siRNA-FoxO1 (encoded by
4
L. Wu et al. / Molecular and Cellular Endocrinology 413 (2015) 1e12
Fig. 1. Effects of FoxO1 on PGC-1a expression in rat kidney mesangial cells (MCs). (A, C) FoxO1 and PGC-1a mRNA were detected by RT-qPCR analysis of total RNA. GAPDH was used as a negative control. MCs were infected with a lentiviral vector expressing constitutively active FoxO1 (CA-FoxO1) or small interfering RNA against FoxO1 (siRNA-FoxO1), under a high-glucose (HG; 25 mM glucose) or normal glucose (NG; 5.6 mM) condition, respectively. Cells infected with an empty-vector lentivirus were used as a positive control (data not shown). (B) FoxO1 and p-FoxO1 were detected by western blot analysis. Left: representative immunoblots. Right: ratio of the p-FoxO1/total FoxO1 as determined by densitometric analysis. (D) PGC-1a protein expression detected by western blot analysis. Left: representative immunoblots. Right: densitometric analysis. (E) Immunofluorescence detection of FoxO1 and PGC-1a in MCs (400). (F) Quantitative analysis based on FoxO1 and PGC-1a fluorescence intensities. Data are presented as the mean ± S.E. (n ¼ 3). *p < 0.05 vs. NG; # p < 0.05 vs. HG.
lentiviral vectors) was introduced into the MCs. As shown in Fig. 1A and B, CA-FoxO1 overexpression increased the levels of FoxO1 mRNA and nuclear FoxO1 protein. Importantly, HG-
induced down-regulation of PGC-1a was reversed when MCs were infected with a CA-FoxO1 lentiviral vector (Fig. 1C and D). In contrast, downregulation of FoxO1 by siRNA-FoxO1
L. Wu et al. / Molecular and Cellular Endocrinology 413 (2015) 1e12
5
Fig. 2. FoxO1 binds the regulatory region of the PGC-1a gene and reduces mitochondrial dysfunction via upregulated PGC-1a expression. (A, B) Chromatin immunoprecipitation assays showing FoxO1 binding to the promoter region of PGC-1a in rat kidney mesangial cells (MCs). Rat-kidney mesangial cells were infected with the empty-vector lentivirus (LVNC) or the constitutively active FoxO1 lentivirus (CA-FoxO1) under a high-glucose (HG) condition (25 mM glucose). Soluble chromatin was immunoprecipitated with antibodies against FoxO1. The DNA fragments were analyzed by qPCR (A), or amplified by PCR and visualized in agarose gels (B). The results shown are representative of 3 independent experiments. (C, D) PGC-1a protein expression detected by western blotting. Left: representative immunoblots. Right: densitometric analysis. (E, F) NRF-1 and Mfn2 proteins were detected by western blotting. Left: representative immunoblots. Right: densitometric analysis. Data are presented as the mean ± S.E. (n ¼ 3).
6
L. Wu et al. / Molecular and Cellular Endocrinology 413 (2015) 1e12
Fig. 3. FoxO1 overexpression prevents the high-glucose-dependent decrease in expression of the mitochondrial-related transcription factor (NRF-1) and mitochondrial fusion protein (Mfn2). FoxO1 downregulation promoted the high glucose-dependent decrease in Mfn2 and NRF-1 levels in rat kidney mesangial cells. (A, B) Real-time qPCR analysis of NRF-1 and Mfn2 expression in rat kidney mesangial cells infected with an empty-vector lentivirus (LV-NC), a constitutively active FoxO1 lentivirus (CA-FoxO1), or a small interfering RNA-FoxO1 lentivirus (siRNA-FoxO1) under a high-glucose (HG) condition (25 mM glucose). GAPDH was used as a negative control. (C, D) The NRF-1 and Mfn2 proteins were detected by western blotting. Left: representative immunoblots. Right: densitometric analysis. Data are presented as the mean ± S.E. (n ¼ 3). *p < 0.05 vs. NG; #p < 0.05 vs. HG.
decreased the mRNA and protein levels of PGC-1a, compared with the NG group (Fig. 1C and D). We also detected the FoxO1 and PGC-1a proteins in MCs by immunofluorescence. A notable decrease of FoxO1 nuclear translocation was observed in MCs exposed to HG. FoxO1 nuclear translocation increased following CA-FoxO1 overexpression. Infection with the siRNA-FoxO1 lentiviral vector caused an opposite effect. Similar to PGC-1a mRNA and protein expression, the increased effect by CA-FoxO1 and inhibitory effect by HG or siRNA-FoxO1 were also reflected in MCs, as assessed by immunofluorescence microscopy (Fig. 1E and F). Taken together, these observations indicated that FoxO1 overexpression prevented the HG-induced downregulation of
PGC-1a levels in HG-treated MCs. 3.2. FoxO1 bound to the PGC-1a promoter in vitro To determine the potential role of FoxO1 in PGC-1a gene transcription in rat kidney MCs, the interaction between FoxO1 and the PGC-1a prompter element was examined by chromatin immunoprecipitation assays, using an antibody specific for FoxO1. As shown in Fig. 2A and B, we found that FoxO1 bound to the PGC-1a promoter region in MCs, and HG strongly suppressed this binding. In addition, FoxO1 recruitment to the PGC-1a promoter was significantly increased in MCs infected with CA-FoxO1 but not with the
L. Wu et al. / Molecular and Cellular Endocrinology 413 (2015) 1e12
empty-vector lentivirus under the HG (25 mM glucose) condition. These data showed that FoxO1 could induce PGC-1a expression. 3.3. FoxO1 overexpression prevented HG-induced mitochondrial dysfunction in MCs To verify the effect of FoxO1 on mitochondrial biogenesis, we measured the levels of PGC-1a, NRF-1, Mfn2, and mitochondrial membrane potential. siRNA-PGC-1a and HG treatment decreased PGC-1a expression, as determined by western blot analysis (Fig. 2C and D). However, the effect of HG was reversed by FoxO1 overexpression. In contrast, the effect of FoxO1 was largely decreased when HG-treated MCs were infected with the CA-FoxO1 and siRNA-PGC-1a lentiviral vectors (Fig. 2C and D). As shown in Fig. 3A and B, a marked decrease in the mRNA levels of NRF-1 and Mfn2 was observed in the HG group compared with the NG group. In agreement, the protein levels of NRF-1 and Mfn2 were significantly decreased in HG-treated MCs compared to that observed following incubation with 5.6 mM glucose (Fig. 3C and D). As expected, FoxO1 overexpression suppressed the HG-dependent
7
downregulation of NRF-1 and Mfn2, at both the mRNA and protein levels (Fig. 3). In addition, downregulation of FoxO1 by siRNAFoxO1 decreased the levels of NRF-1 and Mfn2, compared with HG group (Fig. 3). In contrast, when HG-treated MCs were infected with both the CA-FoxO1 and PGC-1a siRNA lentiviral vectors, the effect of FoxO1 on mitochondrial biogenesis was largely reduced (Fig. 2E and F). As shown in Fig. 4A and B, the JC-1 fluorescence detected by fluorescence microscopy showed a decrease in red fluorescence accumulated in the mitochondria and an increase in green fluorescence distributed in the cytoplasm in MCs incubated with 25 mM glucose, suggesting that HG treatment reduced the mitochondrial membrane potential. In contrast, FoxO1 overexpression resulted in an apparent increase in the mitochondrial membrane potential, when compared to that observed following incubation with 25 mM glucose. However, siRNA-FoxO1 overexpression promoted a HG-dependent reduction of the mitochondrial membrane potential. In contrast, the effect of FoxO1 was largely decreased when HG-treated MCs were infected with the CA-FoxO1 and siRNA-PGC-1a lentiviral vectors (Fig. 4A and B). Together, these
Fig. 4. Effect of FoxO1 on the high-glucose-dependent reduction of mitochondrial membrane potential and cellular ROS accumulation. Rat kidney mesangial cells were infected with an empty-vector lentivirus (LV-NC), a constitutively active FoxO1 lentivirus (CA-FoxO1), a small interfering RNA-FoxO1 lentivirus (siRNA-FoxO1), or a small interfering RNAPGC-1a lentivirus (siRNA-PGC-1a) under a high-glucose (HG) condition (25 mM glucose). (A, B) Cells seeded into 6-well plates were treated for 24 h, as indicated. The cells were then co-incubated with the fluorescence probe JC-1 for 20 min at 37 C, images (400) were scanned with a fluorescent microscope, and red/green fluorescence-intensity values were calculated. (C) Intracellular ROS production was quantified by flow cytometry analysis, using DCFH-DA. Data are presented as the mean ± S.E (n ¼ 3). *p < 0.05 vs. NG; #p < 0.05 vs. HG; &p < 0.05 vs. CA-FoxO1. (For interpretation of the references to colour in this figure legend, the reader is referred to the web version of this article.)
8
L. Wu et al. / Molecular and Cellular Endocrinology 413 (2015) 1e12
results supported a model whereby FoxO1 overexpression can prevent mitochondrial dysfunction via PGC-1a upregulation under stress conditions.
3.4. Overexpression of FoxO1 protected MCs by reduced the accumulation of ROS To establish whether FoxO1-induced upregulation of PGC-1a can increase the cellular detoxification capacity, we measured cellular ROS production. ROS production was increased in MCs induced by HG compared to that observed in the NG group (Fig. 4C). There was no statistical difference in cellular ROS levels between the HG and LV-NC groups, indicating that the LV-NC vector did not affect ROS production. ROS generation in FoxO1-overexpressing MCs infected with the CA-FoxO1 dramatically decreased compared with MCs infected with LV-NC. In contrast, ROS generation in FoxO1 low-expressing MCs infected with siRNA-FoxO1 was significantly increased compared with MCs infected with LV-NC. In addition, the effect of FoxO1 was largely decreased when HGtreated MCs were infected with the CA-FoxO1 and siRNA-PGC-1a lentiviral vectors. Taken together, these results demonstrated that upregulation (or downregulation) of FoxO1 inhibited (or promoted) the HG-induced accumulation of cellular ROS.
3.5. FoxO1 overexpression protected mitochondrial function in the kidney cortices of STZ-induced rats and ameliorated DN progression in vivo Based on our data in vitro, we sought in vivo support of the protective effects of FoxO1 and PGC-1a in the kidney during DN by studying STZ-induced rats treated with constitutively active FoxO1. FoxO1 expression and activity in the kidney cortices of CA-FoxO1treated rats were marked increased at 8 weeks following CAFoxO1 administration (Fig. 5A, C, and D). We found that the levels of blood glucose; the ratios of kidney weight/body weight; and the 24-h urinary protein, urinary albumin, serum creatinine, and blood urea nitrogen levels significantly increased in the diabetic rats, compared to that observed in normal rats. FoxO1 overexpression significantly decreased the levels of biological parameters at the end of the eighth week in comparison to diabetic rats. However, FoxO1 overexpression failed to decrease blood glucose (Table 2). We then examined the effect of FoxO1 treatment on mitochondrial morphology. As shown in Fig. 6A, FoxO1 treatment in STZ-induced diabetic rats reduced mitochondrial swelling compared with that observed in STZ-induced diabetic rats without FoxO1 treatment. We also examined the kidneys of these rats histopathologically. Hematoxylin and eosin staining revealed a larger volume of renal glomeruli, expanded mesangial cells, and a thickening of the glomerular basement membrane in the kidneys of diabetic rats. Conversely, renal pathology was ameliorated in rats from the CA-FoxO1 group (Fig. 6B). Moreover, by electron
Fig. 5. Effect of FoxO1 on PGC-1a expression in the renal cortices of STZ-induced rats. (A, B) Real-time RT-PCR analysis of FoxO1 and PGC-1a mRNA levels. GAPDH was used as a negative control. (C, D) FoxO1 and p-FoxO1 were detected by western blot analysis. Left: representative immunoblots. Right: ratio of p-FoxO1/total FoxO1 expression, as determined by densitometric analysis. (E, F) PGC-1a protein detection by western blotting. Left: representative immunoblots. Right: densitometric analysis. Data are displayed as the mean ± S.E (n ¼ 3). *p < 0.05 vs. NG; #p < 0.05 vs. DM.
L. Wu et al. / Molecular and Cellular Endocrinology 413 (2015) 1e12
9
Table 2 Biological parameters of the study groups. Characteristic
NG
Blood glucose (mM) Kidney weight/body weight ( 103) 24-h urinary protein (mg/24 h) Urinary albumin (mg/24 h) Serum creatinine (mM) Blood urea nitrogen (mmol/L)
5.5 3.1 6.6 0.34 46.6 6.0
DM ± ± ± ± ± ±
0.3 0.1 0.7 0.03 2.0 0.3
26.8 8.0 28.1 0.91 82.1 18.5
CA-FoxO1 ± ± ± ± ± ±
1.7* 0.3* 1.2* 0.03* 2.8* 0.4*
25.9 5.2 16.5 0.66 56.9 13.6
± ± ± ± ± ±
1.8* 0.2*# 0.7*# 0.03*# 1.8*# 0.6*#
LV-NC 26.1 7.9 27.5 0.90 81.3 18.5
± ± ± ± ± ±
1.7 0.3 1.4 0.03 3.2 0.4
Data are expressed as the mean ± S.E. NG, normal control group; DM, diabetic group; CA-FoxO1, diabetic-rat group administered a lentiviral vector expressing constitutively active FoxO1; LV-NC, diabetic-rat group administered an empty-vector lentivirus. *p < 0.05 vs. NG; #p < 0.05 vs. DM.
microscopy, we found that podocytes were seriously injured in diabetic rats. In contrast, FoxO1 overexpression, to some degree, promoted the recovery of injured podocytes (Fig. 6C). These results indicate that the in vivo upregulation of FoxO1 can ameliorate kidney pathology in diabetic rats. Next, we examined the effect of CA-FoxO1 treatment on PGC-1a expression in the kidney cortices of diabetic rats. Importantly, RTqPCR and western blot analysis showed PGC-1a up-regulation in the kidney cortices of CA-FoxO1-treated diabetic rats (Fig. 5B, E, and
F). To further validate the protective effects of FoxO1/PGC-1a on mitochondrial biogenesis, we examined the expression levels of NRF-1 and Mfn2 by comparing kidneys from CA-FoxO1-treated diabetic rats with untreated diabetic rats. Consistent with our in vitro results, both the mRNA and protein levels of NRF-1 and Mfn2 were significantly induced by CA-FoxO1 treatment (Fig. 7B and C). These results demonstrated the therapeutic efficacy of FoxO1/PGC-1a expression in the kidneys of diabetic rats in vivo and suggest that in vivo FoxO1 up-regulation led to increased PGC-1a
Fig. 6. Effect of FoxO1 on mitochondrial morphology in glomerular podocytes and on renal morphology in kidneys from STZ-induced rats. (A) Ultrastructure of glomerular podocytes as viewed by transmission electron microscopy (20,000). (B) Hematoxylin and eosin staining of rat glomeruli (400). (C) Kidney ultrastructure as viewed by transmission electron microscopy (20,000).
10
L. Wu et al. / Molecular and Cellular Endocrinology 413 (2015) 1e12
Fig. 7. Oxidative stress, NRF-1 and Mfn2 levels, and expression of Col IV and FN in the renal cortices of normal control rats and diabetic rats, with or without CA-FoxO1. (A) Analysis of MDA generation. (B) Real-time RT-PCR analysis of NRF-1 and Mfn2 mRNA levels. GAPDH was used as a negative control. (C) Western blot analysis of NRF-1 and Mfn2 protein expression. Left: representative immunoblots. Right: densitometric analysis. (D) Immunohistochemical staining. (E) Densitometry analysis of Col IV and FN expression. Data are displayed as the mean ± S.E (n ¼ 3). *p < 0.05 vs. NG; #p < 0.05 vs. DM.
expression and attenuated mitochondrial dysfunction, consistent with our in vitro findings. To test the effect of FoxO1/PGC-1a overexpression on oxidative stress and extracellular matrix protein expression in the kidneys of diabetic rats, we assessed the expression of MDA, the associated extracellular matrix collagen IV, and fibronectin in their kidney cortices. We observed that MDA generation significantly decreased in CA-FoxO1-treated rats compared with diabetic rats (Fig. 7A). Similarly, immunohistochemistry results showed that collagen IV and fibronectin expression in the kidney cortices significantly decreased in diabetic rats treated with CA-FoxO1 (Fig. 7D and E). 4. Discussion Oxidative stress is increased in diabetes, and ROS production may contribute to the development of diabetes complications, such as DN. However, the understanding of the mechanisms that protect cells against oxidative stress remains elusive. FoxO1 proteins are involved in several pathways responsible for cell metabolism, the onset of diabetes mellitus, and diabetic complications (Maiese et al., 2008). Previously, we proposed that HG significant inhibits FoxO1
activity, leading to increased ROS generation in the kidneys of diabetic rats (Wu et al., 2012a). In this study, we confirmed that forced FoxO1 activation by infection with lentiviral vectors inhibited HG-induced mitochondrial dysfunction and intracellular ROS production. Secondly, increased FoxO1 activity suppressed HGdependent PGC-1a downregulation. We also found that FoxO1 bound to the PGC-1a promoter in rat kidney MCs. Furthermore, our results demonstrated the therapeutic efficacy of FoxO1/PGC-1a modulation in the kidneys of STZ-induced diabetic rats. As DN development is characterized by enhanced ROS generation, protecting cells against oxidative stress is critical. It is notable that FoxO factors have been implicated in ROS homeostasis. For example, it was found that an excess flux of fatty acids in adipocytes increased mitochondrial ROS production; decreased the levels of FoxO1 and oxygen-radical scavengers, such as MnSOD and glutathione peroxidase; and that increased FoxO1 levels by resveratrol treatment protected cells from fatty acids induced ROS formation (Subauste and Burant, 2007). H2O2 inhibited catalase protein expression in MCs through phosphorylation and inactivation of FoxO1 causing a reduced transcriptional response, and constitutively active FoxO1 increased catalase expression (Venkatesan et al.,
L. Wu et al. / Molecular and Cellular Endocrinology 413 (2015) 1e12
2007). Given the versatile and pleiotropic nature of the FoxO-family regulatory circuit, it is possible that FoxO1 expression is a tissuespecific regulator relevant to diabetes. In the present study, we showed that HG caused an increase in oxidative stress in MCs. This change was associated with decreased FoxO1 activity in vitro, which was also seen in vivo in STZ-induced diabetic rats, in agreement with results from our previous studies (Wu et al., 2012a; Liu et al., 2014). Furthermore, our findings here demonstrated that FoxO1 overexpression protected against the HG-induced accumulation of ROS, both in cultured MCs and in the kidneys of STZinduced diabetic rats. In contrast, FoxO1 downregulation increased the HG-induced accumulation of cellular ROS. Collectively, these data indicate that FoxO1 expression is essential for counteracting oxidative stress under HG conditions. It is known that the most important sources of ROS under hyperglycemic conditions are the mitochondria and NADPH oxidases (Afanas'ev, 2010). HG-stimulated generation of mitochondrial superoxide led to mitochondrial injury in renal proximal tubular cells (Munusamy and MacMillan-Crow, 2009). PGC-1a can regulate mitochondrial biogenesis and the oxidative stress-protection system in various cell types. PGC-1a up-regulation in vascular endothelial cells increased the cellular capacity for detoxifying mitochondrial ROS and preventing endothelial dysfunction and apoptotic cell death under oxidative-stress conditions, such as HG (Valle et al., 2005). PGC-1a upregulation conferred increased resistance to oxidative stress and protected mitochondrial function through an increase in the mitochondrial membrane potential in mouse fibroblasts (Anderson et al., 2008). In agreement with these findings, our data showed that HG-treatment inhibited PGC-1a expression, resulting in mitochondrial dysfunction, as demonstrated by a decrease in mitochondrial membrane potential and NRF-1 and Mfn2 expression in rat MCs, which was also seen in vivo in the kidneys of STZ-induced diabetic rats. Some investigators have speculated that FoxO transcription factors can induce PGC-1a expression and stimulate PGC-1a promoter activity via interactions with IRSs. It has been shown previously that FoxO3a is a direct transcriptional regulator of a group of oxidative-stress protection genes and that this regulation requires PGC-1a. FoxO3a and PGC-1a interact directly, and their interaction regulates mitochondrial oxidative stress (Olmos et al., 2009). Insulin-dependent PGC-1a suppression was neutralized by the overexpression of a constitutively nuclear form of FoxO1, and the activation of the PGC-1a promoter required FoxO1-mediated activities (Hong et al., 2011). The results of our study showed that FoxO1 could interact with IRSs within the PGC-1a promoter in rat kidney MCs. In addition, FoxO1 overexpression prevented HGinduced reduction of PGC-1a and mitochondrial dysfunction, and knockdown of PGC-1a reversed the effect. However, downregulating FoxO1 levels with a siRNA caused decreased PGC-1a expression and aggravated mitochondrial dysfunction. Thus, the low FoxO activity observed under oxidative stress signaling may contribute to PGC-1a suppression during HG states. Notably, we also observed that pathological changes in kidneys were improved in diabetic rats treated with CA-FoxO1. For example, the 24-h urinary protein, urine albumin, serum creatinine, and blood urea nitrogen levels were significantly decreased, and podocyte injury was reversed to some degree. In addition, diabetic rats with FoxO1 overexpression demonstrated a decrease in the MDA, collagen IV, and fibronectin content levels in the kidney. Our results showed protective effects of FoxO1/PGC-1a on mitochondrial function and the kidneys of diabetic rats. Maiese et al. (Maiese et al., 2008) reported that targeting FoxO proteins may be a viable approach worthy of consideration for the development of novel therapeutic strategies. Given that the FoxO1 and PGC-1a transcription factors are required for maintaining the balance of oxidative stress and that
11
FoxO serves a role in nephropathy (Kato et al., 2006), our results demonstrate that modulating the FoxO/PGC-1a pathway may have therapeutic utility in treating DN. In conclusion, our findings demonstrated that FoxO1 suppression resulted in mitochondrial dysfunction and MC injury. In contrast, overexpression of FoxO1 increased PGC-1a expression and prevented mitochondrial dysfunction and MC injury. These findings indicate that novel agonists of FoxO1 and/or PGC-1a may be useful therapeutically for treating DN. Conflicts of interest All authors declare that there is no conflict of interest associated with this manuscript. Acknowledgements This work was supported by grants from the National Natural Science Foundation of China (Grant No. 81400800 to X. Ma) and the Innovation Scientists and Technicians Troop Construction Projects of Henan Province (Grant No. 134200510021 to G. Qin). The authors appreciate the generous assistance from the Institute of Clinical Medicine (The First Affiliated Hospital of Zhengzhou University, Zhengzhou, China) in providing the necessary facilities, and from Jun Ouyang and Jinfa Li from the endocrinology laboratory of The First Affiliated Hospital of Zhengzhou University. References Afanas'ev, Igor, 2010. Signaling of reactive oxygen and nitrogen species in diabetes mellitus. Oxid. Med. Cell. Longev. 3, 361e373. Anderson, R.M., Barger, J.L., Edwards, M.G., Braun, K.H., O'Connor, C.E., Prolla, T.A., Weindruch, R., 2008. Dynamic regulation of PGC-1alpha localization and turnover implicates mitochondrial adaptation in calorie restriction and the stress response. Aging Cell 7, 101e111. Brownlee, M., 2005. The pathobiology of diabetic complications: a unifying mechanism. Diabetes 54, 1615e1625. Daitoku, H., Yamagata, K., Matsuzaki, H., Hatta, M., Fukamizu, A., 2003. Regulation of PGC-1 promoter activity by protein kinase B and the forkhead transcription factor FKHR. Diabetes 52, 642e649. Essers, M.A., de Vries-Smits, L.M., Barker, N., Polderman, P.E., Burgering, B.M., Korswagen, H.C., 2005. Functional interaction between beta-catenin and FOXO in oxidative stress signaling. Science 308, 1181e1184. Forbes, J.M., Coughlan, M.T., Cooper, M.E., 2008. Oxidative stress as a major culprit in kidney disease in diabetes. Diabetes 57, 1446e1454. Guo, W.J., Ye, S.S., Cao, N., Huang, J., Gao, J., Chen, Q.Y., 2010. ROS-mediated autophagy was involved in cancer cell death induced by novel copper(II) complex. Exp. Toxicol. Pathol. 62, 577e582. Ha, H., Hwang, I.A., Park, J.H., Lee, H.B., 2008. Role of reactive oxygen species in the pathogenesis of diabetic nephropathy. Diabetes Res. Clin. Pract. 13, S42eS45. Hall, A.M., Unwin, R.J., 2007. The not so “mighty chondrion”: emergence of renal diseases due to mitochondrial dysfunction. Nephron Physiol. 105, 1e10. Hong, T., Ning, J., Yang, X., Liu, H.Y., Han, J., Liu, Z., Cao, W., 2011. Fine-tuned regulation of the PGC-1a gene transcription by different intracellular signaling pathways. Am. J. Physiol. Endocrinol. Metab. 300, E500eE507. Hsieh, T.J., Zhang, S.L., Filep, J.G., Tang, S.S., Ingelfinger, J.R., Chan, J.S., 2002. High glucose stimulates angiotensinogen gene expression via reactive oxygen species generation in rat kidney proximal tubular cells. Endocrinology 143, 2975e2985. Kato, M., Yuan, H., Xu, Z.G., Lanting, L., Li, S.L., Wang, M., Hu, M.C., Reddy, M.A., Natarajan, R., 2006. Role of the Akt/FoxO3a pathway in TGF-b1emediated mesangial cell dysfunction: a novel mechanism related to diabetic kidney disease. J. Am. Soc. Nephrol. 17, 3325e3335. Kolavennu, V., Zeng, L., Peng, H., Wang, Y., Danesh, F.R., 2008. Targeting of RhoA/ ROCK signaling ameliorates progression of diabetic nephropathy independent of glucose control. Diabetes 57, 714e723. Lagouge, M., Argmann, C., Gerhart-Hines, Z., Meziane, H., Lerin, C., Daussin, F., Messadeq, N., Milne, J., Lambert, P., Elliott, P., Geny, B., Laakso, M., Puigserver, P., Auwerx, J., 2006. Resveratrol improves mitochondrial function and protects against metabolic disease by activating SIRT1 and PGC-1a. Cell 127, 1109e1122. Liang, H., Ward, W.F., 2006. PGC-1 alpha: a key regulator of energy metabolism. Adv. Physiol. Educ. 30, 145e151. Lin, H.Y., Yin, Y., Zhang, J.X., Xuan, H., Zheng, Y., Zhan, S.S., Zhu, Y.X., Han, X., 2012. Identification of direct forkhead box O1 targets involved in palmitate-induced apo-ptosis in clonal insulin-secretingcells using chromatin immunoprecipitation coupled to DNA selection and ligation. Diabetologia 55, 2703e2712. Liu, F., Ma, X.J., Wang, Q.Z., Zhao, Y.Y., Wu, L.N., Qin, G.J., 2014. The effect of FoxO1 on
12
L. Wu et al. / Molecular and Cellular Endocrinology 413 (2015) 1e12
the proliferation of rat mesangial cells in high glucose condition. Nephrol. Dial. Transpl. 29, 1879e1887. Maiese, K., Chong, Z.Z., Shang, Y.C., 2008. OutFOXOing disease and disability: the therapeutic potential of targeting FoxO proteins. Trends Mol. Med. 14, 219e227. Munusamy, S., MacMillan-Crow, L.A., 2009. Mitochondrial superoxide plays a crucial role in the development of mitochondrial dysfunction during high glucose exposure in rat renal proximal tubular cells. Free Radic. Biol. Med. 46, 1149e1157. Olmos, Y., Valle, I., Borniquel, S., Tierrez, A., Soria, E., Lamas, S., Monsalve, M., 2009. Mutual dependence of Foxo3a and PGC-1 alpha in the induction of oxidative stress genes. J. Biol. Chem. 284, 14476e14484. Puthanveetil, P., Wang, Y., Wang, F., Kim, M.S., Abrahani, A., Rodrigues, B., Rodrigues, B., 2010. The increase in cardiac pyruvate dehydrogenase kinase-4 after short-term dexamethasone is controlled by an Akt-p38-forkhead box other factor-1 signaling axis. Endocrinology 151, 2306e2318. Rasbach, K.A., Schnellmann, R.G., 2007. Signaling of mitochondrial biogenesis following oxidant injury. J. Biol. Chem. 282, 2355e2362. Sedding, D.G., 2008. FoxO transcription factors in oxidative stress response and ageing-a new fork on the way to longevity? Biol. Chem. 389, 279e283. Subauste, A.R., Burant, C.F., 2007. Role of FoxO1 in FFA induced oxidative stress in adipocytes. Am. J. Physiol. Endocrinol. Metab. 293, 159e164. Susztak, K., Raff, A.C., Schiffer, M., Bottinger, E.P., 2006. Glucose-induced reactive oxygen species cause apoptosis of podocytes and podocyte depletion at the onset of diabetic nephropathy. Diabetes 55, 225e233.
Tran, M., Tam, D., Bardia, A., Bhasin, M., Rowe, G.C., Kher, A., Zsengeller, Z.K., Akhavan-Sharif, M.R., Khankin, E.V., Saintgeniez, M., David, S., Burstein, D., Karumanchi, S.A., Stillman, I.E., Arany, Z., Parikh, S.M., 2011. PGC-1a promotes recovery after acute kidney injury during systemic inflammation in mice. J. Clin. Invest. 121, 4003e4014. Valle, I., Alvarez-Barrientos, A., Arza, E., Lamas, S., Monsalve, M., 2005. PGC-1a regulates the mitochondrial antioxidant defense system in vascular endothelial cells. Cardiovasc. Res. 66, 562e573. Venkatesan, B., Mahimainathan, L., Das, F., Ghosh-Choudhury, N., Ghosh Choudhury, G., 2007. Downregulation of catalase by reactive oxygen species via PI3 kinase/Akt signaling in mesangial cells. J. Cell. Physiol. 211, 457e467. Wu, L., Zhang, Y., Ma, X., Zhang, N., Qin, G., 2012. The effect of Resveratrol on FoxO1 expression in kidneys of diabetic nephropathy rats. Mol. Biol. Rep. 39, 9085e9093. Wu, L., Li, H., Jia, C.Y., Cheng, W., Yu, M., Peng, M., Zhu, Y., Zhao, Q., Dong, Y.W., Shao, K., Wu, A., Wu, X.Z., 2012. MicroRNA-223 regulates FOXO1 expression and cell proliferation. FEBS Lett. 586, 1038e1043. Xu, Z.G., Li, S.L., Lanting, L., Kim, Y.S., Shanmugam, N., Reddy, M.A., Natarajan, R., 2006. Relationship between 12/15-lipoxygenase and COX-2 in mesangial cells: potential role in diabetic nephropathy. Kidney Int. 69, 512e519. Yuan, Y., Huang, S., Wang, W., Wang, Y., Zhang, P., Zhu, C., Ding, G., Liu, B., Yang, T., Zhang, A., 2012. Activation of peroxisome proliferator-activated receptor-g coactivator 1a ameliorates mitochondrial dysfunction and protects podocytes from aldosterone-induced injury. Kidney Int. 82, 771e789.
Contents lists available at ScienceDirect
Molecular and Cellular Endocrinology journal homepage: www.elsevier.com/locate/mce
Activation of FoxO1/ PGC-1a prevents mitochondrial dysfunction and ameliorates mesangial cell injury in diabetic rats Lina Wu a, b, Qingzhu Wang a, Feng Guo a, Yingni Zhou a, b, Hongfei Ji a, b, Fei Liu a, Xiaojun Ma a, Yanyan Zhao a, Guijun Qin a, * a b
Division of Endocrinology, Department of Internal Medicine, The First Affiliated Hospital of Zhengzhou University, Zhengzhou 450052, China Institute of Clinical Medicine, The First Affiliated Hospital of Zhengzhou University, Zhengzhou 450052, China
a r t i c l e i n f o
a b s t r a c t
Article history: Received 30 November 2014 Received in revised form 18 May 2015 Accepted 4 June 2015 Available online 27 June 2015
The generation of hyperglycemia-induced mitochondrial reactive oxygen species (ROS) is a key event in diabetic nephropathy development. The forkhead-box class O1 (FoxO1) and peroxisome proliferatoractivated receptor g co-activator 1a (PGC-1a) proteins are implicated in oxidative stress. We investigated the in vivo association of FoxO1 and PGC-1a in renal cortices from streptozotocin-induced diabetic rats and in rat kidney mesangial cells (MCs) treated with high glucose, in vitro. High-glucose induced FoxO1 inhibition was associated with decreased PGC-1a expression in MCs. These changes were accompanied by mitochondrial dysfunction and increased ROS generation. However, constitutive FoxO1 activation increased PGC-1a expression and partially reversed these changes, which were significantly decreased by the treatment of PGC-1a-small interfering RNA. We identified PGC-1a as a direct FoxO1 transcriptional target by chromatin immunoprecipitation. In addition, lentiviral-mediated FoxO1 overexpression in diabetic-rat kidneys significantly increased PGC-1a, NRF-1, and Mfn2 expression, and decreased malondialdehyde production and proteinuria. These data suggest that FoxO1/PGC-1a activation protected rats against high-glucose-induced MC injury by attenuating mitochondrial dysfunction and cellular ROS production. © 2015 Elsevier Ireland Ltd. All rights reserved.
Keywords: Diabetic nephropathy Forkhead box class O1 Peroxisome proliferator-activated receptor g co-activator 1a Oxidative stress
1. Introduction Diabetic nephropathy (DN) is a major complication of both type 1 and type 2 diabetes mellitus and the most common cause of endstage renal disease. Multiple lines of evidence indicate that increased oxidant stress is a main pathophysiological factor leading to the development of DN (Brownlee, 2005; Forbes et al., 2008; Ha et al., 2008). It is now thought that the mitochondrial electrontransport system is a major source of reactive oxygen species (ROS) overproduction in diabetes and diabetes-associated complications (Susztak et al., 2006; Afanas'ev, 2010; Hall and Unwin,
Abbreviations: DN, diabetic nephropathy; FoxO1, forkhead-box class O1; HG, high glucose; MC, mesangial cell; MDA, malondialdehyde; Mfn2, mitofusin 2; NRF1, nuclear respiratory factor-1; PGC-1a, peroxisome proliferator-activated receptor g co-activator 1a; ROS, reactive oxygen species; STZ, streptozotocin. * Corresponding author. Division of Endocrinology, Department of Internal Medicine, The First Affiliated Hospital, Zhengzhou University, 40 Daxue Road, Zhengzhou 450052, China. E-mail address: [email protected] (G. Qin). http://dx.doi.org/10.1016/j.mce.2015.06.007 0303-7207/© 2015 Elsevier Ireland Ltd. All rights reserved.
2007) and that high glucose (HG) may induce excessive ROS production and mitochondrial dysfunction (Hsieh et al., 2002). Thus, the regulation of aberrant ROS levels may be a promising approach for treating DN. The peroxisome proliferator-activated receptor g co-activator 1a (PGC-1a) protein is a transcriptional coactivator identified as an upstream regulator of mitochondrial function and oxidative metabolism (Liang and Ward, 2006). PGC-1a is abundantly expressed in tissues and organs with high metabolic rates, such as brown adipose tissue, liver, skeletal muscles, and kidney (Rasbach and Schnellmann, 2007). PGC-1a overexpression in vascular endothelial cells reduced ROS accumulation, prevented mitochondrial dysfunction, and reduced apoptotic cell death occurring in response to high-glucose conditions (Valle et al., 2005). The increase in PGC-1a activity caused by silent mating type information regulation 2 homolog 1 (SIRT1) resulted in a robust induction of genes involved in mitochondrial functions and protection against ROS in both muscle and brown adipose tissue of mice fed a high-fat diet (Lagouge et al., 2006). Restored expression of the mitochondrial biogenesis factor PGC-1a promotes recovery after acute
2
L. Wu et al. / Molecular and Cellular Endocrinology 413 (2015) 1e12
kidney injury during systemic inflammation in mice (Tran et al., 2011). In addition, upregulation of PGC-1a by SIRT1 prevented aldosterone-induced mitochondrial malfunction and inhibited podocyte injury in vitro and in aldosterone-infused mice in vivo; endogenous PGC-1a may be important for maintaining mitochondrial function in podocytes under normal conditions (Yuan et al., 2012). Recently forkhead-box class O proteins (FoxOs) have been shown to function together with PGC-1a to regulate mitochondrial oxidative stress. FoxOs are key transcription factors that dominate the regulation of biological processes, including the cell cycle, cell death, differentiation, metabolism, apoptosis, and oxidative stress (Sedding, 2008; Essers et al., 2005). FoxOs stimulate PGC-1 promoter activity via interaction with insulin-response elements (IREs) in HepG2 cells (Daitoku et al., 2003). FOXO3a is a direct transcriptional regulator of a group of oxidation-protection genes and that this regulation requires PGC-1a, and FoxO3a/PGC-1a regulates the expression of genes associated with protection against oxidative stress in the vascular endothelium (Olmos et al., 2009). Notably, overexpression of the constitutively nuclear form of FoxO1 inhibited insulin-induced suppression of PGC-1a gene transcription, and mutations of 3 IREs abolish or blunt activity of the PGC-1a promoter (Hong et al., 2011). Furthermore, we showed recently that FoxO1 expression and activity significantly decreased in the kidneys of DN rats and in rat kidney MCs in response to high-glucose conditions (Wu et al., 2012a; Liu et al., 2014). However, the protective roles of FoxO1 and PGC-1a against oxidative stress in the kidneys during DN have not been characterized. In this study, we showed that FoxO1 can serve as a direct transcriptional regulator of oxidative stress-protection genes in rat kidney MCs. We also showed that FoxO1/PGC-1a activation protected against high glucose-induced MCs injury by preventing mitochondrial dysfunction and reducing the accumulation of ROS, both in vivo and in vitro. 2. Materials and methods 2.1. Reagents and antibodies Streptozotocin (STZ) was supplied by Sigma (Saint Louis, MO, USA). The following antibodies were used: rabbit anti-FoxO1 and anti-PGC-1a (Abcam, Cambridge, UK); rabbit anti-phospho-FoxO1 (Ser256, Cell Signaling Technology, Danvers, MA, USA); rabbit anti-NRF-1 and anti-Mfn2 (Santa Cruz Biotechnology, Santa Cruz, CA); rabbit anti-GAPDH and anti-b-actin (CWBIO, Beijing, PRC); and rabbit anti-Collagen IV and anti-Fibronectin (Bioss, Beijing, PRC). 2.2. Cell culture and lentiviral-vector infections The rat MC line HBZY-1 was obtained from the Cell Culture Centre of Institute of Biomedicine and Health (Guangzhou, PRC) and immediately expanded and frozen, such that fresh cells from the same batch could be thawed every 3e4 months from a frozen vial. The cells were cultured as previously described (Kolavennu et al., 2008). Briefly, the MCs were maintained in Dulbecco's modified Eagle's medium (Invitrogen, USA) supplemented with 10% fetal bovine serum (Gibco, USA) at 37 C in an atmosphere containing 5% CO2. The cells were treated with indicated concentrations of glucose. Lentiviral vectors expressing a constitutively active form of FoxO1 (CA-FoxO1), FoxO1-specific small interfering RNA (siRNA-FoxO1), or a siRNA against PGC-1a (siRNA-PGC-1a) (GenePharma Co., Shanghai, PRC) were introduced into cells via standard infections at a multiplicity of infection of 100 for 24 h. An empty lentiviral vector (LV-NC) (GenePharma Co., Shanghai, PRC) was used as a negative control.
2.3. Animal experiments Eight-week-old, male SpragueeDawley rats (220 ± 20 g) were purchased from the Experimental Animal Center of Henan Province. All animal studies were approved by the Animal Care and Use Committee of the First Affiliated Hospital of Zhengzhou University (No. 41003100001173) and fully complied with the university guidelines for the care and use of laboratory animals. All rats were maintained on a 12-h lightedark cycle in a temperature-controlled room (25 C). Diabetes was induced by a single intraperitoneal injection of 60 mg/kg STZ (dissolved in fresh 0.05 M citrate buffer, pH 4.5; Sigma, USA) after fasting for 12 h. Blood glucose was measured to validate the induction of diabetes (>16.7 mmol/L) at 72 h after STZ injection. Rats that received an injection of diluent buffer alone served as normal control group (NG, n ¼ 8). Diabetic rats were randomly divided into 3 groups: the diabetic group (DM, n ¼ 8), the diabetes with LV-CA-FoxO1 group (CA-FoxO1, n ¼ 8), and diabetes with LV-NC group (LV-NC, n ¼ 8). Diabetic rats were anesthetized by intraperitoneal injection of 10% chloral hydrate (4 mL/kg) after fasting for 12 h. During surgery, a 1e2-cm-long incision was made at a costal spinal angle in the right back to expose the right kidney of rats, followed by the injection of 100 mL LV-CA-FoxO1 or LV-NC into the renal cortex at several sites, whereas rats in the DM group were injected with an equal volume of saline. Then muscle and skin were sutured. At 8 weeks postinjection, a 24-h urine sample from each rat was collected for the determination of 24-h urinary protein and urinary albumin quantities. Subsequently, the rats were anesthetized with pentobarbital sodium (50 mg/kg body wt), and blood was collected from the orbital vein for blood glucose, serum creatinine, and blood urea nitrogen measurements. Kidney weight/body weight ratios were measured after sacrifice. The renal cortex at the injection site was cut into small pieces (1 mm3) and fixed in 4% pre-cooling glutaraldehyde in preparation for electron-microscopy examination. Cortices were fixed in 4% paraformaldehyde for hematoxylin and eosin staining and immunohistochemistry. The remaining kidney cortex was removed as described (Xu et al., 2006) and rapidly preserved in liquid nitrogen for subsequent experiments. 2.4. Reverse-transcriptase quantitative PCR (RT-qPCR) analysis Total RNA from cultured MCs and renal cortices was extracted using the Trizol Reagent (TaKaRa Bio, Shiga, Japan) according to the manufacturer's instructions and reverse-transcribed into cDNA using the cDNA Synthesis Kit (TOYOBO, Japan). The cDNAs were then quantified by real-time PCR using the ABI 7500FAST System (Foster City, CA), the KOD SYBR Green qPCR Mix Kit (TOYOBO, Japan), and appropriate primers. Relative gene expression levels were normalized to GAPDH expression. Primers were obtained from Sangon Biotech Co., Ltd. (Shanghai, PRC), and all primer information is shown in Table 1. The PCR amplification conditions used were 98 C for 2 min, followed by 40 cycles of 98 C for 10 s, 60 C for 10 s, and 68 C for 30 s. 2.5. Western blot analysis Total protein in MCs and renal cortical tissues was extracted with a protein extraction reagent (Thermo, USA), according to the manufacturer's instructions. Western blotting was performed as described previously (Puthanveetil et al., 2010). The primary antibodies used were: anti-FoxO1 (1:1000), anti-phospho-FoxO1 (1:750), anti-PGC-1a (1:1000), anti-NRF-1 (1:250), anti-Mfn2 (1:200), anti-GAPDH (1:1000) and anti-b-actin (1:1000). After incubation with an appropriate secondary antibody, the western blots were visualized using the ECL Western Blotting Substrate
L. Wu et al. / Molecular and Cellular Endocrinology 413 (2015) 1e12
3
Table 1 Sequences of primers used for quantitative RT-PCR analysis. Gene symbol
Forward primer (50 e30 )
Reverse primer (50 e30 )
Product length
FoxO1 PGC-1a NRF-1 Mfn2 GAPDH
CAGCAAATCAAGTTATGGAGGA TGGAGCAATAAAGCAAAGAGC TTGATGGACACTTGGGTAGC GACTGGATTGTGCCGATGAC GCCACTCAGAAGACTCTGGA
TATCATTGTGGGGAGGAGAGTC GTGTGAGGAGGGTCATCGTT GCCAGAAGGACTGAAAGCAG CAGAAGAGGAGGAGGCTTGA GTTCAGCTCTGGGATGACCT
95 bp 104 bp 108 bp 100 bp 129 bp
(Thermo Scientific, USA). Relative protein levels were quantitated using Gel-Pro Analyzer 4.0 software. 2.6. Immunofluorescence analysis Immunofluorescence staining was performed as described previously (Wu et al., 2012b). Briefly, MCs were seeded into chamber slides and incubated for 24 h. The MCs were then fixed in 4% paraformaldehyde solution for 20 min, permeabilized with 0.25% Triton X-100 for 15 min, and blocked with 1% BSA for 30 min, with each step performed at room temperature. After incubation with an anti-FoxO1 antibody (diluted 1:250) or an anti-PGC-1a antibody (diluted 1:300) at 4 C overnight, the MCs were incubated for 1 h at room temperature with a Cy3-labeled secondary antibody (diluted 1:500) and stained with DAPI for 2 min. The distribution and subcellular localization of target proteins were examined under an IX71 fluorescent microscope (Olympus, Japan). Densitometric analysis was performed using Image Pro Plus software, version 6.0.
dichlorofluorescein diacetate (DCFH-DA) (Beyotime, PRC) as described previously (Guo et al., 2010). Briefly, the cells were trypsinized, resuspended, and incubated at 37 C for 20 min with DCFH-DA at a final concentration of 10 mmol/L. Fluorescence intensities were analyzed by flow cytometry using excitation/emission wavelengths of 488/525 nm, respectively. 2.10. Measurement of malondialdehyde (MDA) concentrations Renal cortex MDA levels were quantified using the Lipid Peroxidation MDA Assay Kit (Beyotime Institute of Biotechnology, Jiangsu, PRC), according to the manufacturer's protocol and as described in our previous report (Wu et al., 2012a). 2.11. Immunohistochemistry Paraffin sections of rat kidneys were prepared by a conventional method and treated as we described previously (Wu et al., 2012a). The working concentrations of the anti-Collagen IV and antiFibronectin antibodies were 1:100 and 1:200, respectively.
2.7. Chromatin immunoprecipitation assays 2.12. Light and electron microscopy Chromatin immunoprecipitation assays were conducted using EZ-ChIP kit (Millipore, USA) according to the manufacturer's instructions. Chromatin immunoprecipitation was performed as described previously (Lin et al., 2012). The MCs were infected with the empty-vector lentivirus (LV-NC) or the constitutively active FoxO1 (CA-FoxO1) lentivirus under a HG condition (25 mM glucose). After treatment, cells were fixed in formaldehyde for 10 min at room temperature, after which they were lysed and sonicated. Soluble chromatin was co-immunoprecipitated with a polyclonal FoxO1 antibody (Abcam, Cambridge, UK) or an isotypematched IgG (negative control). De-cross-linked DNA samples were subjected to PCR amplification using a forward primer (50 -AGCCTATGAGAGCCATGGAA-30 ) and a reverse primer (50 -GGTCAACCAAACAGCCTCAT-30 ), which target the rat PGC-1a promoter in the region containing IREs. Precipitated DNA fragments were analyzed by qPCR. In addition, the PCR products were analyzed by electrophoresis in a 4% agarose gel. The activities of the PGC-1a promoter were averaged from the values obtained with 3 independent replicates.
Kidney pathology in hematoxylin and eosin-stained sections was examined by light microscopy. Renal cortices of kidneys were cut into small pieces (1 mm3) and treated as described in our previous report (Wu et al., 2012a). The ultrastructure of renal cortex tissue was observed with an H-7500 transmission electron microscope (Hitachi, Japan). 2.13. Statistics Data were analyzed with SPSS software, version 18.0 (IBM, Endicott, NY, USA). All data are presented as the mean ± S.E. Comparisons among more than 2 groups were assessed with 1-way analysis of variance, followed by Bonferroni's test, and p < 0.05 was considered to be statistically significant. 3. Results 3.1. HG inhibited FoxO1 activity, and FoxO1 overexpression reversed HG-dependent PGC-1a downregulation in HG-treated MCs
2.8. Mitochondrial membrane potential The mitochondrial membrane potential of MCs was monitored using JC-1. Briefly, cells were trypsinized, resuspended, and incubated in the dark with JC-1 for 20 min at 37 C. The cells were then washed with JC-1 washing buffer, and the fluorescence was viewed with an IX71 fluorescent microscope. The relative mitochondrial membrane potential was calculated using the ratios of red/green fluorescence densities. 2.9. Measurement of intracellular ROS Intracellular ROS production was measured using 20 ,70 -
FoxO1 and PGC-1a serve important roles in regulating oxidative stress. To verify the relationship between FoxO1 activity and PGC1a expression in MCs, we analyzed the expression of FoxO1 and PGC-1a stimulation with HG (25 mM glucose) in cultured MCs. Although FoxO1 expression did not differ in MCs from the NG and HG groups (Fig. 1A), the p-FoxO1/total-FoxO1 ratio under the HG condition significantly increased compared to that observed following incubation with 5.6 mM glucose (Fig. 1B). Similarly, the mRNA and protein levels of PGC-1a were significantly decreased in HG-treated MCs compared with control cells (Fig. 1C and D). To determine the effect of FoxO1 on PGC-1a expression, constitutively active FoxO1 or siRNA-FoxO1 (encoded by
4
L. Wu et al. / Molecular and Cellular Endocrinology 413 (2015) 1e12
Fig. 1. Effects of FoxO1 on PGC-1a expression in rat kidney mesangial cells (MCs). (A, C) FoxO1 and PGC-1a mRNA were detected by RT-qPCR analysis of total RNA. GAPDH was used as a negative control. MCs were infected with a lentiviral vector expressing constitutively active FoxO1 (CA-FoxO1) or small interfering RNA against FoxO1 (siRNA-FoxO1), under a high-glucose (HG; 25 mM glucose) or normal glucose (NG; 5.6 mM) condition, respectively. Cells infected with an empty-vector lentivirus were used as a positive control (data not shown). (B) FoxO1 and p-FoxO1 were detected by western blot analysis. Left: representative immunoblots. Right: ratio of the p-FoxO1/total FoxO1 as determined by densitometric analysis. (D) PGC-1a protein expression detected by western blot analysis. Left: representative immunoblots. Right: densitometric analysis. (E) Immunofluorescence detection of FoxO1 and PGC-1a in MCs (400). (F) Quantitative analysis based on FoxO1 and PGC-1a fluorescence intensities. Data are presented as the mean ± S.E. (n ¼ 3). *p < 0.05 vs. NG; # p < 0.05 vs. HG.
lentiviral vectors) was introduced into the MCs. As shown in Fig. 1A and B, CA-FoxO1 overexpression increased the levels of FoxO1 mRNA and nuclear FoxO1 protein. Importantly, HG-
induced down-regulation of PGC-1a was reversed when MCs were infected with a CA-FoxO1 lentiviral vector (Fig. 1C and D). In contrast, downregulation of FoxO1 by siRNA-FoxO1
L. Wu et al. / Molecular and Cellular Endocrinology 413 (2015) 1e12
5
Fig. 2. FoxO1 binds the regulatory region of the PGC-1a gene and reduces mitochondrial dysfunction via upregulated PGC-1a expression. (A, B) Chromatin immunoprecipitation assays showing FoxO1 binding to the promoter region of PGC-1a in rat kidney mesangial cells (MCs). Rat-kidney mesangial cells were infected with the empty-vector lentivirus (LVNC) or the constitutively active FoxO1 lentivirus (CA-FoxO1) under a high-glucose (HG) condition (25 mM glucose). Soluble chromatin was immunoprecipitated with antibodies against FoxO1. The DNA fragments were analyzed by qPCR (A), or amplified by PCR and visualized in agarose gels (B). The results shown are representative of 3 independent experiments. (C, D) PGC-1a protein expression detected by western blotting. Left: representative immunoblots. Right: densitometric analysis. (E, F) NRF-1 and Mfn2 proteins were detected by western blotting. Left: representative immunoblots. Right: densitometric analysis. Data are presented as the mean ± S.E. (n ¼ 3).
6
L. Wu et al. / Molecular and Cellular Endocrinology 413 (2015) 1e12
Fig. 3. FoxO1 overexpression prevents the high-glucose-dependent decrease in expression of the mitochondrial-related transcription factor (NRF-1) and mitochondrial fusion protein (Mfn2). FoxO1 downregulation promoted the high glucose-dependent decrease in Mfn2 and NRF-1 levels in rat kidney mesangial cells. (A, B) Real-time qPCR analysis of NRF-1 and Mfn2 expression in rat kidney mesangial cells infected with an empty-vector lentivirus (LV-NC), a constitutively active FoxO1 lentivirus (CA-FoxO1), or a small interfering RNA-FoxO1 lentivirus (siRNA-FoxO1) under a high-glucose (HG) condition (25 mM glucose). GAPDH was used as a negative control. (C, D) The NRF-1 and Mfn2 proteins were detected by western blotting. Left: representative immunoblots. Right: densitometric analysis. Data are presented as the mean ± S.E. (n ¼ 3). *p < 0.05 vs. NG; #p < 0.05 vs. HG.
decreased the mRNA and protein levels of PGC-1a, compared with the NG group (Fig. 1C and D). We also detected the FoxO1 and PGC-1a proteins in MCs by immunofluorescence. A notable decrease of FoxO1 nuclear translocation was observed in MCs exposed to HG. FoxO1 nuclear translocation increased following CA-FoxO1 overexpression. Infection with the siRNA-FoxO1 lentiviral vector caused an opposite effect. Similar to PGC-1a mRNA and protein expression, the increased effect by CA-FoxO1 and inhibitory effect by HG or siRNA-FoxO1 were also reflected in MCs, as assessed by immunofluorescence microscopy (Fig. 1E and F). Taken together, these observations indicated that FoxO1 overexpression prevented the HG-induced downregulation of
PGC-1a levels in HG-treated MCs. 3.2. FoxO1 bound to the PGC-1a promoter in vitro To determine the potential role of FoxO1 in PGC-1a gene transcription in rat kidney MCs, the interaction between FoxO1 and the PGC-1a prompter element was examined by chromatin immunoprecipitation assays, using an antibody specific for FoxO1. As shown in Fig. 2A and B, we found that FoxO1 bound to the PGC-1a promoter region in MCs, and HG strongly suppressed this binding. In addition, FoxO1 recruitment to the PGC-1a promoter was significantly increased in MCs infected with CA-FoxO1 but not with the
L. Wu et al. / Molecular and Cellular Endocrinology 413 (2015) 1e12
empty-vector lentivirus under the HG (25 mM glucose) condition. These data showed that FoxO1 could induce PGC-1a expression. 3.3. FoxO1 overexpression prevented HG-induced mitochondrial dysfunction in MCs To verify the effect of FoxO1 on mitochondrial biogenesis, we measured the levels of PGC-1a, NRF-1, Mfn2, and mitochondrial membrane potential. siRNA-PGC-1a and HG treatment decreased PGC-1a expression, as determined by western blot analysis (Fig. 2C and D). However, the effect of HG was reversed by FoxO1 overexpression. In contrast, the effect of FoxO1 was largely decreased when HG-treated MCs were infected with the CA-FoxO1 and siRNA-PGC-1a lentiviral vectors (Fig. 2C and D). As shown in Fig. 3A and B, a marked decrease in the mRNA levels of NRF-1 and Mfn2 was observed in the HG group compared with the NG group. In agreement, the protein levels of NRF-1 and Mfn2 were significantly decreased in HG-treated MCs compared to that observed following incubation with 5.6 mM glucose (Fig. 3C and D). As expected, FoxO1 overexpression suppressed the HG-dependent
7
downregulation of NRF-1 and Mfn2, at both the mRNA and protein levels (Fig. 3). In addition, downregulation of FoxO1 by siRNAFoxO1 decreased the levels of NRF-1 and Mfn2, compared with HG group (Fig. 3). In contrast, when HG-treated MCs were infected with both the CA-FoxO1 and PGC-1a siRNA lentiviral vectors, the effect of FoxO1 on mitochondrial biogenesis was largely reduced (Fig. 2E and F). As shown in Fig. 4A and B, the JC-1 fluorescence detected by fluorescence microscopy showed a decrease in red fluorescence accumulated in the mitochondria and an increase in green fluorescence distributed in the cytoplasm in MCs incubated with 25 mM glucose, suggesting that HG treatment reduced the mitochondrial membrane potential. In contrast, FoxO1 overexpression resulted in an apparent increase in the mitochondrial membrane potential, when compared to that observed following incubation with 25 mM glucose. However, siRNA-FoxO1 overexpression promoted a HG-dependent reduction of the mitochondrial membrane potential. In contrast, the effect of FoxO1 was largely decreased when HG-treated MCs were infected with the CA-FoxO1 and siRNA-PGC-1a lentiviral vectors (Fig. 4A and B). Together, these
Fig. 4. Effect of FoxO1 on the high-glucose-dependent reduction of mitochondrial membrane potential and cellular ROS accumulation. Rat kidney mesangial cells were infected with an empty-vector lentivirus (LV-NC), a constitutively active FoxO1 lentivirus (CA-FoxO1), a small interfering RNA-FoxO1 lentivirus (siRNA-FoxO1), or a small interfering RNAPGC-1a lentivirus (siRNA-PGC-1a) under a high-glucose (HG) condition (25 mM glucose). (A, B) Cells seeded into 6-well plates were treated for 24 h, as indicated. The cells were then co-incubated with the fluorescence probe JC-1 for 20 min at 37 C, images (400) were scanned with a fluorescent microscope, and red/green fluorescence-intensity values were calculated. (C) Intracellular ROS production was quantified by flow cytometry analysis, using DCFH-DA. Data are presented as the mean ± S.E (n ¼ 3). *p < 0.05 vs. NG; #p < 0.05 vs. HG; &p < 0.05 vs. CA-FoxO1. (For interpretation of the references to colour in this figure legend, the reader is referred to the web version of this article.)
8
L. Wu et al. / Molecular and Cellular Endocrinology 413 (2015) 1e12
results supported a model whereby FoxO1 overexpression can prevent mitochondrial dysfunction via PGC-1a upregulation under stress conditions.
3.4. Overexpression of FoxO1 protected MCs by reduced the accumulation of ROS To establish whether FoxO1-induced upregulation of PGC-1a can increase the cellular detoxification capacity, we measured cellular ROS production. ROS production was increased in MCs induced by HG compared to that observed in the NG group (Fig. 4C). There was no statistical difference in cellular ROS levels between the HG and LV-NC groups, indicating that the LV-NC vector did not affect ROS production. ROS generation in FoxO1-overexpressing MCs infected with the CA-FoxO1 dramatically decreased compared with MCs infected with LV-NC. In contrast, ROS generation in FoxO1 low-expressing MCs infected with siRNA-FoxO1 was significantly increased compared with MCs infected with LV-NC. In addition, the effect of FoxO1 was largely decreased when HGtreated MCs were infected with the CA-FoxO1 and siRNA-PGC-1a lentiviral vectors. Taken together, these results demonstrated that upregulation (or downregulation) of FoxO1 inhibited (or promoted) the HG-induced accumulation of cellular ROS.
3.5. FoxO1 overexpression protected mitochondrial function in the kidney cortices of STZ-induced rats and ameliorated DN progression in vivo Based on our data in vitro, we sought in vivo support of the protective effects of FoxO1 and PGC-1a in the kidney during DN by studying STZ-induced rats treated with constitutively active FoxO1. FoxO1 expression and activity in the kidney cortices of CA-FoxO1treated rats were marked increased at 8 weeks following CAFoxO1 administration (Fig. 5A, C, and D). We found that the levels of blood glucose; the ratios of kidney weight/body weight; and the 24-h urinary protein, urinary albumin, serum creatinine, and blood urea nitrogen levels significantly increased in the diabetic rats, compared to that observed in normal rats. FoxO1 overexpression significantly decreased the levels of biological parameters at the end of the eighth week in comparison to diabetic rats. However, FoxO1 overexpression failed to decrease blood glucose (Table 2). We then examined the effect of FoxO1 treatment on mitochondrial morphology. As shown in Fig. 6A, FoxO1 treatment in STZ-induced diabetic rats reduced mitochondrial swelling compared with that observed in STZ-induced diabetic rats without FoxO1 treatment. We also examined the kidneys of these rats histopathologically. Hematoxylin and eosin staining revealed a larger volume of renal glomeruli, expanded mesangial cells, and a thickening of the glomerular basement membrane in the kidneys of diabetic rats. Conversely, renal pathology was ameliorated in rats from the CA-FoxO1 group (Fig. 6B). Moreover, by electron
Fig. 5. Effect of FoxO1 on PGC-1a expression in the renal cortices of STZ-induced rats. (A, B) Real-time RT-PCR analysis of FoxO1 and PGC-1a mRNA levels. GAPDH was used as a negative control. (C, D) FoxO1 and p-FoxO1 were detected by western blot analysis. Left: representative immunoblots. Right: ratio of p-FoxO1/total FoxO1 expression, as determined by densitometric analysis. (E, F) PGC-1a protein detection by western blotting. Left: representative immunoblots. Right: densitometric analysis. Data are displayed as the mean ± S.E (n ¼ 3). *p < 0.05 vs. NG; #p < 0.05 vs. DM.
L. Wu et al. / Molecular and Cellular Endocrinology 413 (2015) 1e12
9
Table 2 Biological parameters of the study groups. Characteristic
NG
Blood glucose (mM) Kidney weight/body weight ( 103) 24-h urinary protein (mg/24 h) Urinary albumin (mg/24 h) Serum creatinine (mM) Blood urea nitrogen (mmol/L)
5.5 3.1 6.6 0.34 46.6 6.0
DM ± ± ± ± ± ±
0.3 0.1 0.7 0.03 2.0 0.3
26.8 8.0 28.1 0.91 82.1 18.5
CA-FoxO1 ± ± ± ± ± ±
1.7* 0.3* 1.2* 0.03* 2.8* 0.4*
25.9 5.2 16.5 0.66 56.9 13.6
± ± ± ± ± ±
1.8* 0.2*# 0.7*# 0.03*# 1.8*# 0.6*#
LV-NC 26.1 7.9 27.5 0.90 81.3 18.5
± ± ± ± ± ±
1.7 0.3 1.4 0.03 3.2 0.4
Data are expressed as the mean ± S.E. NG, normal control group; DM, diabetic group; CA-FoxO1, diabetic-rat group administered a lentiviral vector expressing constitutively active FoxO1; LV-NC, diabetic-rat group administered an empty-vector lentivirus. *p < 0.05 vs. NG; #p < 0.05 vs. DM.
microscopy, we found that podocytes were seriously injured in diabetic rats. In contrast, FoxO1 overexpression, to some degree, promoted the recovery of injured podocytes (Fig. 6C). These results indicate that the in vivo upregulation of FoxO1 can ameliorate kidney pathology in diabetic rats. Next, we examined the effect of CA-FoxO1 treatment on PGC-1a expression in the kidney cortices of diabetic rats. Importantly, RTqPCR and western blot analysis showed PGC-1a up-regulation in the kidney cortices of CA-FoxO1-treated diabetic rats (Fig. 5B, E, and
F). To further validate the protective effects of FoxO1/PGC-1a on mitochondrial biogenesis, we examined the expression levels of NRF-1 and Mfn2 by comparing kidneys from CA-FoxO1-treated diabetic rats with untreated diabetic rats. Consistent with our in vitro results, both the mRNA and protein levels of NRF-1 and Mfn2 were significantly induced by CA-FoxO1 treatment (Fig. 7B and C). These results demonstrated the therapeutic efficacy of FoxO1/PGC-1a expression in the kidneys of diabetic rats in vivo and suggest that in vivo FoxO1 up-regulation led to increased PGC-1a
Fig. 6. Effect of FoxO1 on mitochondrial morphology in glomerular podocytes and on renal morphology in kidneys from STZ-induced rats. (A) Ultrastructure of glomerular podocytes as viewed by transmission electron microscopy (20,000). (B) Hematoxylin and eosin staining of rat glomeruli (400). (C) Kidney ultrastructure as viewed by transmission electron microscopy (20,000).
10
L. Wu et al. / Molecular and Cellular Endocrinology 413 (2015) 1e12
Fig. 7. Oxidative stress, NRF-1 and Mfn2 levels, and expression of Col IV and FN in the renal cortices of normal control rats and diabetic rats, with or without CA-FoxO1. (A) Analysis of MDA generation. (B) Real-time RT-PCR analysis of NRF-1 and Mfn2 mRNA levels. GAPDH was used as a negative control. (C) Western blot analysis of NRF-1 and Mfn2 protein expression. Left: representative immunoblots. Right: densitometric analysis. (D) Immunohistochemical staining. (E) Densitometry analysis of Col IV and FN expression. Data are displayed as the mean ± S.E (n ¼ 3). *p < 0.05 vs. NG; #p < 0.05 vs. DM.
expression and attenuated mitochondrial dysfunction, consistent with our in vitro findings. To test the effect of FoxO1/PGC-1a overexpression on oxidative stress and extracellular matrix protein expression in the kidneys of diabetic rats, we assessed the expression of MDA, the associated extracellular matrix collagen IV, and fibronectin in their kidney cortices. We observed that MDA generation significantly decreased in CA-FoxO1-treated rats compared with diabetic rats (Fig. 7A). Similarly, immunohistochemistry results showed that collagen IV and fibronectin expression in the kidney cortices significantly decreased in diabetic rats treated with CA-FoxO1 (Fig. 7D and E). 4. Discussion Oxidative stress is increased in diabetes, and ROS production may contribute to the development of diabetes complications, such as DN. However, the understanding of the mechanisms that protect cells against oxidative stress remains elusive. FoxO1 proteins are involved in several pathways responsible for cell metabolism, the onset of diabetes mellitus, and diabetic complications (Maiese et al., 2008). Previously, we proposed that HG significant inhibits FoxO1
activity, leading to increased ROS generation in the kidneys of diabetic rats (Wu et al., 2012a). In this study, we confirmed that forced FoxO1 activation by infection with lentiviral vectors inhibited HG-induced mitochondrial dysfunction and intracellular ROS production. Secondly, increased FoxO1 activity suppressed HGdependent PGC-1a downregulation. We also found that FoxO1 bound to the PGC-1a promoter in rat kidney MCs. Furthermore, our results demonstrated the therapeutic efficacy of FoxO1/PGC-1a modulation in the kidneys of STZ-induced diabetic rats. As DN development is characterized by enhanced ROS generation, protecting cells against oxidative stress is critical. It is notable that FoxO factors have been implicated in ROS homeostasis. For example, it was found that an excess flux of fatty acids in adipocytes increased mitochondrial ROS production; decreased the levels of FoxO1 and oxygen-radical scavengers, such as MnSOD and glutathione peroxidase; and that increased FoxO1 levels by resveratrol treatment protected cells from fatty acids induced ROS formation (Subauste and Burant, 2007). H2O2 inhibited catalase protein expression in MCs through phosphorylation and inactivation of FoxO1 causing a reduced transcriptional response, and constitutively active FoxO1 increased catalase expression (Venkatesan et al.,
L. Wu et al. / Molecular and Cellular Endocrinology 413 (2015) 1e12
2007). Given the versatile and pleiotropic nature of the FoxO-family regulatory circuit, it is possible that FoxO1 expression is a tissuespecific regulator relevant to diabetes. In the present study, we showed that HG caused an increase in oxidative stress in MCs. This change was associated with decreased FoxO1 activity in vitro, which was also seen in vivo in STZ-induced diabetic rats, in agreement with results from our previous studies (Wu et al., 2012a; Liu et al., 2014). Furthermore, our findings here demonstrated that FoxO1 overexpression protected against the HG-induced accumulation of ROS, both in cultured MCs and in the kidneys of STZinduced diabetic rats. In contrast, FoxO1 downregulation increased the HG-induced accumulation of cellular ROS. Collectively, these data indicate that FoxO1 expression is essential for counteracting oxidative stress under HG conditions. It is known that the most important sources of ROS under hyperglycemic conditions are the mitochondria and NADPH oxidases (Afanas'ev, 2010). HG-stimulated generation of mitochondrial superoxide led to mitochondrial injury in renal proximal tubular cells (Munusamy and MacMillan-Crow, 2009). PGC-1a can regulate mitochondrial biogenesis and the oxidative stress-protection system in various cell types. PGC-1a up-regulation in vascular endothelial cells increased the cellular capacity for detoxifying mitochondrial ROS and preventing endothelial dysfunction and apoptotic cell death under oxidative-stress conditions, such as HG (Valle et al., 2005). PGC-1a upregulation conferred increased resistance to oxidative stress and protected mitochondrial function through an increase in the mitochondrial membrane potential in mouse fibroblasts (Anderson et al., 2008). In agreement with these findings, our data showed that HG-treatment inhibited PGC-1a expression, resulting in mitochondrial dysfunction, as demonstrated by a decrease in mitochondrial membrane potential and NRF-1 and Mfn2 expression in rat MCs, which was also seen in vivo in the kidneys of STZ-induced diabetic rats. Some investigators have speculated that FoxO transcription factors can induce PGC-1a expression and stimulate PGC-1a promoter activity via interactions with IRSs. It has been shown previously that FoxO3a is a direct transcriptional regulator of a group of oxidative-stress protection genes and that this regulation requires PGC-1a. FoxO3a and PGC-1a interact directly, and their interaction regulates mitochondrial oxidative stress (Olmos et al., 2009). Insulin-dependent PGC-1a suppression was neutralized by the overexpression of a constitutively nuclear form of FoxO1, and the activation of the PGC-1a promoter required FoxO1-mediated activities (Hong et al., 2011). The results of our study showed that FoxO1 could interact with IRSs within the PGC-1a promoter in rat kidney MCs. In addition, FoxO1 overexpression prevented HGinduced reduction of PGC-1a and mitochondrial dysfunction, and knockdown of PGC-1a reversed the effect. However, downregulating FoxO1 levels with a siRNA caused decreased PGC-1a expression and aggravated mitochondrial dysfunction. Thus, the low FoxO activity observed under oxidative stress signaling may contribute to PGC-1a suppression during HG states. Notably, we also observed that pathological changes in kidneys were improved in diabetic rats treated with CA-FoxO1. For example, the 24-h urinary protein, urine albumin, serum creatinine, and blood urea nitrogen levels were significantly decreased, and podocyte injury was reversed to some degree. In addition, diabetic rats with FoxO1 overexpression demonstrated a decrease in the MDA, collagen IV, and fibronectin content levels in the kidney. Our results showed protective effects of FoxO1/PGC-1a on mitochondrial function and the kidneys of diabetic rats. Maiese et al. (Maiese et al., 2008) reported that targeting FoxO proteins may be a viable approach worthy of consideration for the development of novel therapeutic strategies. Given that the FoxO1 and PGC-1a transcription factors are required for maintaining the balance of oxidative stress and that
11
FoxO serves a role in nephropathy (Kato et al., 2006), our results demonstrate that modulating the FoxO/PGC-1a pathway may have therapeutic utility in treating DN. In conclusion, our findings demonstrated that FoxO1 suppression resulted in mitochondrial dysfunction and MC injury. In contrast, overexpression of FoxO1 increased PGC-1a expression and prevented mitochondrial dysfunction and MC injury. These findings indicate that novel agonists of FoxO1 and/or PGC-1a may be useful therapeutically for treating DN. Conflicts of interest All authors declare that there is no conflict of interest associated with this manuscript. Acknowledgements This work was supported by grants from the National Natural Science Foundation of China (Grant No. 81400800 to X. Ma) and the Innovation Scientists and Technicians Troop Construction Projects of Henan Province (Grant No. 134200510021 to G. Qin). The authors appreciate the generous assistance from the Institute of Clinical Medicine (The First Affiliated Hospital of Zhengzhou University, Zhengzhou, China) in providing the necessary facilities, and from Jun Ouyang and Jinfa Li from the endocrinology laboratory of The First Affiliated Hospital of Zhengzhou University. References Afanas'ev, Igor, 2010. Signaling of reactive oxygen and nitrogen species in diabetes mellitus. Oxid. Med. Cell. Longev. 3, 361e373. Anderson, R.M., Barger, J.L., Edwards, M.G., Braun, K.H., O'Connor, C.E., Prolla, T.A., Weindruch, R., 2008. Dynamic regulation of PGC-1alpha localization and turnover implicates mitochondrial adaptation in calorie restriction and the stress response. Aging Cell 7, 101e111. Brownlee, M., 2005. The pathobiology of diabetic complications: a unifying mechanism. Diabetes 54, 1615e1625. Daitoku, H., Yamagata, K., Matsuzaki, H., Hatta, M., Fukamizu, A., 2003. Regulation of PGC-1 promoter activity by protein kinase B and the forkhead transcription factor FKHR. Diabetes 52, 642e649. Essers, M.A., de Vries-Smits, L.M., Barker, N., Polderman, P.E., Burgering, B.M., Korswagen, H.C., 2005. Functional interaction between beta-catenin and FOXO in oxidative stress signaling. Science 308, 1181e1184. Forbes, J.M., Coughlan, M.T., Cooper, M.E., 2008. Oxidative stress as a major culprit in kidney disease in diabetes. Diabetes 57, 1446e1454. Guo, W.J., Ye, S.S., Cao, N., Huang, J., Gao, J., Chen, Q.Y., 2010. ROS-mediated autophagy was involved in cancer cell death induced by novel copper(II) complex. Exp. Toxicol. Pathol. 62, 577e582. Ha, H., Hwang, I.A., Park, J.H., Lee, H.B., 2008. Role of reactive oxygen species in the pathogenesis of diabetic nephropathy. Diabetes Res. Clin. Pract. 13, S42eS45. Hall, A.M., Unwin, R.J., 2007. The not so “mighty chondrion”: emergence of renal diseases due to mitochondrial dysfunction. Nephron Physiol. 105, 1e10. Hong, T., Ning, J., Yang, X., Liu, H.Y., Han, J., Liu, Z., Cao, W., 2011. Fine-tuned regulation of the PGC-1a gene transcription by different intracellular signaling pathways. Am. J. Physiol. Endocrinol. Metab. 300, E500eE507. Hsieh, T.J., Zhang, S.L., Filep, J.G., Tang, S.S., Ingelfinger, J.R., Chan, J.S., 2002. High glucose stimulates angiotensinogen gene expression via reactive oxygen species generation in rat kidney proximal tubular cells. Endocrinology 143, 2975e2985. Kato, M., Yuan, H., Xu, Z.G., Lanting, L., Li, S.L., Wang, M., Hu, M.C., Reddy, M.A., Natarajan, R., 2006. Role of the Akt/FoxO3a pathway in TGF-b1emediated mesangial cell dysfunction: a novel mechanism related to diabetic kidney disease. J. Am. Soc. Nephrol. 17, 3325e3335. Kolavennu, V., Zeng, L., Peng, H., Wang, Y., Danesh, F.R., 2008. Targeting of RhoA/ ROCK signaling ameliorates progression of diabetic nephropathy independent of glucose control. Diabetes 57, 714e723. Lagouge, M., Argmann, C., Gerhart-Hines, Z., Meziane, H., Lerin, C., Daussin, F., Messadeq, N., Milne, J., Lambert, P., Elliott, P., Geny, B., Laakso, M., Puigserver, P., Auwerx, J., 2006. Resveratrol improves mitochondrial function and protects against metabolic disease by activating SIRT1 and PGC-1a. Cell 127, 1109e1122. Liang, H., Ward, W.F., 2006. PGC-1 alpha: a key regulator of energy metabolism. Adv. Physiol. Educ. 30, 145e151. Lin, H.Y., Yin, Y., Zhang, J.X., Xuan, H., Zheng, Y., Zhan, S.S., Zhu, Y.X., Han, X., 2012. Identification of direct forkhead box O1 targets involved in palmitate-induced apo-ptosis in clonal insulin-secretingcells using chromatin immunoprecipitation coupled to DNA selection and ligation. Diabetologia 55, 2703e2712. Liu, F., Ma, X.J., Wang, Q.Z., Zhao, Y.Y., Wu, L.N., Qin, G.J., 2014. The effect of FoxO1 on
12
L. Wu et al. / Molecular and Cellular Endocrinology 413 (2015) 1e12
the proliferation of rat mesangial cells in high glucose condition. Nephrol. Dial. Transpl. 29, 1879e1887. Maiese, K., Chong, Z.Z., Shang, Y.C., 2008. OutFOXOing disease and disability: the therapeutic potential of targeting FoxO proteins. Trends Mol. Med. 14, 219e227. Munusamy, S., MacMillan-Crow, L.A., 2009. Mitochondrial superoxide plays a crucial role in the development of mitochondrial dysfunction during high glucose exposure in rat renal proximal tubular cells. Free Radic. Biol. Med. 46, 1149e1157. Olmos, Y., Valle, I., Borniquel, S., Tierrez, A., Soria, E., Lamas, S., Monsalve, M., 2009. Mutual dependence of Foxo3a and PGC-1 alpha in the induction of oxidative stress genes. J. Biol. Chem. 284, 14476e14484. Puthanveetil, P., Wang, Y., Wang, F., Kim, M.S., Abrahani, A., Rodrigues, B., Rodrigues, B., 2010. The increase in cardiac pyruvate dehydrogenase kinase-4 after short-term dexamethasone is controlled by an Akt-p38-forkhead box other factor-1 signaling axis. Endocrinology 151, 2306e2318. Rasbach, K.A., Schnellmann, R.G., 2007. Signaling of mitochondrial biogenesis following oxidant injury. J. Biol. Chem. 282, 2355e2362. Sedding, D.G., 2008. FoxO transcription factors in oxidative stress response and ageing-a new fork on the way to longevity? Biol. Chem. 389, 279e283. Subauste, A.R., Burant, C.F., 2007. Role of FoxO1 in FFA induced oxidative stress in adipocytes. Am. J. Physiol. Endocrinol. Metab. 293, 159e164. Susztak, K., Raff, A.C., Schiffer, M., Bottinger, E.P., 2006. Glucose-induced reactive oxygen species cause apoptosis of podocytes and podocyte depletion at the onset of diabetic nephropathy. Diabetes 55, 225e233.
Tran, M., Tam, D., Bardia, A., Bhasin, M., Rowe, G.C., Kher, A., Zsengeller, Z.K., Akhavan-Sharif, M.R., Khankin, E.V., Saintgeniez, M., David, S., Burstein, D., Karumanchi, S.A., Stillman, I.E., Arany, Z., Parikh, S.M., 2011. PGC-1a promotes recovery after acute kidney injury during systemic inflammation in mice. J. Clin. Invest. 121, 4003e4014. Valle, I., Alvarez-Barrientos, A., Arza, E., Lamas, S., Monsalve, M., 2005. PGC-1a regulates the mitochondrial antioxidant defense system in vascular endothelial cells. Cardiovasc. Res. 66, 562e573. Venkatesan, B., Mahimainathan, L., Das, F., Ghosh-Choudhury, N., Ghosh Choudhury, G., 2007. Downregulation of catalase by reactive oxygen species via PI3 kinase/Akt signaling in mesangial cells. J. Cell. Physiol. 211, 457e467. Wu, L., Zhang, Y., Ma, X., Zhang, N., Qin, G., 2012. The effect of Resveratrol on FoxO1 expression in kidneys of diabetic nephropathy rats. Mol. Biol. Rep. 39, 9085e9093. Wu, L., Li, H., Jia, C.Y., Cheng, W., Yu, M., Peng, M., Zhu, Y., Zhao, Q., Dong, Y.W., Shao, K., Wu, A., Wu, X.Z., 2012. MicroRNA-223 regulates FOXO1 expression and cell proliferation. FEBS Lett. 586, 1038e1043. Xu, Z.G., Li, S.L., Lanting, L., Kim, Y.S., Shanmugam, N., Reddy, M.A., Natarajan, R., 2006. Relationship between 12/15-lipoxygenase and COX-2 in mesangial cells: potential role in diabetic nephropathy. Kidney Int. 69, 512e519. Yuan, Y., Huang, S., Wang, W., Wang, Y., Zhang, P., Zhu, C., Ding, G., Liu, B., Yang, T., Zhang, A., 2012. Activation of peroxisome proliferator-activated receptor-g coactivator 1a ameliorates mitochondrial dysfunction and protects podocytes from aldosterone-induced injury. Kidney Int. 82, 771e789.