- Email: [email protected]
Pharmacological concentration of angiotensin-(1–7) activates NADPH oxidase after ischemia–reperfusion in rat heart through AT1 receptor stimulation
Regulatory Peptides 127 (2005) 101 – 110 www.elsevier.com/locate/regpep
Pharmacological concentration of angiotensin-(1–7) activates NADPH oxidase after ischemia–reperfusion in rat heart through AT1 receptor stimulation Alexandra Oudot*, Catherine Vergely, Aline Ecarnot-Laubriet, Luc Rochette Laboratoire de Physiopathologie et Pharmacologie, Cardio-vasculaires Expe´rimentales, IFR no. 100, Faculte´s de Me´decine et Pharmacie, 7, Boulevard Jeanne d’Arc-BP 87900, 21079 Dijon, France Received 26 July 2004; received in revised form 20 October 2004; accepted 27 October 2004 Available online 19 November 2004
Abstract The cardiovascular role of angiotensin-(1–7), especially in the functional and metabolic alterations associated with ischemia–reperfusion (IR), is still not clearly defined. Our objective was to evaluate the cardiac effects of angiotensin-(1–7), the receptors involved, and their relationships with NADPH oxidase activation under non-ischemic conditions and, during an ischemia–reperfusion sequence. Isolated perfused rat hearts underwent 45 min of non-ischemic perfusion, or 30 min of global ischemia followed by 30 min of reperfusion. Angiotensin-(1–7) and/or AT1 receptor blocker losartan or angiotensin-(1–7) receptor antagonist (d-Ala7)–angiotensin-(1–7) were perfused. Our results showed that angiotensin-(1–7) was without effect at low concentrations (1010 to 107 M). At a pharmacological concentration, 0.5 AM angiotensin-(1–7) induced vasoconstriction, which was antagonised by losartan. After ischemia, we noted a partial recovery of functional parameters, which was not modified by any of the treatments. The expression of AT1 receptor mRNA was increased by ischemia– reperfusion, except in (d-Ala7)–angiotensin-(1–7) treated hearts. Angiotensin-(1–7) further increased the AT1 expression. NADPH oxidase activity was enhanced in 0.5 AM angiotensin-(1–7)-treated hearts subjected to ischemia–reperfusion, this effect was totally reversed by losartan. This is the first time that it has been shown that, in the heart, angiotensin-(1–7) at pharmacological concentration activates NADPH oxidase, an enzyme thought to be involved in several angiotensin II effects. D 2004 Elsevier B.V. All rights reserved. Keywords: Renin–angiotensin system; NADPH oxidase; Heart; AT1 receptor
1. Introduction The renin–angiotensin system (RAS) is considered as one of the major regulatory systems for cardiovascular homeostasis. Though angiotensin II is the most potent peptide of the RAS, angiotensin-(1–7) (Ang-(1–7)), a heptapeptide that lacks phenylalanine at position 8 of the angiotensin II peptide, is now thought to be a biologically active component of this system [1]. Ang-(1–7) is formed from angiotensin II through carboxy-terminal phenylalanine residue cleavage not only by prolyl-carboxypeptidases and * Corresponding author. Tel.: +33 380 39 32 92; fax: +33 380 39 32 93. E-mail address: [email protected] (A. Oudot). 0167-0115/$ - see front matter D 2004 Elsevier B.V. All rights reserved. doi:10.1016/j.regpep.2004.10.013
prolyl-endopeptidases, but also by an angiotensin-converting enzyme (ACE)-independent pathway by direct hydrolysis of angiotensin I by tissue-specific endopeptidases. Moreover, an enzyme involved in the production of Ang(1–7) from angiotensin II has been recently isolated as ACE2 [2]. An important route for inactivation of this heptapeptide appears to be the cleavage to Ang-(1–5) by ACE. The Ang-(1–7) receptor has been identified and is the G-protein-coupled receptor Mas [3]. The circulating levels of Ang-(1–7) were shown to increase during ACE inhibition, which could be accounted for by both an increase in its precursor Ang I, and a decrease in its degradation by ACE [4]. Recent observations suggest that the accumulation of this peptide may play a substantial role in the
102
A. Oudot et al. / Regulatory Peptides 127 (2005) 101–110
cardiovascular effects of RAS blockade [4,5]. Although the heart seems to be an important site for Ang-(1–7) synthesis, the cardiac actions of this peptide are still not very well understood [6]. Even though, the biological responses of Ang-(1–7) are generally given as the opposite of those of angiotensin II [5,7,8], some of them are similar [9–11]. Some investigators have suggested that the biological actions of Ang-(1–7) may be mediated only by a specific receptor [12–14], while others have shown that AT1 receptors could also be involved [15,16]. Though the evidence is growing that the RAS plays a major role during ischemia–reperfusion (IR), the exact mechanisms involved in this still need to be clearly established. It is generally accepted that the production of oxygen-derived radical species is one of the major events involved in the initiation, maintenance and reversibility of metabolic and functional alterations associated with IR injury [17]. However, while the exact mechanisms of postischemic oxidative stress have not yet been elucidated, a close link could be established between the RAS and the production of radical species. In fact, it has been shown that NADPH oxidase, a superoxide-producing enzyme, could be activated through angiotensin II stimulation [18]. In this respect, the implication of Ang-(1–7) during myocardial IR has been poorly investigated, but it has recently been shown that Ang-(1–7) could enhance oxidative stress [19,20]. Therefore, we investigated the cardiac effects of Ang(1–7) and analyzed the concomitant NADPH oxidase expression and activity in isolated rat hearts (1) under control conditions of perfusion and, (2) during an IR sequence.
2. Methods 2.1. Chemicals All chemicals were bought from Sigma (France), except losartan which was obtained from Merck Sharp and Dohm (Ireland), and angiotensin-(1–7) and (d-Ala7)–angiotensin(1–7) which were from Bachem Biochimie (France). 2.2. Perfusion technique and perfusion medium The investigation conforms to the European convention for the use of laboratory animals, which is in agreement with the Guide for the Care and Use of the Laboratory Animals published by the US National Institutes of Health (NIH publication no. 85-23, revised 1996). Male Wistar rats (280– 330 g) were purchased from Depre´ (France). The rats were anaesthetized with sodium thiopental (60 mg/kg, i.p.) and heparin was intravenously injected (500 IU/kg). After 1 min, the hearts were excised and placed in a cold (4 8C) perfusion buffer bath until contractions ceased. Each heart was then immediately cannulated through the aorta and perfused at 37 8C by the Langendorff method, at a constant
perfusion pressure equivalent to 80 cm of water (8 kPa). The perfusion buffer consisted of a modified Krebs–Henselheit bicarbonate buffer (KH) (millimolar concentrations: NaCl 118, NaHCO3 25, MgSO4 1.2, KH2PO4 1.2, KCl 4.5, glucose 5.5 and CaCl2 3). The perfusion fluid was filtered through a 0.8-Am Millipore filter to remove any particulate contaminants and gassed with 95% oxygen and 5% carbon dioxide (pH 7.3–7.5 at 37 8C). An elastic water-filled latex balloon (no. 4, Hugo Sachs, Germany) was inserted into the left ventricle through the mitral valve, connected to a pressure transducer, and inflated to obtain an end-diastolic pressure (LVEDP) of between 6 and 12 mm Hg (0.8–1.6 kPa). A Gould TA 240 recorder was used to measure intraventricular pressures (LVEDP and left ventricular systolic pressure (LVSP), left ventricular developed pressure (LVDP)=LVSPLVEDP) and heart rate (HR)). The ratepressure product (RPP) was calculated from the product of LVDP (mm Hg) and HR (beats min1) and expressed in mm Hg beats min1. During post-ischemic recovery, RPP was expressed as a percentage of the preischemic value (measured just before the onset of ischemia). In the dose– response study, the perfusion system was switched to a constant flow mode using a peristaltic pump (Gilson). A supplementary pressure transducer was connected upstream of the coronary bed and linked to a Gould TA recorder to measure coronary perfusion pressure (CPP). In the studies with constant perfusion pressure, coronary flow (CF) was measured by the timed collection of the effluent. 2.3. Dose–response study Two groups, each composed of five hearts were constituted. After a 15-min stabilization period under constant pressure mode, CF was measured and the hearts were switched to the corresponding constant flow mode (10–12 ml/min) and stabilized for an additional 15-min period. The treated hearts (n=5) were perfused for 2 min with bradykinin (BK) at a final concentration of 30 nM to test the endothelial reactivity. After 5 min of recovery, increasing concentrations of Ang-(1–7) were perfused for 5 min (1010, 109, 108, 107, 5107, 106 and 105 M). Five minutes after the end of the last Ang-(1–7) concentration perfusion, BK (30 nM) was reperfused for 2 min. Angiotensin-(1–7) and bradykinin were dissolved in NaCl 0.9% and administered upstream of the heart with a mini-pump (Harvard Apparatus), at an infusion rate adjusted to 1/40 of the CF, ensuring the required final concentration. A control group was constituted (n=5) and perfused in the same conditions as the treated group, but with saline buffer (NaCl 0.9%). 2.4. Perfusion protocols Fourteen groups, each composed of six to nine hearts, were subjected to different perfusion protocols at 37 8C (Fig. 1). After 15 min of stabilization, isolated hearts were perfused aerobically for 15 min (pre-ischemic control
A. Oudot et al. / Regulatory Peptides 127 (2005) 101–110
103
Fig. 1. Perfusion protocols of isolated rat hearts. Hearts were either perfused under non-ischemic (NI) conditions (a), or subjected to the ischemia–reperfusion (IR) protocol (b). The NI perfusion protocol (a) consisted of 45-min NI perfusion. The IR protocol (b) consisted of 15-min NI perfusion followed by 30 min of total global ischemia and 30 min of reperfusion. Drugs (Ang-(1–7) 0.1 or 0.5 AM, Losartan 1 AM, and (d-Ala7)–Ang-(1–7) 1 AM) were infused as indicated in the frame.
period). Non-ischemic hearts (NI) (Fig. 1a) were perfused for an additional 30-min period. In groups undergoing ischemia–reperfusion (IR) (Fig. 1b), global normothermic ischemia was induced by clamping aortic inflow for 30 min, during which a thermoregulated chamber maintained the heart temperature at 37 8C. After ischemia, aortic inflow was resumed for 30 min (reperfusion period). Seven groups were constituted in each series (NI and IR): each group receiving either vehicle (NaCl 0.9%) (control group, n=9), Ang-(1–7) 0.1 AM (n=6), Ang-(1–7) 0.5 AM (n=9), losartan 1 AM (n=9), (d-Ala7)–Ang-(1–7) 1 AM (n=6), Ang-(1–7) 0.5 AM+(d-Ala7)–Ang-(1–7) 1 AM coadministration (n=6), or Ang-(1–7) 0.5 AM+losartan 1 AM co-administration (n=6) as described in Fig. 1. Ang-(1–7) was diluted in the perfusion buffer in order to obtain a final concentration of 0.1 or 0.5 AM. The concentrations of Ang(1–7) were based on the results obtained in the dose– response study. (d-Ala7)–angiotensin-(1–7) ((d-Ala7)–Ang(1–7)), an Ang-(1–7) receptor blocker, was dissolved at the concentration of 40 AM in NaCl 0.9% and administered upstream of the coronary bed with a mini-pump (Harvard
Apparatus), at an infusion rate adjusted to 1/40 of the CF, ensuring a final concentration of 1 AM. This concentration has been shown to block Ang-(1–7)-specific effects without competing for angiotensin II binding sites as determined by binding studies [21]. The AT1 receptor antagonist losartan was dissolved and administered in the same way, ensuring a final concentration of 1 AM. We chose the 1 AM concentration of losartan because it has been shown by radioligand binding that at this concentration 100% of the AT1 receptors were occupied [22]. 2.5. Tissue processing After each experimental perfusion protocol, the atria were rapidly excised and the remainder of the heart was instantaneously frozen, crushed in liquid nitrogen and kept at 70 8C until use. Afterwards, the hearts were homogenised in either 3 volumes of KH/Hepes 25 mM (1:1), or in 5 volumes of Trizol. KH/Hepes homogenates were used for the evaluation of NADPH oxidase activity. Trizol homogenates were used to extract total cytoplasmic RNA.
104
A. Oudot et al. / Regulatory Peptides 127 (2005) 101–110
Table 1 Sequence, characteristics and amount of the (F) forward and (R) reverse primers used to amplify target cDNAs and temperature of PCR cycling mRNA
Sequence
Nucleotides localisation
Product length
Tm
Amount of primers (ng)
Hybridisation temperature (8C)
Number of cycles
GAPDH
(F)ACCACAGTCCATGCGATCAC (R)ACCACAGTCCATGCGATCAC (F)ACGACCAAAGGACCATCC (R)TTGATGTGTGGACTTGGG (F)CACATCCTCCACCAAAACCA (R)GGGACGCTTGACGAAAATGT (F)GGGGAAAGAGGAAAAAGGGC (R)GGTAGGTGGCTGCTTGATGG
1369–1388 1801–1821 1420–1435 1954–1971 570–589 971–990 197–216 470–489
453
55.2 55.2 51.4 48.7 55.2 56.2 57.6 56.6
100
55
28
300
55
40
300
55
36
300
55
36
AT1 gp91phox p22-phox
552 420 293
2.6. Quantification of gene transcripts by RT-PCR
2.8. Statistical analysis
AT1 receptor, and NADPH oxidase subunits (p22phox and gp91phox) mRNA expression were evaluated using RTPCR. The extraction of the total cytoplasmic RNA from cardiac homogenates was carried out as previously described [23]. The steady state level of the studied gene transcripts was evaluated by comparative RT-PCR assay, as previously described [24,25], using a GAPDH sequence internal standard. The sequence and location of primers, the size of amplicons, and the specific cycling parameters are given in Table 1. Densitometric quantification of fluorescent signals was performed by the image analyser Gel Doc 1000 system driven by the molecular Analyst software (Biorad, USA). The PCR amplification yield was expressed in arbitrary units (AU) as the ratio of the target per amplicon optical density and as a percentage of the NI control group.
All data were expressed as meansFS.E.M. For functional parameters, statistical analysis comparisons were performed with the one-factor ANOVA test. For molecular biology results and chemiluminescence, statistical analysis was performed with two-factor fully factorial ANOVA, the two factors being the type of perfusion protocol (NI perfusion versus IR) and the treatments applied. ANOVA (one or two factors) was followed by inter-group pair wise comparisons with Tukey HSD multiple comparisons.
The effects of 30 nM Bradykinin (BK) perfusion were examined at the beginning and at the end of the perfusion protocol (Fig. 2). After the stabilization phase, BK induced a significant decrease in CPP and a negative inotropic effect. The same effects were observed when BK was perfused after administration of increasing concentrations of Ang-(1– 7). There was no significant change in the reactivity to BK before and after Ang-(1–7) perfusion.
Control group (n=5) Before
Before
After
2000
5 0 -5 -10
Treated group (n=5)
After Change in RPP
The capacity of myocardial tissue to produce superoxide in an NADPH-dependent way, is a good indicator of NADPH oxidase activity, and was assessed using an LB 9507 luminometer (Berthold Systems, Aliquippa, PA, USA) by the measurement of superoxide-enhanced lucigenin chemiluminescence [26] as previously described [24]. One hundred microliters of the KH/Hepes homogenates (2.5–5 mg of protein) was transferred to a luminometer tube containing lucigenin (final concentration=0.5 AM) in KH/ Hepes (8:1) (final volume=1 ml). The baseline luminescence was recorded over a 5-min period. Then, the reaction was started by the addition of NADPH (final concentration=30 AM), and the production of light induced by superoxide attack on lucigenin was recorded for 15 min. Samples were mixed between each measure to ensure a homogenous and reproducible distribution of injected reagents in the luminometer tube. Homogenates alone, without the addition of NADPH, gave only a minimal signal. Protein content was measured in an aliquot of the homogenate by the method of Lowry et al. [27]. The maximal amplitude signal was determined by the difference between maximal photon production and baseline level. Results were expressed in maximal amplitude signal (arbitrary units) per g of protein (AU/g prot).
3.1. Dose–response study
Change in CPP (mmHg)
2.7. Determination of NADPH oxidase activity
3. Results
***
***
0 -2000 -4000
***
***
Fig. 2. Effects of 30 nM bradykinin perfusion on coronary perfusion pressure (CPP) and rate-pressure product (RPP). Results are expressed as a change in CPP or RPP after 1 min bradykinin 30 nM (or NaCl 0.9%) perfusion, and as meansFS.E.M. Before measure corresponds to the first bradykinin (or NaCl 0.9%) administration, before Ang-(1–7) (or NaCl 0.9%) treatment; after measure corresponds to the second bradykinin (or NaCl 0.9%) administration, after Ang-(1–7) (or NaCl 0.9%) treatment. ***Pb0.001 versus control group.
Change in CPP (mmHg)
A. Oudot et al. / Regulatory Peptides 127 (2005) 101–110 60
*
*
*
40 30 20 10
0 Ang-(1-7) (M) 0
Change in RPP
Control group (NaCl 0.9%) (n=5) Ang-(1-7)-treated group (n=5)
50
10-10
10-9
10-8
10-7
5.10-7
10-6
10-5
-2000
-4000
-6000
Fig. 3. Effects of increasing concentrations of Ang-(1–7) (or NaCl 0.9% for control group) on coronary perfusion pressure (CPP) and rate pressure product (RPP) of isolated perfused rat hearts. Results are expressed as meansFS.E.M. *Pb0.05 versus control group.
The cardiac effects of the administration of increasing concentrations of Ang-(1–7) are shown in Fig. 3. A dosedependent increase of CPP was observed during Ang-(1–7) perfusion. This variation became statistically different from the control group at concentrations above 5107 M. The administration of Ang-(1–7) did not induce significant modification of LVDP or HR, leading to no change in RPP evolution, compared to the NaCl 0.9% perfused group. 3.2. Functional parameters 3.2.1. Effects of angiotensin-(1–7), (d -Ala7)–angiotensin(1–7), and losartan under non-ischemic conditions of perfusion The effects of Ang-(1–7) and/or (d-Ala7)–Ang-(1–7) or losartan administration on functional parameters of isolated
105
rat hearts were observed over a 45-min period in conditions of non-ischemic perfusion (NI series). The values of functional parameters evaluated 15 min after the beginning of the experiment and at the end of the NI perfusion protocol are presented in Table 2. The perfusion of 0.1 AM Ang-(1–7), losartan, or (dAla7)–Ang-(1–7) did not modify the evolution of functional parameters during the perfusion protocol (CF, LVEDP, LVDP or HR). The perfusion of 0.5 AM Ang-(1–7) induced a 10% decrease in CF (compared to the control group), which reached 20% of diminution at the end of the 45-min perfusion. The co-administration of 1 AM losartan totally antagonised the vasoconstrictor effect of 0.5 AM Ang-(1–7) at the beginning of the perfusion protocol (Table 2, see coronary flow at 15 min perfusion), but this effect was attenuated after 45 min of NI perfusion since the decrease in the coronary flow induced by 0.5 AM angiotensin-(1–7) was not totally prevented by losartan administration. (d-Ala7)– Ang-(1–7) did not influence the coronary constriction induced by Ang-(1–7). Moreover, 0.5 AM Ang-(1–7) caused a slight, but significant 15% decrease of LVDP compared to the control group. Losartan co-administration reversed the Ang-(1–7) negative inotropic effect, whereas (d-Ala7)–Ang(1–7) co-perfusion was ineffective. Ang-(1–7) 0.5 AM did not influence LVEDP and HR. 3.2.2. Effects of angiotensin-(1–7), (d-Ala7)–angiotensin(1–7), and losartan on post-ischemic myocardial recovery The post-ischemic myocardial recovery of functional parameters was evaluated during 30 min of reperfusion (Table 3). The evolution of functional parameters before the induction of ischemia was similar to that described for NI groups during the first 15 min of the perfusion protocol. CF was only partially restored with reperfusion, reaching only 35% of the initial value for untreated and treated hearts, with no intergroup differences. From the onset of reperfusion, LVEDP rose rapidly to a peak value that was obtained in 3 min, then steadily decreased, but remained at a high level
Table 2 Functional parameters of isolated perfused hearts measured 15 and 45 min after the beginning of the perfusion protocol (NI series) Control
15-min perfusion CF (ml/min) LVEDP (mm Hg) LVDP (mm Hg) HR (beats/min) 45-min perfusion CF (ml/min) LVEDP (mm Hg) LVDP (mm Hg) HR (beats/min)
Ang-(1–7)
Losartan
(d-Ala7)–Ang-(1–7)
Ang-(1–7) + Losartan
Ang-(1–7) + (d-Ala7)–Ang-(1–7)
0.1 AM
0.5 AM
11.4F0.2 7.7F0.8 128.3F3.0 283.1F4.9
10.7F0.2 10.3F0.6 120.5F7.6 280.0F14.6
9.8F0.5* 9.2F0.5 109.8F2.9* 293.3F11.5
11.3F0.3 8.6F0.5 127.8F3.9 288.9F6.9
11.1F0.4 10.3F0.4 121.5F7.7 276.7F3.3
10.4F0.2 9.8F0.5 124.8F5.2 288.3F6.2
10.1F0.3* 9.9F0.5 105.6F3.8* 280.0F6.0
10.5F0.2 7.4F0.6 113.0F2.9 264.4F5.6
8.9F0.3 9.3F0.8 94.8F4.4 270.0F12.4
8.6F0.5** 8.2F0.6 91.8F2.9* 273.3F10.0
10.3F0.3 7.2F0.8 113.4F4.8 268.8F8.9
10.2F0.6 8.5F0.4 108.8F8.4 266.7F9.9
8.7F0.2* 9.3F0.5 111.2F7.6 260.0F8.9
8.3F0.7** 9.3F0.7 89.8F3.6* 253.3F6.7
Coronary flow (CF), left ventricular end-diastolic pressure (LVEDP), left ventricular developed pressure (LVDP), heart rate (HR), non-ischemic (NI). * Pb0.05 versus control group. ** Pb0.01 versus control group.
106
A. Oudot et al. / Regulatory Peptides 127 (2005) 101–110
Table 3 Functional parameters of isolated perfused hearts measured after the 30-min reperfusion period following 30 min of global total ischemia (IR series) Control
End reperfusion CF (ml/min) LVEDP (mm Hg) LVDP (mm Hg) RPP (%) Rhythm disturbances (min)
4.0F0.5 66.4F8.3 23.6F6.7 14.6F6.4 19.4F2.4
Ang-(1–7) 0.1 AM
0.5 AM
4.0F0.5 75.8F6.1 22.0F6.3 15.9F6.0 16.6F3.8
4.5F0.3 73.1F5.3 24.3F6.9 12.9F5.9 15.7F3.1
Losartan
(d-Ala7)– Ang-(1–7)
Ang-(1–7) + Losartan
Ang-(1–7) + (d-Ala7)–Ang-(1–7)
4.2F0.7 82.7F2.4 22.4F5.7 11.8F3.8 14.9F3.9
4.8F0.4 83.6F6.3 25.3F9.5 13.4F7.7 16.4F5.1
4.8F0.3 85.2F5.7 28.3F12.5 11.0F7.0 13.83F4.2
4.4F0.3 78.0F9.3 26.8F6.3 21.9F8.3 15.00F4.0
Coronary flow (CF), left ventricular end-diastolic pressure (LVEDP), left ventricular developed pressure (LVDP), rate pressure product (RPP), ischemia– reperfusion (IR).
during the 30 min of reperfusion (66.4F8.3 mm Hg, control group). This post-ischemic contracture was not modified by any of the treatments. With reperfusion, LVDP recovered only very slowly and remained at a low level, reaching about 20% of its initial value at the end of the reperfusion (23.6F6.7 mm Hg, control group). The evolution of ratepressure product (RPP), calculated from the product of LVDP and HR, is a good index of post-ischemic recovery, and was found to show a similar pattern to that described for LVDP, with no intergroup differences. Since arrhythmias were very frequent during post-ischemic reperfusion, HR did not give us any relevant information about myocardial functional recovery and is not presented in Table 3. Although the correct classification of rhythm abnormalities must be defined according to Lambeth’s conventions on electrocardiographic criteria [28], monitoring ventricular
pressure allowed us to evaluate the contraction abnormalities that reflect reperfusion arrhythmias. Ventricular contractile disturbances were frequently observed after 30 min of a global normothermic ischemia with a mean duration of 19.4F2.4 min in control hearts (Table 3), and were mostly represented by tachycardia and fibrillations. The duration of these disturbances was not significantly modified by any of the treatments. 3.3. Angiotensin AT1 receptor mRNA expression The expression of angiotensin AT1 receptor mRNA was determined at the end of the experimental protocol in the non-ischemic hearts (NI series) and hearts undergoing 30 min of total global ischemia and 30 min of reperfusion (IR series) (Fig. 4).
Fig. 4. mRNA expression of AT1 receptors in rat hearts subjected to the different treatments and perfusion protocols (n=6 in each group). Results are expressed as a percentage of the control NI group, and as meansFS.E.M. ***Pb0.001 versus control group; yyyPb0.001 versus NI corresponding group.
A. Oudot et al. / Regulatory Peptides 127 (2005) 101–110
In NI hearts, none of the four treatments modified the expression of AT1 receptors. However, the expression of AT1 receptor mRNA was markedly increased after 30 min of ischemia and 30 min of reperfusion, as compared to the NI series, except in hearts treated by (d-Ala7)–Ang-(1–7) (alone, or co-perfused with Ang-(1–7)). In IR series, AT1 receptor mRNA expression was significantly enhanced by 0.5 AM Ang-(1–7) administration compared to the control ischemic group, whereas Ang-(1–7) 0.1 AM had no influence. This increase was totally antagonised not only by losartan, but also by (d-Ala7)–Ang-(1–7) co-perfusion. Losartan or (d-Ala7)– Ang-(1–7) infusion alone did not affect AT1 mRNA expression.
107
3.5. NADPH oxidase activity in heart tissue NADPH oxidase activity was assessed at the end of the experimental protocol in NI and IR hearts (Fig. 6). The activity of NADPH oxidase in NI hearts was not modified by any of the treatments. However, IR hearts treated with 0.5 AM Ang-(1–7) showed increased enzyme activity. Losartan co-administration suppressed this effect, whereas (d-Ala7)–Ang-(1–7) co-perfusion had no effect. Losartan and (d-Ala7)–Ang-(1–7) infusion alone did not affect NADPH oxidase activity in IR groups.
4. Discussion 3.4. NADPH oxidase subunits mRNA expression The mRNA expression of p22phox and gp91phox was analysed in the hearts subjected to the different perfusion protocols and treatments (Fig. 5). None of the treatments was shown to affect p22phox and gp91phox expression either in NI hearts, or in hearts undergoing IR. There were no overall differences between NI and IR hearts in the expression of the subunits.
There is no consensus about the vascular and cardiac effects of Ang-(1–7), and the mechanisms involved are still not clearly understood. In the present study, we observed preliminary experiments, which showed that increasing concentrations of Ang-(1–7) exerted vasoconstrictive effects on coronary arteries of isolated perfused rat hearts, without impairing the integrity of the endothelium since the vascular reactivity to bradykinin was not modified. From this dose–
Fig. 5. mRNA expression of NADPH oxidase subunits (p22phox and gp91phox) in rats hearts subjected to the different treatments and perfusion protocols (n=6 in each group). Results are expressed as a percentage of the control group, and as meansFS.E.M.
108
A. Oudot et al. / Regulatory Peptides 127 (2005) 101–110
Fig. 6. NADPH oxidase activity in cardiac homogenates obtained by measurement of lucigenin chemiluminescence. Results are expressed as meansFS.E.M. **Pb0.01 versus control group.
response study, we set out to examine the effects of a nonvasoactive concentration of Ang-(1–7): 0.1 AM (107 M) and of a vasoactive concentration: 0.5 AM (5107 M) in the following experiments. Using the isolated rat heart model, Ang-(1–7) appeared either to exert no effect on coronary flow when administered at low doses (2 ng/mlc2.2 nM) [7], or to be vasoconstrictive at higher concentrations (27–210 nM) [29]. These observations are in accordance with the results obtained in our study, even though Neves et al. [29] observed coronary vasoconstrictive actions of Ang-(1–7) above 27 nM. However, their perfusion buffer differed from ours. Since losartan, but not (d-Ala7)–Ang-(1–7), reversed these Ang-(1–7) vasoconstrictive effects, they are likely to be linked to AT1 receptors activation as already suggested [10,14]. Nevertheless, this antagonism by Losartan did not last, which may suggest that, non-AT1 receptors might also be involved or that losartan antagonism was not sufficiently pronounced. Actually, Ang-(1–7) was described as either a vasorelaxant [1], or a vasoconstrictor [10], and could be either an activator of prostaglandins and nitric oxide release [7,8,20], or a stimulator of vasopressin release [11]. In addition, evidence for the obvious differences in the vascular effects of Ang-(1–7) among species and vascular beds has been provided by several studies [30]. After 30 min of total global ischemia, functional parameters only partially recovered with reperfusion (35% of CF, 20% of LVDP, 15% of RPP), an observation that corresponds to the data usually obtained in our laboratory [31]. None of the treatments applied influenced the postischemic myocardial functional recovery. To date, only two experimental studies have concerned the effects of Ang-(1–
7) during myocardial IR [13,29], and very low doses of Ang-(1–7) were perfused (0.22, 27 nM). The effects of higher concentrations of Ang-(1–7) have not yet been reported. In our study, the AT1 receptor mRNA expression was found to be upregulated with IR (nearly six times). This up-regulation of AT1 receptors has already been reported after myocardial infarction [32–34], and after IR injury [35], suggesting that this event is not only a long-term consequence of ischemia but also occurs immediately after an IR sequence. In contrast with the results reported by Yang et al. [35], which studied Ang II in conditions close to those adopted in our work, our data did not show the attenuation of the AT1 receptor up-regulation by 1 AM losartan. However, these authors chose to perfuse losartan at a concentration 10 times higher (10 AM) than the one used in our work (1 AM). evidence has been provided [36] that the effects of high concentrations of this compound could be independent of AT1 blockade. IR-induced AT1 receptor upregulation was prevented by (d-Ala7)–Ang-(1–7), suggesting the possible involvement of a (d-Ala7)–Ang-(1–7)sensitive receptor (distinct from AT1) in AT1 up-regulation after IR. The functional consequences of this up-regulation are not clearly demonstrated and remain to be elucidated. Yang et al. [35] proposed that the marked increase in AT1 receptor expression after IR sequence could contribute to the increase in coronary vascular resistance and cardiac dysfunction. This interpretation is not compatible with our findings since no influence of (d-Ala7)–Ang-(1–7) perfusion was noted in post-ischemic myocardial functional contracture compared to control hearts. Contrary to the NI series, the AT1 receptor mRNA expression was further enhanced by 0.5 AM Ang-(1–7) treatment in IR hearts,
A. Oudot et al. / Regulatory Peptides 127 (2005) 101–110
suggesting the hypothesis that a link could be established between Ang-(1–7) and AT1 receptors. This Ang-(1–7)induced AT1 receptor up-regulation after IR was totally antagonised by losartan co-perfusion, but also by (d-Ala7)– Ang-(1–7) which bind poorly to AT1 receptors [21]. This finding suggest that the up-regulation of AT1 receptors is mediated through the activation of a non-AT1 angiotensin receptor by Ang-(1–7) [37]. This hypothesis is further supported by observations showing that losartan can bind to non-angiotensin II binding sites [38]. Therefore, it could be hypothesized that this major up-regulation of AT1 receptor could be modulated by angiotensin-(1–7) and its specific receptor. Nevertheless, the implication of AT1 receptor activation could not be totally excluded since the reversion of Ang-(1–7) effects by (d-Ala7)–Ang-(1–7) could constitute an artefact caused by the specific actions of this compound on AT1 receptor up-regulation by IR. It has been well established that Ang II can activate NADPH oxidase through an AT1 mediated pathway [39]. However, the effects of heptapeptide Ang-(1–7) on NADPH oxidase are poorly documented. In our experimental conditions, none of the treatments administered influenced NADPH oxidase expression or activity, suggesting that, despite AT1-mediated vasoconstrictive effects, Ang-(1–7) peptide did not interact with myocardial NADPH oxidase. The binding of Ang-(1–7) to AT1 receptors, might not be sufficient to activate the cellular mechanisms which lead to NADPH oxidase activation. Recently, Heitsch et al. [20] reported that the NO release from the endothelial cells after stimulation of putative Ang-(1–7) receptors was associated with very low concomitant production of superoxide. They speculated that Ang-(1–7) interacts with multiple binding sites on endothelial cells, the signal transduction pathway coupled to the Ang-(1–7) receptor being unknown. No incidence of the IR sequence on NADPH oxidase expression and activity was observed, which agrees with recent results. However, concerning the activity of the enzyme in the myocardial tissue subjected to IR, we observed that Ang-(1–7) perfusion could increase NADPH oxidase activity after I and R, an effect that seems to be mediated through AT1 receptor stimulation. Since p22phox and gp91phox mRNA levels were not changed, the mechanisms involved in the oxidase activation seemed to be transcription-independent. Losartan co-administration suppressed this Ang-(1–7)-induced NADPH oxidase activation, where as (d-Ala7)–Ang-(1–7) co-perfusion had no influence. Consequently, these effects could be directly related to AT1 receptor activation. Nevertheless, it appears that IR might trigger modifications that allow Ang-(1–7) to stimulate this enzyme. The most probable explanation could be the enhancement of AT1 receptor activation due to the up-regulation of this receptor induced by an IR sequence. Arachidonic acid produced by phospholipase A2, which has been shown to be enhanced by IR [40], was recently demonstrated to regulate NADPH oxidase activation by modulating the translocation of p47phox and p67phox to the
109
membrane [41]. These results could explain why NADPH oxidase mRNA was not changed while enzyme activity was enhanced in IR hearts in the presence of 0.5 AM Ang-(1–7). In conclusion, this study showed that an Ang-(1–7) concentration of 0.1 AM did not only modify cardiac functional parameters of isolated rat heart during a nonischemic perfusion, but also during ischemia–reperfusion. However, pharmacologic concentrations of Ang-(1–7) (0.5 AM) were vasoconstrictive and increased NADPH oxidase activity after ischemia reperfusion through AT1 receptor stimulation. These effects were probably linked to the important up regulation of AT1 receptors observed after ischemia–reperfusion sequence. This is the first time that it has been shown that, in the heart, Ang-(1–7) activates NADPH oxidase, an enzyme thought to be involved in several angiotensin II effects. Acknowledgements A. Oudot was supported by a grant from the Socie´te´ Franc¸aise d’Hypertension Arte´rielle. The authors gratefully acknowledge the Conseil Re´gional de Bourgogne, the Faculty of Medicine of Dijon, and the fondation de France for their continuing support. The authors thank Didier Carnet and Philip Bastable for correcting the English in the manuscript. References [1] Ferrario CM, Iyer SN. Angiotensin-(1–7): a bioactive fragment of the renin–angiotensin system. Regul Pept 1998;78(1–3):13 – 8. [2] Burrell LM, Johnston CI, Tikellis C, Cooper ME. ACE2, a new regulator of the renin–angiotensin system. Trends Endocrinol Metab 2004;15(4):166 – 9. [3] Santos RA, Simoes e Silva AC, Maric C, Silva DM, Machado RP, de Buhr I, et al. Angiotensin-(1–7) is an endogenous ligand for the G protein-coupled receptor Mas. Proc Natl Acad Sci U S A 2003;100(14): 8258 – 63. [4] Iyer SN, Ferrario CM, Chappell MC. Angiotensin-(1–7) contributes to the antihypertensive effects of blockade of the renin–angiotensin system. Hypertension 1998;31(1 Pt 2):356 – 61. [5] Iyer SN, Chappell MC, Averill DB, Diz DI, Ferrario CM. Vasodepressor actions of angiotensin-(1–7) unmasked during combined treatment with lisinopril and losartan. Hypertension 1998;31(2): 699 – 705. [6] Santos RA, Campagnole-Santos MJ, Andrade SP. Angiotensin-(1–7): an update. Regul Pept 2000;91(1–3):45 – 62. [7] Almeida AP, Frabregas BC, Madureira MM, Santos RJ, CampagnoleSantos MJ, Santos RA. Angiotensin-(1–7) potentiates the coronary vasodilatatory effect of bradykinin in the isolated rat heart. Braz J Med Biol Res 2000;33(6):709 – 13. [8] Brosnihan KB, Li P, Ferrario CM. Angiotensin-(1–7) dilates canine coronary arteries through kinins and nitric oxide. Hypertension 1996;27(3 Pt 2):523 – 8. [9] Gironacci MM, Adler-Graschinsky E, Pena C, Enero MA. Effects of angiotensin II and angiotensin-(1–7) on the release of [3H]norepinephrine from rat atria. Hypertension 1994;24(4):457 – 60. [10] Kumagai H, Khosla M, Ferrario C, Fouad-Tarazi FM. Biological activity of angiotensin-(1–7) heptapeptide in the hamster heart. Hypertension 1990;15(2 Suppl.):I29 – 33.
110
A. Oudot et al. / Regulatory Peptides 127 (2005) 101–110
[11] Schiavone MT, Santos RAS, Brosnihan KB, Khosla MC, Ferrario CM. Release of vasopressin from the rat hypothalamo-neurohypophysial system by angiotensin-(1–7) heptapeptide. Proc Natl Acad Sci 1988;85:4095 – 8. [12] Tallant EA, Lu X, Weiss RB, Chappell MC, Ferrario CM. Bovine aortic endothelial cells contain an angiotensin-(1–7) receptor. Hypertension 1997;29(1 Pt 2):388 – 93. [13] Ferreira AJ, Santos RA, Almeida AP. Angiotensin-(1–7): cardioprotective effect in myocardial ischemia/reperfusion. Hypertension 2001;38(3 Pt 2):665 – 8. [14] Benter IF, Diz DI, Ferrario CM. Cardiovascular actions of angiotensin(1–7). Peptides 1993;14(4):679 – 84. [15] Champion HC, Czapla MA, Kadowitz PJ. Responses to angiotensin peptides are mediated by AT1 receptors in the rat. Am J Physiol 1998;274(1 Pt 1):E115 – 23. [16] Gironacci MM, Coba MP, Pena C. Angiotensin-(1–7) binds at the type 1 angiotensin II receptors in rat renal cortex. Regul Pept 1999;84(1–3): 51 – 4. [17] Vergely C, Tabard A, Maupoil V, Rochette L. Isolated perfused rat hearts release secondary free radicals during ischemia reperfusion injury: cardiovascular effects of the spin trap alpha-phenyl N-tertbutylnitrone. Free Radic Res 2001;35(5):475 – 89. [18] Rajagopalan S, Kurz S, Mqnzel T, Tarpey M, Freeman BA, Griendling KK, et al. Angiotensin II-mediated hypertension in the rat increases vascular superoxide production via membrane NADH/ NADPH oxidase activation. Contribution to alterations of vasomotor tone. J Clin Invest 1996;97(8):1916 – 23. [19] Gonzales S, Noriega GO, Tomaro ML, Pena C. Angiotensin-(1–7) stimulates oxidative stress in rat kidney. Regul Pept 2002;106(1–3): 67 – 70. [20] Heitsch H, Brovkovych S, Malinski T, Wiemer G. Angiotensin-(1–7)stimulated nitric oxide and superoxide release from endothelial cells. Hypertension 2001;37(1):72 – 6. [21] Santos RA, Campagnole-Santos MJ, Baracho NC, Fontes MA, Silva la, Neves la, et al. Characterization of a new angiotensin antagonist selective for angiotensin-(1–7): evidence that the actions of angiotensin-(1–7) are mediated by specific angiotensin receptors. Brain Res Bull 1994;35(4):293 – 8. [22] Hunyady L, Balla T, Catt KJ. The ligand binding site of the angiotensin AT1 receptor. Trends Pharmacol Sci 1996;17(4):135 – 40. [23] Assem M, Teyssier JR, Benderitter M, Terrand J, Laubriet A, Javouhey A, et al. Pattern of superoxide dismutase enzymatic activity and RNA changes in rat heart ventricles after myocardial infarction. Am J Pathol 1997;151(2):549 – 55. [24] Oudot A, Vergely C, Ecarnot-Laubriet A, Rochette L. Angiotensin II activates NADPH oxidase in isolated rat hearts subjected to ischaemia–reperfusion. Eur J Pharmacol 2003;462:145 – 54. [25] Ecarnot-Laubriet A, De Luca K, Vandroux D, Moisant M, Bernard C, Assem M, et al. Downregulation and nuclear relocation of MLP during the progression of right ventricular hypertrophy induced by chronic pressure overload. J Mol Cell Cardiol 2000;32(12):2385 – 95. [26] Iliou J, Villeneuve N, Fournet-Bourguignon M, Robin F, Jacquemin V, Lestriez V, et al. Mathematical treatment of chemiluminescence data allowing an optimised kinetic analysis of vascular NAD(P)Hdependent superoxide anion production. Analusis 2000;28:479 – 86.
[27] Lowry O, Rosenbrough N, Fair A, Randall R. Protein measurement with the Folin phenol reagent. J Biol Chem 1951;193:268 – 73. [28] Walker MJ, Curtis MJ, Hearse DJ, Campbell RW, Janse MJ, Yellon DM, et al. The Lambeth Conventions: guidelines for the study of arrhythmias in ischaemia infarction, and reperfusion. Cardiovasc Res 1988;22(7):447 – 55. [29] Neves LA, Almeida AP, Khosla MC, Campagnole-Santos MJ, Santos RA. Effect of angiotensin-(1–7) on reperfusion arrhythmias in isolated rat hearts. Braz J Med Biol Res 1997;30(6):801 – 89. [30] Lopez Ordieres MG, Gironacci M, Rodriguez de Lores Arnaiz G, Pena C. Effect of angiotensin-(1–7) on ATPase activities in several tissues. Regul Pept 1998;77(1–3):135 – 9. [31] Vergely C, Perrin C, Laubriet A, Oudot A, Zeller M, Guilland JC, et al. Postischemic myocardial recovery and oxidative stress status of vitamin C deficient rat hearts. Cardiovasc Res 2001;51(1):89 – 99. [32] Busche S, Gallinat S, Bohle RM, Reinecke A, Seebeck J, Franke F, et al. Expression of angiotensin AT(1) and AT(2) receptors in adult rat cardiomyocytes after myocardial infarction. A single-cell reverse transcriptase-polymerase chain reaction study. Am J Pathol 2000; 157(2):605 – 11. [33] Leri A, Liu Y, Li B, Fiodaliso F, Malhotra A, Latini R, et al. Upregulation of AT(1) and AT(2) receptors in postinfarcted hypertrophied myocytes and stretch-mediated apoptotic cell death. Am J Pathol 2000;156(5):1663 – 72. [34] Nio Y, Matsubara H, Murasawa S, Kanasaki M, Inada M. Regulation of gene transcription of angiotensin II receptor subtypes in myocardial infarction. J Clin Invest 1995;95(1):46 – 54. [35] Yang BC, Phillips MI, Ambuehl PE, Shen LP, Mehta P, Mehta JL. Increase in angiotensin II type 1 receptor expression immediately after ischemia–reperfusion in isolated rat hearts. Circulation 1997;96(3): 922 – 6. [36] Thomas GP, Ferrier GR, Howlett SE. Losartan exerts antiarrhythmic activity independent of angiotensin II receptor blockade in simulated ventricular ischemia and reperfusion. J Pharmacol Exp Ther 1996;278(3):1090 – 7. [37] Baracho NC, Simoes-e-Silva AC, Khosla MC, Santos RA. Effect of selective angiotensin antagonists on the antidiuresis produced by angiotensin-(1–7) in water-loaded rats. Braz J Med Biol Res 1998; 31(9):1221 – 7. [38] Widdowson PS, Renouard A, Vilaine JP. Binding of [3H]angiotensin II and [3H]DuP 753 (Losartan) to rat liver homogenates reveals multiple sites. Relationship to AT1a- and AT1b-type angiotensin receptors and novel nonangiotensin binding sites. Peptides 1993; 14(4):829 – 37. [39] Griendling KK, Ushio-Fukai M. Reactive oxygen species as mediators of angiotensin II signaling. Regul Pept 2000;91(1–3):21 – 7. [40] Van Der Vusse GJ, Reneman RS, Van Bilsen M. Accumulation of arachidonic acid in ischemic/reperfused cardiac tissue: possible causes and consequences. Prostaglandins Leukot Essent Fat Acids 1997; 57(1):85 – 93. [41] Zhao X, Bey EA, Wientjes FB, Cathcart MK. Cytosolic phospholipase A2 (cPLA2) regulation of human monocyte NADPH oxidase activity. cPLA2 affects translocation but not phosphorylation of p67(phox) and p47(phox). J Biol Chem 2002;277(28):25385 – 92.
Pharmacological concentration of angiotensin-(1–7) activates NADPH oxidase after ischemia–reperfusion in rat heart through AT1 receptor stimulation Alexandra Oudot*, Catherine Vergely, Aline Ecarnot-Laubriet, Luc Rochette Laboratoire de Physiopathologie et Pharmacologie, Cardio-vasculaires Expe´rimentales, IFR no. 100, Faculte´s de Me´decine et Pharmacie, 7, Boulevard Jeanne d’Arc-BP 87900, 21079 Dijon, France Received 26 July 2004; received in revised form 20 October 2004; accepted 27 October 2004 Available online 19 November 2004
Abstract The cardiovascular role of angiotensin-(1–7), especially in the functional and metabolic alterations associated with ischemia–reperfusion (IR), is still not clearly defined. Our objective was to evaluate the cardiac effects of angiotensin-(1–7), the receptors involved, and their relationships with NADPH oxidase activation under non-ischemic conditions and, during an ischemia–reperfusion sequence. Isolated perfused rat hearts underwent 45 min of non-ischemic perfusion, or 30 min of global ischemia followed by 30 min of reperfusion. Angiotensin-(1–7) and/or AT1 receptor blocker losartan or angiotensin-(1–7) receptor antagonist (d-Ala7)–angiotensin-(1–7) were perfused. Our results showed that angiotensin-(1–7) was without effect at low concentrations (1010 to 107 M). At a pharmacological concentration, 0.5 AM angiotensin-(1–7) induced vasoconstriction, which was antagonised by losartan. After ischemia, we noted a partial recovery of functional parameters, which was not modified by any of the treatments. The expression of AT1 receptor mRNA was increased by ischemia– reperfusion, except in (d-Ala7)–angiotensin-(1–7) treated hearts. Angiotensin-(1–7) further increased the AT1 expression. NADPH oxidase activity was enhanced in 0.5 AM angiotensin-(1–7)-treated hearts subjected to ischemia–reperfusion, this effect was totally reversed by losartan. This is the first time that it has been shown that, in the heart, angiotensin-(1–7) at pharmacological concentration activates NADPH oxidase, an enzyme thought to be involved in several angiotensin II effects. D 2004 Elsevier B.V. All rights reserved. Keywords: Renin–angiotensin system; NADPH oxidase; Heart; AT1 receptor
1. Introduction The renin–angiotensin system (RAS) is considered as one of the major regulatory systems for cardiovascular homeostasis. Though angiotensin II is the most potent peptide of the RAS, angiotensin-(1–7) (Ang-(1–7)), a heptapeptide that lacks phenylalanine at position 8 of the angiotensin II peptide, is now thought to be a biologically active component of this system [1]. Ang-(1–7) is formed from angiotensin II through carboxy-terminal phenylalanine residue cleavage not only by prolyl-carboxypeptidases and * Corresponding author. Tel.: +33 380 39 32 92; fax: +33 380 39 32 93. E-mail address: [email protected] (A. Oudot). 0167-0115/$ - see front matter D 2004 Elsevier B.V. All rights reserved. doi:10.1016/j.regpep.2004.10.013
prolyl-endopeptidases, but also by an angiotensin-converting enzyme (ACE)-independent pathway by direct hydrolysis of angiotensin I by tissue-specific endopeptidases. Moreover, an enzyme involved in the production of Ang(1–7) from angiotensin II has been recently isolated as ACE2 [2]. An important route for inactivation of this heptapeptide appears to be the cleavage to Ang-(1–5) by ACE. The Ang-(1–7) receptor has been identified and is the G-protein-coupled receptor Mas [3]. The circulating levels of Ang-(1–7) were shown to increase during ACE inhibition, which could be accounted for by both an increase in its precursor Ang I, and a decrease in its degradation by ACE [4]. Recent observations suggest that the accumulation of this peptide may play a substantial role in the
102
A. Oudot et al. / Regulatory Peptides 127 (2005) 101–110
cardiovascular effects of RAS blockade [4,5]. Although the heart seems to be an important site for Ang-(1–7) synthesis, the cardiac actions of this peptide are still not very well understood [6]. Even though, the biological responses of Ang-(1–7) are generally given as the opposite of those of angiotensin II [5,7,8], some of them are similar [9–11]. Some investigators have suggested that the biological actions of Ang-(1–7) may be mediated only by a specific receptor [12–14], while others have shown that AT1 receptors could also be involved [15,16]. Though the evidence is growing that the RAS plays a major role during ischemia–reperfusion (IR), the exact mechanisms involved in this still need to be clearly established. It is generally accepted that the production of oxygen-derived radical species is one of the major events involved in the initiation, maintenance and reversibility of metabolic and functional alterations associated with IR injury [17]. However, while the exact mechanisms of postischemic oxidative stress have not yet been elucidated, a close link could be established between the RAS and the production of radical species. In fact, it has been shown that NADPH oxidase, a superoxide-producing enzyme, could be activated through angiotensin II stimulation [18]. In this respect, the implication of Ang-(1–7) during myocardial IR has been poorly investigated, but it has recently been shown that Ang-(1–7) could enhance oxidative stress [19,20]. Therefore, we investigated the cardiac effects of Ang(1–7) and analyzed the concomitant NADPH oxidase expression and activity in isolated rat hearts (1) under control conditions of perfusion and, (2) during an IR sequence.
2. Methods 2.1. Chemicals All chemicals were bought from Sigma (France), except losartan which was obtained from Merck Sharp and Dohm (Ireland), and angiotensin-(1–7) and (d-Ala7)–angiotensin(1–7) which were from Bachem Biochimie (France). 2.2. Perfusion technique and perfusion medium The investigation conforms to the European convention for the use of laboratory animals, which is in agreement with the Guide for the Care and Use of the Laboratory Animals published by the US National Institutes of Health (NIH publication no. 85-23, revised 1996). Male Wistar rats (280– 330 g) were purchased from Depre´ (France). The rats were anaesthetized with sodium thiopental (60 mg/kg, i.p.) and heparin was intravenously injected (500 IU/kg). After 1 min, the hearts were excised and placed in a cold (4 8C) perfusion buffer bath until contractions ceased. Each heart was then immediately cannulated through the aorta and perfused at 37 8C by the Langendorff method, at a constant
perfusion pressure equivalent to 80 cm of water (8 kPa). The perfusion buffer consisted of a modified Krebs–Henselheit bicarbonate buffer (KH) (millimolar concentrations: NaCl 118, NaHCO3 25, MgSO4 1.2, KH2PO4 1.2, KCl 4.5, glucose 5.5 and CaCl2 3). The perfusion fluid was filtered through a 0.8-Am Millipore filter to remove any particulate contaminants and gassed with 95% oxygen and 5% carbon dioxide (pH 7.3–7.5 at 37 8C). An elastic water-filled latex balloon (no. 4, Hugo Sachs, Germany) was inserted into the left ventricle through the mitral valve, connected to a pressure transducer, and inflated to obtain an end-diastolic pressure (LVEDP) of between 6 and 12 mm Hg (0.8–1.6 kPa). A Gould TA 240 recorder was used to measure intraventricular pressures (LVEDP and left ventricular systolic pressure (LVSP), left ventricular developed pressure (LVDP)=LVSPLVEDP) and heart rate (HR)). The ratepressure product (RPP) was calculated from the product of LVDP (mm Hg) and HR (beats min1) and expressed in mm Hg beats min1. During post-ischemic recovery, RPP was expressed as a percentage of the preischemic value (measured just before the onset of ischemia). In the dose– response study, the perfusion system was switched to a constant flow mode using a peristaltic pump (Gilson). A supplementary pressure transducer was connected upstream of the coronary bed and linked to a Gould TA recorder to measure coronary perfusion pressure (CPP). In the studies with constant perfusion pressure, coronary flow (CF) was measured by the timed collection of the effluent. 2.3. Dose–response study Two groups, each composed of five hearts were constituted. After a 15-min stabilization period under constant pressure mode, CF was measured and the hearts were switched to the corresponding constant flow mode (10–12 ml/min) and stabilized for an additional 15-min period. The treated hearts (n=5) were perfused for 2 min with bradykinin (BK) at a final concentration of 30 nM to test the endothelial reactivity. After 5 min of recovery, increasing concentrations of Ang-(1–7) were perfused for 5 min (1010, 109, 108, 107, 5107, 106 and 105 M). Five minutes after the end of the last Ang-(1–7) concentration perfusion, BK (30 nM) was reperfused for 2 min. Angiotensin-(1–7) and bradykinin were dissolved in NaCl 0.9% and administered upstream of the heart with a mini-pump (Harvard Apparatus), at an infusion rate adjusted to 1/40 of the CF, ensuring the required final concentration. A control group was constituted (n=5) and perfused in the same conditions as the treated group, but with saline buffer (NaCl 0.9%). 2.4. Perfusion protocols Fourteen groups, each composed of six to nine hearts, were subjected to different perfusion protocols at 37 8C (Fig. 1). After 15 min of stabilization, isolated hearts were perfused aerobically for 15 min (pre-ischemic control
A. Oudot et al. / Regulatory Peptides 127 (2005) 101–110
103
Fig. 1. Perfusion protocols of isolated rat hearts. Hearts were either perfused under non-ischemic (NI) conditions (a), or subjected to the ischemia–reperfusion (IR) protocol (b). The NI perfusion protocol (a) consisted of 45-min NI perfusion. The IR protocol (b) consisted of 15-min NI perfusion followed by 30 min of total global ischemia and 30 min of reperfusion. Drugs (Ang-(1–7) 0.1 or 0.5 AM, Losartan 1 AM, and (d-Ala7)–Ang-(1–7) 1 AM) were infused as indicated in the frame.
period). Non-ischemic hearts (NI) (Fig. 1a) were perfused for an additional 30-min period. In groups undergoing ischemia–reperfusion (IR) (Fig. 1b), global normothermic ischemia was induced by clamping aortic inflow for 30 min, during which a thermoregulated chamber maintained the heart temperature at 37 8C. After ischemia, aortic inflow was resumed for 30 min (reperfusion period). Seven groups were constituted in each series (NI and IR): each group receiving either vehicle (NaCl 0.9%) (control group, n=9), Ang-(1–7) 0.1 AM (n=6), Ang-(1–7) 0.5 AM (n=9), losartan 1 AM (n=9), (d-Ala7)–Ang-(1–7) 1 AM (n=6), Ang-(1–7) 0.5 AM+(d-Ala7)–Ang-(1–7) 1 AM coadministration (n=6), or Ang-(1–7) 0.5 AM+losartan 1 AM co-administration (n=6) as described in Fig. 1. Ang-(1–7) was diluted in the perfusion buffer in order to obtain a final concentration of 0.1 or 0.5 AM. The concentrations of Ang(1–7) were based on the results obtained in the dose– response study. (d-Ala7)–angiotensin-(1–7) ((d-Ala7)–Ang(1–7)), an Ang-(1–7) receptor blocker, was dissolved at the concentration of 40 AM in NaCl 0.9% and administered upstream of the coronary bed with a mini-pump (Harvard
Apparatus), at an infusion rate adjusted to 1/40 of the CF, ensuring a final concentration of 1 AM. This concentration has been shown to block Ang-(1–7)-specific effects without competing for angiotensin II binding sites as determined by binding studies [21]. The AT1 receptor antagonist losartan was dissolved and administered in the same way, ensuring a final concentration of 1 AM. We chose the 1 AM concentration of losartan because it has been shown by radioligand binding that at this concentration 100% of the AT1 receptors were occupied [22]. 2.5. Tissue processing After each experimental perfusion protocol, the atria were rapidly excised and the remainder of the heart was instantaneously frozen, crushed in liquid nitrogen and kept at 70 8C until use. Afterwards, the hearts were homogenised in either 3 volumes of KH/Hepes 25 mM (1:1), or in 5 volumes of Trizol. KH/Hepes homogenates were used for the evaluation of NADPH oxidase activity. Trizol homogenates were used to extract total cytoplasmic RNA.
104
A. Oudot et al. / Regulatory Peptides 127 (2005) 101–110
Table 1 Sequence, characteristics and amount of the (F) forward and (R) reverse primers used to amplify target cDNAs and temperature of PCR cycling mRNA
Sequence
Nucleotides localisation
Product length
Tm
Amount of primers (ng)
Hybridisation temperature (8C)
Number of cycles
GAPDH
(F)ACCACAGTCCATGCGATCAC (R)ACCACAGTCCATGCGATCAC (F)ACGACCAAAGGACCATCC (R)TTGATGTGTGGACTTGGG (F)CACATCCTCCACCAAAACCA (R)GGGACGCTTGACGAAAATGT (F)GGGGAAAGAGGAAAAAGGGC (R)GGTAGGTGGCTGCTTGATGG
1369–1388 1801–1821 1420–1435 1954–1971 570–589 971–990 197–216 470–489
453
55.2 55.2 51.4 48.7 55.2 56.2 57.6 56.6
100
55
28
300
55
40
300
55
36
300
55
36
AT1 gp91phox p22-phox
552 420 293
2.6. Quantification of gene transcripts by RT-PCR
2.8. Statistical analysis
AT1 receptor, and NADPH oxidase subunits (p22phox and gp91phox) mRNA expression were evaluated using RTPCR. The extraction of the total cytoplasmic RNA from cardiac homogenates was carried out as previously described [23]. The steady state level of the studied gene transcripts was evaluated by comparative RT-PCR assay, as previously described [24,25], using a GAPDH sequence internal standard. The sequence and location of primers, the size of amplicons, and the specific cycling parameters are given in Table 1. Densitometric quantification of fluorescent signals was performed by the image analyser Gel Doc 1000 system driven by the molecular Analyst software (Biorad, USA). The PCR amplification yield was expressed in arbitrary units (AU) as the ratio of the target per amplicon optical density and as a percentage of the NI control group.
All data were expressed as meansFS.E.M. For functional parameters, statistical analysis comparisons were performed with the one-factor ANOVA test. For molecular biology results and chemiluminescence, statistical analysis was performed with two-factor fully factorial ANOVA, the two factors being the type of perfusion protocol (NI perfusion versus IR) and the treatments applied. ANOVA (one or two factors) was followed by inter-group pair wise comparisons with Tukey HSD multiple comparisons.
The effects of 30 nM Bradykinin (BK) perfusion were examined at the beginning and at the end of the perfusion protocol (Fig. 2). After the stabilization phase, BK induced a significant decrease in CPP and a negative inotropic effect. The same effects were observed when BK was perfused after administration of increasing concentrations of Ang-(1– 7). There was no significant change in the reactivity to BK before and after Ang-(1–7) perfusion.
Control group (n=5) Before
Before
After
2000
5 0 -5 -10
Treated group (n=5)
After Change in RPP
The capacity of myocardial tissue to produce superoxide in an NADPH-dependent way, is a good indicator of NADPH oxidase activity, and was assessed using an LB 9507 luminometer (Berthold Systems, Aliquippa, PA, USA) by the measurement of superoxide-enhanced lucigenin chemiluminescence [26] as previously described [24]. One hundred microliters of the KH/Hepes homogenates (2.5–5 mg of protein) was transferred to a luminometer tube containing lucigenin (final concentration=0.5 AM) in KH/ Hepes (8:1) (final volume=1 ml). The baseline luminescence was recorded over a 5-min period. Then, the reaction was started by the addition of NADPH (final concentration=30 AM), and the production of light induced by superoxide attack on lucigenin was recorded for 15 min. Samples were mixed between each measure to ensure a homogenous and reproducible distribution of injected reagents in the luminometer tube. Homogenates alone, without the addition of NADPH, gave only a minimal signal. Protein content was measured in an aliquot of the homogenate by the method of Lowry et al. [27]. The maximal amplitude signal was determined by the difference between maximal photon production and baseline level. Results were expressed in maximal amplitude signal (arbitrary units) per g of protein (AU/g prot).
3.1. Dose–response study
Change in CPP (mmHg)
2.7. Determination of NADPH oxidase activity
3. Results
***
***
0 -2000 -4000
***
***
Fig. 2. Effects of 30 nM bradykinin perfusion on coronary perfusion pressure (CPP) and rate-pressure product (RPP). Results are expressed as a change in CPP or RPP after 1 min bradykinin 30 nM (or NaCl 0.9%) perfusion, and as meansFS.E.M. Before measure corresponds to the first bradykinin (or NaCl 0.9%) administration, before Ang-(1–7) (or NaCl 0.9%) treatment; after measure corresponds to the second bradykinin (or NaCl 0.9%) administration, after Ang-(1–7) (or NaCl 0.9%) treatment. ***Pb0.001 versus control group.
Change in CPP (mmHg)
A. Oudot et al. / Regulatory Peptides 127 (2005) 101–110 60
*
*
*
40 30 20 10
0 Ang-(1-7) (M) 0
Change in RPP
Control group (NaCl 0.9%) (n=5) Ang-(1-7)-treated group (n=5)
50
10-10
10-9
10-8
10-7
5.10-7
10-6
10-5
-2000
-4000
-6000
Fig. 3. Effects of increasing concentrations of Ang-(1–7) (or NaCl 0.9% for control group) on coronary perfusion pressure (CPP) and rate pressure product (RPP) of isolated perfused rat hearts. Results are expressed as meansFS.E.M. *Pb0.05 versus control group.
The cardiac effects of the administration of increasing concentrations of Ang-(1–7) are shown in Fig. 3. A dosedependent increase of CPP was observed during Ang-(1–7) perfusion. This variation became statistically different from the control group at concentrations above 5107 M. The administration of Ang-(1–7) did not induce significant modification of LVDP or HR, leading to no change in RPP evolution, compared to the NaCl 0.9% perfused group. 3.2. Functional parameters 3.2.1. Effects of angiotensin-(1–7), (d -Ala7)–angiotensin(1–7), and losartan under non-ischemic conditions of perfusion The effects of Ang-(1–7) and/or (d-Ala7)–Ang-(1–7) or losartan administration on functional parameters of isolated
105
rat hearts were observed over a 45-min period in conditions of non-ischemic perfusion (NI series). The values of functional parameters evaluated 15 min after the beginning of the experiment and at the end of the NI perfusion protocol are presented in Table 2. The perfusion of 0.1 AM Ang-(1–7), losartan, or (dAla7)–Ang-(1–7) did not modify the evolution of functional parameters during the perfusion protocol (CF, LVEDP, LVDP or HR). The perfusion of 0.5 AM Ang-(1–7) induced a 10% decrease in CF (compared to the control group), which reached 20% of diminution at the end of the 45-min perfusion. The co-administration of 1 AM losartan totally antagonised the vasoconstrictor effect of 0.5 AM Ang-(1–7) at the beginning of the perfusion protocol (Table 2, see coronary flow at 15 min perfusion), but this effect was attenuated after 45 min of NI perfusion since the decrease in the coronary flow induced by 0.5 AM angiotensin-(1–7) was not totally prevented by losartan administration. (d-Ala7)– Ang-(1–7) did not influence the coronary constriction induced by Ang-(1–7). Moreover, 0.5 AM Ang-(1–7) caused a slight, but significant 15% decrease of LVDP compared to the control group. Losartan co-administration reversed the Ang-(1–7) negative inotropic effect, whereas (d-Ala7)–Ang(1–7) co-perfusion was ineffective. Ang-(1–7) 0.5 AM did not influence LVEDP and HR. 3.2.2. Effects of angiotensin-(1–7), (d-Ala7)–angiotensin(1–7), and losartan on post-ischemic myocardial recovery The post-ischemic myocardial recovery of functional parameters was evaluated during 30 min of reperfusion (Table 3). The evolution of functional parameters before the induction of ischemia was similar to that described for NI groups during the first 15 min of the perfusion protocol. CF was only partially restored with reperfusion, reaching only 35% of the initial value for untreated and treated hearts, with no intergroup differences. From the onset of reperfusion, LVEDP rose rapidly to a peak value that was obtained in 3 min, then steadily decreased, but remained at a high level
Table 2 Functional parameters of isolated perfused hearts measured 15 and 45 min after the beginning of the perfusion protocol (NI series) Control
15-min perfusion CF (ml/min) LVEDP (mm Hg) LVDP (mm Hg) HR (beats/min) 45-min perfusion CF (ml/min) LVEDP (mm Hg) LVDP (mm Hg) HR (beats/min)
Ang-(1–7)
Losartan
(d-Ala7)–Ang-(1–7)
Ang-(1–7) + Losartan
Ang-(1–7) + (d-Ala7)–Ang-(1–7)
0.1 AM
0.5 AM
11.4F0.2 7.7F0.8 128.3F3.0 283.1F4.9
10.7F0.2 10.3F0.6 120.5F7.6 280.0F14.6
9.8F0.5* 9.2F0.5 109.8F2.9* 293.3F11.5
11.3F0.3 8.6F0.5 127.8F3.9 288.9F6.9
11.1F0.4 10.3F0.4 121.5F7.7 276.7F3.3
10.4F0.2 9.8F0.5 124.8F5.2 288.3F6.2
10.1F0.3* 9.9F0.5 105.6F3.8* 280.0F6.0
10.5F0.2 7.4F0.6 113.0F2.9 264.4F5.6
8.9F0.3 9.3F0.8 94.8F4.4 270.0F12.4
8.6F0.5** 8.2F0.6 91.8F2.9* 273.3F10.0
10.3F0.3 7.2F0.8 113.4F4.8 268.8F8.9
10.2F0.6 8.5F0.4 108.8F8.4 266.7F9.9
8.7F0.2* 9.3F0.5 111.2F7.6 260.0F8.9
8.3F0.7** 9.3F0.7 89.8F3.6* 253.3F6.7
Coronary flow (CF), left ventricular end-diastolic pressure (LVEDP), left ventricular developed pressure (LVDP), heart rate (HR), non-ischemic (NI). * Pb0.05 versus control group. ** Pb0.01 versus control group.
106
A. Oudot et al. / Regulatory Peptides 127 (2005) 101–110
Table 3 Functional parameters of isolated perfused hearts measured after the 30-min reperfusion period following 30 min of global total ischemia (IR series) Control
End reperfusion CF (ml/min) LVEDP (mm Hg) LVDP (mm Hg) RPP (%) Rhythm disturbances (min)
4.0F0.5 66.4F8.3 23.6F6.7 14.6F6.4 19.4F2.4
Ang-(1–7) 0.1 AM
0.5 AM
4.0F0.5 75.8F6.1 22.0F6.3 15.9F6.0 16.6F3.8
4.5F0.3 73.1F5.3 24.3F6.9 12.9F5.9 15.7F3.1
Losartan
(d-Ala7)– Ang-(1–7)
Ang-(1–7) + Losartan
Ang-(1–7) + (d-Ala7)–Ang-(1–7)
4.2F0.7 82.7F2.4 22.4F5.7 11.8F3.8 14.9F3.9
4.8F0.4 83.6F6.3 25.3F9.5 13.4F7.7 16.4F5.1
4.8F0.3 85.2F5.7 28.3F12.5 11.0F7.0 13.83F4.2
4.4F0.3 78.0F9.3 26.8F6.3 21.9F8.3 15.00F4.0
Coronary flow (CF), left ventricular end-diastolic pressure (LVEDP), left ventricular developed pressure (LVDP), rate pressure product (RPP), ischemia– reperfusion (IR).
during the 30 min of reperfusion (66.4F8.3 mm Hg, control group). This post-ischemic contracture was not modified by any of the treatments. With reperfusion, LVDP recovered only very slowly and remained at a low level, reaching about 20% of its initial value at the end of the reperfusion (23.6F6.7 mm Hg, control group). The evolution of ratepressure product (RPP), calculated from the product of LVDP and HR, is a good index of post-ischemic recovery, and was found to show a similar pattern to that described for LVDP, with no intergroup differences. Since arrhythmias were very frequent during post-ischemic reperfusion, HR did not give us any relevant information about myocardial functional recovery and is not presented in Table 3. Although the correct classification of rhythm abnormalities must be defined according to Lambeth’s conventions on electrocardiographic criteria [28], monitoring ventricular
pressure allowed us to evaluate the contraction abnormalities that reflect reperfusion arrhythmias. Ventricular contractile disturbances were frequently observed after 30 min of a global normothermic ischemia with a mean duration of 19.4F2.4 min in control hearts (Table 3), and were mostly represented by tachycardia and fibrillations. The duration of these disturbances was not significantly modified by any of the treatments. 3.3. Angiotensin AT1 receptor mRNA expression The expression of angiotensin AT1 receptor mRNA was determined at the end of the experimental protocol in the non-ischemic hearts (NI series) and hearts undergoing 30 min of total global ischemia and 30 min of reperfusion (IR series) (Fig. 4).
Fig. 4. mRNA expression of AT1 receptors in rat hearts subjected to the different treatments and perfusion protocols (n=6 in each group). Results are expressed as a percentage of the control NI group, and as meansFS.E.M. ***Pb0.001 versus control group; yyyPb0.001 versus NI corresponding group.
A. Oudot et al. / Regulatory Peptides 127 (2005) 101–110
In NI hearts, none of the four treatments modified the expression of AT1 receptors. However, the expression of AT1 receptor mRNA was markedly increased after 30 min of ischemia and 30 min of reperfusion, as compared to the NI series, except in hearts treated by (d-Ala7)–Ang-(1–7) (alone, or co-perfused with Ang-(1–7)). In IR series, AT1 receptor mRNA expression was significantly enhanced by 0.5 AM Ang-(1–7) administration compared to the control ischemic group, whereas Ang-(1–7) 0.1 AM had no influence. This increase was totally antagonised not only by losartan, but also by (d-Ala7)–Ang-(1–7) co-perfusion. Losartan or (d-Ala7)– Ang-(1–7) infusion alone did not affect AT1 mRNA expression.
107
3.5. NADPH oxidase activity in heart tissue NADPH oxidase activity was assessed at the end of the experimental protocol in NI and IR hearts (Fig. 6). The activity of NADPH oxidase in NI hearts was not modified by any of the treatments. However, IR hearts treated with 0.5 AM Ang-(1–7) showed increased enzyme activity. Losartan co-administration suppressed this effect, whereas (d-Ala7)–Ang-(1–7) co-perfusion had no effect. Losartan and (d-Ala7)–Ang-(1–7) infusion alone did not affect NADPH oxidase activity in IR groups.
4. Discussion 3.4. NADPH oxidase subunits mRNA expression The mRNA expression of p22phox and gp91phox was analysed in the hearts subjected to the different perfusion protocols and treatments (Fig. 5). None of the treatments was shown to affect p22phox and gp91phox expression either in NI hearts, or in hearts undergoing IR. There were no overall differences between NI and IR hearts in the expression of the subunits.
There is no consensus about the vascular and cardiac effects of Ang-(1–7), and the mechanisms involved are still not clearly understood. In the present study, we observed preliminary experiments, which showed that increasing concentrations of Ang-(1–7) exerted vasoconstrictive effects on coronary arteries of isolated perfused rat hearts, without impairing the integrity of the endothelium since the vascular reactivity to bradykinin was not modified. From this dose–
Fig. 5. mRNA expression of NADPH oxidase subunits (p22phox and gp91phox) in rats hearts subjected to the different treatments and perfusion protocols (n=6 in each group). Results are expressed as a percentage of the control group, and as meansFS.E.M.
108
A. Oudot et al. / Regulatory Peptides 127 (2005) 101–110
Fig. 6. NADPH oxidase activity in cardiac homogenates obtained by measurement of lucigenin chemiluminescence. Results are expressed as meansFS.E.M. **Pb0.01 versus control group.
response study, we set out to examine the effects of a nonvasoactive concentration of Ang-(1–7): 0.1 AM (107 M) and of a vasoactive concentration: 0.5 AM (5107 M) in the following experiments. Using the isolated rat heart model, Ang-(1–7) appeared either to exert no effect on coronary flow when administered at low doses (2 ng/mlc2.2 nM) [7], or to be vasoconstrictive at higher concentrations (27–210 nM) [29]. These observations are in accordance with the results obtained in our study, even though Neves et al. [29] observed coronary vasoconstrictive actions of Ang-(1–7) above 27 nM. However, their perfusion buffer differed from ours. Since losartan, but not (d-Ala7)–Ang-(1–7), reversed these Ang-(1–7) vasoconstrictive effects, they are likely to be linked to AT1 receptors activation as already suggested [10,14]. Nevertheless, this antagonism by Losartan did not last, which may suggest that, non-AT1 receptors might also be involved or that losartan antagonism was not sufficiently pronounced. Actually, Ang-(1–7) was described as either a vasorelaxant [1], or a vasoconstrictor [10], and could be either an activator of prostaglandins and nitric oxide release [7,8,20], or a stimulator of vasopressin release [11]. In addition, evidence for the obvious differences in the vascular effects of Ang-(1–7) among species and vascular beds has been provided by several studies [30]. After 30 min of total global ischemia, functional parameters only partially recovered with reperfusion (35% of CF, 20% of LVDP, 15% of RPP), an observation that corresponds to the data usually obtained in our laboratory [31]. None of the treatments applied influenced the postischemic myocardial functional recovery. To date, only two experimental studies have concerned the effects of Ang-(1–
7) during myocardial IR [13,29], and very low doses of Ang-(1–7) were perfused (0.22, 27 nM). The effects of higher concentrations of Ang-(1–7) have not yet been reported. In our study, the AT1 receptor mRNA expression was found to be upregulated with IR (nearly six times). This up-regulation of AT1 receptors has already been reported after myocardial infarction [32–34], and after IR injury [35], suggesting that this event is not only a long-term consequence of ischemia but also occurs immediately after an IR sequence. In contrast with the results reported by Yang et al. [35], which studied Ang II in conditions close to those adopted in our work, our data did not show the attenuation of the AT1 receptor up-regulation by 1 AM losartan. However, these authors chose to perfuse losartan at a concentration 10 times higher (10 AM) than the one used in our work (1 AM). evidence has been provided [36] that the effects of high concentrations of this compound could be independent of AT1 blockade. IR-induced AT1 receptor upregulation was prevented by (d-Ala7)–Ang-(1–7), suggesting the possible involvement of a (d-Ala7)–Ang-(1–7)sensitive receptor (distinct from AT1) in AT1 up-regulation after IR. The functional consequences of this up-regulation are not clearly demonstrated and remain to be elucidated. Yang et al. [35] proposed that the marked increase in AT1 receptor expression after IR sequence could contribute to the increase in coronary vascular resistance and cardiac dysfunction. This interpretation is not compatible with our findings since no influence of (d-Ala7)–Ang-(1–7) perfusion was noted in post-ischemic myocardial functional contracture compared to control hearts. Contrary to the NI series, the AT1 receptor mRNA expression was further enhanced by 0.5 AM Ang-(1–7) treatment in IR hearts,
A. Oudot et al. / Regulatory Peptides 127 (2005) 101–110
suggesting the hypothesis that a link could be established between Ang-(1–7) and AT1 receptors. This Ang-(1–7)induced AT1 receptor up-regulation after IR was totally antagonised by losartan co-perfusion, but also by (d-Ala7)– Ang-(1–7) which bind poorly to AT1 receptors [21]. This finding suggest that the up-regulation of AT1 receptors is mediated through the activation of a non-AT1 angiotensin receptor by Ang-(1–7) [37]. This hypothesis is further supported by observations showing that losartan can bind to non-angiotensin II binding sites [38]. Therefore, it could be hypothesized that this major up-regulation of AT1 receptor could be modulated by angiotensin-(1–7) and its specific receptor. Nevertheless, the implication of AT1 receptor activation could not be totally excluded since the reversion of Ang-(1–7) effects by (d-Ala7)–Ang-(1–7) could constitute an artefact caused by the specific actions of this compound on AT1 receptor up-regulation by IR. It has been well established that Ang II can activate NADPH oxidase through an AT1 mediated pathway [39]. However, the effects of heptapeptide Ang-(1–7) on NADPH oxidase are poorly documented. In our experimental conditions, none of the treatments administered influenced NADPH oxidase expression or activity, suggesting that, despite AT1-mediated vasoconstrictive effects, Ang-(1–7) peptide did not interact with myocardial NADPH oxidase. The binding of Ang-(1–7) to AT1 receptors, might not be sufficient to activate the cellular mechanisms which lead to NADPH oxidase activation. Recently, Heitsch et al. [20] reported that the NO release from the endothelial cells after stimulation of putative Ang-(1–7) receptors was associated with very low concomitant production of superoxide. They speculated that Ang-(1–7) interacts with multiple binding sites on endothelial cells, the signal transduction pathway coupled to the Ang-(1–7) receptor being unknown. No incidence of the IR sequence on NADPH oxidase expression and activity was observed, which agrees with recent results. However, concerning the activity of the enzyme in the myocardial tissue subjected to IR, we observed that Ang-(1–7) perfusion could increase NADPH oxidase activity after I and R, an effect that seems to be mediated through AT1 receptor stimulation. Since p22phox and gp91phox mRNA levels were not changed, the mechanisms involved in the oxidase activation seemed to be transcription-independent. Losartan co-administration suppressed this Ang-(1–7)-induced NADPH oxidase activation, where as (d-Ala7)–Ang-(1–7) co-perfusion had no influence. Consequently, these effects could be directly related to AT1 receptor activation. Nevertheless, it appears that IR might trigger modifications that allow Ang-(1–7) to stimulate this enzyme. The most probable explanation could be the enhancement of AT1 receptor activation due to the up-regulation of this receptor induced by an IR sequence. Arachidonic acid produced by phospholipase A2, which has been shown to be enhanced by IR [40], was recently demonstrated to regulate NADPH oxidase activation by modulating the translocation of p47phox and p67phox to the
109
membrane [41]. These results could explain why NADPH oxidase mRNA was not changed while enzyme activity was enhanced in IR hearts in the presence of 0.5 AM Ang-(1–7). In conclusion, this study showed that an Ang-(1–7) concentration of 0.1 AM did not only modify cardiac functional parameters of isolated rat heart during a nonischemic perfusion, but also during ischemia–reperfusion. However, pharmacologic concentrations of Ang-(1–7) (0.5 AM) were vasoconstrictive and increased NADPH oxidase activity after ischemia reperfusion through AT1 receptor stimulation. These effects were probably linked to the important up regulation of AT1 receptors observed after ischemia–reperfusion sequence. This is the first time that it has been shown that, in the heart, Ang-(1–7) activates NADPH oxidase, an enzyme thought to be involved in several angiotensin II effects. Acknowledgements A. Oudot was supported by a grant from the Socie´te´ Franc¸aise d’Hypertension Arte´rielle. The authors gratefully acknowledge the Conseil Re´gional de Bourgogne, the Faculty of Medicine of Dijon, and the fondation de France for their continuing support. The authors thank Didier Carnet and Philip Bastable for correcting the English in the manuscript. References [1] Ferrario CM, Iyer SN. Angiotensin-(1–7): a bioactive fragment of the renin–angiotensin system. Regul Pept 1998;78(1–3):13 – 8. [2] Burrell LM, Johnston CI, Tikellis C, Cooper ME. ACE2, a new regulator of the renin–angiotensin system. Trends Endocrinol Metab 2004;15(4):166 – 9. [3] Santos RA, Simoes e Silva AC, Maric C, Silva DM, Machado RP, de Buhr I, et al. Angiotensin-(1–7) is an endogenous ligand for the G protein-coupled receptor Mas. Proc Natl Acad Sci U S A 2003;100(14): 8258 – 63. [4] Iyer SN, Ferrario CM, Chappell MC. Angiotensin-(1–7) contributes to the antihypertensive effects of blockade of the renin–angiotensin system. Hypertension 1998;31(1 Pt 2):356 – 61. [5] Iyer SN, Chappell MC, Averill DB, Diz DI, Ferrario CM. Vasodepressor actions of angiotensin-(1–7) unmasked during combined treatment with lisinopril and losartan. Hypertension 1998;31(2): 699 – 705. [6] Santos RA, Campagnole-Santos MJ, Andrade SP. Angiotensin-(1–7): an update. Regul Pept 2000;91(1–3):45 – 62. [7] Almeida AP, Frabregas BC, Madureira MM, Santos RJ, CampagnoleSantos MJ, Santos RA. Angiotensin-(1–7) potentiates the coronary vasodilatatory effect of bradykinin in the isolated rat heart. Braz J Med Biol Res 2000;33(6):709 – 13. [8] Brosnihan KB, Li P, Ferrario CM. Angiotensin-(1–7) dilates canine coronary arteries through kinins and nitric oxide. Hypertension 1996;27(3 Pt 2):523 – 8. [9] Gironacci MM, Adler-Graschinsky E, Pena C, Enero MA. Effects of angiotensin II and angiotensin-(1–7) on the release of [3H]norepinephrine from rat atria. Hypertension 1994;24(4):457 – 60. [10] Kumagai H, Khosla M, Ferrario C, Fouad-Tarazi FM. Biological activity of angiotensin-(1–7) heptapeptide in the hamster heart. Hypertension 1990;15(2 Suppl.):I29 – 33.
110
A. Oudot et al. / Regulatory Peptides 127 (2005) 101–110
[11] Schiavone MT, Santos RAS, Brosnihan KB, Khosla MC, Ferrario CM. Release of vasopressin from the rat hypothalamo-neurohypophysial system by angiotensin-(1–7) heptapeptide. Proc Natl Acad Sci 1988;85:4095 – 8. [12] Tallant EA, Lu X, Weiss RB, Chappell MC, Ferrario CM. Bovine aortic endothelial cells contain an angiotensin-(1–7) receptor. Hypertension 1997;29(1 Pt 2):388 – 93. [13] Ferreira AJ, Santos RA, Almeida AP. Angiotensin-(1–7): cardioprotective effect in myocardial ischemia/reperfusion. Hypertension 2001;38(3 Pt 2):665 – 8. [14] Benter IF, Diz DI, Ferrario CM. Cardiovascular actions of angiotensin(1–7). Peptides 1993;14(4):679 – 84. [15] Champion HC, Czapla MA, Kadowitz PJ. Responses to angiotensin peptides are mediated by AT1 receptors in the rat. Am J Physiol 1998;274(1 Pt 1):E115 – 23. [16] Gironacci MM, Coba MP, Pena C. Angiotensin-(1–7) binds at the type 1 angiotensin II receptors in rat renal cortex. Regul Pept 1999;84(1–3): 51 – 4. [17] Vergely C, Tabard A, Maupoil V, Rochette L. Isolated perfused rat hearts release secondary free radicals during ischemia reperfusion injury: cardiovascular effects of the spin trap alpha-phenyl N-tertbutylnitrone. Free Radic Res 2001;35(5):475 – 89. [18] Rajagopalan S, Kurz S, Mqnzel T, Tarpey M, Freeman BA, Griendling KK, et al. Angiotensin II-mediated hypertension in the rat increases vascular superoxide production via membrane NADH/ NADPH oxidase activation. Contribution to alterations of vasomotor tone. J Clin Invest 1996;97(8):1916 – 23. [19] Gonzales S, Noriega GO, Tomaro ML, Pena C. Angiotensin-(1–7) stimulates oxidative stress in rat kidney. Regul Pept 2002;106(1–3): 67 – 70. [20] Heitsch H, Brovkovych S, Malinski T, Wiemer G. Angiotensin-(1–7)stimulated nitric oxide and superoxide release from endothelial cells. Hypertension 2001;37(1):72 – 6. [21] Santos RA, Campagnole-Santos MJ, Baracho NC, Fontes MA, Silva la, Neves la, et al. Characterization of a new angiotensin antagonist selective for angiotensin-(1–7): evidence that the actions of angiotensin-(1–7) are mediated by specific angiotensin receptors. Brain Res Bull 1994;35(4):293 – 8. [22] Hunyady L, Balla T, Catt KJ. The ligand binding site of the angiotensin AT1 receptor. Trends Pharmacol Sci 1996;17(4):135 – 40. [23] Assem M, Teyssier JR, Benderitter M, Terrand J, Laubriet A, Javouhey A, et al. Pattern of superoxide dismutase enzymatic activity and RNA changes in rat heart ventricles after myocardial infarction. Am J Pathol 1997;151(2):549 – 55. [24] Oudot A, Vergely C, Ecarnot-Laubriet A, Rochette L. Angiotensin II activates NADPH oxidase in isolated rat hearts subjected to ischaemia–reperfusion. Eur J Pharmacol 2003;462:145 – 54. [25] Ecarnot-Laubriet A, De Luca K, Vandroux D, Moisant M, Bernard C, Assem M, et al. Downregulation and nuclear relocation of MLP during the progression of right ventricular hypertrophy induced by chronic pressure overload. J Mol Cell Cardiol 2000;32(12):2385 – 95. [26] Iliou J, Villeneuve N, Fournet-Bourguignon M, Robin F, Jacquemin V, Lestriez V, et al. Mathematical treatment of chemiluminescence data allowing an optimised kinetic analysis of vascular NAD(P)Hdependent superoxide anion production. Analusis 2000;28:479 – 86.
[27] Lowry O, Rosenbrough N, Fair A, Randall R. Protein measurement with the Folin phenol reagent. J Biol Chem 1951;193:268 – 73. [28] Walker MJ, Curtis MJ, Hearse DJ, Campbell RW, Janse MJ, Yellon DM, et al. The Lambeth Conventions: guidelines for the study of arrhythmias in ischaemia infarction, and reperfusion. Cardiovasc Res 1988;22(7):447 – 55. [29] Neves LA, Almeida AP, Khosla MC, Campagnole-Santos MJ, Santos RA. Effect of angiotensin-(1–7) on reperfusion arrhythmias in isolated rat hearts. Braz J Med Biol Res 1997;30(6):801 – 89. [30] Lopez Ordieres MG, Gironacci M, Rodriguez de Lores Arnaiz G, Pena C. Effect of angiotensin-(1–7) on ATPase activities in several tissues. Regul Pept 1998;77(1–3):135 – 9. [31] Vergely C, Perrin C, Laubriet A, Oudot A, Zeller M, Guilland JC, et al. Postischemic myocardial recovery and oxidative stress status of vitamin C deficient rat hearts. Cardiovasc Res 2001;51(1):89 – 99. [32] Busche S, Gallinat S, Bohle RM, Reinecke A, Seebeck J, Franke F, et al. Expression of angiotensin AT(1) and AT(2) receptors in adult rat cardiomyocytes after myocardial infarction. A single-cell reverse transcriptase-polymerase chain reaction study. Am J Pathol 2000; 157(2):605 – 11. [33] Leri A, Liu Y, Li B, Fiodaliso F, Malhotra A, Latini R, et al. Upregulation of AT(1) and AT(2) receptors in postinfarcted hypertrophied myocytes and stretch-mediated apoptotic cell death. Am J Pathol 2000;156(5):1663 – 72. [34] Nio Y, Matsubara H, Murasawa S, Kanasaki M, Inada M. Regulation of gene transcription of angiotensin II receptor subtypes in myocardial infarction. J Clin Invest 1995;95(1):46 – 54. [35] Yang BC, Phillips MI, Ambuehl PE, Shen LP, Mehta P, Mehta JL. Increase in angiotensin II type 1 receptor expression immediately after ischemia–reperfusion in isolated rat hearts. Circulation 1997;96(3): 922 – 6. [36] Thomas GP, Ferrier GR, Howlett SE. Losartan exerts antiarrhythmic activity independent of angiotensin II receptor blockade in simulated ventricular ischemia and reperfusion. J Pharmacol Exp Ther 1996;278(3):1090 – 7. [37] Baracho NC, Simoes-e-Silva AC, Khosla MC, Santos RA. Effect of selective angiotensin antagonists on the antidiuresis produced by angiotensin-(1–7) in water-loaded rats. Braz J Med Biol Res 1998; 31(9):1221 – 7. [38] Widdowson PS, Renouard A, Vilaine JP. Binding of [3H]angiotensin II and [3H]DuP 753 (Losartan) to rat liver homogenates reveals multiple sites. Relationship to AT1a- and AT1b-type angiotensin receptors and novel nonangiotensin binding sites. Peptides 1993; 14(4):829 – 37. [39] Griendling KK, Ushio-Fukai M. Reactive oxygen species as mediators of angiotensin II signaling. Regul Pept 2000;91(1–3):21 – 7. [40] Van Der Vusse GJ, Reneman RS, Van Bilsen M. Accumulation of arachidonic acid in ischemic/reperfused cardiac tissue: possible causes and consequences. Prostaglandins Leukot Essent Fat Acids 1997; 57(1):85 – 93. [41] Zhao X, Bey EA, Wientjes FB, Cathcart MK. Cytosolic phospholipase A2 (cPLA2) regulation of human monocyte NADPH oxidase activity. cPLA2 affects translocation but not phosphorylation of p67(phox) and p47(phox). J Biol Chem 2002;277(28):25385 – 92.