Phenotypic and genotypic spectrum of Turkish patients with isovaleric acidemia

European Journal of Medical Genetics 57 (2014) 596e601

Contents lists available at ScienceDirect

European Journal of Medical Genetics journal homepage: http://www.elsevier.com/locate/ejmg

Clinical research

Phenotypic and genotypic spectrum of Turkish patients with isovaleric acidemia Rıza Koksal Ozgul a, b,1, Mehmet Karaca c,1, Mustafa Kilic d, Ozgul Kucuk e, Didem Yucel-Yilmaz a, Ozlem Unal a, Burcu Hismi a, Didem Aliefendioglu f, Serap Sivri a, Aysegul Tokatli a, Turgay Coskun a, Ali Dursun a, * a

Hacettepe University, Faculty of Medicine, Department of Pediatrics, Metabolism Unit, Ankara, Turkey Hacettepe University, Institute of Child Health, Ankara, Turkey Aksaray University, Faculty of Science and Arts, Department of Biology, Aksaray, Turkey d Dr. Sami Ulus Maternity and Children Hospital, Training and Research Hospital, Division of Metabolism, Ankara, Turkey e Public Health Organisation of Turkey, Ankara, Turkey f Department of Pediatrics, Kirikkale University, Kirikkale, Turkey b c

a r t i c l e i n f o

a b s t r a c t

Article history: Received 2 July 2014 Accepted 25 August 2014 Available online 8 September 2014

We aim to investigate the genetic basis of isovaleryl-CoA dehydrogenase (IVD) gene mutations and genotypeephenotype correlations in Turkish patients. Accordingly, bi-directional sequencing was performed to screen 26 patients with isovaleric acidemia (IVA). Nine novels (c.145delC, c.234 þ 3G > C, c.506_507insT, p.Glu85Gln, p.Met147Val, p.Ala268Val, p.Ile287Met, p.Gly346Asp and p.Arg382Trp) and six previously reported (c.456 þ 2T > C, p.Arg21His, p.Arg21Pro, p.Arg363Cys, p.Arg363His p.Glu379Lys) pathogenic mutations were identified. Pathogenicity of the novel mutations was supported using computational programs. No clear genotypeephenotype correlation could be determined. One of the cases with the novel c.234 þ 3G > C mutation has portoseptal liver fibrosis, the clinical condition that was first reported for IVA. This study is the first comprehensive report from Turkey related to IVA genetics that provides information about the high number of disease-causing novel mutations. Ó 2014 Elsevier Masson SAS. All rights reserved.

Keywords: Isovaleric acidemia IVD gene Mutation screening Genotypeephenotype correlation

1. Introduction Isovaleric acidemia (IVA, OMIM #243500) is the first organic acidemia recognized in humans. It is an autosomal recessive metabolic disorder caused by a genetic deficiency of isovaleryl-CoA dehydrogenase (IVD, E.C.1.3.99.10), which catalyzes the conversion of isovaleryl-CoA to 3-methylcrotonyl-CoA in leucine catabolism. The IVD enzyme defects are caused by the accumulation of isovaleryl-CoA derivatives, which abnormally increase concentrations of isovaleric acid, 3-hydroxyisovaleric acid, isovaleryl (C5)carnitine, and isovalerylglycine (IVG) in the cells, blood, and urine. The clinical features of IVA include poor feeding, vomiting, lethargy, developmental delay, neuropathologic implications, metabolic acidosis, diabetic ketoacidosis, hyperglycemia, hypoglycemia,

* Corresponding author. Metabolism Unit, Department of Pediatrics, Faculty of Medicine, Hacettepe University, Sıhhiye, Ankara, Turkey. Tel.: þ90 (312) 305 11 41. E-mail address: [email protected] (A. Dursun). 1 Contributed equally. http://dx.doi.org/10.1016/j.ejmg.2014.08.006 1769-7212/Ó 2014 Elsevier Masson SAS. All rights reserved.

hypocalcemia, and sweaty, odourous feet [Erdem et al., 2010; Grünert et al., 2012]. They can vary even in genetically homogeneous populations [Dercksen et al., 2012]. Abnormalities of the hematopoietic system, such as thrombocytopenia, neutropenia, or pancytopenia, occur during metabolic crises [Vatanavicharn et al., 2011]. Moreover, experimental studies on animal brain tissue show that isovaleryl-CoA derivatives may induce oxidative stress, decrease Naþ, Kþ-ATPase activity and lead to neurological abnormalities [Ribeiro et al., 2007; Solano et al., 2008]. Coma and death may occur if appropriate treatments are not initiated [Rezvani and Rosenblatt, 2007; Sweetman and Williams, 2001]. Therefore, early diagnosis and proper treatment is crucial to reduce the severe effect of the disease. Clinical manifestation of IVA can exhibit in a severe, mild or asymptomatic fashion. Three phenotypes (acute neonatal form, chronic intermittent presentation and asymptomatic form) were described. The first form is an acute neonatal presentation with the patient becoming symptomatic within the first two weeks of life. The second group presents a relatively non-specific failure to thrive and/or developmental delay. Moreover, with the application of MS/

Table 1 Clinical and molecular analysis of the patients with IVD gene defect. Patient no.

Current age (months)/sex

Consanguinity

Age at onset/age at diagnosis

Type*

Clinical presentation

Mental retardation

C5 mmol/L (0.0e0.52)

Urine organic acid analyses (Urine isovaleryl-glycine, X: 130 mmol/mol creatinine)

1 2

222/F

þ

36 m/60 m

2

vomiting, lethargy, confusion, tachypnea, Kussmaul’s breathing,

mild

11.46

ND

mild

ND

ND

A

3

196/F

þ

24 m/60 m

2

A

4

64/M

þ

8 d/10 d

1

5

236/M

þ

3 d/114 m

1

6 7

143/F

þ

12 d/60 d

1

8

336/F

þ

13 m/13 m

2

poor suction, lethargy, ketonuria, leucopenia, neutropenia, thrombocytopenia recurrent vomiting, headache, intensional tremor, epilepsy, hypertransaminasemia, liver portoseptal fibrosis

e

5.39

mild

6.9

vomiting, hypertransaminasemia, strabismus, microcephaly diarrhea, vomiting, fever, after acute viral gastroenteritis

moderate

5.3

e

ND

5 3-oh iva,28 isovaleryl-glycine, 3 3-oh butiric,1 suberic very much isovaleryl-glycine, much isovaleryl-glutamic acid

þ

6 d/21 d

1

12

106/F

þ

31 m/46 m

2

13 14

107/M

þ

24 m/45 m

2

15 16

165/F

þ

10 d/60 m

1

17

44/M

þ

5 d/14 d

1

B

18

80/F

þ

-/53 m

3

B

19

Ex/M

þ

15 d/20 d

1

20

52/F

þ

27 m/27 m

2

21 22

141/F 63/M

þ þ

3 d/10 d 3 d/9 m

1 1

23

21/M

þ

3 d/21 d

1

C

24

Ex/F

þ

2 d/4 d

1

C

25

16/F

þ

-/7 d

3

fever, vomiting, encephalopathy, diabetic ketoacidosis, pancytopenia, metabolic acidosis, hypocalcemia poor suction, hypoactivity poor suction, vomiting, tachypnea, metabolic acidosis, hyperactivity poor suction, vomiting, lethargy, hyperammonemia, neutropenia poor feeding, tachypnea, lethargy, hypoactivity, hypotonia, hypoglycemia, hypocalcemia, severe metabolic and lactic acidosis, hyperuricemia, hypernatremic dehydration, prerenal acute renal failure, peritoneal dialysis exitus in newborn period screened due to IVA twin

112/M

þ

6 m/90 m

2

vomiting, tachypnea

26

poor feeding, lethargy, hypoactivity, thrombocytopenia, leucopenia, attention deficit hyperactivity disorder (ADHD) vomiting, lethargy, confusion, kusmall breathing, stridor, hyperglycemia, metabolic acidosis, diabetic ketoacidosis, hypertransaminasemia, hyperammonemia, comas, reye-like syndromes? (acute encephalopathy), anaphylaxy related to drugs? intubated abdominal pain, cyclic vomiting related to infections

prematurity, premature rupture of membrane, vomiting, poor feeding, hypotonia, abdominal distension, diabetic ketoacidosis, coma, epilepsy Poor suction, vomiting, tachypnea, metabolic acidosis, ketonuria, recurrent admission of emergency service poor feeding, evulsion of proteins, vomiting, genetic diagnosis due to sibling history of IVA poor suction, metabolic acidosis, hyperammonemia, peritoneal dialysis, convulsions, exitus in newborn period

mild

c.890C > T/c.1222G > A c.890C > T/c.1222G > A c.234þ3G > C

c.948C > G c.890C > T

ND

c.1124G > A c.890C > T/c.1222G > A c.506-507insT c.456þ2T > C

23.1

6 isovaleryl-glycine, a little increased 3-oh iva, sebasic acid, 3-oh sebasic acid

e

2.9

30 3-oh iva, isovaleryl-glycine, 2 lactic acid, acetoacetate, methylsuccinate, 20 3-oh butiric acid

c.149G > C

e

2.82

100 isovaleryl-glycine, 1 3-oh iva

mild

ND

ND

c.456þ2T > C c.149G > C/c.526A > G c.1124G > A c.1175G > A

e

ND

ND

c.149G > C c.1231C > T

ND

98 isovaleryl-glycine, 1/4 mma, 1/10 3-oh iva, 2 hva 11 isovaleryl-glycine, 2.5 3-oh ıva,2 lactic acid, 4-oh valeric acid,1.5 levulinic acid,3/4  3-oh butiric acid, piruvic acid,1 4-oh fenyllactic acid ND

5.72 ND

10-3-oh ıva, 15 isovaleryl-glycine, Increased 3-oh iva, isovaleryl-glycine

c.145delC c.1222G > A

26 isovaleryl-glycine

c.340G > C

ND

c.1174C > T

8 isovaleryl-glycine,1.5 fumaric, 1/2 3-oh iva,1/3 4-oh fenilpiruvic asit, 1/15 metilmalonic acid 100 isovaleryl-glycine,1/4 3-oh iva, methylmalonic acid,1/5 n-acetyl tyrosine

c.1174C > T

e

8.88

exitus

7

e mild

7.73 exitus

37.58

e

9.11

mild

5.71

c.456þ2T > C

c.890C > T

597

ND: not determined; d: day(s); m: month(s); y: year(s). * 1- acute neonatal form, 2-chronic intermittent form, 3-Asyptomatic form; Same letter are siblings; X-fold increased (130 mmol/mol cre).

c.1231C > T

R.K. Ozgul et al. / European Journal of Medical Genetics 57 (2014) 596e601

62/F

c.1222G > A c.149 G > A

1 3-oh iva, 2 isovaleryl-glycine

9 10 11

Nucleotide change

598

R.K. Ozgul et al. / European Journal of Medical Genetics 57 (2014) 596e601

MS in newborn screening, potentially asymptomatic patients with one recurring IVD gene mutation and a mild biochemical phenotype are being identified in increasing numbers, representing an additional phenotype of IVA [Ensenauer et al., 2004; Tanaka, 1990]. As treatment may affect the promotion of normal development in affected individuals, diagnosis of the disease prior to the development of symptoms is important. Decreasing the production of toxic metabolites from leucine catabolism by restricting protein or leucine in the diet and/or promoting an excretion of isovalerate in the urine by carnitine and glycine supplementation is an effective way to prevent metabolic crises. IVD is a member of the acyl-CoA dehydrogenases (ACDs) family and homotetrameric mitochondrial flavoenzyme, which contains one non-covalently bound FAD (flavin adenine dinucleotide) molecule per subunit [Ensenauer et al., 2004; Tiffany et al., 1997]. In various species, the IVD proteins have an 85e90% amino acid sequence identity with humans IVD [Mohsen et al., 1998; Willard et al., 2001]. The native protein is synthesized by the nuclear genome as a precursor form in cytoplasm and is then transported into the mitochondria, where the protein is mature and functional [Ikeda et al., 1987]. The human IVD gene is located on chromosome 15q14-15 and consists of 12 exons [Kraus et al., 1987; Parimoo and Tanaka, 1993]. Currently, 43 pathogenic IVD gene mutations causing IVA deficiency have been published (http://www.hgmd.cf.ac.uk/ac/all.php. However, a clear genotypeephenotype correlation has not yet been established. Common IVD mutations differ among populations: the p.Ala282Val was reported for Caucasians [Ensenauer et al., 2004] and the p.Gly123Arg for Caucasians that colonized in South Africa [Dercksen et al., 2012], as frequent mutations. The c.457e3_2CA > GG mutation is common in Taiwan [Vatanavicharn et al., 2011] and Korea [Lee et al., 2007], while p.Tyr371Cys is frequent in Han Chinese [Lee et al., 2010]. The IVA frequency has been reported as 1:250,000, 1:365,000, and 1:62,500 for the United States, Taiwan, and Germany respectively [Ensenauer et al., 2004; Lin et al., 2007]. Unfortunately, there is no knowledge of the incidence of IVA in Turkey. This study focused on the investigation of genetic causes of this rare disease in a relatively large group of Turkish patients (n ¼ 26) with IVA. The clinical outcomes of the patients were evaluated, and the disease-causing mutations were determined. Finally, we aimed to verify the IVA diagnosis at the DNA level and establish a genotypeephenotype correlation in this cohort of patients.

Wechsler Intelligence Scale for Children was used. Information on the psychomotor development was obtained from medical records. 3. Methods Genomic DNA from the patients was isolated from peripheral blood samples (10 ml) using a standard salting-out method. All IVD exons flanking the exonic nucleotide sequences were amplified using intronic primers (Table 2) to confirm the integrity.of the intron-exon boundaries. PCR reactions were performed in a total reaction-volume of 25 mL (1 PCR buffer, 1.5 mM MgCl2, 200 mM of each dNTP, 50 pmol of each primer and 0.5 U HotStartTaq DNA polymerase) using 50 ng of genomic DNA. The PCR amplification conditions were as follows: an initial denaturation step at 95  C for 15 min, followed by 30 cycles of denaturation, annealing and extension at 95  C (30 s), 57e60  C (30 s) and 72  C (30 s) respectively, with a final extension step of 72  C for 10 min. PCR products were purified using the MinElute 96 UF plate systems (Qiagen, Hilden, Germany). Samples were then sequenced in both directions using the BigDye Terminator Kit version 3.1 (Applied Biosystems, Foster City, CA) and analyzed in an automated DNA sequencer (ABI 3130). Analysis Software v 5.2 Patch 2 (Applied Biosystems) was used to analyze the sequencing data. To assess the potential pathogenic effects of these mutations on IVD protein we used the Human Splicing Finder program Version 2.4.1 (http://www.umd.be/HSF/), PolyPhen2 (http://genetics.bwh. harvard.edu/pph2/) and SIFT (http://sift.jcvi.org/sift-bin/retrieve_ enst.pl) analysis programs. Table 2 Primers used for PCR and sequencing reactions of IVD gene. Exon

Forward primers (50 / 30 )

Reverse primers (30 / 50 )

Product Annealing size (bp) temperature ( C)

1 2 3 4 5 6 7 8 9 10e11 12

ttactgggtacgtgggcag agttacttgtggccttttctc agtgtttgggtctcatt gaatgtcccgatttaatctgg gtttgaaggggtttaatgtgg tctcaaaggtggacagcttc acagggactcaataggaagg tctccctctgaccagcactt taactgtggcaagactttctg atcctgagtaaatcccatctc ctatatacttggcattctgt

ccacccagccttggctttt gaagtgtttgggtctcattgt gaaacccagaactgcatcttt ccatgaaccaaatgtggtta cagaactttctcaaaggtgga ggaatcagtgttgtgtgctc cctagccacatgtcactgaa catctcccaggagagagcag acaagctcaatttgctagagg acacctataatcccagcactt gagatgtggcggctttcc

660 319 258 357 310 334 402 393 382 534 284

58 58 60 58 58 58 60 58 60 57 58

2. Patient data 4. Results Study participants were patients from Hacettepe University, Faculty of Medicine, Metabolism Unit at the Department of Pediatrics. Ethical review board approval was obtained and the principles outlined in the Declaration of Helsinki for human experimental investigations were followed. Twenty-six patients from 23 unrelated Turkish families were enrolled in the study after obtaining informed consent. All patients were diagnosed from the clinical presentation and confirmed by IVA-specific metabolites in plasma and/or urine. Clinical information was available for 20 patients and collected for each patient by review of the patient’s medical records. Patients’ characteristics, clinical and genotyping data are presented in Table 1. Phenotypic subtypes (acute neonatal form, chronic intermittent form or asymptomatic form) were as described in the introduction section. The term early diagnosis refers to a diagnosis made within the first two weeks of life, whereas the term late diagnosis refers to one made thereafter. In patients younger than five years old, psychomotor development was evaluated using the Denver Developmental Screening Test; in the remaining patients the

All the IVD exons were screened by direct DNA sequencing in a total of 26 patients with IVA diagnosis, who came from 23 unrelated families. Clinical information was available for 20 patients (Table 1). The parental consanguinity rate was 17/23 (74%) among families. The male to female ratio was 10/16. The age of the patients ranged from 16 months to 28 years, and the age of diagnosis ranged from 3 days to 9.5 years. Eleven patients (55%) had the acute neonatal form, seven patients (35%) had the chronic intermittent form, and the remaining two (10%) were diagnosed with the sibling history (asymptomatic form). Two of the patients (10%) with the acute neonatal form were deceased. Mortality in the early diagnosed group was 2/11 (18%) and 2/20 (10%) in all IVA patients. Data on psychomotor development was obtained for 16/20 (80%) patients from their medical records. Seven patients had mild and one had moderate mental retardation, while eight patients had normal intelligence (Table 1). The results revealed 15 different mutations (Table 3), nine of which were novel. Most of the nucleotide alterations described

R.K. Ozgul et al. / European Journal of Medical Genetics 57 (2014) 596e601

599

Table 3 IVD gene mutations in Turkish patients. Nucleotide change

Exon/Intron

Effect of mutation

Allele frequency (%)

References

c.145delC c.149 G > A c.149 G > C c.234D3G > C c.340 G > C c.456þ2T > C c.506_507insT c.526 A > G c.890 C > T c.948 C > G c.1124 G > A c.1174C > T c.1175 G > A c.1222 G > A c.1231 C > T

2 2 2 IVS 2 4 IVS 4 5 5 9 9 11 12 12 12 12

p.Leu20Phe fs*63 p.Arg21His p.Arg21Pro Splicing p.Glu85Gln Splicing p.Ala140Alafs*2 p.Met147Val p.Ala268Val p.Ile287Met p.Gly346Asp p.Arg363Cys p.Arg363His p.Glu379Lys p.Arg382Trp

4.35 4.35 10.87 4.35 4.35 13.04 4.35 2.18 13.04 4.35 8.70 4.35 4.35 13.04 4.35

This study [Ensenauer et al., 2004] [Mohsen et al., 1998] This study This study [Mohsen et al., 1998] This study This study This study This study This study [Mohsen et al., 1998] [Hertecant et al., 2012] [Kucuk et al., 2010] This study

The numberings of nucleotide changes are based on cDNA sequence in accordance with the GenBank entries NM_002225.3. The amino acid numbers were designed according to the ENST00000249760 and positions are corresponds to the sequence of mature protein. Novel mutations described in this study are shown in bold.

here were scattered along the coding sequences of the IVD gene and included 11 missense, one deletion and one insertion types of mutation. In addition, two of the detected mutations were localized in the splice sites of the IVD gene. We were able to determine the mutant alleles in all patients with IVA. A hundred unrelated control chromosomes were screened for the testing of absence of novel mutations. None of these changes were detected in healthy controls in our population. The previously reported p.Ala268Val, p.Glu379Lys and c.456þ2T > C splice site variations were the most frequent mutations in these patients, with an allele frequency of 13.04% for each. They were followed by the p.Arg21Pro substitution, with a 10.87% allele frequency. Overall, these four mutations represented about 50% of the mutant IVD alleles. Excluding siblings, 11 patients bore one of these alleles, either in a homozygous or heterozygous combination. The p.Met147Val is a novel variation described in this study, and it appears to be a rare allele for the Turkish population. It was detected in a compound heterozygous state with the previously reported p.Arg21Pro mutation. The novel homozygous c.145delC and c.506_507insT mutations were detected in two unrelated patients, and both caused a frameshift that introduced a premature stop codon that generated a truncated inactive IVD protein. A novel homozygous c.234þ3G > C splice site mutation was found in a patient. The remaining five novel and four previously described missense mutations (Table 3) were segregated with a disease phenotype in at least one or more IVA families. In addition to the pathogenic mutations, sequence analysis revealed three single nucleotide polymorphisms in the intronic regions of the IVD gene. One of them is a novel nucleotide change, namely c.550 þ 57A > G. The others, c.234 þ 14T > C and c.1065 þ 41G > T, have been previously described as intronic polymorphisms. 5. Discussion IVD gene mutations and bioprocessing of the protein have been well studied and understood, but the genotypeephenotype correlation is still ill-defined [Dercksen et al., 2012; Hertecant et al., 2012]. In this study, we aim to investigate the mutation spectrum of the IVD gene and phenotypeegenotype relation in Turkish patients. Heterogeneity was observed on both a mutational and clinical basis. Intra- and inter-familiar variability regarding clinical manifestations had been recognized in the screened patients. Siblings (patients 3 and 4, 18 and 19, 24 and 25), carrying the same mutations,

presented extremely different phenotypes (Table 1). The variation may be due to poor dietary intervention, delayed diagnosis or even epigenetic and polygenetic factors of unknown origin [Dercksen et al., 2012]. As far as we know from the literature, patients who survive a neonatal crisis are clinically indistinguishable from children diagnosed later in life [Tanaka, 1990]. In this study, all the patients with mental retardation had late diagnosis (except patient 11). The mild mental retardation of patient 11 may have resulted from the given diet. Furthermore, most of the patients with normal intelligence received an early diagnosis and treatment (except patients 12, 13, and 18) (Table 1). Patient 18 has an asymptomatic form that accounts for the late diagnosis. However, it is difficult to explain the normal mental development of the other two patients. It might be due to the late onset and mild form of the disease. We can conclude that neither the clinical subtypes nor the type of mutations are related to the mental health. Indeed, early diagnosis and effective treatment seem to be the most important means of preventing mental retardation. Different clinical presentations and chronic intermittent forms were observed, especially in patients with a late diagnosis. Patient 5, with the acute neonatal type, had a late diagnosis and presented an intentional tremor, epilepsy, hypertransaminasemia, and liver portoseptal fibrosis. A portoseptal liver fibrosis has not already been reported for patients diagnosed with IVA. Laboratory tests were normal for liver involvement. It is known that liver cirrhosis can be a rare complication of organic academia, such as propionic acidemia. Patient 12, with the chronic intermittent form, presented a coma and was intubated due to respiratory failure and a suspected diagnosis of anaphlaxia. We have previously reported upon a patient with the chronic intermittent form of IVA who presented diabetic ketoacidosis [Kilic et al., 2014]. Other patients with the chronic intermittent form presented crisis after infectious diseases. Different studies have revealed allelic heterogeneity in the IVD gene. More than 40 mutations were found to be associated with the IVA phenotype (http://www.hgmd.cf.ac.uk/ac/all.php). In spite of the biological characteristics (such as clinical symptoms, biochemical findings, and molecular evidence), that were defined in some Western and Far Eastern countries, studies in Turkey are quite limited and consist of only clinical and biochemical characterizations [Erdem et al., 2010; Kasapkara et al., 2011; Kilic et al., 2014; Malbora et al., 2010; Tokatli et al., 1998]. The present study revealed 15 different mutations that are associated with IVA pathogenesis in Turkish patients. Two of the defined mutations, c.234þ3G > C and c.456þ2T > C, have the potential to cause an abnormal splicing of IVD mRNA. The substitution

600

R.K. Ozgul et al. / European Journal of Medical Genetics 57 (2014) 596e601

at position c.234þ3G > C is a donor splice site mutation with Ri values of 6.5 / 2.1 bits, respectively. The NetGene2 v.2.4 and Automated Splice Site Analyses programs were used to predict the putative effect of this mutation. The results show a weak donor binding site for the correct splicing between exons 2 and 3, which means that the normal splicing process could be altered. The c.456þ2T > C substitution effected a splicing with Ri values of 11.0 / 3.5 bits, respectively. This alters the conserved intron 4 splicing donor site. It was reported that the mutation contributed to the formation of unstable IVD mRNA [Vockley et al., 2000]. The insertion at position c.506-507insT and deletion at position c.145delC truncates the open reading frame by creating a premature stop codon, 6 and 189 bp downstream from the mutation point, respectively. Consequently, these frameshift mutations eliminate 252 and 311 amino acids, respectively, from the C terminus of the mature IVD protein. The protein positions p.Glu85, p.Met147, p.Ala268, p.Arg363, p.Glu379, and p.Arg382 are located in completely conserved IVD gene regions among different species, while p.Ile287 and p.Arg21 are highly (93.75% and 87.5%, respectively) conserved regions of the IVD protein (HomoloGene database: http://www.ncbi.nlm.nih.gov/ homologene). The novel missense mutations (p.Glu85Gln, p.Met147Val, p.Ala268Val, p.Ile287Met, p.Gly346Asp, and p.Arg382Trp) occurring in these sites are considered pathogenic, as they segregate with the disease phenotype in the screened families. In addition, they are absent in one hundred unrelated healthy controls. The potential pathogenic effects of these mutations were predicted by computational programs and the obtained values were 0.993e1.00 for PolyPhen2 and 0 for SIFT, which indicates that these substitutions, with high scores, would affect the protein function, thus further supporting their pathogenicity. It is well known that missense mutations located in particular exonic regions may cause splice site defects [Mohsen et al., 1998; Vockley et al., 2000]. Due to their exonic localization, four out of the six novel missense mutations (p.Met147Val, p.Ala268Val, p.Ile287Met and p.Gly346Asp) were analyzed by the Human Splicing Finder program Version 2.4.1, which checked whether these substitutions lead to splicing defects on the IVD gene. The values indicating their ability to create a new splice site were þ69.53% and þ66.57% for mutations p.Ala268Val and p.Met147Val, respectively. The mutation p.Gly346Asp occurred in a less conserved protein region (the position is conserved 56.25% among the 16 different species). Its pathogenic affect may be due to the different characteristics of amino acid side chains involved in the substitution at this site. Glycine (Gly) provides conformational flexibility because of its structure. Accordingly, it can reside in parts of protein structures that are forbidden to all other amino acids (e.g. tight turns in structures). The occupation of this site by charged and polar aspartate (Asp) is likely to cause an impaired protein structure. The mutation p.Ile287Met is localized at the beginning of helix G. Moreover, positions 280 (Arg) and 291 (Gln) are the FAD binding sites (http://www.uniprot.org/uniprot/P26440), and the p.Ile287Met substitution will introduce a more flexible methionine with its bulky side chain between the two FAD binding pockets. The p.Arg21 is localized at the end of helix A, which corresponds to the N terminus of the enzyme. Several mutations have been described at this position, in which some (such as p.Arg21Leu) disrupt the salt and hydrogen bonds associated with Gly85 and Tyr312 residues [Lee et al., 2007], while others (such as p.Arg21Pro or p.Arg21Cys) lead to the skipping of exon 2 [Vockley et al., 2000], thus indicating the importance of this point in terms of protein structure and function. In the present study, we identified p.Arg21Pro and p.Arg21His mutations in this site. It was shown that the p.Arg21Pro mutation leads to the quick degradation of protein following its transfer into the mitochondria [Mohsen

et al., 1998; Vockley et al., 2000]. However, the putative effect of p.Arg21His has not yet been defined. We observed two different previously identified mutations at position p.Arg363. The p.Arg363Cys is located in the a-helix J and leads to a less stable protein with decreased enzyme activity up to 1% [Mohsen et al., 1998; Vockley et al., 2000]. Based on molecular/ computational analysis, the second mutation, p.Arg363His, at this site may lead to the disruption of enzymatic activity and the stability of IVD [Hertecant et al., 2012]. Notably, p.Arg363His was considered to be pathogenic in spite of its nonpenetrant phenotype [Hertecant et al., 2012]. The C terminal amino acids of the IVD protein are necessary for tetramer stability and subunit interactions. There is a possible interaction between the positively charged p.Arg382 and the negatively charged p.Glu379 residues that are located in the same subunit. Both positions are close to the C terminus of the protein [Volchenboum et al., 2001]. Disruption of the hydrogen bond between these residues and the FAD molecule, due to the p.Glu379Lys mutation, has already been associated with the impaired enzymatic activity of IVD [Hertecant et al., 2012]. The novel p.Arg382Trp mutation leads to the replacement of arginine (Arg) by an aromatic tryptophan (Trp) residue, which is unique in terms of its chemistry and size, and will most likely break the interaction that serves to maintain the proper tertiary structure of IVD monomers. 6. Conclusion This is the first comprehensive report from Turkey. Clinical and genetic heterogeneity were observed in a screened cohort in spite of the high rate of consanguineous marriages (22%) in Turkey, which are considered to be an important factor contributing to the higher incidences of autosomal recessive hereditary diseases. Identification of novel IVD gene variations can be useful for early diagnosis and treatment prior to symptoms and better understanding of the structure-function relation of the enzyme. Conflict of interest The authors declare that they have no confict of interest. Acknowledgments We would like to acknowledge to Dr. Sefayet Karaca for scientific contribution and to Dr. Francesca Bertola for providing the computational programs. We thank to the staff of the DNA Bank of Hacettepe University for use of their biobanking facility. We are greatly indebted to the patients and their families for generous cooperation. This study was funded by the DPT-1206400603 and TUBITAK111S217 projects. References Dercksen M, Duran M, Ijlst L, Mienie LJ, Reinecke CJ, Ruiter JP, et al. Clinical variability of isovaleric acidemia in a genetically homogeneous population. J Inherit Metab Dis 2012;35(6):1021e9. Ensenauer R, Vockley J, Willard JM, Huey JC, Sass JO, Edland SD, et al. A common mutation is associated with a mild, potentially asymptomatic phenotype in patients with isovaleric acidemia diagnosed by newborn screening. Am J Hum Genet 2004;75:1136e42. Erdem E, Cayonu N, Uysalol E, Yildirmak ZY. Chronic intermittent form of isovaleric acidemia mimicking diabetic ketoacidosis. J Pediatr Endocrinol Metab 2010;23: 503e5. Grünert SC, Wendel U, Lindner M, Leichsenring M, Schwab KO, Vockley J, et al. Clinical and neurocognitive outcome in symptomatic isovaleric acidemia. Orphanet J Rare Dis 2012;7:9. Hertecant JL, Ben-Rebeh I, Marah MA, Abbas T, Ayadi L, Ben Salem S, et al. Clinical and molecular analysis of isovaleric acidemia patients in the United Arab

R.K. Ozgul et al. / European Journal of Medical Genetics 57 (2014) 596e601 Emirates reveals remarkable phenotypes and four novel mutations in the IVD gene. Eur J Med Genet 2012;55(12):671e6. Ikeda Y, Keese SM, Fenton WA, Tanaka K. Biosynthesis of four rat liver mitochondrial acyl-CoA dehydrogenases: in vitro synthesis, import into mitochondria, and processing of their precursors in a cellfree system and in cultured cells. Arch Biochem Biophys 1987;252:662e74. Kasapkara CS, Ezgu FS, Okur I, Tumer L, Biberoglu G, Hasanoglu A. N-carbamylglutamate treatment for acute neonatal hyperammonemia in isovaleric acidemia. Eur J Pediatr 2011;170:799e801. Kilic M, Kaymaz N, Ozgul RK. Isovaleric acidemia presenting as diabetic ketoacidosis. J Clin Res Pediatr Endocrinol 2014;6(1):59e61. Kraus JP, Matsubara Y, Barton D, Yang-Feng TL, Glassberg R, Ito M, et al. Isolation of cDNA clones coding for rat isovaleryl-CoA dehydrogenase and assignment of the gene to human chromosome 15. Genomics 1987;1:264e9. Kucuk O, Ozgul RK, Karaca M, Sivri HS, Coskun T, Tokatli A, et al. Six novel mutations in Turkish patients with isovaleric acidemia. J Inherit Metab Dis 2010;33(Suppl. 1):44. Lee YW, Lee DH, Vockley J, Kim ND, Lee YK, Ki CS. Different spectrum of mutations of isovaleryl-CoA dehydrogenase (IVD) gene in Korean patients with isovaleric acidemia. Mol Genet Metab 2007;92:71e7. Lee HHC, Lee RSY, Lai CK, Yuen YP, Siu TS, Chan AYW, et al. A novel duplication at the putative DNA polymerase alpha arrest site and a founder mutation in Chinese in the IVD gene underlie isovaleric acidaemia. Hong Kong Med J 2010;16:219e22. Lin WD, Wang CH, Lee CC, Lai CC, Tsai Y, Tsai FJ. Genetic mutation profile of isovaleric acidemia patients in Taiwan. Mol Genet Metab 2007;90:134e9. Malbora B, Avci Z, Hasanoglu A, Alehan F, Ozbek N. Late onset of isovaleric acidemia presenting with bicytopenia. Turk J Hematol 2010;27:216e8. Mohsen AW, Anderson BD, Volchenboum SL, Battaile KP, Tiffany K, Roberts D, et al. Characterization of molecular defects in isovaleryl-CoA dehydrogenase in patients with isovaleric acidemia. Biochemistry 1998;37:10325e35. Parimoo B, Tanaka K. Structural organization of the human isovaleryl-CoA dehydrogenase gene. Genomics 1993;15:582e90.

601

Rezvani I, Rosenblatt DS. Valine, leucine and related organic acidemia. In: Behrman RE, Kliegman RM, Jenson HB, editors. Textbook of pediatrics. 18th ed. Philadelphia, PA: WB Saunders; 2007. p. 542. Ribeiro CAJ, Balestro F, Grando V, Wajner M. Isovaleric acid reduces Naþ, Kþ-ATPase activity in synaptic membranes from cerebral cortex of young rats. Cell Mol Neurobiol 2007;27(4):529e40. Solano AF, Leipnitz G, De Bortoli GM, Seminotti B, Amaral AU, Fernandes CG, et al. Induction of oxidative stress by the metabolites accumulating in isovaleric acidemia in brain cortex of young rats. Free Radic Res 2008;42(8):707e15. Sweetman L, Williams JC. Branched chain organic acidurias. In: Scriver CR, Beaudet AL, Sly WS, Valle D, editors. The metabolic and molecular basis of inherited disease. New York: Mc-Graw-Hill; 2001. pp. 2125e63. Tanaka K. Isovaleric acidemia: personal history, clinical survey and study of the molecular basis. Prog Clin Biol Res 1990;321:273e90. Tiffany KA, Roberts DL, Wang M, Paschke R, Mohsen AW, Kim J, et al. Structure of human isovaleryl-CoA dehydrogenase at 2.6 A resolution: structural basis for substrate specificity. Biochemistry 1997;36:8455e64. Tokatli A, Coskun T, Ozal I. Isovaleric acidemia: clinical presentation of 6 cases. Turk J Pediatr 1998;40(1):111e9. Vatanavicharn N, Liammongkolkul S, Sakamoto O, Sathienkijkanchai A, Wasant P. Phenotypic and mutation spectrums of Thai patients with isovaleric acidemia. Pediat Int 2011;53(6):990e4. Vockley J, Rogan PK, Anderson BD, Willard J, Seelan RS, Smith DI, et al. Exon skipping in IVD RNA processing in isovaleric acidemia caused by point mutations in the coding region of the IVD gene. Am J Hum Genet 2000;66: 356e67. Volchenboum SL, Mohsen AW, Kim JJ, Vockley J. Arginine 387 of human isovalerylCoA dehydrogenase plays a crucial role in substrate/product binding. Mol Genet Metab 2001;74(1e2):226e37. Willard JM, Reinard T, Mohsen AW, Vockley J. Cloning of genomic and cDNA for mouse isovaleryl-CoA dehydrogenase (IVD) and evolutionary comparison to other known IVDs. Gene 2001;270:253e7.