- Email: [email protected]
Pharmacology of the human CGRP1 receptor in Cos 7 cells
peptides 27 (2006) 1367–1375
available at www.sciencedirect.com
journal homepage: www.elsevier.com/locate/peptides
Pharmacology of the human CGRP1 receptor in Cos 7 cells Richard J. Bailey, Debbie L. Hay * Proteomics & Biomedicine Research Group, School of Biological Sciences, University of Auckland, 3 Symonds Street, Private Bag 92 019, New Zealand
article info
abstract
Article history:
Only limited pharmacological characterization of the CGRP1 receptor, a heterodimer of the
Received 27 October 2005
calcitonin (CT) receptor-like receptor (CL) and receptor activity-modifying protein 1 has been
Received in revised form
performed in cells that do not endogenously express RAMP2. We characterized the receptor
15 November 2005
in RAMP-deficient Cos 7 cells by measuring cAMP responses following agonist treatment in
Accepted 16 November 2005
the absence or presence of antagonists. Potent cAMP responses to human a-and b-CGRP
Published on line 20 December 2005
(Cys(Et)2,7)haCGRP and human adrenomedullin (AM) were observed. Adrenomedullin15–52 was also an effective agonist of the CGRP1 receptor but human and salmon calcitonin and rat
Keywords:
amylin were only weak agonists. As expected, BIBN4096BS and CGRP8–37 were effective
BIBN4096BS
antagonists of the CGRP1 receptor. (Cys(Acm)2,7)haCGRP also antagonized CGRP responses.
Calcitonin receptor-like receptor
Antagonists of related receptors were only weakly able to inhibit CGRP responses. # 2005 Elsevier Inc. All rights reserved.
CGRP CGRP1 receptor Receptor activity modifying protein Abbreviations: AM, adrenomedullin AMY, amylin BIBN4096BS, 1-piperidinecarboxamide N-[2-[[5amino-l-[[4-(4-pyridinyl)l-piperazinyl]carbonyl]pentyl]amino]1-[(3,5-dibromo-4-hydroxyphenyl) methyl]-2-oxoethyl]-4-(1,4-dihydro2-oxo-3(2H)-quinazolinyl) CT, calcitonin CGRP, CT gene-related peptide CL, CT receptor-like receptor RAMP, receptor activity modifying protein
1.
Introduction
Calcitonin (CT) gene-related peptide (CGRP) is a potent vasodilator with pleiotropic pharmacological actions [3]. It
belongs to the CT peptide family. This group of peptides share many structural features and functional activities. There has been a resurgence of interest in the properties of CGRP in recent years with two important discoveries; CGRP receptors were
* Corresponding author. Tel.: +64 9 373 7599; fax: +64 9 373 7414. E-mail address: [email protected] (D.L. Hay). 0196-9781/$ – see front matter # 2005 Elsevier Inc. All rights reserved. doi:10.1016/j.peptides.2005.11.014
1368
peptides 27 (2006) 1367–1375
cloned [20] and the first high affinity, selective CGRP receptor antagonist was identified [9]. This antagonist, BIBN4096BS, is currently in late-stage development as a novel class of treatment for migraine and thus information regarding its mode and selectivity of action is of considerable interest [24]. Pharmacologically, two major phenotypes of CGRP receptor have been reported; CGRP1 and CGRP2 receptors [17]. The most consistent difference between them is their sensitivity (CGRP1) or insensitivity (CGRP2) to antagonism by the CGRP fragment CGRP8–37 but it has also been reported that they can be selectively activated by the linear CGRP analogs (Cys(Acm)2,7)haCGRP and (Cys(Et)2,7)haCGRP [17]. There is strong evidence to suggest that CGRP1 receptors are composed of heterodimeric complexes of the family B CT receptor-like receptor (CL) and the single transmembrane receptor activity modifying protein 1 (RAMP1) [26]. In contrast, the molecular nature of CGRP2 receptors has not been defined but there is evidence that AMY1(a) or AM2 receptors might contribute to reports of CGRP2 receptors; both receptors can be activated by CGRP and its linear analogs but are only weakly antagonized by CGRP8–37 [12,15,19]. In order to understand the contribution of different CGRP receptor subtypes to peptide physiology it is imperative to have undertaken thorough pharmacological characterization of CGRP receptors so that the in vivo use of agonists and antagonists can be appropriately interpreted. Although the pharmacology of CGRP1 receptors is relatively well defined, there has been no detailed functional analysis of recombinant CGRP1 receptors, composed of human CL and human RAMP1. In particular, many studies of transfected CGRP1 receptors have been performed in HEK293 cells which often endogenously express RAMP2 [1]. Thus, it is unclear how much of the apparent CGRP1 receptor response to adrenomedullin (AM) is due to inherent activity at CL/RAMP1 complexes or because of the formation of AM receptors, in addition to CGRP receptors. There is a similar issue for cell lines that endogenously express CGRP1 receptor components as they also invariably express RAMP2 (e.g. SK-N-MC, L6) [5]. Furthermore, the functional effects of antagonists have not been studied in depth at CGRP1 receptors. Therefore, in this study we sought to determine agonist potencies and antagonist pA2 or pKB (affinity) values for a selection of agonists and antagonists of CT peptide family receptors at CGRP1 receptors expressed in Cos 7 cells, cells which, in our hands, do not express significant levels of endogenous RAMPs.
2.
Materials and methods
2.1.
Materials
All peptides were purchased from Bachem (Bubendorf, Switzerland) except rat amylin (AMY) which was from Auspep (Parkville, Australia) and the 15–52 fragment of AM (AM15–52) was kindly provided by Professor David Coy (Tulane University Medical School, New Orleans). BIBN4096BS was a kind gift from Henri Doods (Boehringer Ingelheim). Isobutylmethylxanthine (IBMX), protein kinase A and activated charcoal were from Sigma. Dulbecco’s modified Eagle’s medium (DMEM) and fetal bovine serum (FBS) were from Invitrogen. Forskolin was from Tocris. All other reagents were of analytical grade.
2.2.
Reconstitution of drugs
BIBN4096BS was prepared as a 1 mM stock as previously described [14]. All peptides were dissolved in water to make 1 mM stock solutions which were stored as 10 ml aliquots at 30 8C in siliconized microcentrifuge tubes (Bio Plas). When making up the peptides, the peptide content was taken into account but where no data sheet was supplied, content was assumed to be 80%.
2.3.
Cell culture
Cos 7 cells (kindly donated by Dr. N. Birch, School of Biological Sciences, University of Auckland) were cultured in DMEM supplemented with 10% heat inactivated fetal bovine serum and 5% (v/v) penicillin/streptomycin and kept in a 37 8C humidified 95% air/5% CO2 incubator. Cells were subcultured as previously described [15]. Cells were plated into 96 well plates or T75 cm2 flasks one day prior to transfection so that cells were approximately 80% confluent for transfection.
2.4.
Transient transfection using polyethylenimine
Human CL with an N-terminal hemagglutinin (HA) epitope tag (YPYDVPDYA) [20], provided by Dr. S.M. Foord (GlaxoWellcome, Stevenage, UK) and sub-cloned into pcDNA3 (Invitrogen, Renfrew, UK) as previously described [6] was transfected along with human RAMP1, RAMP2 or RAMP3 into Cos 7 cells. Introduction of the epitope tag into human CL has been shown to make no significant difference to the pharmacology of the receptor [20]. The human CT receptor (CTR, insert negative form (CT(a))) was kindly provided by Dr. P.M. Sexton (Howard Florey Institute, University of Melbourne). All constructs were transfected using polyethylenimine (PEI). A 0.9 mg/ml (w/v) stock PEI solution (25 kDa, Aldrich (40,872–7)) was made by dissolving the PEI in distilled water and correcting the pH to 7.5 with dilute HCl. This solution was filter-sterilized and stored as frozen 1 ml aliquots. Plated cells were treated with a mixture of plasmid DNA (0.25 mg per well or 15 mg per flask) and PEI, in 5% glucose. The volume of PEI solution used was calculated by multiplying the total number of microgram DNA in each transfection mix by three (10 equivalents of amine nitrogen [2]). The DNA was diluted in 5% glucose, mixed and PEI added to it (not the other way round). This mixture was left to stand at room temperature for 15 min. The transfection mix was then added to normal culture media (including serum and antibiotics) so that it made up one-tenth of the final volume. Old growth media was aspirated from the cells and the transfection mix added in a volume of 100 ml per well or 12.5 ml per flask. RNA was harvested or cAMP assays were performed 36–48 h later.
2.5.
cAMP assay
cAMP assays were performed essentially as described previously [6,25], though modified to be performed in 96 well plates. Briefly, transfected cells were serum-deprived in DMEM containing 1 mM IBMX and 0.1% bovine serum albumin for 30–60 min. After this period, in most experiments, antagonists were added first followed, immediately by
peptides 27 (2006) 1367–1375
agonists. In some experiments, BIBN4096BS was added for 2 h prior to the addition of agonist. Forskolin (50 mM) was included as a positive control on each plate and plates were incubated at 37 8C for 15 min. The media was then aspirated from the wells and reactions terminated with ice-cold absolute ethanol. Ethanol was evaporated to dryness and cell extracts resuspended in 30 ml cAMP assay buffer (5 mM EDTA, 20 mM HEPES, pH 7.5). Twenty-five microlitre of the extracts were transferred to round-bottomed 96 well plates (Greiner), followed by 25 ml 3H-cAMP and 50 ml protein kinase A at previously determined concentrations [25]. The plate contents were gently agitated to mix the contents and then incubated at 4 8C for between 2 and 24 h. Activated charcoal (50 ml) was added to the wells which were mixed and then centrifuged at 3000 rpm (Eppendorf A-4-81 rotor in a 5810R centrifuge) for 5 min at 4 8C. Seventy-five microlitres of the supernatant was removed to a 96 well plate capable of being counted in a microbeta Trilux (Perkin-Elmer). Two hundred microlitre Starscint scintillation fluid (Packard) was added and the plates mixed and counted. Corrected counts per minute were converted to a percentage of the forskolin response which was expressed as 100%, samples that had not been treated with drug were expressed as 0%.
2.6.
1369
electrophoresed with a size marker for 60 min in a 2% (w/v) agarose gel containing SYBR SafeTM DNA gel stain (Molecular Probes) and visualized on a BioradTM imaging system under UV transillumination.
2.7.
Data analysis and statistics
Data were analyzed using Graphpad Prism version 4.02. Agonist pEC50 values were obtained from a four parameter logistic equation. For calculation of antagonist pKB or pA2 values, data were analyzed using Global Schild analysis as previously described [12]. Schild slopes were compared to one in each experiment; where the Schild slope was not significantly different to one, it was constrained to one. The reported Schild slope for BIBN4096BS is the mean value of Schild slopes that were calculated in five separate experiments (haCGRP versus BIBN4096BS). Where the Schild slope was not significantly different from unity the data are expressed as pKB values but where it was significantly different, pA2 values are used to describe antagonist potency. For statistical analysis, pEC50 or pA2/pKB values were evaluated using unpaired Student’s t-tests where only two values were compared or one-way ANOVA followed by Tukey’s or Dunnett’s test where multiple comparisons were appropriate.
RT-PCR
Total RNA was extracted from confluent T75 cm2 flasks containing transfected Cos 7 cells using TRIZOL1 Reagent (Invitrogen) according to the manufacturers protocol, resuspended in 50 ml DEPC treated water and stored at 80 8C. The concentration of total RNA was determined by a NanoDrop1 ND-1000 Spectrophotometer and RNA integrity was determined by gel electrophoresis. The total RNA concentrations ranged from 1100 to 2077 ng/ml. First strand cDNA was synthesized by using a SuperScriptTM first-strand synthesis system (Invitrogen). Total RNA (5 mg) was incubated with or without SuperScriptTM II reverse transcriptase (RT) in the presence of random hexamer primers. Both the RT and no-RT products were used as templates in PCR reactions containing primers developed for specificity to human RAMP1, 2 or 3, human CTR, human CL and African green monkey beta-2-microglobulin (B2m). The 50 –30 sequences and annealing temperatures of the primers were: human RAMP1 AAGCTGGGCTGCTTCTGG (forward) and ACACAATGCCCTCAGTGC (reverse), 58 8C; human RAMP2 ATTGCCTGGAGCACTTTGC and GCCTCACTGTCTTTACTCC, 58 8C; human RAMP3 TCGTGGGCTGCTACTGG and CTCACAGCAGCGTGTCG, 58 8C; human CTR CGCATACCAAGGAGAAGGTC and AGTTGGACCAGGTTCGATTG, 58 8C and human CL, CTCCTCTACATTATCCATGG and CCTCCTCTGCAATCTTTCC, 50 8C, respectively. The 50 –30 sequences and annealing temperature of the African green monkey B2m cDNA forward and reverse primers were CGTGCTCCAAAGATTCAGGT and ACGGCAGGCATACTCATCTT, 59 8C, respectively. The PCR reactions were performed in 20 ml volumes using PFU polymerase (Promega) and contained 2 ml of the appropriate RT products or no-RT reactions as template. Reactions containing no template were also set up as controls. The PCR cycling comprised a single step of 95 8C for 2 min followed by 35 cycles of 95 8C for 45 s, 50–58 8C for 45 s, 72 8C for 90 s and a single final extension step of 72 8C for 7 min. PCR products (10 ml) were
3.
Results
3.1. Characterization of background level of RAMPs in Cos 7 cells 3.1.1.
cAMP
Mock transfection of Cos 7 cells with empty vector (pcDNA3.1) did not yield significant elevation of cAMP above basal following human CT, CGRP or AM treatment (100 nM each) (Fig. 1A). Furthermore, transfection of RAMP1 alone did not induce cAMP responses to CGRP, suggesting that endogenous CL or CTR was not present. Likewise, transfection of CL alone did not lead to elevation of cAMP levels in response to CGRP or AM indicating that there were insufficient levels of endogenous RAMPs to produce CGRP or AM receptors. However, CGRP1 receptor (CL/RAMP1) transfected cells responded to haCGRP and CTR transfected cells responded to CT (Fig. 1A). Given that Cos 7 cells are of African green monkey origin it is possible that endogenous RAMPs or CL were present but were incapable of interacting with human receptor components. We do not feel that this is a likely scenario, however, given that mixed components from several species have previously been shown to interact [1,15].
3.1.2.
RT-PCR
As the sequences of African green monkey RAMPs, CL and CTR are currently unknown, primers were chosen based on the sequences of human RAMPs and receptors. It should be noted that the primers match, identically, sequences found in predicted Pan Troglodytes (chimpanzee) RAMP2, CL and CTR sequences. At the time of preparation of this manuscript only a partial Pan Troglodytes RAMP3 sequence was available. Our reverse RAMP3 primer aligned perfectly with this sequence but we were unable to confidently align our forward primer as
1370
peptides 27 (2006) 1367–1375
Table 1 – Agonist potency values at CGRP1 receptors Agonist
pEC50 S.E.M. (n)
haCGRP hbCGRP (Cys(Et)2,7)haCGRP hAM hAM15–52 hCT sCT rAMY
10.11 0.17 (9) 10.5 0.09 (5) 9.09 0.25 (7) 8.42 0.12 (s12) 7.77 0.22 (4) <6 (3) <6 (3) 6.63 0.12 (4)
is published, the data shown in Fig. 1B indicate that mock transfected Cos 7 cells do not express endogenous RAMPs, CL or CTR. Products were amplified, however, from transfected cells used as positive controls. In order to ensure the integrity of the RNA and consequent cDNA obtained from the mock transfected cells, B2m was used as a positive control. A product of anticipated size was amplified effectively.
3.2.
Fig. 1 – (A) Stimulation of cAMP production in response to a series of agonists in Cos 7 cells transfected with vector or various receptor components expressed as a percentage of that produced in response to 50 mM forskolin. CGRP1 denotes cells transfected with hCL and hRAMP1. Data shown are representative and values are mean W S.E.M. of triplicates; (B) expression of mRNA encoding RAMP1, 2, 3, CL, CTR and B2m in Cos 7 cells by RT-PCR. Lanes 1, 3, 5, 7 and 9 are positive controls for RAMP1, 2, 3, CL and CTR primers, respectively and show bands of predicted size (marked in bp). RNA was prepared from cells transfected with appropriate receptor components. Lanes 2, 4, 6, 8 and 10 are the paired results from vector transfected Cos 7 cells. No PCR products were detected. Lane 11 shows a B2m product in vector transfected Cos 7 cells, as a positive control for this cDNA.
the Pan Troglodytes RAMP3 sequence was incomplete. The forward primer for RAMP1 matches the Pan Troglodytes predicted RAMP1 sequence; there is a double base-pair change in the reverse primer. Although not completely conclusive until the complete sequence of African green monkey genome
Agonist potency
Co-transfection of human CL and human RAMP1 (CGRP1 receptors) into Cos 7 cells produced potent responses to CGRP as expected. Human a- and b-CGRP were equipotent and were significantly more potent than any of the other agonists tested (P < 0.01 one way ANOVA, followed by Tukey’s multiple comparisons test; Table 1). (Cys(Et)2,7)haCGRP and hAM were also potent agonists but were approximately 10-fold less potent than a- or b-CGRP (Table 1, Fig. 2A and B). The human AM fragment, AM15–52 was also able to stimulate cAMP production via the CGRP1 receptor (Table 1 and Fig. 2B). This was compared to its effect at AM1 and AM2 receptors where AM15–52 was a potent stimulator of cAMP, producing pEC50 values of 8.34 0.28 (n = 3) and 9.36 0.14 (n = 4), respectively (Fig. 2C and D). Rat AMY was a weak agonist of the CGRP1 receptor (Fig. 2A) and salmon CT or human CT gave little to no discernable response (not shown). (Cys(Acm)2,7)haCGRP was a very weak partial agonist, only occasionally eliciting a cAMP response above basal levels (Fig. 2A). Thus, a pEC50 could not be confidently determined for this peptide.
3.3.
Antagonists
As expected, BIBN4096BS was an effective antagonist of CGRP1 receptors and inhibited all agonists with equal affinity (Table 2, Fig. 3). Slow kinetics have previously been reported
Table 2 – Antagonist affinity values at CGRP1 receptors pKB S.E.M. (n)a haCGRP BIBN4096BS CGRP8–37 (Cys(Acm)2,7)haCGRP AM22–52 sCT8–32 AC187 AMY8–37 a
10.04 0.16 9.34 0.38 7.36 0.06 5.83 0.25 5.48 0.28 6.03 0.32 5.62 0.18
(5) (5) (3) (3) (3) (3) (3)
hbCGRP
hAM
(Cys(Et)2,7)haCGRP
9.96 0.2 (4) 8.8 0.41 (4) – – – – –
9.24 0.31 (5) 8.56 0.61 (3) – 6.15 0.02 (3) – – –
9.22 0.47 (4) 8.63 0.85 (3) – – – – –
Except BIBN4096BS where values are pA2 (Schild slope significantly different from 1; 1.52 0.16 (n = 5) for haCGRP vs. BIBN496BS).
peptides 27 (2006) 1367–1375
1371
Fig. 2 – Stimulation of cAMP production by CGRP1 receptors in response to (Cys(Et)2,7)haCGRP (CysEt) (Cys(Acm)2,7)haCGRP (CysACM) and rat AMY (rAMY) (A); stimulation of cAMP production by hAM or hAM15–52 at CGRP1 (B); AM1 (C); or AM2 (D) receptors. Data shown are from representative experiments. Values are mean W S.E.M. of duplicates. Experiments were repeated 3–12 times.
for BIBN4096BS [29]. Therefore, pre-incubation with BIBN4096BS for 2 h prior to agonist addition was compared with no BIBN4096BS pre-incubation. Although there was a trend towards increased affinity with a 2 h BIBN4096BS preincubation (pA2 10.35 0.27 (n = 3) after 2 h incubation versus no pre-incubation pA2 10.04 0.16 (n = 5)), this did not reach statistical significance (P > 0.05, Students’s t-test, data not shown). As has previously been demonstrated with this antagonist, the Schild slope differed significantly from one in most experiments (1.52 0.16 (n = 5)) [14]. Two hour preincubation with BIBN4096BS did not significantly modify the Schild slope (1.42 0.33 (n = 3)). CGRP8–37 was a potent, competitive antagonist of all agonists at CGRP1 receptors (Table 2, Fig. 4). CGRP8–37 was a weaker antagonist than BIBN4096BS at inhibiting agonist responses but this did not reach significance. Given that weak partial agonists often behave as antagonists and a recent report that (Cys(Acm)2,7)haCGRP may indeed behave in this manner [18], the ability of (Cys(Acm)2,7)haCGRP to inhibit haCGRP responses at CGRP1 receptors was evaluated. As shown in Fig. 5A and Table 2 (Cys(Acm)2,7)haCGRP was an effective antagonist of CGRP1 receptors. In contrast, the AM fragment AM22–52, salmon CT fragment sCT8–32 and rat AMY fragment AMY8–37 were all weak antagonists of CGRP1 receptors with similar pKB values (Fig. 5B and Table 2). AC187, a modified form of sCT8–32 was equally weak (Fig. 5B and Table 2).
4.
Discussion
This study provides the first comprehensive pharmacological analysis of recombinant CGRP1 receptors expressed in cells
that do not endogenously express significant levels of RAMP2. Such data provides a useful baseline for understanding the pharmacology of CGRP receptors in more complex systems. As binding studies have not historically been shown to be useful in defining CGRP receptor subtypes, we elected to functionally analyze the CGRP1 receptor in this study [7,8,27,28,31]. Analysis of agonist responses showed that human a- and bCGRP were equipotent agonists of CGRP1 receptors. This is supported by several other studies of CL/RAMP1 complexes of various species as reviewed in Poyner et al. [26]. Divergent responses between a- and b-CGRP have been reported elsewhere [16]. As both forms of CGRP seem to act equivalently at CGRP1 receptors, such reports suggest that this divergence may be due to the action of the CGRPs at alternative receptors, although factors such as differential metabolism cannot be excluded. Indeed, a- and b-CGRP are both reasonably potent agonists of AM2 receptors formed from CL/RAMP3 yet b-CGRP appears to be the more potent agonist, although this may be species dependent [15]. (Cys(Et)2,7)haCGRP was originally reported as a CGRP2 subtype selective agonist [10]. This property has since been disputed [22,33] and we provide further evidence here that this is an effective agonist of CGRP1 receptors. (Cys(Acm)2,7)haCGRP, another modified form of human a-CGRP has also been reported as a selective agonist of CGRP2 receptors. In the study presented here (Cys(Acm)2,7)haCGRP was certainly an ineffective agonist of CGRP1 receptors, in terms of cAMP production. (Cys(Acm)2,7)haCGRP has been reported to act as a partial agonist elsewhere [32]. It was recently reported that (Cys(Acm)2,7)haCGRP can act as an antagonist of CGRP in osteoblastic cells [18] and we provide data to support this observation here. The data confirm that these agents should
1372
peptides 27 (2006) 1367–1375
Fig. 3 – Antagonism of haCGRP (A); hbCGRP (B); (Cys(Et)2,7)haCGRP (cys Et) (C); or hAM (D) stimulated cAMP responses by various concentrations of BIBN4096BS, as indicated. Control is agonist alone with subsequent agonist curves also including increasing concentrations of antagonist. Data shown are from representative experiments. Values are mean W S.E.M. of duplicates. Experiments were repeated 4–5 times.
Fig. 4 – Antagonism of haCGRP (A); hbCGRP (B); (Cys(Et)2,7)haCGRP (cys Et) (C); or hAM (D) stimulated cAMP responses by various concentrations of CGRP8–37, as indicated. Control is agonist alone with subsequent agonist curves also including increasing concentrations of antagonist. Data shown are from representative experiments. Values are mean W S.E.M. of duplicates. Experiments were repeated 3–5 times.
peptides 27 (2006) 1367–1375
Fig. 5 – Antagonism of haCGRP cAMP responses by (Cys(Acm)2,7)haCGRP (A); or 10 mM AM22–52, sCT8–32, AMY8– 37 or AC187 (B). Data shown are from representative experiments. Values are mean W S.E.M. of duplicates. Experiments were repeated three times.
be used with caution; (Cys(Et)2,7)haCGRP certainly does not appear to be CGRP2-selective given its potency at CGRP1 receptors. As a partial agonist, the properties of (Cys(Acm)2,7)haCGRP will be highly system-dependent and particularly sensitive to receptor density. Although not without its own problems, CGRP8–37 appears to be the most robust readily available tool for distinguishing CGRP1 and CGRP2 receptors at the present time. BIBN4096BS is a useful tool for distinguishing CGRP1 receptors from other CGRP-activated receptors but because it is not commercially available, this limits its use. AM has been reported to be an effective agonist of CGRP receptors such as the CGRP receptors endogenously expressed in SK–N–MC cells [34]. However, as these cells also express RAMP2 [5] it could be considered that AM1 receptors might also contribute to the observed potency. The data presented here show that AM appears to have innate efficacy for CGRP1 receptors as RAMP2 or 3 do not appear to be present in the Cos 7 cells used in this study. Further, there are many examples where CGRP8–37 has been shown to successfully inhibit the effects of both AM and CGRP in vivo; indicating that AM can act at CGRP1 receptors (e.g. rat mesenteric vascular bed [23]). Consideration of the effects of AM and two of its fragments (AM15–52 and AM22–52) which were also used in this study might give some insight into the structure-activity relationship between these peptides and the CGRP1 receptor. As discussed, full-length AM was a potent agonist of the CGRP1 receptor. In
1373
contrast, AM22–52 was a very weak antagonist of both haCGRP and AM responses at this receptor. This suggests that removal of the first 21 amino acids of AM results in a loss of interaction with this receptor and indicates that this region of the peptide is important for high affinity interactions with the CGRP1 receptor. Different results were obtained for a second fragment, AM15–52, that retains the disulphide-linked ring that is critical for agonist activity. This was a potent agonist and was not significantly weaker than full-length AM, although there was a trend towards a decrease in potency. Thus, a loss of the N-terminal amino acids can be accommodated but further loss somewhere between residues 16 and 21 results in diminished interaction with the receptor. Very similar observations have been made in SK–N–MC cells which we now know express CGRP1 receptors. Here, AM and AM13–52 were similarly potent at stimulating cAMP production and had high affinity in binding studies, whereas AM22–52 could not displace 125I-CGRP at 1 mM [34]. This is different to the situation at AM1 receptors where the loss of these residues does not have such a dramatic impact (Table 3), although the degree of difference in binding affinity between AM and AM22–52 does vary somewhat from study to study (summarized in [26]). There may be more of an impact of the loss of these residues at AM2 receptors but again, the results are variable (Table 3 [26]). The other agonists that we tested here were all considerably less potent than the CGRPs and AM. Human and salmon CT produced virtually no cAMP response and rat AMY was also weak. As anticipated, CGRP8–37 was an effective, competitive antagonist of CGRP1 receptors, inhibiting the effects of haCGRP, hbCGRP (Cys(Et)2,7)haCGRP and human AM equally. The generated pKB values are in line with previous observations for human CGRP1 receptors, either in transfected cells or endogenously expressed in SK–N–MC cells (as reviewed in [13]). However, it should be noted that the pKB against a-CGRP obtained in this study is at the high end of reported values, highlighting the rather unpredictable nature of this antagonist. In common with the weak effects of CTs and AMY, sCT8– 32, AMY8–37 and a modified form of sCT8–32 (AC187) were all weak antagonists of the human CGRP1 receptor in Cos 7 cells. BIBN4096BS was also equally effective at antagonizing haCGRP, hbCGRP (Cys(Et)2,7)haCGRP and human AM in this study; although not significant, BIBN4096BS did appear to be slightly weaker at inhibiting hAM and (Cys(Et)2,7)haCGRP responses. Small differences, beyond the resolution of the experimental conditions used in this assay cannot be ruled out. The data are in good agreement with literature values against haCGRP in SK–N–MC cells and most tissues that have been tested (reviewed in [13]). On the other hand, there is heterogeneity in the reported affinity values for BIBN4096BS in the rat, not only between tissues but also between agonists [13]. Indeed, in the rat vas deferens, pKB values for BIBN4096BS against (Cys(Et)2,7)haCGRP and human AM were higher than against human or rat aCGRP or human bCGRP [33]. As BIBN4096BS was equally effective against all of these agonists at the human CGRP1 receptor, the data suggest that the rat CGRP1 receptor is not responsible for the observed affinity values for BIBN4096BS in the rat vas deferens and other receptor(s) must be involved. As the AMY1(a) receptor can be activated by (Cys(Et)2,7)haCGRP and contains RAMP1 (a major
1374
peptides 27 (2006) 1367–1375
Table 3 – Comparison of agonist potency (pEC50) and antagonist affinity (pKB/pA2) values at human receptors for the calcitonin peptide family expressed in Cos 7 cells CGRP1 Agonists haCGRP hbCGRP hAM (Cys(Et)2,7)haCGRP hAM15–52 hCT sCT rAMY IMDS Antagonists BIBN4096BS CGRP8–37 (Cys(Acm)2,7)haCGRP AM22–52 sCT8–32 AC187 AMY8–37
AM1
AM2
CTR
10.11a 10.5a 8.42a 9.09a 7.77a <6a <6a 6.63a 8.71b
– – 8.8c – 8.34a – – – 8.1b
– – 9.6c – 9.36a – – – 8.69b
6.8b 7.18b 6.73b <6b
10.04a 9.34a 7.36a 5.83a 5.48a 6.03a 5.62a
<5c 7.04c – 7.34c – – –
<5c 6.95c – 6.73c – – –
AMY1(a) 8.7b 9.16b 6.48b 7.79b,d
8.99b
8.93b
6.95b 6.53b
9.12b 8.07b
– <5b – <5b 8.17b 7.15b <5b
– 6.62b – <5b 7.78b 8.02b 5.59b
AMY2(a)
AMY3(a)
– – – – – – – – 6.25b
7.6b 7.67b 6.48b <6b – 8.02b – 8.63b 7.12b
– – – – – – –
– 6.17b – <5b 7.92b 7.68b <5b
pKB/pA2 values were calculated against haCGRP at CGRP1 receptors, hAM at AM1 and AM2 receptors, hCT at CTR and rAMY at amylin receptors. Data from this study. b Data from [12]. c Data from [15]. d Denotes weak partial agonist. a
determinant of BIBN4096BS affinity for a receptor), it is possible that this receptor may be antagonized by BIBN4096BS and contribute to the unusual pharmacology observed in the rat vas deferens although this remains to be demonstrated [12,19,21]. In human extracranial arteries, BIBN4096BS and CGRP8–37 were more effective at inhibiting a than b-CGRP [30]. However, the difference was less than 10-fold and we did not observe such a difference here. As previously observed in SK– N–MC cells [14], the Schild slope for BIBN4096BS was significantly different from one in many experiments. As slow kinetics have been observed for this compound [29], the effect of varying the antagonist incubation time was investigated. However, this did not have a significant effect. The agonist potency and antagonist affinity data from this study are compared with that generated for other calcitoninfamily receptors in the same cellular background in Table 3. While the relative agonist potencies may serve as a useful guide, it is important to emphasize that the actual values obtained are likely to vary from study to study due to a number of system-dependent variables such as receptor number (transfection efficiency) and G-protein complement. The pharmacology of CGRP in tissues is complicated. At least two subtypes are recognized pharmacologically and further novel entities are invoked from time to time to explain what the current dogma cannot [4,11]. In molecular terms, the pharmacologically defined CGRP1 receptor is composed of CL and RAMP1 [26]. The pharmacologies that together define the CGRP2 receptor do not yet have a molecular correlate and it may be that this pharmacology can be explained by more than one receptor entity. For example, studies of recombinant AMY and AM receptor subtypes have shown us that some of these receptors may be potently activated by various CGRPs and antagonized weakly by CGRP8–37; properties of a CGRP2 receptor [12,14,19]. In time this work may help explain
complicated observations in tissues. The pharmacology studies would be best complemented by co-localization studies with well-characterized RAMP and receptor antibodies. For example, localization of key receptor components in the vas deferens would help determine which receptor(s) are responsible for the CGRP2 phenotype in this tissue. In conclusion, the study presented here provides a pharmacological profile for recombinant human CGRP1 receptors which may serve as a useful reference guide for those studying CGRP and related peptides.
Acknowledgements We would like to thank Professor David Coy (Tulane University Medical School, New Orleans) for the synthesis and provision of AM15–52. This work was supported by grants from the Auckland Medical Research Foundation, New Zealand Lottery Health fund and University of Auckland Staff Research fund. We thank Dr. David R. Poyner for critical reading of this manuscript.
references
[1] Aiyar N, Disa J, Zhaohui A, Dong X, Surya A, Pillarisetti K, et al. Molecular cloning and pharmacological characterization of bovine calcitonin receptor-like receptor from bovine aortic endothelial cells. Biochem Pharmacol 2002;63:1949–59. [2] Boussif O, Lezoualc’h F, Zanta MA, Mergny MD, Scherman D, Demeneix B, et al. A versatile vector for gene and oligonucleotides transfer into cells in culture and in vivo: polyethyleneimine. Proc Natl Acad Sci USA 1995;92:7297–301.
peptides 27 (2006) 1367–1375
[3] Brain SD, Grant AD. Vascular actions of calcitonin generelated peptide and adrenomedullin. Physiol Rev 2004;84:903–34. [4] Chauhan M, Thota CS, Kondapaka S, Wimalawansa S, Yallampalli C. Evidence for the existence of a new receptor for CGRP, which is not CRLR. Peptides 2003;24:65–71. [5] Choksi T, Hay DL, Legon S, Poyner DR, Hagner S, Bloom SR, et al. Comparison of the expression of calcitonin receptorlike receptor (CRLR) and receptor activity modifying proteins (RAMPs) with CGRP and AM binding in cell lines. Br J Pharmacol 2002;136:784–92. [6] Conner AC, Hay DL, Simms J, Howitt SG, Schindler M, Smith DM, et al. A key role for transmembrane prolines in calcitonin receptor-like receptor agonist binding and signalling: implications for family B G-protein coupled receptors. Mol Pharmacol 2005;67:20–31. [7] Dennis T, Fournier A, Cadieux A, Pomerleau F, Jolicoeur FB, Quirion R. hCGRP8-37, a calcitonin gene-related peptide antagonist revealing calcitonin gene-related peptide receptor heterogeneity in brain and periphery. J Pharmacol Exp Ther 1990;254:123–8. [8] Dennis T, Fournier A, St Pierre S, Quirion R. Structureactivity profile of calcitonin gene-related peptide in peripheral and brain tissues. Evidence for receptor multiplicity. J Pharmacol Exp Ther 1989;251:718–25. [9] Doods H, Hallermayer G, Wu D, Entzeroth M, Rudolf K, Engel W, et al. Pharmacological profile of BIBN4096BS, the first selective small molecule CGRP antagonist. Br J Pharmacol 2000;129:420–3. [10] Dumont Y, Fournier A, St-Pierre S, Quirion R. A potent and selective CGRP2 agonist [Cys(Et)2,7]hCGRP alpha: comparison in prototypical CGRP1 and CGRP2 in vitro bioassays. Can J Physiol Pharmacol 1997;75:671–6. [11] Esfandyari T, Macnaughton WK, Quirion R, St Pierre S, Junien JL, Sharkey KA. A novel receptor for calcitonin generelated peptide (CGRP) mediates secretion in the rat colon: implications for secretory function in colitis. FASEB J 2000;14:1439–46. [12] Hay DL, Christopoulos G, Christopoulos A, Poyner DR, Sexton PM. Pharmacological discrimination of calcitonin receptor–receptor activity modifying protein complexes. Mol Pharmacol 2005;67:1655–65. [13] Hay DL, Conner AC, Howitt SG, Takhshid MA, Simms J, Mahmoud K, et al. The pharmacology of CGRP responsive receptors in cultured and transfected cells. Peptides 2004;25:2019–26. [14] Hay DL, Howitt SG, Conner AC, Doods H, Schindler M, Poyner DR. A comparison of the actions of BIBN4096BS and CGRP(8-37) on CGRP and adrenomedullin receptors expressed on SK-N-MC, L6 Col 29 and Rat 2 cells. Br J Pharmacol 2002;137:80–6. [15] Hay DL, Howitt SG, Conner AC, Schindler M, Smith DM, Poyner DR. CL/RAMP2 and CL/RAMP3 produce pharmacologically distinct adrenomedullin receptors: a comparison of effects of adrenomedullin22–52 CGRP8-37 and BIBN4096BS. Br J Pharmacol 2003;140:477–86. [16] Hirt D, Bernard GW. CGRP-beta unlike CGRP-alpha has no osteogenic stimulatory effect in vitro. Peptides 1997;18:1461–3. [17] Juaneda C, Dumont Y, Quirion R. The molecular pharmacology of CGRP and related peptide receptor subtypes. Trends Pharmacol Sci 2000;21:432–8. [18] Kawase T, Okuda K, Burns DM. Immature osteoblastic MG63 cells possess two calcitonin gene-related peptide receptor subtypes that differentially respond to [Cys(Acm)2,7]-CGRP and CGRP8-37. Am J Physiol Cell Physiol 2005 [published online Jun 15].
1375
[19] Kuwasako K, Cao Y, Nagoshi Y, Tsuruda T, Kitamura K, Eto T. Characterization of the human calcitonin gene-related peptide receptor subtypes associated with receptor activity modifying proteins. Mol Pharmacol 2004;65:207–13. [20] McLatchie LM, Fraser NJ, Main MJ, Wise A, Brown J, Thompson N, et al. RAMPs regulate the transport and ligand specificity of the calcitonin-receptor-like receptor. Nature 1998;393:333–9. [21] Mallee JJ, Salvatore CA, LeBourdelles B, Oliver KR, Longmore J, Koblan S, et al. Receptor activity-modifying protein 1 determines the species selectivity of non-peptide CGRP receptor antagonists. J Biol Chem 2002;277:14294–8. [22] Nodin C, Vauquelin G, von Mentzer B. Cys2,7EtaCGRP is a potent agonist for CGRP1 receptors in SK–N–MC cells. Biochem Pharmacol 2005;69:1235–40. [23] Nuki C, Kawasaki H, Kitamura K, Tagenaga M, Kangawa K, Eto T, et al. Vasodilator effect of adrenomedullin and calcitonin gene-related peptide receptors in rat mesenteric vascular beds. Biochem Biophys Res Commun 1993;196:245–51. [24] Olesen J, Diener HC, Husstedt IW, Goadsby PJ, Hall D, Meier U, et al. BIBN 4096 BS clinical proof of concept study group calcitonin gene-related peptide receptor antagonist BIBN 4096 BS for the acute treatment of migraine. N Engl J Med 2004;350:1104–10. [25] Poyner DR, Andrew DP, Brown D, Bose C, Hanley MR. Pharmacological characterization of a receptor for calcitonin gene-related peptide on rat L6 myocytes. Br J Pharmacol 1992;105:441–7. [26] Poyner DR, Sexton PM, Marshall I, Smith DM, Quirion R, Born W, et al. International union of pharmacology. XXXII. The mammalian calcitonin gene-related peptides, adrenomedullin, amylin, and calcitonin receptors. Pharmacol Rev 2002;54:233–46. [27] Poyner DR, Taylor GM, Tomlinson AE, Richardson AG, Smith DM. Characterization of receptors for calcitonin gene-related peptide and adrenomedullin on the guineapig vas deferens. Br J Pharmacol 1999;126:1276–82. [28] Rorabaugh BR, Scofield MA, Smith DD, Jeffries WB, Abel PW. Functional calcitonin gene-related peptide subtype 2 receptors in porcine coronary arteries are identified as calcitonin gene-related peptide subtype 1 receptors by radioligand binding and reverse transcription-polymerase chain reaction. J Pharmacol Exp Ther 2001;299:1086–94. [29] Schindler M, Doods HN. Binding properties of the novel, non-peptide CGRP receptor antagonist radioligand [(3)H]BIBN4096BS. Eur J Pharmacol 2002;442:187–93. [30] Verheggen R, Bumann K, Kaumann AJ. BIBN4096BS is a potent competitive antagonist of the relaxant effects of alpha-CGRP on human temporal artery: comparison with CGRP(8–37). Br J Pharmacol 2002;136:120–6. [31] Van Rossum D, Uwe-Karsten H, Quirion R. Neuroanatomical localization, pharmacological characterization and functions of CGRP, related peptides and their receptors. Neurosci Biobehav Rev 1994;21:649–78. [32] Waugh DJ, Bockman CS, Smith DD, Abel PW. Limitations in using peptide drugs to characterize calcitonin gene-related peptide receptors. J Pharmacol Exp Ther 1999;289:1419–26. [33] Wu D, Eberlein W, Rudolf K, Engel W, Hallermayer G, Doods H. Characterisation of calcitonin gene-related peptide receptors in rat atrium and vas deferens: evidence for a [Cys(Et)(2, 7)]hCGRP-preferring receptor. Eur J Pharmacol 2000;21(400):313–9. [34] Zimmermann U, Fischer JA, Muff R. Adrenomedullin and calcitonin gene-related peptide interact with the same receptor in cultured human neuroblastoma SK–N–MC cells. Peptides 1995;16:421–4.
available at www.sciencedirect.com
journal homepage: www.elsevier.com/locate/peptides
Pharmacology of the human CGRP1 receptor in Cos 7 cells Richard J. Bailey, Debbie L. Hay * Proteomics & Biomedicine Research Group, School of Biological Sciences, University of Auckland, 3 Symonds Street, Private Bag 92 019, New Zealand
article info
abstract
Article history:
Only limited pharmacological characterization of the CGRP1 receptor, a heterodimer of the
Received 27 October 2005
calcitonin (CT) receptor-like receptor (CL) and receptor activity-modifying protein 1 has been
Received in revised form
performed in cells that do not endogenously express RAMP2. We characterized the receptor
15 November 2005
in RAMP-deficient Cos 7 cells by measuring cAMP responses following agonist treatment in
Accepted 16 November 2005
the absence or presence of antagonists. Potent cAMP responses to human a-and b-CGRP
Published on line 20 December 2005
(Cys(Et)2,7)haCGRP and human adrenomedullin (AM) were observed. Adrenomedullin15–52 was also an effective agonist of the CGRP1 receptor but human and salmon calcitonin and rat
Keywords:
amylin were only weak agonists. As expected, BIBN4096BS and CGRP8–37 were effective
BIBN4096BS
antagonists of the CGRP1 receptor. (Cys(Acm)2,7)haCGRP also antagonized CGRP responses.
Calcitonin receptor-like receptor
Antagonists of related receptors were only weakly able to inhibit CGRP responses. # 2005 Elsevier Inc. All rights reserved.
CGRP CGRP1 receptor Receptor activity modifying protein Abbreviations: AM, adrenomedullin AMY, amylin BIBN4096BS, 1-piperidinecarboxamide N-[2-[[5amino-l-[[4-(4-pyridinyl)l-piperazinyl]carbonyl]pentyl]amino]1-[(3,5-dibromo-4-hydroxyphenyl) methyl]-2-oxoethyl]-4-(1,4-dihydro2-oxo-3(2H)-quinazolinyl) CT, calcitonin CGRP, CT gene-related peptide CL, CT receptor-like receptor RAMP, receptor activity modifying protein
1.
Introduction
Calcitonin (CT) gene-related peptide (CGRP) is a potent vasodilator with pleiotropic pharmacological actions [3]. It
belongs to the CT peptide family. This group of peptides share many structural features and functional activities. There has been a resurgence of interest in the properties of CGRP in recent years with two important discoveries; CGRP receptors were
* Corresponding author. Tel.: +64 9 373 7599; fax: +64 9 373 7414. E-mail address: [email protected] (D.L. Hay). 0196-9781/$ – see front matter # 2005 Elsevier Inc. All rights reserved. doi:10.1016/j.peptides.2005.11.014
1368
peptides 27 (2006) 1367–1375
cloned [20] and the first high affinity, selective CGRP receptor antagonist was identified [9]. This antagonist, BIBN4096BS, is currently in late-stage development as a novel class of treatment for migraine and thus information regarding its mode and selectivity of action is of considerable interest [24]. Pharmacologically, two major phenotypes of CGRP receptor have been reported; CGRP1 and CGRP2 receptors [17]. The most consistent difference between them is their sensitivity (CGRP1) or insensitivity (CGRP2) to antagonism by the CGRP fragment CGRP8–37 but it has also been reported that they can be selectively activated by the linear CGRP analogs (Cys(Acm)2,7)haCGRP and (Cys(Et)2,7)haCGRP [17]. There is strong evidence to suggest that CGRP1 receptors are composed of heterodimeric complexes of the family B CT receptor-like receptor (CL) and the single transmembrane receptor activity modifying protein 1 (RAMP1) [26]. In contrast, the molecular nature of CGRP2 receptors has not been defined but there is evidence that AMY1(a) or AM2 receptors might contribute to reports of CGRP2 receptors; both receptors can be activated by CGRP and its linear analogs but are only weakly antagonized by CGRP8–37 [12,15,19]. In order to understand the contribution of different CGRP receptor subtypes to peptide physiology it is imperative to have undertaken thorough pharmacological characterization of CGRP receptors so that the in vivo use of agonists and antagonists can be appropriately interpreted. Although the pharmacology of CGRP1 receptors is relatively well defined, there has been no detailed functional analysis of recombinant CGRP1 receptors, composed of human CL and human RAMP1. In particular, many studies of transfected CGRP1 receptors have been performed in HEK293 cells which often endogenously express RAMP2 [1]. Thus, it is unclear how much of the apparent CGRP1 receptor response to adrenomedullin (AM) is due to inherent activity at CL/RAMP1 complexes or because of the formation of AM receptors, in addition to CGRP receptors. There is a similar issue for cell lines that endogenously express CGRP1 receptor components as they also invariably express RAMP2 (e.g. SK-N-MC, L6) [5]. Furthermore, the functional effects of antagonists have not been studied in depth at CGRP1 receptors. Therefore, in this study we sought to determine agonist potencies and antagonist pA2 or pKB (affinity) values for a selection of agonists and antagonists of CT peptide family receptors at CGRP1 receptors expressed in Cos 7 cells, cells which, in our hands, do not express significant levels of endogenous RAMPs.
2.
Materials and methods
2.1.
Materials
All peptides were purchased from Bachem (Bubendorf, Switzerland) except rat amylin (AMY) which was from Auspep (Parkville, Australia) and the 15–52 fragment of AM (AM15–52) was kindly provided by Professor David Coy (Tulane University Medical School, New Orleans). BIBN4096BS was a kind gift from Henri Doods (Boehringer Ingelheim). Isobutylmethylxanthine (IBMX), protein kinase A and activated charcoal were from Sigma. Dulbecco’s modified Eagle’s medium (DMEM) and fetal bovine serum (FBS) were from Invitrogen. Forskolin was from Tocris. All other reagents were of analytical grade.
2.2.
Reconstitution of drugs
BIBN4096BS was prepared as a 1 mM stock as previously described [14]. All peptides were dissolved in water to make 1 mM stock solutions which were stored as 10 ml aliquots at 30 8C in siliconized microcentrifuge tubes (Bio Plas). When making up the peptides, the peptide content was taken into account but where no data sheet was supplied, content was assumed to be 80%.
2.3.
Cell culture
Cos 7 cells (kindly donated by Dr. N. Birch, School of Biological Sciences, University of Auckland) were cultured in DMEM supplemented with 10% heat inactivated fetal bovine serum and 5% (v/v) penicillin/streptomycin and kept in a 37 8C humidified 95% air/5% CO2 incubator. Cells were subcultured as previously described [15]. Cells were plated into 96 well plates or T75 cm2 flasks one day prior to transfection so that cells were approximately 80% confluent for transfection.
2.4.
Transient transfection using polyethylenimine
Human CL with an N-terminal hemagglutinin (HA) epitope tag (YPYDVPDYA) [20], provided by Dr. S.M. Foord (GlaxoWellcome, Stevenage, UK) and sub-cloned into pcDNA3 (Invitrogen, Renfrew, UK) as previously described [6] was transfected along with human RAMP1, RAMP2 or RAMP3 into Cos 7 cells. Introduction of the epitope tag into human CL has been shown to make no significant difference to the pharmacology of the receptor [20]. The human CT receptor (CTR, insert negative form (CT(a))) was kindly provided by Dr. P.M. Sexton (Howard Florey Institute, University of Melbourne). All constructs were transfected using polyethylenimine (PEI). A 0.9 mg/ml (w/v) stock PEI solution (25 kDa, Aldrich (40,872–7)) was made by dissolving the PEI in distilled water and correcting the pH to 7.5 with dilute HCl. This solution was filter-sterilized and stored as frozen 1 ml aliquots. Plated cells were treated with a mixture of plasmid DNA (0.25 mg per well or 15 mg per flask) and PEI, in 5% glucose. The volume of PEI solution used was calculated by multiplying the total number of microgram DNA in each transfection mix by three (10 equivalents of amine nitrogen [2]). The DNA was diluted in 5% glucose, mixed and PEI added to it (not the other way round). This mixture was left to stand at room temperature for 15 min. The transfection mix was then added to normal culture media (including serum and antibiotics) so that it made up one-tenth of the final volume. Old growth media was aspirated from the cells and the transfection mix added in a volume of 100 ml per well or 12.5 ml per flask. RNA was harvested or cAMP assays were performed 36–48 h later.
2.5.
cAMP assay
cAMP assays were performed essentially as described previously [6,25], though modified to be performed in 96 well plates. Briefly, transfected cells were serum-deprived in DMEM containing 1 mM IBMX and 0.1% bovine serum albumin for 30–60 min. After this period, in most experiments, antagonists were added first followed, immediately by
peptides 27 (2006) 1367–1375
agonists. In some experiments, BIBN4096BS was added for 2 h prior to the addition of agonist. Forskolin (50 mM) was included as a positive control on each plate and plates were incubated at 37 8C for 15 min. The media was then aspirated from the wells and reactions terminated with ice-cold absolute ethanol. Ethanol was evaporated to dryness and cell extracts resuspended in 30 ml cAMP assay buffer (5 mM EDTA, 20 mM HEPES, pH 7.5). Twenty-five microlitre of the extracts were transferred to round-bottomed 96 well plates (Greiner), followed by 25 ml 3H-cAMP and 50 ml protein kinase A at previously determined concentrations [25]. The plate contents were gently agitated to mix the contents and then incubated at 4 8C for between 2 and 24 h. Activated charcoal (50 ml) was added to the wells which were mixed and then centrifuged at 3000 rpm (Eppendorf A-4-81 rotor in a 5810R centrifuge) for 5 min at 4 8C. Seventy-five microlitres of the supernatant was removed to a 96 well plate capable of being counted in a microbeta Trilux (Perkin-Elmer). Two hundred microlitre Starscint scintillation fluid (Packard) was added and the plates mixed and counted. Corrected counts per minute were converted to a percentage of the forskolin response which was expressed as 100%, samples that had not been treated with drug were expressed as 0%.
2.6.
1369
electrophoresed with a size marker for 60 min in a 2% (w/v) agarose gel containing SYBR SafeTM DNA gel stain (Molecular Probes) and visualized on a BioradTM imaging system under UV transillumination.
2.7.
Data analysis and statistics
Data were analyzed using Graphpad Prism version 4.02. Agonist pEC50 values were obtained from a four parameter logistic equation. For calculation of antagonist pKB or pA2 values, data were analyzed using Global Schild analysis as previously described [12]. Schild slopes were compared to one in each experiment; where the Schild slope was not significantly different to one, it was constrained to one. The reported Schild slope for BIBN4096BS is the mean value of Schild slopes that were calculated in five separate experiments (haCGRP versus BIBN4096BS). Where the Schild slope was not significantly different from unity the data are expressed as pKB values but where it was significantly different, pA2 values are used to describe antagonist potency. For statistical analysis, pEC50 or pA2/pKB values were evaluated using unpaired Student’s t-tests where only two values were compared or one-way ANOVA followed by Tukey’s or Dunnett’s test where multiple comparisons were appropriate.
RT-PCR
Total RNA was extracted from confluent T75 cm2 flasks containing transfected Cos 7 cells using TRIZOL1 Reagent (Invitrogen) according to the manufacturers protocol, resuspended in 50 ml DEPC treated water and stored at 80 8C. The concentration of total RNA was determined by a NanoDrop1 ND-1000 Spectrophotometer and RNA integrity was determined by gel electrophoresis. The total RNA concentrations ranged from 1100 to 2077 ng/ml. First strand cDNA was synthesized by using a SuperScriptTM first-strand synthesis system (Invitrogen). Total RNA (5 mg) was incubated with or without SuperScriptTM II reverse transcriptase (RT) in the presence of random hexamer primers. Both the RT and no-RT products were used as templates in PCR reactions containing primers developed for specificity to human RAMP1, 2 or 3, human CTR, human CL and African green monkey beta-2-microglobulin (B2m). The 50 –30 sequences and annealing temperatures of the primers were: human RAMP1 AAGCTGGGCTGCTTCTGG (forward) and ACACAATGCCCTCAGTGC (reverse), 58 8C; human RAMP2 ATTGCCTGGAGCACTTTGC and GCCTCACTGTCTTTACTCC, 58 8C; human RAMP3 TCGTGGGCTGCTACTGG and CTCACAGCAGCGTGTCG, 58 8C; human CTR CGCATACCAAGGAGAAGGTC and AGTTGGACCAGGTTCGATTG, 58 8C and human CL, CTCCTCTACATTATCCATGG and CCTCCTCTGCAATCTTTCC, 50 8C, respectively. The 50 –30 sequences and annealing temperature of the African green monkey B2m cDNA forward and reverse primers were CGTGCTCCAAAGATTCAGGT and ACGGCAGGCATACTCATCTT, 59 8C, respectively. The PCR reactions were performed in 20 ml volumes using PFU polymerase (Promega) and contained 2 ml of the appropriate RT products or no-RT reactions as template. Reactions containing no template were also set up as controls. The PCR cycling comprised a single step of 95 8C for 2 min followed by 35 cycles of 95 8C for 45 s, 50–58 8C for 45 s, 72 8C for 90 s and a single final extension step of 72 8C for 7 min. PCR products (10 ml) were
3.
Results
3.1. Characterization of background level of RAMPs in Cos 7 cells 3.1.1.
cAMP
Mock transfection of Cos 7 cells with empty vector (pcDNA3.1) did not yield significant elevation of cAMP above basal following human CT, CGRP or AM treatment (100 nM each) (Fig. 1A). Furthermore, transfection of RAMP1 alone did not induce cAMP responses to CGRP, suggesting that endogenous CL or CTR was not present. Likewise, transfection of CL alone did not lead to elevation of cAMP levels in response to CGRP or AM indicating that there were insufficient levels of endogenous RAMPs to produce CGRP or AM receptors. However, CGRP1 receptor (CL/RAMP1) transfected cells responded to haCGRP and CTR transfected cells responded to CT (Fig. 1A). Given that Cos 7 cells are of African green monkey origin it is possible that endogenous RAMPs or CL were present but were incapable of interacting with human receptor components. We do not feel that this is a likely scenario, however, given that mixed components from several species have previously been shown to interact [1,15].
3.1.2.
RT-PCR
As the sequences of African green monkey RAMPs, CL and CTR are currently unknown, primers were chosen based on the sequences of human RAMPs and receptors. It should be noted that the primers match, identically, sequences found in predicted Pan Troglodytes (chimpanzee) RAMP2, CL and CTR sequences. At the time of preparation of this manuscript only a partial Pan Troglodytes RAMP3 sequence was available. Our reverse RAMP3 primer aligned perfectly with this sequence but we were unable to confidently align our forward primer as
1370
peptides 27 (2006) 1367–1375
Table 1 – Agonist potency values at CGRP1 receptors Agonist
pEC50 S.E.M. (n)
haCGRP hbCGRP (Cys(Et)2,7)haCGRP hAM hAM15–52 hCT sCT rAMY
10.11 0.17 (9) 10.5 0.09 (5) 9.09 0.25 (7) 8.42 0.12 (s12) 7.77 0.22 (4) <6 (3) <6 (3) 6.63 0.12 (4)
is published, the data shown in Fig. 1B indicate that mock transfected Cos 7 cells do not express endogenous RAMPs, CL or CTR. Products were amplified, however, from transfected cells used as positive controls. In order to ensure the integrity of the RNA and consequent cDNA obtained from the mock transfected cells, B2m was used as a positive control. A product of anticipated size was amplified effectively.
3.2.
Fig. 1 – (A) Stimulation of cAMP production in response to a series of agonists in Cos 7 cells transfected with vector or various receptor components expressed as a percentage of that produced in response to 50 mM forskolin. CGRP1 denotes cells transfected with hCL and hRAMP1. Data shown are representative and values are mean W S.E.M. of triplicates; (B) expression of mRNA encoding RAMP1, 2, 3, CL, CTR and B2m in Cos 7 cells by RT-PCR. Lanes 1, 3, 5, 7 and 9 are positive controls for RAMP1, 2, 3, CL and CTR primers, respectively and show bands of predicted size (marked in bp). RNA was prepared from cells transfected with appropriate receptor components. Lanes 2, 4, 6, 8 and 10 are the paired results from vector transfected Cos 7 cells. No PCR products were detected. Lane 11 shows a B2m product in vector transfected Cos 7 cells, as a positive control for this cDNA.
the Pan Troglodytes RAMP3 sequence was incomplete. The forward primer for RAMP1 matches the Pan Troglodytes predicted RAMP1 sequence; there is a double base-pair change in the reverse primer. Although not completely conclusive until the complete sequence of African green monkey genome
Agonist potency
Co-transfection of human CL and human RAMP1 (CGRP1 receptors) into Cos 7 cells produced potent responses to CGRP as expected. Human a- and b-CGRP were equipotent and were significantly more potent than any of the other agonists tested (P < 0.01 one way ANOVA, followed by Tukey’s multiple comparisons test; Table 1). (Cys(Et)2,7)haCGRP and hAM were also potent agonists but were approximately 10-fold less potent than a- or b-CGRP (Table 1, Fig. 2A and B). The human AM fragment, AM15–52 was also able to stimulate cAMP production via the CGRP1 receptor (Table 1 and Fig. 2B). This was compared to its effect at AM1 and AM2 receptors where AM15–52 was a potent stimulator of cAMP, producing pEC50 values of 8.34 0.28 (n = 3) and 9.36 0.14 (n = 4), respectively (Fig. 2C and D). Rat AMY was a weak agonist of the CGRP1 receptor (Fig. 2A) and salmon CT or human CT gave little to no discernable response (not shown). (Cys(Acm)2,7)haCGRP was a very weak partial agonist, only occasionally eliciting a cAMP response above basal levels (Fig. 2A). Thus, a pEC50 could not be confidently determined for this peptide.
3.3.
Antagonists
As expected, BIBN4096BS was an effective antagonist of CGRP1 receptors and inhibited all agonists with equal affinity (Table 2, Fig. 3). Slow kinetics have previously been reported
Table 2 – Antagonist affinity values at CGRP1 receptors pKB S.E.M. (n)a haCGRP BIBN4096BS CGRP8–37 (Cys(Acm)2,7)haCGRP AM22–52 sCT8–32 AC187 AMY8–37 a
10.04 0.16 9.34 0.38 7.36 0.06 5.83 0.25 5.48 0.28 6.03 0.32 5.62 0.18
(5) (5) (3) (3) (3) (3) (3)
hbCGRP
hAM
(Cys(Et)2,7)haCGRP
9.96 0.2 (4) 8.8 0.41 (4) – – – – –
9.24 0.31 (5) 8.56 0.61 (3) – 6.15 0.02 (3) – – –
9.22 0.47 (4) 8.63 0.85 (3) – – – – –
Except BIBN4096BS where values are pA2 (Schild slope significantly different from 1; 1.52 0.16 (n = 5) for haCGRP vs. BIBN496BS).
peptides 27 (2006) 1367–1375
1371
Fig. 2 – Stimulation of cAMP production by CGRP1 receptors in response to (Cys(Et)2,7)haCGRP (CysEt) (Cys(Acm)2,7)haCGRP (CysACM) and rat AMY (rAMY) (A); stimulation of cAMP production by hAM or hAM15–52 at CGRP1 (B); AM1 (C); or AM2 (D) receptors. Data shown are from representative experiments. Values are mean W S.E.M. of duplicates. Experiments were repeated 3–12 times.
for BIBN4096BS [29]. Therefore, pre-incubation with BIBN4096BS for 2 h prior to agonist addition was compared with no BIBN4096BS pre-incubation. Although there was a trend towards increased affinity with a 2 h BIBN4096BS preincubation (pA2 10.35 0.27 (n = 3) after 2 h incubation versus no pre-incubation pA2 10.04 0.16 (n = 5)), this did not reach statistical significance (P > 0.05, Students’s t-test, data not shown). As has previously been demonstrated with this antagonist, the Schild slope differed significantly from one in most experiments (1.52 0.16 (n = 5)) [14]. Two hour preincubation with BIBN4096BS did not significantly modify the Schild slope (1.42 0.33 (n = 3)). CGRP8–37 was a potent, competitive antagonist of all agonists at CGRP1 receptors (Table 2, Fig. 4). CGRP8–37 was a weaker antagonist than BIBN4096BS at inhibiting agonist responses but this did not reach significance. Given that weak partial agonists often behave as antagonists and a recent report that (Cys(Acm)2,7)haCGRP may indeed behave in this manner [18], the ability of (Cys(Acm)2,7)haCGRP to inhibit haCGRP responses at CGRP1 receptors was evaluated. As shown in Fig. 5A and Table 2 (Cys(Acm)2,7)haCGRP was an effective antagonist of CGRP1 receptors. In contrast, the AM fragment AM22–52, salmon CT fragment sCT8–32 and rat AMY fragment AMY8–37 were all weak antagonists of CGRP1 receptors with similar pKB values (Fig. 5B and Table 2). AC187, a modified form of sCT8–32 was equally weak (Fig. 5B and Table 2).
4.
Discussion
This study provides the first comprehensive pharmacological analysis of recombinant CGRP1 receptors expressed in cells
that do not endogenously express significant levels of RAMP2. Such data provides a useful baseline for understanding the pharmacology of CGRP receptors in more complex systems. As binding studies have not historically been shown to be useful in defining CGRP receptor subtypes, we elected to functionally analyze the CGRP1 receptor in this study [7,8,27,28,31]. Analysis of agonist responses showed that human a- and bCGRP were equipotent agonists of CGRP1 receptors. This is supported by several other studies of CL/RAMP1 complexes of various species as reviewed in Poyner et al. [26]. Divergent responses between a- and b-CGRP have been reported elsewhere [16]. As both forms of CGRP seem to act equivalently at CGRP1 receptors, such reports suggest that this divergence may be due to the action of the CGRPs at alternative receptors, although factors such as differential metabolism cannot be excluded. Indeed, a- and b-CGRP are both reasonably potent agonists of AM2 receptors formed from CL/RAMP3 yet b-CGRP appears to be the more potent agonist, although this may be species dependent [15]. (Cys(Et)2,7)haCGRP was originally reported as a CGRP2 subtype selective agonist [10]. This property has since been disputed [22,33] and we provide further evidence here that this is an effective agonist of CGRP1 receptors. (Cys(Acm)2,7)haCGRP, another modified form of human a-CGRP has also been reported as a selective agonist of CGRP2 receptors. In the study presented here (Cys(Acm)2,7)haCGRP was certainly an ineffective agonist of CGRP1 receptors, in terms of cAMP production. (Cys(Acm)2,7)haCGRP has been reported to act as a partial agonist elsewhere [32]. It was recently reported that (Cys(Acm)2,7)haCGRP can act as an antagonist of CGRP in osteoblastic cells [18] and we provide data to support this observation here. The data confirm that these agents should
1372
peptides 27 (2006) 1367–1375
Fig. 3 – Antagonism of haCGRP (A); hbCGRP (B); (Cys(Et)2,7)haCGRP (cys Et) (C); or hAM (D) stimulated cAMP responses by various concentrations of BIBN4096BS, as indicated. Control is agonist alone with subsequent agonist curves also including increasing concentrations of antagonist. Data shown are from representative experiments. Values are mean W S.E.M. of duplicates. Experiments were repeated 4–5 times.
Fig. 4 – Antagonism of haCGRP (A); hbCGRP (B); (Cys(Et)2,7)haCGRP (cys Et) (C); or hAM (D) stimulated cAMP responses by various concentrations of CGRP8–37, as indicated. Control is agonist alone with subsequent agonist curves also including increasing concentrations of antagonist. Data shown are from representative experiments. Values are mean W S.E.M. of duplicates. Experiments were repeated 3–5 times.
peptides 27 (2006) 1367–1375
Fig. 5 – Antagonism of haCGRP cAMP responses by (Cys(Acm)2,7)haCGRP (A); or 10 mM AM22–52, sCT8–32, AMY8– 37 or AC187 (B). Data shown are from representative experiments. Values are mean W S.E.M. of duplicates. Experiments were repeated three times.
be used with caution; (Cys(Et)2,7)haCGRP certainly does not appear to be CGRP2-selective given its potency at CGRP1 receptors. As a partial agonist, the properties of (Cys(Acm)2,7)haCGRP will be highly system-dependent and particularly sensitive to receptor density. Although not without its own problems, CGRP8–37 appears to be the most robust readily available tool for distinguishing CGRP1 and CGRP2 receptors at the present time. BIBN4096BS is a useful tool for distinguishing CGRP1 receptors from other CGRP-activated receptors but because it is not commercially available, this limits its use. AM has been reported to be an effective agonist of CGRP receptors such as the CGRP receptors endogenously expressed in SK–N–MC cells [34]. However, as these cells also express RAMP2 [5] it could be considered that AM1 receptors might also contribute to the observed potency. The data presented here show that AM appears to have innate efficacy for CGRP1 receptors as RAMP2 or 3 do not appear to be present in the Cos 7 cells used in this study. Further, there are many examples where CGRP8–37 has been shown to successfully inhibit the effects of both AM and CGRP in vivo; indicating that AM can act at CGRP1 receptors (e.g. rat mesenteric vascular bed [23]). Consideration of the effects of AM and two of its fragments (AM15–52 and AM22–52) which were also used in this study might give some insight into the structure-activity relationship between these peptides and the CGRP1 receptor. As discussed, full-length AM was a potent agonist of the CGRP1 receptor. In
1373
contrast, AM22–52 was a very weak antagonist of both haCGRP and AM responses at this receptor. This suggests that removal of the first 21 amino acids of AM results in a loss of interaction with this receptor and indicates that this region of the peptide is important for high affinity interactions with the CGRP1 receptor. Different results were obtained for a second fragment, AM15–52, that retains the disulphide-linked ring that is critical for agonist activity. This was a potent agonist and was not significantly weaker than full-length AM, although there was a trend towards a decrease in potency. Thus, a loss of the N-terminal amino acids can be accommodated but further loss somewhere between residues 16 and 21 results in diminished interaction with the receptor. Very similar observations have been made in SK–N–MC cells which we now know express CGRP1 receptors. Here, AM and AM13–52 were similarly potent at stimulating cAMP production and had high affinity in binding studies, whereas AM22–52 could not displace 125I-CGRP at 1 mM [34]. This is different to the situation at AM1 receptors where the loss of these residues does not have such a dramatic impact (Table 3), although the degree of difference in binding affinity between AM and AM22–52 does vary somewhat from study to study (summarized in [26]). There may be more of an impact of the loss of these residues at AM2 receptors but again, the results are variable (Table 3 [26]). The other agonists that we tested here were all considerably less potent than the CGRPs and AM. Human and salmon CT produced virtually no cAMP response and rat AMY was also weak. As anticipated, CGRP8–37 was an effective, competitive antagonist of CGRP1 receptors, inhibiting the effects of haCGRP, hbCGRP (Cys(Et)2,7)haCGRP and human AM equally. The generated pKB values are in line with previous observations for human CGRP1 receptors, either in transfected cells or endogenously expressed in SK–N–MC cells (as reviewed in [13]). However, it should be noted that the pKB against a-CGRP obtained in this study is at the high end of reported values, highlighting the rather unpredictable nature of this antagonist. In common with the weak effects of CTs and AMY, sCT8– 32, AMY8–37 and a modified form of sCT8–32 (AC187) were all weak antagonists of the human CGRP1 receptor in Cos 7 cells. BIBN4096BS was also equally effective at antagonizing haCGRP, hbCGRP (Cys(Et)2,7)haCGRP and human AM in this study; although not significant, BIBN4096BS did appear to be slightly weaker at inhibiting hAM and (Cys(Et)2,7)haCGRP responses. Small differences, beyond the resolution of the experimental conditions used in this assay cannot be ruled out. The data are in good agreement with literature values against haCGRP in SK–N–MC cells and most tissues that have been tested (reviewed in [13]). On the other hand, there is heterogeneity in the reported affinity values for BIBN4096BS in the rat, not only between tissues but also between agonists [13]. Indeed, in the rat vas deferens, pKB values for BIBN4096BS against (Cys(Et)2,7)haCGRP and human AM were higher than against human or rat aCGRP or human bCGRP [33]. As BIBN4096BS was equally effective against all of these agonists at the human CGRP1 receptor, the data suggest that the rat CGRP1 receptor is not responsible for the observed affinity values for BIBN4096BS in the rat vas deferens and other receptor(s) must be involved. As the AMY1(a) receptor can be activated by (Cys(Et)2,7)haCGRP and contains RAMP1 (a major
1374
peptides 27 (2006) 1367–1375
Table 3 – Comparison of agonist potency (pEC50) and antagonist affinity (pKB/pA2) values at human receptors for the calcitonin peptide family expressed in Cos 7 cells CGRP1 Agonists haCGRP hbCGRP hAM (Cys(Et)2,7)haCGRP hAM15–52 hCT sCT rAMY IMDS Antagonists BIBN4096BS CGRP8–37 (Cys(Acm)2,7)haCGRP AM22–52 sCT8–32 AC187 AMY8–37
AM1
AM2
CTR
10.11a 10.5a 8.42a 9.09a 7.77a <6a <6a 6.63a 8.71b
– – 8.8c – 8.34a – – – 8.1b
– – 9.6c – 9.36a – – – 8.69b
6.8b 7.18b 6.73b <6b
10.04a 9.34a 7.36a 5.83a 5.48a 6.03a 5.62a
<5c 7.04c – 7.34c – – –
<5c 6.95c – 6.73c – – –
AMY1(a) 8.7b 9.16b 6.48b 7.79b,d
8.99b
8.93b
6.95b 6.53b
9.12b 8.07b
– <5b – <5b 8.17b 7.15b <5b
– 6.62b – <5b 7.78b 8.02b 5.59b
AMY2(a)
AMY3(a)
– – – – – – – – 6.25b
7.6b 7.67b 6.48b <6b – 8.02b – 8.63b 7.12b
– – – – – – –
– 6.17b – <5b 7.92b 7.68b <5b
pKB/pA2 values were calculated against haCGRP at CGRP1 receptors, hAM at AM1 and AM2 receptors, hCT at CTR and rAMY at amylin receptors. Data from this study. b Data from [12]. c Data from [15]. d Denotes weak partial agonist. a
determinant of BIBN4096BS affinity for a receptor), it is possible that this receptor may be antagonized by BIBN4096BS and contribute to the unusual pharmacology observed in the rat vas deferens although this remains to be demonstrated [12,19,21]. In human extracranial arteries, BIBN4096BS and CGRP8–37 were more effective at inhibiting a than b-CGRP [30]. However, the difference was less than 10-fold and we did not observe such a difference here. As previously observed in SK– N–MC cells [14], the Schild slope for BIBN4096BS was significantly different from one in many experiments. As slow kinetics have been observed for this compound [29], the effect of varying the antagonist incubation time was investigated. However, this did not have a significant effect. The agonist potency and antagonist affinity data from this study are compared with that generated for other calcitoninfamily receptors in the same cellular background in Table 3. While the relative agonist potencies may serve as a useful guide, it is important to emphasize that the actual values obtained are likely to vary from study to study due to a number of system-dependent variables such as receptor number (transfection efficiency) and G-protein complement. The pharmacology of CGRP in tissues is complicated. At least two subtypes are recognized pharmacologically and further novel entities are invoked from time to time to explain what the current dogma cannot [4,11]. In molecular terms, the pharmacologically defined CGRP1 receptor is composed of CL and RAMP1 [26]. The pharmacologies that together define the CGRP2 receptor do not yet have a molecular correlate and it may be that this pharmacology can be explained by more than one receptor entity. For example, studies of recombinant AMY and AM receptor subtypes have shown us that some of these receptors may be potently activated by various CGRPs and antagonized weakly by CGRP8–37; properties of a CGRP2 receptor [12,14,19]. In time this work may help explain
complicated observations in tissues. The pharmacology studies would be best complemented by co-localization studies with well-characterized RAMP and receptor antibodies. For example, localization of key receptor components in the vas deferens would help determine which receptor(s) are responsible for the CGRP2 phenotype in this tissue. In conclusion, the study presented here provides a pharmacological profile for recombinant human CGRP1 receptors which may serve as a useful reference guide for those studying CGRP and related peptides.
Acknowledgements We would like to thank Professor David Coy (Tulane University Medical School, New Orleans) for the synthesis and provision of AM15–52. This work was supported by grants from the Auckland Medical Research Foundation, New Zealand Lottery Health fund and University of Auckland Staff Research fund. We thank Dr. David R. Poyner for critical reading of this manuscript.
references
[1] Aiyar N, Disa J, Zhaohui A, Dong X, Surya A, Pillarisetti K, et al. Molecular cloning and pharmacological characterization of bovine calcitonin receptor-like receptor from bovine aortic endothelial cells. Biochem Pharmacol 2002;63:1949–59. [2] Boussif O, Lezoualc’h F, Zanta MA, Mergny MD, Scherman D, Demeneix B, et al. A versatile vector for gene and oligonucleotides transfer into cells in culture and in vivo: polyethyleneimine. Proc Natl Acad Sci USA 1995;92:7297–301.
peptides 27 (2006) 1367–1375
[3] Brain SD, Grant AD. Vascular actions of calcitonin generelated peptide and adrenomedullin. Physiol Rev 2004;84:903–34. [4] Chauhan M, Thota CS, Kondapaka S, Wimalawansa S, Yallampalli C. Evidence for the existence of a new receptor for CGRP, which is not CRLR. Peptides 2003;24:65–71. [5] Choksi T, Hay DL, Legon S, Poyner DR, Hagner S, Bloom SR, et al. Comparison of the expression of calcitonin receptorlike receptor (CRLR) and receptor activity modifying proteins (RAMPs) with CGRP and AM binding in cell lines. Br J Pharmacol 2002;136:784–92. [6] Conner AC, Hay DL, Simms J, Howitt SG, Schindler M, Smith DM, et al. A key role for transmembrane prolines in calcitonin receptor-like receptor agonist binding and signalling: implications for family B G-protein coupled receptors. Mol Pharmacol 2005;67:20–31. [7] Dennis T, Fournier A, Cadieux A, Pomerleau F, Jolicoeur FB, Quirion R. hCGRP8-37, a calcitonin gene-related peptide antagonist revealing calcitonin gene-related peptide receptor heterogeneity in brain and periphery. J Pharmacol Exp Ther 1990;254:123–8. [8] Dennis T, Fournier A, St Pierre S, Quirion R. Structureactivity profile of calcitonin gene-related peptide in peripheral and brain tissues. Evidence for receptor multiplicity. J Pharmacol Exp Ther 1989;251:718–25. [9] Doods H, Hallermayer G, Wu D, Entzeroth M, Rudolf K, Engel W, et al. Pharmacological profile of BIBN4096BS, the first selective small molecule CGRP antagonist. Br J Pharmacol 2000;129:420–3. [10] Dumont Y, Fournier A, St-Pierre S, Quirion R. A potent and selective CGRP2 agonist [Cys(Et)2,7]hCGRP alpha: comparison in prototypical CGRP1 and CGRP2 in vitro bioassays. Can J Physiol Pharmacol 1997;75:671–6. [11] Esfandyari T, Macnaughton WK, Quirion R, St Pierre S, Junien JL, Sharkey KA. A novel receptor for calcitonin generelated peptide (CGRP) mediates secretion in the rat colon: implications for secretory function in colitis. FASEB J 2000;14:1439–46. [12] Hay DL, Christopoulos G, Christopoulos A, Poyner DR, Sexton PM. Pharmacological discrimination of calcitonin receptor–receptor activity modifying protein complexes. Mol Pharmacol 2005;67:1655–65. [13] Hay DL, Conner AC, Howitt SG, Takhshid MA, Simms J, Mahmoud K, et al. The pharmacology of CGRP responsive receptors in cultured and transfected cells. Peptides 2004;25:2019–26. [14] Hay DL, Howitt SG, Conner AC, Doods H, Schindler M, Poyner DR. A comparison of the actions of BIBN4096BS and CGRP(8-37) on CGRP and adrenomedullin receptors expressed on SK-N-MC, L6 Col 29 and Rat 2 cells. Br J Pharmacol 2002;137:80–6. [15] Hay DL, Howitt SG, Conner AC, Schindler M, Smith DM, Poyner DR. CL/RAMP2 and CL/RAMP3 produce pharmacologically distinct adrenomedullin receptors: a comparison of effects of adrenomedullin22–52 CGRP8-37 and BIBN4096BS. Br J Pharmacol 2003;140:477–86. [16] Hirt D, Bernard GW. CGRP-beta unlike CGRP-alpha has no osteogenic stimulatory effect in vitro. Peptides 1997;18:1461–3. [17] Juaneda C, Dumont Y, Quirion R. The molecular pharmacology of CGRP and related peptide receptor subtypes. Trends Pharmacol Sci 2000;21:432–8. [18] Kawase T, Okuda K, Burns DM. Immature osteoblastic MG63 cells possess two calcitonin gene-related peptide receptor subtypes that differentially respond to [Cys(Acm)2,7]-CGRP and CGRP8-37. Am J Physiol Cell Physiol 2005 [published online Jun 15].
1375
[19] Kuwasako K, Cao Y, Nagoshi Y, Tsuruda T, Kitamura K, Eto T. Characterization of the human calcitonin gene-related peptide receptor subtypes associated with receptor activity modifying proteins. Mol Pharmacol 2004;65:207–13. [20] McLatchie LM, Fraser NJ, Main MJ, Wise A, Brown J, Thompson N, et al. RAMPs regulate the transport and ligand specificity of the calcitonin-receptor-like receptor. Nature 1998;393:333–9. [21] Mallee JJ, Salvatore CA, LeBourdelles B, Oliver KR, Longmore J, Koblan S, et al. Receptor activity-modifying protein 1 determines the species selectivity of non-peptide CGRP receptor antagonists. J Biol Chem 2002;277:14294–8. [22] Nodin C, Vauquelin G, von Mentzer B. Cys2,7EtaCGRP is a potent agonist for CGRP1 receptors in SK–N–MC cells. Biochem Pharmacol 2005;69:1235–40. [23] Nuki C, Kawasaki H, Kitamura K, Tagenaga M, Kangawa K, Eto T, et al. Vasodilator effect of adrenomedullin and calcitonin gene-related peptide receptors in rat mesenteric vascular beds. Biochem Biophys Res Commun 1993;196:245–51. [24] Olesen J, Diener HC, Husstedt IW, Goadsby PJ, Hall D, Meier U, et al. BIBN 4096 BS clinical proof of concept study group calcitonin gene-related peptide receptor antagonist BIBN 4096 BS for the acute treatment of migraine. N Engl J Med 2004;350:1104–10. [25] Poyner DR, Andrew DP, Brown D, Bose C, Hanley MR. Pharmacological characterization of a receptor for calcitonin gene-related peptide on rat L6 myocytes. Br J Pharmacol 1992;105:441–7. [26] Poyner DR, Sexton PM, Marshall I, Smith DM, Quirion R, Born W, et al. International union of pharmacology. XXXII. The mammalian calcitonin gene-related peptides, adrenomedullin, amylin, and calcitonin receptors. Pharmacol Rev 2002;54:233–46. [27] Poyner DR, Taylor GM, Tomlinson AE, Richardson AG, Smith DM. Characterization of receptors for calcitonin gene-related peptide and adrenomedullin on the guineapig vas deferens. Br J Pharmacol 1999;126:1276–82. [28] Rorabaugh BR, Scofield MA, Smith DD, Jeffries WB, Abel PW. Functional calcitonin gene-related peptide subtype 2 receptors in porcine coronary arteries are identified as calcitonin gene-related peptide subtype 1 receptors by radioligand binding and reverse transcription-polymerase chain reaction. J Pharmacol Exp Ther 2001;299:1086–94. [29] Schindler M, Doods HN. Binding properties of the novel, non-peptide CGRP receptor antagonist radioligand [(3)H]BIBN4096BS. Eur J Pharmacol 2002;442:187–93. [30] Verheggen R, Bumann K, Kaumann AJ. BIBN4096BS is a potent competitive antagonist of the relaxant effects of alpha-CGRP on human temporal artery: comparison with CGRP(8–37). Br J Pharmacol 2002;136:120–6. [31] Van Rossum D, Uwe-Karsten H, Quirion R. Neuroanatomical localization, pharmacological characterization and functions of CGRP, related peptides and their receptors. Neurosci Biobehav Rev 1994;21:649–78. [32] Waugh DJ, Bockman CS, Smith DD, Abel PW. Limitations in using peptide drugs to characterize calcitonin gene-related peptide receptors. J Pharmacol Exp Ther 1999;289:1419–26. [33] Wu D, Eberlein W, Rudolf K, Engel W, Hallermayer G, Doods H. Characterisation of calcitonin gene-related peptide receptors in rat atrium and vas deferens: evidence for a [Cys(Et)(2, 7)]hCGRP-preferring receptor. Eur J Pharmacol 2000;21(400):313–9. [34] Zimmermann U, Fischer JA, Muff R. Adrenomedullin and calcitonin gene-related peptide interact with the same receptor in cultured human neuroblastoma SK–N–MC cells. Peptides 1995;16:421–4.