Phenotype in X chromosome rearrangements: pitfalls of X inactivation study

Pathologie Biologie 55 (2007) 29–36 http://france.elsevier.com/direct/PATBIO/

Phenotype in X chromosome rearrangements: pitfalls of X inactivation study Phénotype des anomalies de structure du chromosome X : pièges de l’étude de l’inactivation de l’X C. Schluth a, M. Cossée b, F. Girard-Lemaire a, N. Carelle a, H. Dollfus c E. Jeandidier d, E. Flori a,* a

Laboratoire de cytogénétique, hôpital de Hautepierre, avenue Molière, 67098 Strasbourg cedex, France b Laboratoire de diagnostic génétique, hôpitaux universitaires de Strasbourg, Strasbourg, France c Service de génétique médicale, hôpital de Hautepierre, Strasbourg, France d Laboratoire de génétique, hôpital Emile-Muller, Mulhouse, France Received 21 March 2006; accepted 5 April 2006 Available online 11 May 2006

Abstract Objective. – X inactivation pattern in X chromosome rearrangements usually favor the less unbalanced cells. It is correlated to a normal phenotype, small size or infertility. We studied the correlation between phenotype and X inactivation ratio in patients with X structural anomalies. Patients and methods. – During the 1999–2005 period, 12 X chromosome rearrangements, including three prenatal cases, were diagnosed in the Laboratoire de Cytogénétique of Strasbourg. In seven cases, X inactivation ratio could be assessed by late replication or methylation assay. Results. – In three of seven cases (del Xp, dup Xp, t(X;A)), X inactivation ratio and phenotype were consistent. The four other cases showed discrepancies between phenotype and X inactivation pattern: mental retardation and dysmorphism in a case of balanced X-autosome translocation, schizophrenia and autism in two cases of XX maleness and MLS syndrome (microphthalmia with linear skin defects) in a case of Xp(21.3pter) deletion. Conclusion. – Discrepancies between X inactivation ratio and phenotype are not rare and can be due to gene disruption, position effect, complex microrearrangements, variable pattern of X inactivation in different tissues or fortuitous association. In this context, the prognostic value of X inactivation study in prenatal diagnosis will be discussed. © 2006 Elsevier Masson SAS. All rights reserved. Résumé Objectif. – Dans les anomalies de structure du chromosome X, le patron d’inactivation de l’X favorise les cellules les moins déséquilibrées et est en général corrélé à un phénotype normal, une petite taille ou une infertilité. C’est pourquoi nous avons confronté le phénotype et le ratio d’inactivation de l’X chez les patients porteurs d’anomalies de structure homogènes du chromosome X. Patients et méthodes. – Durant la période allant de 1999 à 2005, 12 cas d’anomalies de structure du chromosome X ont été diagnostiquées dans le laboratoire de Cytogénétique de Strasbourg, dont 1/4 en période prénatale. Dans sept cas, l’inactivation de l’X a pu être déterminée, soit par étude de la réplication tardive, soit par étude de la méthylation aux loci HUMARA et FRAXA. Résultats. – Pour trois cas [del Xp, dup Xp, t(X ;A)], le phénotype et le ratio d’inactivation sont concordants. Pour les quatre autres cas, il existe une discordance entre le profil d’inactivation et le phénotype : un retard mental et une dysmorphie dans un cas de translocation X-autosome équilibrée, une schizophrénie et un autisme chez deux hommes XX et un syndrome MLS (Microphthalmia with linear skin defects) dans un cas de délétion del(X)(p21.3-pter). * Corresponding

author. E-mail address: [email protected] (E. Flori).

0369-8114/$ - see front matter © 2006 Elsevier Masson SAS. All rights reserved. doi:10.1016/j.patbio.2006.04.003

30

C. Schluth et al. / Pathologie Biologie 55 (2007) 29–36

Conclusion. – Les discordances entre le profil d’inactivation et le phénotype ne sont pas rares et peuvent relever d’une pathologie du point de cassure, de remaniements complexes, d’une variabilité tissulaire du patron d’inactivation ou de pathologies surajoutées. La valeur pronostique de l’inactivation de l’X, en particulier en diagnostic prénatal, est discutée. © 2006 Elsevier Masson SAS. All rights reserved. Keywords: X inactivation; X chromosome structural anomalies; MLS syndrome; XX maleness Mots clés : Inactivation de l’X ; Anomalies de structure de l’X ; Diagnostic prénatal ; Syndrome MLS ; Homme XX

1. Introduction X chromosome inactivation is the epigenetic mechanism through which mammalian cells achieve gene dosage compensation between male (XY) and female (XX) cells. X inactivation is established early in development at late blastocyst stage [1]. In each cell, the X chromosome that will be inactivated is randomly chosen, that means that the paternal and maternal X chromosomes have the same 50% probability to be inactivated. Each female is then a functional mosaic for two cell populations [2]. Once it is established, the inactive state has to be maintained and transmitted to the daughter cells in a stable way during mitosis [2]. Inactive X chromosome is characterized by XIST RNA coating (a untranslated RNA expressed exclusively by the inactive X), condensation of chromatin (visualized as Barr body), late replication, methylation of CpG islands, post-translational modifications of histones, presence of the histone variant macroH2A [3–5]. X inactivation can be analyzed through two main methods in current diagnosis: visualization of late replication timing after incorporation of BrdU at the end of cell culture, or determination of the methylation status of CpG islands at polymorphic loci on X chromosome (HUMARA, FRAXA) [6,7]. The relative proportion of each X chromosome, paternal or maternal, that is inactivated in a cell population defines the X inactivation ratio. A 50/50 value is normally observed, reflecting a random process. A ratio significantly different from the expected 50/50 value defines a skewed X inactivation. In X chromosome structural anomalies, X inactivation pattern is usually skewed towards the unbalanced clone secondary to cell selection after the inactivation has been established at random (Fig. 1). In 95% of balanced X-autosome translocations, the normal X is inactive in all cells, so that the translocated autosomal segment is maintained active [8]. In 90% of unbalanced X-autosome translocations, the derivative X is inactive, thus avoiding partial trisomy for the autosomal segment [8]. The abnormal X is also inactive in deletions, duplications or isochromosomes [9–11]. Usually, preferential inactivation of the less unbalanced clone is correlated with a normal or mild phenotype (short stature, ovarian failure) whereas a random pattern is associated with severe phenotype (mental retardation, malformations) [12]. Nevertheless, it is frequent to observe discrepancies between X inactivation ratio and phenotype. These discrepancies will be discussed through the experience of the Laboratoire de

Cytogénétique of Strasbourg with a particular attention to prenatal diagnosis. 2. Material and methods 2.1. Patients Homogeneous X chromosome structural anomalies were registered for a 6-year period (1999–2005) in the Laboratoire de Cytogénétique of Strasbourg. When material was available, X inactivation ratio was assessed using late replication assay or methylation assay. 2.2. Karyotype Karyotype (RBG bands) was performed from peripheral lymphocytes or amniotic fluid cells according to standard procedures. 2.3. Late replication assay RHG karyotype was performed according to standard techniques, with adjunction of 5-bromo-2-deoxyuridine (BrdU) in the 6 last hours of cell culture.

Fig. 1. Schematic representation of X chromosome structural anomalies and their usual pattern of inactivation.

C. Schluth et al. / Pathologie Biologie 55 (2007) 29–36

31

3. HUMARA and FRAXA methylation assay

Table 1 Clinical, cytogenetics and X inactivation data

The human androgen receptor (HUMARA) and the FRAXA locus assay were used with experimental conditions modified from the literature [6,7]. Five hundred nanogram genomic DNA was digested with either 25 U MspI, 10 U RsaI or 10 U RsaI plus 20 U HpaII in a 40 μl final volume at 37 °C overnight. Enzymes were inactivated at 95 °C for 5 min. HUMARA locus was amplified in a 25 μl PCR reaction with: 2 μl of digestion product, 1.2 U Taq polymerase, 10 mM Tris– HCl pH 8.5, 50 mM KCl, 200 μM of each deoxyribonucleotides, 1.5 mM MgCl2, 5% DMSO and 10 pmol of each primer (sense: 5′ TGCTGGCGGCCACGGCGGCT 3′, antisenseFAM: 5′ TCCAGAATCTGTTCCAGAGCGTGC 3′). The cycling conditions were: 1 cycle of 95 °C (5 min), 24 cycles of 95 °C (10 s), 64 °C (30 s), 72 °C (30 s), 1 cycle of 72 °C (10 min). FRAXA locus was amplified in a 20 μl PCR reaction with: 2 μl of digestion product, 0.75 U of Pfa-DNA-platinum polymerase (Gibco-BRL) in appropriate buffer, 8 μl of platinumPCR-enhancer, 1.5 mM MgSO4, 200 μM of each deoxyribonucleotide and 20 pmol of each primers (sense-TET 5′ AGCCCCGCACTTCCACCACCAGCTCCTCCA 3′, antisense 5′ GCTCAGCTCCGTTTCGGTTTCACTTCCGGT 3′). The cycling conditions were: 1 cycle of 95 °C (3 min), 27 cycles 95 °C (15 s), 56 °C (2 min), 75 °C (2 min), 1 cycle of 75 °C (10 min). PCR products were loaded on an ABI 310 DNA sequencer and analyzed by a Genescan Software. Late replication assay distinguishes the two X chromosomes according to their morphology (normal or rearranged), whereas methylation assay distinguishes them according to DNA polymorphisms but can’t ascertain precisely which is the rearranged one. So the inactivation was said to be skewed when one X chromosome was inactivated in 80% or more cells (X inactivation ratio 80/20), independently of its normal or rearranged characteristics.

Patient

Phenotype

Karyotype

A

MR/ dysmorphism MCA/MR MR/autism Schizophrenia Normal Short stature MLS syndrome

t(X;16)(q13;q13)

X inactivation ratio 100/0

derX,t(X;3)(q25;q13) 46,X,derX,t(X;Y)(p22.3;p11) 46,X,derX,t(X;Y)(p22.3;p11) dupX(p21.1-p22.33) delX(p11.2-p11.4) delX(p21.3-pter)

80/20 27/73 33/67 100/0 100/0 100/0

B C D E F G

MR: mental retardation; MCA: multiple congenital anomalies.

with jaundice and streptococcus D infection. She evolved with growth retardation (–2 S.D.), scoliosis, conduction hearing loss and delayed puberty. The development was mildly retarded. The exam at 20 years old showed facial dysmorphism (epicanthus, long philtrum, micrognathia, eversed inferior lip, large ears), low hairline, strabismus, naevi and short fingers. The karyotype revealed a balanced X-autosome translocation: 46, XX,t(X;16)(q13;q13) (Fig. 2a). X inactivation was completely biased (ratio: 100/0, methylation assay). 4.2. Patient B This girl was born at 36 weeks’ gestation, after an uneventful pregnancy, by ceasarian section for fetal distress. Birth length was 47 cm (10th centile), birth weight was 2740 g (25th centile) and OFC was 32 cm (10th-25th centile). Hypotonia, hypoglycemia and failure to thrive were rapidly noticed. The baby presented with facial dysmorphism (large nose, long philtrum, micrognathia), short femur and humerus, anal anteposition, ventricular septal defect and intralobar pulmonary lymphangectasia. She died at 11 months. The chromosome constitution was: 46,X,der(X),t(X;3)(q25;q13), de novo (Fig. 2b). The normal X chromosome was late replicating in 80% of cells.

4. Results

4.3. Patient C

Between 1999 and 2005, 12 cases of homogeneous structural anomalies of the X chromosome were diagnosed. Three of them (25%) were diagnosed in the prenatal period. The 12 anomalies consisted in: two balanced X-autosome translocations, one unbalanced X-autosome translocation, three XX (SRY+) males, two isochromosomes Xq, one Xp duplication and three Xp deletions. In five cases, there was no material available to study X inactivation. The seven cases for which the analysis could be performed are reported thereafter and are summarized in Table 1.

This boy was referred for autism, absent language, agressiveness, epilepsy, incomplete puberty and gynecomastia. The karyotype and FISH analyses showed a 46,XX constitution with one copy of the SRY gene on one X chromosome. X inactivation was random, the maternal X was inactive in 27% of cells, and the paternal X was inactive in 73% of cells (methylation assay).

4.1. Patient A The patient was the first child of unrelated young parents. She was born at 32 weeks’ gestation (birth weight: 2000 g, 25th centile; birth length: 42 cm, 10th centile). She presented

4.4. Patient D The karyotype was performed at 20 years of age for testicular atrophy and short stature. It revealed a 46,XX constitution with one copy of the SRY gene on one X chromosome (Fig. 2c). Androgenotherapy was introduced. Few months later, the patient developed schizophrenia. The methylation assay showed a random pattern of inactivation (ratio: 33/67).

32

C. Schluth et al. / Pathologie Biologie 55 (2007) 29–36

Fig. 2. Partial karyotype (R-banding) and FISH analysis.

4.5. Patient E Patient E was the mother of a boy presenting with growth retardation (–4 S.D.), facial dysmorphism, developmental delay, micropenis and chryptorchidism. He inherited a X chromosome duplication: dup(X)(p21.1-p22.33) from his mother (Fig. 2d). The mother was asymptomatic and the X inactivation was completely biased (100/0 – methylation assay). 4.6. Patient F A 46,X,del(X)(p11.2-p11.4) was diagnosed in a girl with isolated short stature (–2 S.D.) (Fig. 2e). X inactivation (methylation assay) was completely biased (100/0). 4.7. Patient G Amniocentesis was performed at 16 weeks’ gestation for abnormal maternal serum screening. The karyotype showed a

de novo Xp deletion: 46,X,del(X)(p21.3-pter) of paternal origin (Fig. 2f). The deleted X chromosome was inactivated in all amniotic cells according to late replication and methylation assay. Prenatal sonography was normal. The mother showed a biased X inactivation, but her karyotype was normal, and no microdeletion of the X chromosome using CGH-array (1 Mb resolution) was found. A reassuring genetic counseling was given, with restriction as for the possibility of short stature and the risk of X-linked disease. The proband was delivered at term. She presented with bilateral microphthalmia, sclerocornea and linear skin lesions of the head and neck consistent with MLS syndrome (Microphthalmia with linear skin defects). 5. Discussion In X chromosome structural anomalies, the clone with the abnormal X being active is negatively selected. Consequently, X inactivation ratio is skewed towards the most unbalanced clone. This pattern is usually correlated with a normal or mild phenotype.

C. Schluth et al. / Pathologie Biologie 55 (2007) 29–36

More than half of the cases described here showed discrepancies between an X inactivation pattern of good prognosis and an abnormal phenotype. Mechanisms that underline these discrepancies are discussed as well as the prognostic value of X inactivation ratio in prenatal diagnosis. 5.1. X inactivation ratio and phenotype concordance Cases E and F presented with normal phenotype. X inactivation pattern was completely biased as usually expected. Patient B showed a more unusual X inactivation ratio, as the normal X was inactive in 80% of cells, resulting in a partial 3(q13-qter) trisomy, and a partial X(q27-qter) monosomy in 80% of cells. The phenotype of patient B is consistent with trisomy 3q syndrome. This entity is characterized by mental retardation, hypotonia, post-natal growth retardation, hirsutism, cleft palate and short limbs, facial dysmorphism (upslanted palpebral fissures, synophrys, anteverted nostrils, microretrognathism and downturned corners of the mouth), congenital heart defect and other malformations involving kidney, central nervous system, external genitalia and anus [13–16]. 5.2. X inactivation ratio and phenotype discrepancies Patient A showed a balanced X-autosome translocation with Turner stigmata and mild mental retardation despite a completely biased X inactivation. Complete Turner phenotype is quite rare in X-autosome translocations [17] whereas mental retardation and multiple congenital anomalies are described in 42% of them [18]. In patient A, the breakpoint lies in the critical region Xq13– Xq26 and can explain ovarian dysfunction [8,18]. Mental retardation and dysmorphic features could be relevant of different hypotheses. In this case the inactivation of the normal X seems the most probable. The breakpoint could disrupt a gene or a regulation sequence on chromosome X or 16. The rearrangement could also be more complex with gain or loss of material. Finally, as the perinatal history of the patient was marked by an infection, acquired sequellae cannot be excluded. Patients C and D presented XX maleness (or De la Chapelle syndrome). This syndrome is due to the translocation of the SRY gene (Yp11) on X chromosome in Xp22.3 by illegitimate recombination between X and Y chromosomes outside the pseudo-autosomal region PAR1 during male meiosis [19–22]. Phenotype is characterized by hypogonadism, with normal male genitalia and azoospermia [23–25]. Some cases with hypospadias or true hermaphroditism with a 46,XX (SRY +) karyotype have been described [26]. Few papers mentioned data about X inactivation pattern in XX males [27–35]. It appears that X inactivation is usually random in XX males (16/20 patients). The translocation may not be sufficient by itself to induce a selective pressure. Both patients C and D have random inactivation but they also display unusual conditions for XX maleness: autism and

33

mental retardation for case C and schizophrenia for case D. The rearrangement could have disrupted a gene or be more complex. Indeed, Xp22.3 band contains genes responsible for mental retardation and autism like STK9 [36,37] or NLGN4 [38]. A deletion of Xp22.3 has been described in three autistic unrelated girls [39]. The Xp22.3 region is also related to schizophrenia. Three XX males [40–42] and two females with a deletion Xp22.3 [43] and schizophrenia have previously been reported. A fortuitous association cannot be excluded. Patient G presented with an MLS syndrome and inactivation of the deleted X in all cells. MLS syndrome (microphthalmia with linear skin defect) is a rare entity with about 40 cases reported to date. It associates microphthalmia, sclerocornea, linear erythematous skin lesions of the face and the neck [44–46], and additional malformations (agenesis of corpus callosum, microcephalia, congenital heart defect, cardiomyopathy) [45,46]. Most cases are associated with a rearrangement of the Xp22.3 band: deletions [45,46], unbalanced X-autosome translocations [44,46], inversions [47] and XX maleness [33]. Some cases with normal karyotype have been described [46]. The Xp21.3 bands have never been involved. In most cases where X inactivation could have been studied, the abnormal X chromosome was preferentially inactive [33,48–51]. In the case of patient G, three hypotheses can be proposed to explain the phenotype. First, as it is currently assumed, MLS syndrome is an X-linked dominant disease. Xp21.3 deletion would be responsible for haploinsufficiency for the critical region. However, Xp21.3 has never been involved in MLS syndrome before and this deletion is usually associated with Turner syndrome. Second, some authors proposed that the phenotype is expressed when the deleted X chromosome is active and the normal copy inactive in critical tissues such as eye and skin. Finally, the deletion may reveal a mutation on the normal X chromosome. This hypothesis is supported by the fact that in the present case the mother had a completely biased X inactivation pattern. The inactive X chromosome of the mother might be mutated and transmitted to her daughter. In conclusion, in presence of discrepancies between X inactivation pattern and phenotype, different mechanisms should be explored: ● Disruption of gene or regulation sequences at the breakpoint; ● Complex chromosomal rearrangement; ● Tissular variation of X inactivation pattern; ● Fortuitous association of acquired or genetic diseases. 5.3. X inactivation and prenatal diagnosis Frequency of prenatal cases in our series (1/4) and discrepancies between X inactivation and phenotype (more than 50%) led us to ask about the place of X inactivation study in prenatal diagnosis.

34

C. Schluth et al. / Pathologie Biologie 55 (2007) 29–36

Table 2 X inactivation and prenatal diagnosis of X rearrangements: review of the literature Karyotype t(X;4)(p21;q35) t(X;9)(p22.1;q32) t(X;1)(p11.4;p36.3) t(X;9)(p21.3;q22) t(X;11)(q21.1;q21) t(X;8)(p11.2;q24.1) t(X;16)(q11.1;p13.12) t(X;6)(q26;q23) der(X),t(X;16)(q28;p12) 46,X,idic(X)(q27)

Inactive X (ratio) Xn (100%) Xn (100%) Xn (100%) Skewing (100%) Xn (100%) Xn (100%) Skewing (100%) Xn (100%) der X (100%) idic(Xq) (100%)

Postnatal phenotype Duchenne myopathy Nager syndrome Norrie disease IUFD, normal Normal Polymalformations Polymalformations Normal Polymalformations Normal

References Bodrug et al., 1990 [52] Zori et al., 1993 [53] Seller et al., 1995 [54] Feldman et al., 1999 [55] Waters et al., 2001 [18] Waters et al., 2001 [18] Wolbert et al. 2002 [56] Abrams and Cotter, 2004 [57] Kalz-Füller et al., 1999 [58] Lebbar et al., 2002 [59]

IUFD: intra-uterine fetal death; Xn: normal X; der X:derivative X.

Little is known about that issue as structural X chromosome anomalies are usually post-natally diagnosed. There are only 10 prenatal cases with X inactivation study in the literature: eight balanced X-autosome translocations [18,52–57], one unbalanced X-autosome translocation [58] and one isochromosome Xq [59]. In all cases, X inactivation pattern was reassuring, since the less unbalanced clone was preferentially active. Only four children were born with a normal phenotype [18,55,57,59]. The other cases presented with mental retardation, multiple congenital anomalies or X-linked diseases (Table 2). In all but two cases [18,56] X inactivation was assessed by late replication. This method is adapted in structural rearrangement analysis because it defines which X is inactive. Zori et al. [53] reported the case of a balanced (X;9) translocation where the normal X was inactive in all amniocytes of the fetus whereas the derivative X was inactive in all lymphocytes of the baby. Choosing a sample that is representative of the fetus is a critical step. Trophoblast and placenta are not appropriate because trophoblast cells differ from embryonic bud cells. Moreover, X inactivation is heterogeneous [60], selection pressure against chromosome imbalances seems less important [61] and the methylation of CpG islands is not completely established before 15 weeks gestation [61]. Amniotic cells or lymphocytes seem to be a better choice, but it would be wise to perform the test on two distinct tissues [59]. Culture conditions should also be taken into account in the interpretation of results since they could be responsible for an artifactual skewing by favoring a clone rather than another [62]. Prenatal genetic counseling of structural X chromosome anomalies is based on the nature, the location, the size, the inherited or de novo nature of the rearrangement and the presence of sonographic anomalies. In this context, X inactivation assay is faced to methodological problems. Its interpretation is difficult due to artifacts and the possibility of gene disruption, complex rearrangements, or X-linked genetic disease. X inactivation study should be limited to particular cases, such as inherited X rearrangements where the observation of the same inactivation pattern in the mother and in the baby would be reassuring. In de novo anomalies, even a favorable skewing

is not sufficient enough to reassure parents. In any case, genetic counseling should be careful. In conclusion, discrepancies between X inactivation pattern and phenotype are not rare and are relevant to various mechanisms. This makes the X inactivation assay in prenatal diagnosis a weak predictive factor of the phenotype. References [1]

Busque L, Mio R, Mattioli J, Brais E, Blais N, Lalonde Y, et al. Nonrandom X-inactivation patterns in normal females: lyonisation ratios vary with age. Blood 1996;88:59–65.

[2]

Lyon M. Nature 1961;190:372–3.

[3]

Schmidt M, Migeon BR. Asynchronous replication of homologous loci on human active and inactive X chromosomes. Genetics 1990;87: 3685–9.

[4]

Sheardown SA, Duthie SM, Johnston CM, Newall AET, Formstone EJ, Arkell RM, et al. Stabilization of Xist RNA mediates initiation of X chromosome inactivation. Cell 1997;91:99–107.

[5]

Okamoto I, Otte AP, Allis CD, Reinberg D, Heard E. Epigenetic dynamics of imprinted X inactivation during early mouse development. Science 2004;303:644–9.

[6]

Allen RC, Zoghbi HY, Moseley AB, Rosenblatt HM, Belmont JW. Methylation of HpaII and HhaI sites near the polymorphic CAG repeat in the human androgen-receptor gene correlates with X chromosome inactivation. Am J Hum Genet 1992;51:1229–39.

[7]

Carrel L, Willard HF. An assay for X inactivation based on differentiel methylation at the fragile X locus, FMR1. Am J Med Genet 1996;64: 27–30.

[8]

Mattei MG, Mattei JF, Ayme S, Giraud F. X-autosome translocations: cytogenetic characteristics and their consequences. Hum Genet 1982; 61:295–309.

[9]

Matsuo M, Muroya K, Kosaki K, Ishii T, Fukushima Y, Anzo M, et al. Random X-inactivation in a girl with duplication Xp-11.21-p21.3: report of a patient and review of the literature. Am J Med Genet 1999;86: 44–50.

[10]

Ogata T, Muroya K, Matsuo N, Shinohara O, Yorifuji T, Nishi Y, et al. Turner syndrome and Xp deletions: clinical and molecular studies in 47 patients. J Clin Endocrinol Metab 2001;86:5498–508.

[11]

Boucher CA, Sargent CA, Ogata T, Affara NA. Breakpoints analysis of Turner patients with partial Xp deletions: implications for the lymphoedema gene location. J Med Genet 2001;38:591–8.

[12]

Wolff DJ, Schwartz S, Carrel L. Molecular determination of X inactivation pattern correlates with phenotype in women with a structurally abnormal X chromosome. Genet Med 2002;2:136–41.

C. Schluth et al. / Pathologie Biologie 55 (2007) 29–36 [13]

[14]

[15]

[16]

[17]

[18]

[19]

[20]

[21]

[22]

[23] [24]

[25] [26]

[27]

[28]

[29]

[30]

[31]

[32]

Salazar D, Rosenfeld W, Verma RS, Jhaveri RC, Dosik H. Partial trisomy of chromosome 3 (3q12 leads to qter) owing to 3q/18p translocation. A trisomy 3q syndrome. Am J Dis Child 1979;133:1006–8. Faas BHW, de Vries BBA, van Es-van Gaal J, Merkx G, Draaisma JMT, Smeets DFCM. A new case of dup(3q) syndrome due to a pure duplication of 3qter. Clin Genet 2002;62:315–20. Pires A, Ramos L, Venancio M, Rei AI, Castedo S, Saraiva J. Prenatal foetal diagnosis of partial trisomy 3q and monosomy 13q due to a maternal balanced rearrangement. Prenat Diagn 2005;25:292–5. Zafra de la Rosa G, Venegas-Vega CA, Monroy N, Contreras-Bucio G, Friedrich U, Houman M, et al. Trisomy 3q25.1-qter and monosomy 8p23.1pter in a patient: cytogenetic and molecular analysis with delineation of the phenotype. Am J Med Genet 2005;136A:259–64. Ogata T, Matsuo N. Turner syndrome and female sex chromosome aberrations: deduction of the principal factors involved in the development of clinical features. Hum Genet 1995;95:607–29. Waters JJ, Campbell PL, Crocker AJM, Campbell CM. Phenotypic effects of balanced X-autosome translocations in females: a retrospective survey of 104 cases reported from UK laboratories. Hum Genet 2001; 108:318–27. Magenis RE, Webb MJ, McKean RS, Tomar D, Allen LJ, Kammer H, et al. Translocation (X;Y)(p22.33;p11.2) in XX males: etiology of male phenotype. Hum Genet 1982;62:271–6. Vergnaud G, Page DC, Simmler MC, Brown L, Rouyer F, Noel B, et al. A deletion map of the human Y chromosome based on DNA hybridization. Am J Hum Genet 1986;38:109–24. Weil D, Wrang I, Dietrich A, Poustka A, Weissenbach J, Petit C. Highly homologous loci on the X and Y chromosome are hot-spots for ectopic recombinations leading to XX maleness. Nat Genet 1994; 7:414–9. Schiebel K, Winkelmann M, Mertz A, Xu X, Page DC, Weil D, et al. Abnormal XY interchange between a novel isolated protein kinase gene, PRKY, and its homologue, PRKX, accounts for one third of all (Y+) XX males and (Y–) XY females. Hum Mol Genet 1997;6:1985– 9. De la Chapelle A. Nature and origin of males with XX sex chromosomes. Am J Hum Genet 1972;24:71–105. Margarit E, Soler A, Carrio A, Oliva R, Costa D, Vendrell T, et al. Molecular, cytogenetic, and clinical characterisation of six XX males including one prenatal diagnosis. J Med Genet 1998;35:727–30. Dupuy O, Palou M, Mayaudon H, Sarret D, Bordier L, Garcin JM, et al. Le syndrome de De la Chapelle. Presse Med 2001;30:369–72. McElreavey K, Rappaport R, Vilain E, Abbas N, Richaud F, LortatJacob S, et al. A minority of 46,XX true hermaphrodites are positive for the Y-DNA sequence including SRY. Hum Genet 1992;90:121–5. Bernstein R, Pinto MR, Almeida M, Solarsh SM, Meck J, Jenkins T. XY translocation in an adolescent mentally normal phenotypic male with features of hypogonadism. J Med Genet 1980;17:437–43. Schempp W, Muller G, Sherer G, Bohlander SK, Rommerskirch W, Fraccaro M, et al. Localization of Y chromosome sequences and X chromosomal replication studies in XX males. Hum Genet 1989;81: 144–8. Fechner PY, Rosenberg C, Stetten G, Cargile CB, Pearson PL, Smith KD, et al. Nonrandom inactivation of the Y-bearing X chromosome in a 46,XX individual: evidence for the etiology of 46,XX true hermaphroditism. Cytogenet Cell Genet 1994;66:22–6. Kusz K, Kotecki M, Wojda A, Szarras-Czapnik M, Latos-Bielenska A, Warenik-Szymankiewicz A, et al. Incomplete masculinisation of XX subjects carrying the SRY gene on an inactiva X chromosome. J Med Genet 1999;36:452–6. Jakubowski L, Jeziorowska A, Constantinou M, Helszer Z, Baumstark A, Vogel W. Xp;Yp translocation inherited from the father in an SRY, RBM, and TSPY positive true hermaphrodite with oligozoospermia. J Med Genet 2000;37:e28. Abdelmoula NB, Portnoi MF, Keskes L, Recan D, Bahloul A, Boudawara T, et al. Skewed X-chromosome inactivation pattern in SRY po-

[33] [34]

[35]

[36]

[37]

[38]

[39]

[40] [41]

[42] [43] [44]

[45]

[46]

[47]

[48]

[49]

[50]

[51]

35

sitive XX maleness: a case report and review of literature. Ann Genet 2003;46:11–8. Anguiano A, Yang X, Felix JK, Hoo JJ. Twin brothers with MIDAS syndrome and XX karyotype. Am J Med Genet 2003;119A:47–9. Modan Moses D, Litmanovitch T, Rienstein S, Meyerovitch J, Goldman B, Aviram-Goldring A. True hermaphroditism with ambiguous genitalia due to a complicated mosaic karyotype: clinical features, cytogenetic findings and literature review. Am J Med Genet 2003;116A: 300–3. Sharp A, Kusz K, Jaruzelska J, Trapper W, Szarras-Czapnik M, Wolski J, et al. Variability of sexual phenotype in 46,XX(SRY+) patients: the influence of spreading X inactivation versus position effects. J Med Genet 2005;42:420–7. Kalscheuer VM, Tao J, Donnely A, Hollway G, Schwinger E, Kubart S, et al. Disruption of the serine/threonine kinase 9 gene causes severe X-linked infantile spasms and mental retardation. Am J Hum Genet 2003;72:1401–11. Scala E, Ariani F, Mari F, Caselli R, Pescucci C, Longo I, et al. Renieri 1. CDKL5/STK9 is mutated in Rett syndrome variant with infantile spasms. J Med Genet 2005;42:103–7. Laumonnier F, Bonnet-Brihault F, Gomot M, Blanc R, David A, Moizard MP, et al. X-linked mental retardation and autism are associated with a mutation in the NLGN4 gene. Am J Hum Genet 2004;74:552–7. Thomas NS, Sharp AJ, Browne CE, Skuse D, Hardie C, Dennis NR. Xp deletions associated with autism in three females. Hum Genet 1999; 104:43–8. Nanko S. Schizophrenia-like psychosis in a 46,XX male. Folia Psychiatr Neurl Jpn 1981;35:461–3. Muller N, Andres M. An XX male with schizophrenia: a case of personality development and illness similar to that in XXY males. J Clin Psychiatry 1987;48:379–80. Ichikawa H, Uchiyama M, Kishi K. A case of 46 XX male syndrome with schizophrenia like psychosis. Seishin Igaku 1989;31:519–25. Milunski J, Huang XL, Milunski A. Schizophrenia susceptibility gene locus at Xp22.3. Clin Genet 1999;55:455–60. Ogata T, Wakui K, Muroya K, Ohashi H, Matsuo N, Brown DM, et al. Microphthalmia with linear skin defects syndrome in a mosaic female infant with monosomy for the Xp22 region: molecular analysis of the Xp22 breakpoint and the X-inactivation pattern. Hum Genet 1998;103: 51–6. Cape CJ, Zaidman GW, Beck AD, Kaufman AH. Phenotypic variation in ophthalmic manifestations of MIDAS syndrome (microphthalmia, dermal aplasia, and sclerocornea). Arch Ophthalmol 2004;:1070–4. Morleo M, Pramparo T, Perone L, Gregato G, Le Caignec C, Mueller RF, et al. Microphthalmia with linear skin defects (MLS) syndrome: clinical, cytogenetic, and molecular characterization of 11 Cases. Am J Med Genet 2005;137A:190–8. Kutsche K, Werner W, Bartsch O, von der Wense A, Meinecke P, Gal A. Microphthalmia with linear skin defects syndrome (MLS): a male with a mosaic paracentric inversion of Xp. Cytogenet Genome Res 2002;99:297–302. Al-Gazali LI, Mueller RF, Caine A, Antoniou A, McCarney A, Fitchett M, et al. Two 46,XX,t(X;Y) females with linear skin defects and congenital microphthalmia: a new syndrome at Xp22.3. J Med Genet 1990;27:59–63. Lindor NM, Michels VV, Hoppe DA, Driscoll DJ, Leavitt JA, Dewald GW. Xp22.3 microdeletion syndrome with microphthalmia, sclerocornea, linear skin defects, and congenital heart defects. Am J Med Genet 1992;44:61–5. Naritomi K, Izumikawa Y, Nagataki S, Fukushima Y, Wakui K, Niikawa N, et al. Combined Goltz and Aicardi syndromes in a terminal Xp deletion: are they a contiguous gene syndrome? Am J Med Genet 1992;43:839–43. Lindsay EA, Grillo A, Ferrero GB, Roth EJ, Magenis E, Grompe M, et al. Microphthalmia with linear skin defects (MLS) syndrome: clini-

36

[52]

[53]

[54]

[55]

[56]

C. Schluth et al. / Pathologie Biologie 55 (2007) 29–36 cal, cytogenetic, and molecular characterization. Am J Med Genet 1994;49:229–34. Bodrug SE, Roberson JR, Weiss L, Ray PN, Worton RG, Van Dyke DL. Prenatal identification of a girl with a t(X;4)(p21;q35) translocation: molecular characterisation, paternal origin, and association with muscular dystrophy. J Med Genet 1990;27:426–32. Zori RT, Gray BA, Bent-William A, Driscoll DJ, Williams CA, Zackowski JL. Preaxial acrofacial dysostosis (Nager syndrome) associated with an inherited and apparently balanced X;9 translocation: prenatal and postnatal late replication studies. Am J Med Genet 1993;46:379– 83. Seller MJ, Pal K, Horsley S, Davies AF, Berry AC, Meredith R, et al. A fetus with an X;1 balanced reciprocal translocation and eye disease. J Med Genet 1995;32:557–60. Feldman B, Kramer RL, Ebrahim SAD, Wolff DJ, Evans MI. Prenatal evaluation of a de novo X;9 translocation. Am J Med Genet 1999;85: 476–8. Wolbert M, Slaw R, Christ L, Karode M, Jeng L, Schwartz S. Molecular and cytogenetic characterization of a prenatally detected t(X;16)

[57]

(q11.1;p13.12) identified in a female fetus. J Assoc Cytogenet Technol 2002;28:A103. Abrams L, Cotter PD. Prenatal diagnosis of de novo X;autosome translocations. Clin Genet 2004;65:423–8.

[58]

Kalz-Füller B, Sleegers E, Schwanitz G, Schubert R. Characterisation, phenotypic manifestations and X-inactivation pattern in 14 patients with X-autosome translocations. Clin Genet 1999;55:362–6.

[59]

Lebbar A, Viot G, Szpiro-Tapia S, Baverel F, Rabineau D, Dupont JM. Pregnancy outcome following prenatal diagnosis of an isodicentric X chromosome: first case report. Prenat Diagn 2002;22:973–5.

[60]

Looijenga LHJ, Gillis AJM, Verkerk AJMH, van Putten WLJ, Oosterhuis JW. Heterogeneous X inactivation in trophoblastic cells of human full-term female placentas. Am J Hum Genet 1999;64:1445–52. Penaherrera MS, Ma S, Ho Yuen B, Brown CJ, Robinson WP. X-chromosome inactivation (XCI) patterns in placenta tissues of a paternally derived bal t(X;20) case. Am J Med Genet 2003;118A:29–34.

[61]

[62]

Sun YJ, Baumer A. Nonrandom X inactivation and selection of fragile X full mutation in fetal fibroblasts. Am J Med Genet 1999;86:162–4.