Phenotypic changes in ciprofloxacin-resistant Staphylococcus aureus

Research in Microbiology 160 (2009) 785e791 www.elsevier.com/locate/resmic

Phenotypic changes in ciprofloxacin-resistant Staphylococcus aureus Lili R. Mesak, Julian Davies* Department of Microbiology and Immunology, University of British Columbia, Life Sciences Institute, 2350 Health Science Mall, Vancouver, BC V6T 1Z3 Canada Received 6 August 2009; accepted 23 September 2009 Available online 7 October 2009

Abstract The work described here continues our studies of the effects of subinhibitory concentrations of antibiotics on SOS and DNA repair gene expression in Staphylococcus aureus. Mitomycin C and the new-generation fluoroquinolone moxifloxacin induced expression of SOS response genes (lexA, recA, sosA, and umuC ) in a ciprofloxacin-resistant CiprI strain of S. aureus. To examine phenotypic changes in Cipr strains mutated in CIP targets (GrlA and/or GyrA), we used Biolog Phenotype MicroArraysÔ. Two other Cipr strains mutated in the norA promoter region were used to study the effects of subinhibitory concentrations of DNA-damaging antibiotics on norA expression. We show that mitomycin C and moxifloxacin induced overexpression of the norA gene in Cipr strains. Finally, we confirm that subinhibitory concentrations of CIP increase mutation rates in S. aureus. Ó 2009 Elsevier Masson SAS. All rights reserved. Keywords: Efflux pumps; Fluoroquinolone; Major facilitator superfamily (MFS); Resistance; Transcription modulation

1. Introduction Staphylococcus aureus is a major nosocomial pathogen responsible for substantial morbidity and mortality in intensive care units throughout the world. It is becoming increasingly encountered in the community. Methicillin-resistant S. aureus (MRSA) are often multidrug-resistant. For example, a clone of MRSA isolated in 1994 was found to be resistant to 15 antibiotics including ciprofloxacin (CIP) [1]. The fluoroquinolones (FQs), as typified by CIP, were introduced in the early 1980s and have become the leading class of broad-spectrum antimicrobials [38,39]. Not surprisingly, resistance has developed with the increasing use of FQs; CIP resistance among MRSA has reached almost 100% in some locations [11,20]. CIP blocks DNA replication by binding to DNA gyrase and topoisomerase IV [20], and mutations in several genes, notably gyrA and grlA, lead to resistance [19]. Another mechanism leading to FQ resistance is active efflux by drug transporters

* Corresponding author. Tel.: þ1 604 822 5856; fax: þ1 604 822 6041. E-mail addresses: [email protected] (L.R. Mesak), jed@interchange. ubc.ca (J. Davies). 0923-2508/$ - see front matter Ó 2009 Elsevier Masson SAS. All rights reserved. doi:10.1016/j.resmic.2009.09.013

such as NorA, NorB, and NorC [9,10,22,34,42]. Expression of the S. aureus norA gene depends on at least two regulatory pathways controlled by ArlRS and MgrA (previously known as NorR). These proteins bind to the norA promoter region [16,17,33,35]. Insertion or deletion mutations in the norA promoter region overexpress NorA, the efflux pump protein. This is associated with resistance to a number of DNAdamaging agents [8,21,28]. Antibiotic resistance is a serious problem worldwide. New antibiotics are urgently needed, particularly for the treatment of multidrug-resistant bacteria. The use of two or more antibiotics having a synergistic action is frequently employed [37]. For example, the therapeutic value of FQ in combination with rifampin has been demonstrated against serious S. aureus infections [14,13]. Combination therapy with daptomycin, vancomycin, linezolid and rifampin is an alternative available for the treatment of severe MRSA infections [2,3]. Novel FQs such as DX-619 [32,40] and WCK-1734 [31], with enhanced antibiotic activity against a number of Gram-positive pathogens including MRSA, have been synthesized. In a previous communication, we isolated spontaneous Cipr S. aureus mutants. These mutants were used for studying transcription modulation of SOS response genes by antibiotics

786

L.R. Mesak, J. Davies / Research in Microbiology 160 (2009) 785e791

such as FQs and DNA-damaging compounds [25]. We demonstrate that sub-MIC levels of CIP increase the mutation rate. Here we examined Cipr mutants in more detail, since we noted significant variations in recA expression in Cipr mutants [25]. Two previously isolated Cipr mutants, CiprI (GrlA[S80F]) and CiprIIa (GrlA[S80F], GyrA[E88Q]), were analyzed with Phenotype MicroArrayÔ technology (Biolog Inc) [4,5] to observe changes in metabolism of carbon, nitrogen, phosphate and sulfur sources as well as responses to other nutrients, pH, osmolytes, antibiotics and other metabolic inhibitors. Comparison of SOS response and methyl mismatch repair (MMR) [25] gene expression in S. aureus RN4220 and CiprI were performed in the presence of sub-MIC levels of CIP, moxifloxacin, and mitomycin C. We also investigated the effect of DNA-damaging antibiotics on the altered norA promoters in CiprIa and CiprIIb. 2. Materials and methods 2.1. Bacterial strains and growth conditions S. aureus Newman [12], COL, [27], RN4220 [24] and Cipr mutants [25] were grown on NYE medium [29]. Escherichia coli DH10B (Invitrogen) was grown on Luria broth. Antibiotics were obtained from Sigma and antibiotic disks were obtained from Becton Dickinson and Difco.

Antibiotic disks were placed on the overlay and the plates incubated at 37  C. After 20 h, inhibition zones were measured and luminescence was detected with a luminograph LB980 photon camera (Berthold). 2.4. Liquid assays S. aureus promoter-lux reporter strains were grown in NYEC broth at 37  C. The overnight cultures were diluted appropriately for luminescence assays OD595 z 0.150. OD595 and luminescence values were recorded hourly for 14 h at room temperature in a Wallac 1420 Victor Multilabel Counter (PerkineElmer). Each experiment was repeated thrice. 2.5. Determination of mutation frequency 0.5 ml of an overnight culture of an S. aureus strain was inoculated into 10-ml NYE medium with or without CIP (0.1, 0.2, or 0.5 mg/ml). Cultures were incubated for 5 h to OD600 z 1.0. 1 ml samples were taken at 5 h and centrifuged; the pellets were resuspended in 50 ml medium and plated on NYE containing rifampicin (5 mg/ml). The mutation frequency was calculated from the total number of colonies on rifampicin medium divided by the total number of cells (CFU/ml) after overnight incubation at 37  C. 2.6. Phenotype microarray (PM) analysis

2.2. Construction of plasmids carrying norA promoter-lux fusions Promoter sequences were amplified by PCR using S. aureus RN4220, S. aureus CiprIa, and S. aureus CiprIIb chromosomal DNA templates with primers: 50 CGCGGATC CCATCACATGCACCAATGCCG30 and 50 CGCGGATCCC TGTTTATTCATATGCTCAC30 . The PCR products were digested with BamHI, ligated into the BamHI cloning site of the vector, pAmilux [26], and transformed into E. coli DH10B. Transformants were selected on LB supplemented with ampicillin (100 mg/ml). The orientation of the promoters with respect to the luxABCDE cassette was determined by PCR using the norA promoter gene primers (see above) in combinati on with t he luxA primer (5 0 TTGGG GAG GTTGGTATGTAAGC30 ), followed by sequencing of the amplicons. The amplification protocol was 35 cycles at 94  C for 30 s, 60  C for 30 s and 72  C for 40 s. The plasmids pAmiNorA, pAmiNorA3 and pAmiNorA6 carry, respectively, the norA promoter regions of S. aureus RN4220, S. aureus CiprIa and S. aureus CiprIIb. The plasmids were electroporated into S. aureus hosts using standard procedures [29] and transformants were selected on NYE supplemented with chloramphenicol (10 mg/ml) (NYEC). 2.3. Diffusion assays Single colonies from NYEC agar were resuspended in 200 ml sterile water and 7 ml of the resuspended cells were mixed with 7 ml of 0.7% agar and overlaid on NYEC agar.

Twenty 96-well PMs (carbon sources PMs: PM1 and PM2A, nitrogen sources: PM3B, phosphorus and sulfur sources: PM4A, nutrient supplements: PM5, peptide nitrogen sources: PM6-PM8, osmolytes: PM9, pH: PM10, chemical/ antibiotic sensitivity panels: PM11C, PM12B, PM13B, PM14A, PM15B, PM16A, PM17A, PM18C, PM19, PM20) were used in this study. Measurement of bacterial metabolism was by colorimetric redox assay. Results were recorded using the OmniLogÒ and companion computer software. The standard PM testing protocol for Gram-positive bacteria with Dye H was employed. 3. Results 3.1. The paradoxical effect of sub-MIC CIP, moxifloxacin, and mitomycin C on SOS and MMR gene expression in S. aureus RN4220 and CiprI In previous studies [25], we observed that DNA-damaging agents such as FQs and mitomycin C upregulated S. aureus SOS genes; in addition patterns of antibiotic-induced transcriptional modulation of recA gene were altered in Cipr mutants. The response profiles to other antibiotics, i.e. novobiocin and rifampicin, were also changed in Cipr mutants [25]. Plasmids with SOS response and MMR promoter-lux constructs [25] were transformed into S. aureus CiprI to examine possible changes in gene expression based on luminescence measurements. Here, we compared the effect of sub-

L.R. Mesak, J. Davies / Research in Microbiology 160 (2009) 785e791

787

Table 1 Effect of ciprofloxacin (CIP), moxifloxacin (MXF), and mitomycin C (MIT) on SOS and MMR gene expression in S. aureus RN4220 and CiprI.a Promoter

Median-fold inductionb (standard deviation) þCIP (1 mg/ml)

lexA recA sosA recF dinBc umuCc mutSL mutS2c mutS3b mutTb a b c

þMXF (1 mg/ml)

þMIT (0.5 mg/ml)

RN4220

CiprI

RN4220

CiprI

RN4220

CiprI

2 16 29 2 1 68 2 2 1 2

1 1 1 1 1 0 1 1 1 1

4 7 77 2 1 96 5 2 2 3

5 6 9 1 1 38 3 1 2 2

2 8 12 3 1 56 2 2 1 3

2 6 5 1 1 23 1 1 0 0

(0.07) (1.52) (11.44) (0.15) (0.94) (9.54) (1.91) (1.41) (0.68) (1.41)

(0.16) (0.02) (0.14) (0.04) (0.23) (0.57) (0.23) (0.23) (0.35) (0.23)

(0.09) (0.80) (12.70) (0.50) (0.90) (48.79) (4.20) (0.06) (0.40) (0.25)

(0.50) (0.06) (0.44) (0.30) (0.20) (4.24) (0.70) (0.14) (1.17) (0.23)

(0.11) (0.2) (1.08) (1.71) (0.70) (23.09) (0.49) (1.01) (0.43) (0.86)

(0.03) (0.43) (0.97) (0.14) (0.50) (4.94) (0.17) (0.53) (0.20) (0.12)

The luminescence value obtained at 5 h after incubation. The fold change was calculated by dividing the luminescence value of antibiotic-treated samples with that of untreated samples. Expression of genes as measured by luminescence production was very low (less than 100 counts per s).

MIC levels of CIP, moxifloxacin, and mitomycin C of the SOS response and MMR gene expression in S. aureus RN4220 and CiprI. As expected, sub-MIC levels of CIP did not induce expression of the SOS response and MMR genes in the CiprI mutant (Table 1). Expression of lexA, recA, umuC, and sosA, which are regulated by one or more SOS boxes, were still induced by moxifloxacin and mitomycin C in CiprI, although the levels were reduced compared to RN4220 (Table 1). The other SOS gene, recF, which has no SOS boxes in the promoter region, was unaffected by moxifloxacin or mitomycin C in the CiprI mutant. MMR genes (mutSL, mutS2, mutS3, and mutT ) and dinB were expressed at low levels in liquid medium with or without treatment (Table 1). Furthermore, using disk diffusion assays, we observed that the MMR genes (mutSL, mutS2, mutS3, and mutT ) and dinB were not induced by CIP, moxifloxacin or mitomycin in the CiprI mutant (data not shown). 3.2. Effect of sub-MIC levels of CIP on mutation rates of S. aureus

Table 3 Comparison of S. aureus CiprI and CiprIIa with their wild-type RN4220. PM panels

PM09

Substrates

PM10 PM11C

7% Urea 2% Sodium lactate pH9.5 þ Agmatine Cefazoline

PM12B

Tetracycline Benzethonium Dodecyltrimethyl ammonium bromide Spiramycin

PM14A

Acriflavine Nitrofurantoin

Sub-MIC DNA-damaging antibiotics such as CIP may enhance levels of mutagenesis that occur as results of errors in DNA synthesis generated by SOS polymerases [25]. In this study, mutation frequencies were examined by growing S. aureus in media containing sub-MIC CIP (0.1, 0.2, and 0.5 mg/ml) and testing them for changes in appearance of

Table 2 The median mutation frequency of S. aureus strains growing in NYE with or without sub-MIC concentrations of CIP and selected on rifampicin (5 mg/ml). S. aureus strains

RN4220 Newman COL

NYE

4.7  108 1.8  108 7.5  109

PM15B

Guanidine

PM16A

hydrochloride Domiphen bromide 1,10-Phenathroline Cetylpyridinium

PM17A PM18C

Sodium tungstate Poly-L-lysine Plumbagin Lidocaine

Median mutation frequency þ0.1 mg/ ml CIP

þ0.2 mg/ ml CIP

þ0.5 mg/ ml CIP

3.8  108 1.8  108 7.1  109

1.5  107 2.8  108 8.9  109

0.7  107 4.1  108 2.5  108

PM20B

3,5-Dinitrobenzene Proflavine

a

Function or target

a

Phenotype of

CiprI

CiprIIa

Osmolytes Osmolytes

e e

R R

pH, deaminase Antibiotic, cell wall Antibiotic, protein synthesis Chloride detergent, membrane Detergent, membrane

R e

e R

R

R

RL

e

R

e

Antibiotic, protein synthesis DNA intercalator, RNA synthesis Oxidizing agent, DNA damage Chaotropic agent, membrane

e

R

R

e

S

e

R

e

Detergent, membrane Chelator Chloride detergent, membrane Toxic anion Detergent, membrane Oxidizing agent Ion channel inhibitor Ionophore, respiration DNA intercalator

R

e

e RL

S e

e S

S e

S e

e RL

R

e

e

S

Large phenotypic changes (with OmniLog values greater than 200) are indicated with an ‘‘L’’ as in ‘‘RL’’. R: Resistance; S: sensitive.

788

L.R. Mesak, J. Davies / Research in Microbiology 160 (2009) 785e791

mutants resistant to another antibiotic (rifampicin). CIP (0.5 mg/ml) increased the frequency of mutation to rifampicin (5 mg/ml) in all S. aureus strains tested and was higher in S. aureus RN4220 and Newman strains than that of the COL strain (Table 2).

3.3. Phenotype microarray (PM) of S. aureus CIP mutants The phenotypic effects of mutations in primary targets (GrlA and GyrA) of CIP were examined using PM analysis [4,5]. Two spontaneous CIP-resistant strains [25], CiprI (GrlA[S80F]) and CiprIIa (GrlA[S80F], GyrA[E88Q]) were used as representative strains. PM analysis showed that, in the CiprI and CiprIIa mutants, there were no significant changes in their metabolism of a variety of carbon, nitrogen, phosphorus and sulfur sources compared to their parent strain S. aureus RN4220. However, there were changes in chemical sensitivities in the mutant strains (Table 3). For the antibiotics tested, both CiprI and CiprIIa were more resistant to tetracycline, while increased resistance to spiramycin and cefazoline was observed in CiprIIa and increased sensitivity to nitrofurantion was seen in CiprI. The CiprI mutant was notably resistant to some cationic detergents, benzethonium chloride, cetylpyridinium chloride, dodecyltrimethyl ammonium bromide, and domiphen bromide, whereas the CiprIIa mutant was strongly resistant to lidocaine. Other phenotypic changes detected are shown in Table 3.

3.4. The effect of DNA-damaging antibiotics on the function of the norA promoter in S. aureus Two of the spontaneous CIP-resistant mutants (CiprIa and CiprIIb), were found to have repeated sequences (25 and 14) in the norA promoter region (Fig. 1A). CiprIIb also carries a grlA mutation. CiprIa and CiprIIb mutants are resistant to 21 and 42 mg/ml CIP, respectively [25]; such mutants have not been described previously. Interestingly, the altered norA promoter regions of CiprIa and CiprIIb showed an additional inverted repeat (Fig. 1A). NorA efflux pumps play an important role in resistance to hydrophilic FQs, lipophilic and monocationic compounds. The norA promoter was fused with the luxABCDE (lux) genes [26] to study antibiotic responses in S. aureus RN4220 (norA-lux), S. aureus CiprIa (norA3-lux) and S. aureus CiprIIb (norA6-lux) (Fig. 1). Expression of norA in CiprIa and CiprIIb is higher than in the wild-type, RN4220 (Fig. 1B), supporting the notion that NorA was overexpressed in the mutants. Some antibiotics, notably moxifloxacin, mitomycin C and netropsin, modulated norA expression in both CiprIa and CiprIIb, but not in the wild type (Fig. 2A). We observed growth inhibition in the CiprIa and CiprIIb strains in the presence of mitomycin C (50 ng/ml); however, the expression of norA in the presence of mitomycin C (50 ng/ml) was 3- and 2-fold greater in CiprIa and CiprIIb, respectively (Fig. 2B). In contrast, norA expression was not induced by ethidium bromide (EtBr) (5 mg/ml) in any of the mutants (Fig. 2C). Mitomycin C and EtBr did not effect norA expression in RN4220. These results show that sequence

Fig. 1. (A) Promoter regions of norA genes. The identified 10 and 35 box (bold and italic), transcription start site (þ1) and inverted repeat (arrow) are shown. (B) Luminescence assays of S. aureus RN4220 (norA-lux), S. aureus CiprIa (norA3-lux) and S. aureus CiprIIb (norA6-lux) in liquid medium showing quantitative measurement of norA expression using a Wallac 1420 Victor Multilabel Counter (PerkineElmer).

L.R. Mesak, J. Davies / Research in Microbiology 160 (2009) 785e791

789

Fig. 2. (A) Effect of antibiotics on norA gene expression in different S. aureus strains as indicated: RN4220, CiprIa, and CiprIIb. The first row in each set shows inhibition zones in representative disk diffusion assays after 20 h; the other rows show the effect of antibiotics on the indicated reporter strains using a luminograph LB980 photon camera (Berthold) converted to the color scale on the right. Antibiotics did not affect promoterless-lux constructs. Antibiotic disks are: NAL: nalidixic acid 30 mg; CIP: ciprofloxacin 5 mg; NOR: norfloxacin 5 mg; MXF: moxifloxacin 5 mg; ETBR: ethidium bromide 10 mg; MIT: mitomycin C 5 mg; TMP: trimethoprim 5 mg; RES: reserpine 10 mg; BLE: bleomycin A 10 mg; phleomycin 10 mg; DIS: distamycin 10 mg; NET: netropsin 10 mg; BLK: blank disk. (B) Fold change of norA expression in the presence of MIT (50 ng/ml) and (C) fold change of norA expression in the presence of ETBR (5 mg/ml) in the CiprIa (triangle) and CiprIIb (circle). RN4220 was not affected by those compounds. Luminescence measurements were using a Wallac 1420 Victor Multilabel Counter (Perkine Elmer).

duplication in the norA promoter region influences norA expression. 4. Discussion S. aureus RN4220 is a non-pathogenic laboratory strain and is sensitive to most of the antibiotics used to treat pathogenic strains. We showed previously that when S. aureus RN4220 is grown in the presence of sub-MIC of CIP, there is increasing expression of SOS response genes [25]; here we demonstrate that low concentrations of CIP (0.2 and 0.5 mg/ml) increased the frequency of mutation to antibiotics 3.2- and 1.6-fold respectively. In pathogenic S. aureus Newman and COL strain, the frequency was increased 2- and 3-fold, respectively, when grown in medium supplemented with CIP (0.5 mg/ml). This supports the notion that sub-MIC antibiotics are significant factors in chemical and environmental responses to antibiotics and in the development of resistance. Little is known about the

physiology of resistant strains; does the acquisition of a resistant trait have pleiotropic effects? Previously, we showed that antibiotic-induced transcription patterns varied in different CIP-resistant mutants [25]. With the aid of PM technology [4,5], we examined these changes in more detail. The two CIPresistant mutants (CiprI and CiprIIa) showed a small number of phenotypic changes in chemical sensitivity compared to the wild type. For example, the mutants exhibited increased resistance to tetracycline and altered sensitivity to membraneactive cationic detergents and lidocaine (see Table 3). It is evident that antibiotic resistance in S. aureus is a more complex phenotype than generally realized. Many genes of the SOS regulon are negatively regulated by binding of LexA to conserved upstream sequences (SOS box) in their promoter/operator regions [15,30]. The SOS box sequence of S. aureus is identical to that of Bacillus subtilis (GAAC-N4-GTTC) [6,7,25]. In S. aureus, one or more SOS boxes are associated with the promoters of lexA, recA, umuC

790

L.R. Mesak, J. Davies / Research in Microbiology 160 (2009) 785e791

and sosA, but not with recF and dinB. Sub-MIC antibiotics modulate expression of SOS genes, perhaps by interaction with SOS boxes. S. aureus norA encodes a NorA multidrug transporter and is regulated by global regulator MgrA [35]. The MgrA repressor binding site in the norA upstream region includes 35 and 10 boxes, the norA transcription site and inverted repeats [23]. NorA confers resistance to a number of structurally distinct compounds, and an understanding of regulation of norA expression may point to ways of increasing or reducing NorA activity [23]. The norA promoter-lux fusion was constructed in different S. aureus backgrounds to examine the responses of promoter region sequences to norA expression. The CiprIa and CiprIIb strains have altered norA promoter regions and showed enhanced norA expression in the presence of sub-MIC of antibiotics such as moxifloxacin, mitomycin C and netropsin; the tandem duplications in the nearby 10 box (Fig. 1A) may play a role in increased norA expression. Interestingly, mutations in promoter regions of efflux pump genes (norB, norC, mepA, and mdeA) were reported to increase expression of the associated efflux pump genes in bloodstream isolates of S. aureus [9]. The mechanism of these processes requires further study. Here we show that the new FQ (moxifloxacin) but not quinolone (nalidixic acid) or first generation FQ (norfloxacin) strongly upmodulated the norA promoter in the CiprIa and CiprIIb strains. In conclusion, our results confirm and extend previous studies on the multiple effects of sub-MIC antibiotics and their influence on resistance development and other phenotypic changes in bacteria [18,25,26,36,41]. It is clear that more attention should be given to these antibiotic dose responses. Acknowledgments This research was supported by the Canadian Institutes of Health Research. We are grateful to Vanessa Gomez and Barry Bochner at Biolog, Inc for performing the phenotype microarray assays and for their interest and help in preparing this manuscript. References [1] Aires de Sousa, M., de Lencastre, H. (2004) Bridges from hospitals to the laboratory: genetic portraits of methicillin-resistant Staphylococcus aureus clones. FEMS Immunol. Med. Microbiol. 40, 101e111. [2] Antony, S.J. (2006) Combination therapy with daptomycin, vancomycin, and rifampin for recurrent, severe bone and prosthetic joint infections involving methicillin-resistant Staphylococcus aureus. Scand. J. Infect. Dis. 38, 293e295. [3] Baldoni, D., Haschke, M., Rajacic, Z., Zimmerli, W., Trampuz, A. (2009) Linezolid alone or combined with rifampin against methicillin-resistant Staphylococcus aureus in experimental foreign-body infection. Antimicrob. Agents Chemother. 53, 1142e1148. [4] Bochner, B.R. (2009) Global phenotypic characterization of bacteria. FEMS Microbiol. Rev. 33, 191e205. [5] Bochner, B.R., Gadzinski, P., Panomitros, E. (2001) Phenotype microarrays for high-throughput phenotypic testing and assay of gene function. Genome Res. 11, 1246e1255.

[6] Cheo, D.L., Bayles, K.W., Yasbin, R.E. (1991) Cloning and characterization of DNA damage-inducible promoter regions from Bacillus subtilis. J. Bacteriol. 173, 1696e1703. [7] Cirz, R.T., Jones, M.B., Gingles, N.A., Minogue, T.D., Jarrahi, B., Peterson, S.N., et-al. (2007) Complete and SOS-mediated response of Staphylococcus aureus to the antibiotic ciprofloxacin. J. Bacteriol. 189, 531e539. [8] Couto, I., Costa, S.S., Viveiros, M., Martins, M., Amaral, L. (2008) Efflux-mediated response of Staphylococcus aureus exposed to ethidium bromide. J. Antimicrob. Chemother. 62, 504e513. [9] DeMarco, C.E., Cushing, L.A., Frempong-Manso, E., Seo, S.M., Jaravaza, T.A., Kaatz, G.W. (2007) Efflux-related resistance to norfloxacin, dyes, and biocides in bloodstream isolates of Staphylococcus aureus. Antimicrob. Agents Chemother. 51, 3235e5239. [10] Ding, Y., Onodera, Y., Lee, J.C., Hooper, D.C. (2008) NorB, an efflux pump in Staphylococcus aureus MW2, contributes to bacterial fitness in abscesses. J. Bacteriol. 190, 7123e7129. [11] Drlica, K., Malik, M. (2003) Fluoroquinolones: action and resistance. Curr. Top. Med. Chem. 3, 249e282. [12] Duthie, E.S., Lorenz, L.L. (1952) Staphylococcal coagulase; mode of action and antigenicity. J. Gen. Microbiol. 6, 95e107. [13] Dworkin, R.J., Lee, B.L., Sande, M.A., Chambers, H.F. (1989) Treatment of right-sided Staphylococcus aureus endocarditis in intravenous drug users with ciprofloxacin and rifampicin. Lancet 2, 1071e1073. [14] Dworkin, R., Modin, G., Kunz, S., Rich, R., Zak, O., Sande, M. (1990) Comparative efficacies of ciprofloxacin, pefloxacin, and vancomycin in combination with rifampin in a rat model of methicillin-resistant Staphylococcus aureus chronic osteomyelitis. Antimicrob. Agents Chemother. 34, 1014e1016. [15] Erill, I., Campoy, S., Barbe, J. (2007) Aeons of distress: an evolutionary perspective on the bacterial SOS response. FEMS Microbiol. Rev. 31, 637e656. [16] Fournier, B., Aras, R., Hooper, D.C. (2000) Expression of the multidrug resistance transporter NorA from Staphylococcus aureus is modified by a two-component regulatory system. J. Bacteriol. 182, 664e671. [17] Fournier, B., Hooper, D.C. (2000) A new two-component regulatory system involved in adhesion, autolysis, and extracellular proteolytic activity of Staphylococcus aureus. J. Bacteriol. 182, 3955e3964. [18] Goh, E.B., Yim, G., Tsui, W., McClure, J., Surette, M.G., Davies, J. (2002) Transcriptional modulation of bacterial gene expression by subinhibitory concentrations of antibiotics. Proc. Natl. Acad. Sci. U.S.A. 99, 17025e17030. [19] Hooper, D.C. (2002) Fluoroquinolone resistance among Gram-positive cocci. Lancet Infect. Dis. 2, 530e538. [20] Jacoby, G.A. (2005) Mechanisms of resistance to quinolones. Clin. Infect. Dis. 41(Suppl. 2), S120e126. [21] Kaatz, G.W., Seo, S.M., Foster, T.J. (1999) Introduction of a norA promoter region mutation into the chromosome of a fluoroquinolonesusceptible strain of Staphylococcus aureus using plasmid integration. Antimicrob. Agents Chemother. 43, 2222e2224. [22] Kaatz, G.W., Seo, S.M., Ruble, C.A. (1993) Efflux-mediated fluoroquinolone resistance in Staphylococcus aureus. Antimicrob. Agents Chemother. 37, 1086e1094. [23] Kaatz, G.W., Thyagarajan, R.V., Seo, S.M. (2005) Effect of promoter region mutations and mgrA overexpression on transcription of norA, which encodes a Staphylococcus aureus multidrug efflux transporter. Antimicrob. Agents Chemother. 49, 161e169. [24] Kreiswirth, B.N., Lofdahl, S., Betley, M.J., O’Reilly, M., Schlievert, P.M., Bergdoll, M.S., et al. (1983) The toxic shock syndrome exotoxin structural gene is not detectably transmitted by a prophage. Nature 305, 709e712. [25] Mesak, L.R., Miao, V., Davies, J. (2008) Effects of subinhibitory concentrations of antibiotics on SOS and DNA repair gene expression in Staphylococcus aureus. Antimicrob. Agents Chemother. 52, 3394e3397. [26] Mesak, L.R., Yim, G., Davies, J. (2009) Improved lux reporters for use in Staphylococcus aureus. Plasmid 61, 182e187.

L.R. Mesak, J. Davies / Research in Microbiology 160 (2009) 785e791 [27] Murakami, K., Tomasz, A. (1989) Involvement of multiple genetic determinants in high-level methicillin resistance in Staphylococcus aureus. J. Bacteriol. 171, 874e879. [28] Noguchi, N., Okihara, T., Namiki, Y., Kumaki, Y., Yamanaka, Y., Koyama, M., et-al. (2005) Susceptibility and resistance genes to fluoroquinolones in methicillin-resistant Staphylococcus aureus isolated in 2002. Int. J. Antimicrob. Agents 25, 374e379. [29] Schenk, S., Laddaga, R.A. (1992) Improved method for electroporation of Staphylococcus aureus. FEMS Microbiol. Lett. 73, 133e138. [30] Schlacher, K., Goodman, M.F. (2007) Lessons from 50 years of SOS DNAdamage-induced mutagenesis. Nat. Rev. Mol. Cell Biol. 8, 587e594. [31] Strahilevitz, J., Hooper, D.C. (2005) Dual targeting of topoisomerase IV and gyrase to reduce mutant selection: direct testing of the paradigm by using WCK-1734, a new fluoroquinolone, and ciprofloxacin. Antimicrob. Agents Chemother. 49, 1949e1956. [32] Strahilevitz, J., Truong-Bolduc, Q.C., Hooper, D.C. (2005) DX-619, a novel des-fluoro(6) quinolone manifesting low frequency of selection of resistant Staphylococcus aureus mutants: quinolone resistance beyond modification of type II topoisomerases. Antimicrob. Agents Chemother. 49, 5051e5057. [33] Truong-Bolduc, Q.C., Dunman, P.M., Strahilevitz, J., Projan, S.J., Hooper, D.C. (2005) MgrA is a multiple regulator of two new efflux pumps in Staphylococcus aureus. J. Bacteriol. 187, 2395e2405. [34] Truong-Bolduc, Q.C., Strahilevitz, J., Hooper, D.C. (2006) NorC, a new efflux pump regulated by MgrA of Staphylococcus aureus. Antimicrob. Agents Chemother. 50, 1104e1107.

791

[35] Truong-Bolduc, Q.C., Zhang, X., Hooper, D.C. (2003) Characterization of NorR protein, a multifunctional regulator of norA expression in Staphylococcus aureus. J. Bacteriol. 185, 3127e3138. [36] Tsui, W.H., Yim, G., Wang, H.H., McClure, J.E., Surette, M.G., Davies, J. (2004) Dual effects of MLS antibiotics: transcriptional modulation and interactions on the ribosome. Chem. Biol. 11, 1307e 1316. [37] Vicente, M., Hodgson, J., Massidda, O., Tonjum, T., HenriquesNormark, B., Ron, E.Z. (2006) The fallacies of hope: will we discover new antibiotics to combat pathogenic bacteria in time? FEMS Microbiol. Rev. 30, 841e852. [38] Wise, R., Andrews, J.M., Edwards, L.J. (1983) In vitro activity of Bay 09867, a new quinoline derivative, compared with those of other antimicrobial agents. Antimicrob. Agents Chemother. 23, 559e564. [39] Wolfson, J.S., Hooper, D.C. (1989) Fluoroquinolone antimicrobial agents. Clin. Microbiol. Rev. 2, 378e424. [40] Xiao, Y., Li, Y., Liu, J., Zhong, W., Yang, W. (2007) In vitro antibacterial activity of DX-619, a novel Des-F (6)-quinolone against clinical isolates in China. J. Chemother. 19, 632e642. [41] Yim, G., de la Cruz, F., Spiegelman, G.B., Davies, J. (2006) Transcription modulation of Salmonella enterica serovar Typhimurium promoters by sub-MIC levels of rifampin. J. Bacteriol. 188, 7988e7991. [42] Yoshida, H., Bogaki, M., Nakamura, S., Ubukata, K., Konno, M. (1990) Nucleotide sequence and characterization of the Staphylococcus aureus norA gene, which confers resistance to quinolones. J. Bacteriol. 172, 6942e9694.