Phenotypic characterization and fine mapping of mps1, a premature leaf senescence mutant in rice (Oryza sativa L.)

Journal of Integrative Agriculture 2016, 15(9): 1944–1954 Available online at www.sciencedirect.com

ScienceDirect

RESEARCH ARTICLE

Phenotypic characterization and fine mapping of mps1, a premature leaf senescence mutant in rice (Oryza sativa L.) LIU Zhong-xian, CUI Yu, WANG Zhong-wei, XIE Yuan-hua, SANG Xian-chun, YANG Zheng-lin, ZHANG Chang-wei, ZHAO Fang-ming, HE Guang-hua, LING Ying-hua Chongqing Key Laboratory of Application and Safety Control of Genetically Modified Crops/Rice Research Institute, Southwest University, Chongqing 400715, P.R.China

Abstract Leaves play a key role in photosynthesis in rice plants. The premature senescence of such plants directly reduces the accumulation of photosynthetic products and also affects yield and grain quality significantly and negatively. A novel premature senescence mutant, mps1 (mid-late stage premature senescence 1), was identified from a mutant library consisting of ethyl methane sulfonate (EMS) induced descendants of Jinhui 10, an elite indica restorer line of rice. The mutant allele, mps1, caused no phenotypic differences from the wild type (WT), Jinhui 10, but drove the leaves to turn yellow when mutant plants grew to the tillering stage, and accelerated leaf senescence from the filling stage to final maturation. We characterized the agronomic traits, content of photosynthetic pigments and photosynthetic efficiency of mps1 and WT, and fine-mapped MPS1. The results showed that the MPS1-drove premature phenotype appeared initially on the leaf tips at the late tillering stage and extended to the middle of leaves during the maturing stage. Compared to the WT, significant differences were observed among traits of the number of grains per panicle (–31.7%) and effective number of grains per panicle (–38.5%) of mps1 individuals. Chlorophyll contents among the first leaf from the top (Top 1st), the second leaf from the top (Top 2nd) and the third leaf from the top (Top 3rd) of mps1 were significantly lower than those of WT (P<0.05), and the levels of photosynthetic efficiency from Top 1st to the forth leaf from the top (Top 4th) of mps1 were significantly lower than those of WT (P<0.01). Results from the genetic analysis indicated that the premature senescence of mps1 is controlled by a recessive nuclear gene, and this locus, MPS1 is located in a 37.4-kb physical interval between the markers Indel145 and Indel149 on chromosome 6. Genomic annotation suggested eight open reading frames (ORFs) within this physical region. All of these results will provide informative references for the further researches involving functional analyses and molecular mechanism exploring of MPS1 in rice. Keywords: rice (Oryza sativa L.), premature senescence, fine mapping, mps1

1. Introduction Received 31 August, 2015 Accepted 13 January, 2016 Correspondence LING Ying-hua, Tel: +86-23-68250486, Fax: +86-23-68250158, E-mail: [email protected] © 2016, CAAS. All rights reserved. Published by Elsevier Ltd. doi: 10.1016/S2095-3119(15)61279-5

Rice (Oryza sativa L.) is one of the most important cereal crops and its adequate supply is critical for addressing food shortages associated with the continuous growth of the global population (Li et al. 2010; Tester and Langridge 2010). Maintaining a high and stable yield of rice cultivars is a great

LIU Zhong-xian et al. Journal of Integrative Agriculture 2016, 15(9): 1944–1954

challenge for both rice breeders and researchers. Leaves are the main photosynthetic organ of rice plants. Premature leaf senescence in these plants shortens the photosynthetic period, thereby reducing the photosynthetic effect and the accumulation of photosynthetic products, resulting in lower yield and worse quality. Leaf senescence, a typical form of genetically programmed cell death, was shown to be controlled by numerous genes that respond to different biochemical pathways (Gepstein et al. 2003; Yoshida 2003; Lim et al. 2007). In addition, numerous external factors, including shading, deficiency of trace elements (i.e., Mg2+), drought, and infection by pathogens, affect the senescence of plant leaves (Gan and Amasino 1997; Nooden et al. 1997; Kobayashi et al. 2012). So far, more than 130 senescence-associated genes (SAGs) in rice have been included in the Leaf Senescence database (http://psd.cbi.pku.edu.cn/). These SAGs are distributed on all of the 12 chromosomes of the rice genome. They control the pathways of synthesis/digestion of chlorophyll, plant hormone response, signal transport, digestion of lipid or carbohydrate, nutrient recycling, synthesis or digestion of protein, ROS reaction, and transcriptional regulation (Liu et al. 2011; Li et al. 2013). The premature senescence phenotype that is controlled by SAGs in rice can occur at different growth stages across the whole life cycle, including the seedling stage (Wang et al. 2006; Fang et al. 2010; Yang et al. 2011; Zhang et al. 2014), the tillering stage or the late heading stage (Xu et al. 2012; Liang et al. 2014; Sang et al. 2014). Some instances of the premature senescence phenotype are also accompanied with spotted leaf or sterility (Li et al. 2005; Yan et al. 2010; Yang et al. 2011; Zhao et al. 2014), and some mutants maintain premature senescence across all growth stages (Miao et al. 2013). The senescence-related mutants can be divided into two major classes, namely, those that exhibit delayed and premature senescence. Several delayed senescence genes have been cloned in rice, including NYC1, NYC3, NYC4, and SGR. The main functions of NYC1/3/4 involve chlorophyll digestion, and these three genes are located on chromosomes 1, 6 and 6, respectively. NYC1 mainly controls the digestion of chlorophyll b (Chl b) and light harvest compound II (LHCPII) through its coded product of shortchain dehydrogenase/reductase (SDR) (Sato et al. 2009), NYC3 digests chlorophyll during leaf senescence (Morita et al. 2009). NYC4 is the ortholog of THF1 in Arabidopsis thaliana and can inhibit the degradation of chlorophyll in poor light (Yamatani et al. 2013). SGR is located on chromosome 9. The products of this gene can combine with LHCPII to form a compound protein of Sgr-LHCPII. The content of LHCPII in leaves is thus reduced and chlorophyll biosynthesis thereby controlled (Park et al. 2007; Jiang et al.

1945

2011; Rong et al. 2013). Some premature senescence genes, such as HYS1, ATPG, ATAPG9, and OLD1, were isolated in Arabidopsis thaliana, but only a few have been documented in rice (Ansari et al. 2011; Wu et al. 2012; Zhou et al. 2013). Many major genes for premature senescence have been identified in rice, but only a few have been analyzed in respect of their function. These detailedly documented genes include NOE1, OsDMI3 and OsSAP, which are involved in the response to stresses of H2O2 and drought (Lin et al. 2012; Shi et al. 2012, 2014); SPL28, RSL1, OSL2, and OHS69/ OsAkaGal, which are involved in chlorophyll degradation (Lee and Chen 2002; Ansari et al. 2005; Ansari and Chen 2009; Qiao et al. 2010; Jiao et al. 2012); and OsNAP, which is involved in plant hormone and signal transport (Liang et al. 2014). Besides these stress-response or plant hormone related genes, some other genes can also cause premature senescence phenotype in rice. For example, a single base substitution in OsCDC48 which resulting in the impair development of chloroplast preferred to cause premature senescence at six-leaf stage in rice (Huang et al. 2015). In addition, interactions of different aspects, i.e., transcriptional networks, crosstalk of different pathways, rather than single gene can also cause the phenotype of premature senescence (Schippers 2015). A recent report by Zhou et al. (2013) revealed that the over expression of OsSWEET5 with the encoding product of sugar transporter, preferred to cause the changes of sugar metabolism and auxin transport. This changes resulted in premature senescence at the seedling stage among the transgenic lines in rice, which suggested that crosstalk of different pathways, i.e., sugar and auxin, can also cause premature senescence in rice (Zhou et al. 2013). So we can speculate that as the adding identifications of novel mutants, more new mechanisms controlled the phenotype of premature senescence might be explored in rice. We treated the seeds of Jinhui 10 with ethyl methane sulfonate (EMS), and identified a recessive premature senescence mutant, mid-late stage premature senescence 1 (mps1), from the mutant library. In its early stage, mps1 grows normally; at the tillering stage, the tips of its fourth leaf from the top begin to turn yellow; and from the filling to mature stages, the leaves senesce rapidly. The premature senescence performance of mps1 is quite different from the other reported premature senescence mutants. The objectives of the present study were to (1) reveal the agronomic and physiological differences between mps1 and its WT; and (2) fine-map the candidate gene that controlled the mutant phenotype of mps1, so as to provide informative references for the further molecular mechanism dissection

1946

LIU Zhong-xian et al. Journal of Integrative Agriculture 2016, 15(9): 1944–1954

of this novel premature senescence phenotype in rice.

2. Materials and methods 2.1. Screening of mps1 Using EMS, a mutant with premature senescence at the tillering stage was identified from numerous M1 descendants derived from the chemical treatment of Jinhui 10. After selfing for more than six generations, we obtained a stable premature senescence mutant, and named it “mid-late stage premature senescence 1” (mps1). In the spring of 2013, we collected pollen from mps1, pollinated to Xinong 1A, and obtained seeds for the F1 generation. In the winter of the same year, we planted the F1 seeds in a field in Hainan Province, China and obtained the F2 generation after the self-pollination of F1 plants. All of the F2 seeds were planted in the fields of the Rice Research Institute, Southwest University, Chongqing, China in the spring of 2014.

2.2. Phenotyping of mps1 When the F2 population grew to the tillering stage and premature senescence appeared, we counted the numbers of plants that showed phenotypes similar to mps1 and Jinhui 10 (wild type, WT); cut up the leaf material of all of the F2 plants with scissors; and, using the parental lines as standards for the content, determined the levels of chlorophyll a (Chl a), chlorophyll b (Chl b) and carotenoid (Car), and calculated the total chlorophyll content (Chl T=Chl a+Chl b) (Wellburn 1994). At this growth stage, four photosynthesis-related parameters, namely, net photosynthetic rate (Pn, μmol m–2 s–1), stomatal conductance (Gs, mmol m–2 s–1), changes of intercellular CO2 concentration (Ci, μmol mol–1), and transpiration rate (Tr, mmol m–2 s–1), of the F2 population and parental lines were measured using L-6400XT portable photosynthesis (LI-COR, Nebraska, USA) according to Sang et al. (2014). The values of the above parameters for different parts of the leaves including leaf top, medium and leaf base, were measured among four leaves from the top of rice plants, i.e., the 1st leaf from the top (Top 1st), the 2nd leaf from the top (Top 2nd), the 3rd leaf from the top (Top 3rd), and the 4th leaf from the top (Top 4th). At the mature stage, 10 plants were randomly selected and labelled from the middle of the plots of both mps1 and WT in order to measure plant height and panicle length. After harvesting these labelled plants and drying them naturally, we counted the number of effective panicles, number of grains per panicle, number of filled grains per panicle, and 1 000-seed weight, then calculated the seed-setting rate (Seed-Setting rate (%)=(Number of filled grains per panicle/

Number of grains per panicle)×100). Analysis of variance (ANOVA) of all of these four photosynthesis-related parameters and 10 agronomic traits was performed using the general linear model (GLM) in SAS software (ver. 9.0). Multiple comparisons of these 15 parameters between mps1 and WT were made using Fisher’s least significance difference (LSD) test, with significance set at the probability levels of 0.05 and 0.01. The ratio of F2 plants with the WT phenotype to those with the mps1 phenotype was calculated, and the chi-square test was used to identify whether this ratio matched the theoretical threshold of 3:1 through Microsoft Office Excel 2010.

2.3. Observation by transmission electron microscopy The structures of leaf cells and chloroplasts of mps1 and WT were observed by transmission electron microscopy (TEM) according to Fang et al. (2010). All of the cells were double-fixed with glutaraldehyde and osmic acid. After dehydration using ethanol with a concentration gradient, the samples were embedded, cut into ultrathin slices, and double-dyed with a solution of uranyl acetate and lead citrate, after which the slices were observed by TEM (H600, Hitachi, Tokyo, Japan) and photographed.

2.4. Fine mapping of MPS1 Ten plants each that exhibited the same phenotypes as WT and mps1, correspondingly, were randomly selected from the F2 population derived from Xinong 1A×mps1, and equal amounts of leaf materials were cut up with scissors from both sets of plants in order to construct corresponding mixed pools of WT and mutant for DNA extraction by a CTAB (cetyltrimethyl ammonium bromide) procedure (Saghai-Maroof et al. 1984). MPS1 was fine-mapped according to Sang et al. (2014). A total of 423 simple sequence repeats (SSRs) covering the entire rice genome were selected to screen the polymorphism markers between Xinong 1A and mps1, and the selected polymorphism SSRs were used for the primary mapping of MPS1. New SSRs and indel markers within the flanking markers of MPS1 were developed according to the genome sequences of 93-11 and Nipponbare via NTI Vector ver. 11.0 and Primer Premier ver. 5.0. All of the newly developed markers were also screened for polymorphism between Xinong 1A and mps1, and those selected were used to fine-map MPS1. The primers of all markers were synthesized by Sangon Biotech (www.sangonb.com; Shanghai, China). The PCR Reaction System of 25 μL included 2.5 μL of 10× PCR buffer, 1.3 μL of 25 mmol L–1 MgCl2, 1.0 μL of 2.5 mmol L–1 dNTPs, 16.0 μL of ddH2O,

LIU Zhong-xian et al. Journal of Integrative Agriculture 2016, 15(9): 1944–1954

2.0 μL of 10 μmol L–1 forward and reverse primers, 2.0 μL of template DNA, and 0.2 μL of 5 U μL–1 Taq polymerase. Amplifications were performed with the following procedure: 5 min at 94°C followed by 35 cycles of 30 s at 94°C, 30 s at 55°C, and 1 min at 72°C, terminated with a final extension at 72°C for 10 min. The PCR products were separated by 10% un-denatured polyacrylamide gel electrophoresis (PAGE) and visualized after silver staining. When the bands were observed, homozygous bands representing the same genotype as Xinong 1A were recorded as A, those the same as that of mps1 as B, and the heterozygous cases as H. A linkage map was constructed using MapMaker ver. 3.0, and the recombination rate was transformed into genetic distance (cM) using the Kosambi function.

significant premature senescence phenotype (Fig. 1-D and E). The phenotyping results indicated that the premature senescence phenotype appeared the first at the leaf tips, and then in the middle and base parts of the leaves. When the plants grew to maturity, the whole leaves all showed the premature senescence phenotype (Fig. 1-C, E, F). Analysis of agronomic traits showed that the number of grains per panicle and the number of filled grains per panicle of mps1 were significantly lower than those of WT at the 0.05 and 0.01 levels, respectively (Table 1). Plant height ((112.00±2.00) cm) and effective panicle (9.33±1.52) of mps1 were 3.06 and 3.67% greater than those of WT, while panicle length ((24.83±1.05) cm), seed-setting rate ((69±2)%) and 1 000-grain weight ((23.98±1.59) g) of the mutant were 4.5, 9.2 and 8.6% lower than those of WT, respectively. ANOVA indicated no significant differences among the latter five traits between mps1 and WT (Table 1).

3. Results 3.1. Phenotypic characterization of mps1

3.2. Chlorophyll content and photosynthesis efficiency of mps1

The results from the phenotyping throughout all of the growth stages showed that mps1 had a normal appearance at the seedling stage, but that the leaves began to turn yellow from the leaf tips when the plants grew to the tillering stage (Fig. 1-A and B). When the plants grew to the filling stage, all of the functional leaves turned yellow, with a descent gradient from Top 4th to Top 1st, showing a

A

When the plants grew to the heading stage, the contents of Chl a, Chl b and Chl T of four leaves from Top 1st to Top 4th were significantly lower than those of WT at the 0.05 or 0.01 level (Fig. 2-A, C, D). The carotenoid contents of these four leaves of the mutant were also lower than those

B

WT

C 1

mps1

D

E

3

3

mps1 F

1947

2

3

4

mps1

WT

2

2 1 1

WT

mps1

WT mps1

mps1

Fig. 1 Phenotypes of mps1 and wild type (WT, Jinhui 10) of rice. A, tillering stage. B, panicle initiation of mps1. C, leaves of mps1 at panicle initiation stage. D, grain filling stage. E, leaves at grain filling stage. F, maturation stage. 1, the 1st leaf from the top (Top 1st); 2, the 2nd leaf from the top (Top 2nd); 3, the 3rd leaf from the top (Top 3rd); 4, the 4th leaf from the top (Top 4th). The same as below.

1948

LIU Zhong-xian et al. Journal of Integrative Agriculture 2016, 15(9): 1944–1954

Table 1 Differences among the agronomic traits between mps1 and wild type (WT, Jinhui 10) of rice Materials

Agronomic traits

WT 108.67±1.53 9.00±1.00 25.99±0.20 203.00±11.14 155.00±4.36 76±2 26.23±0.18

Plant height (cm) Effective panicles per plant Panicle length (cm) Grain no. per panicle Filled grain no. per panicle Seed-setting rate (%) 1 000-grain weight (g)

Significance P

mps1 112.00±2.00 9.33±1.52 24.83±1.05 138.67±25.50 95.33±15.04 69±2 23.98±1.59

NS NS NS P<0.05 P<0.01 NS NS

Results are shown as means±SD. NS, not significant. The same as below.

WT mps1

4.5 3.6 2.7

** *

1.8 0.9

B Content (mg g–1)

Content (mg g–1)

A

**

0.0

4.5

WT

3.6

mps1

2.7 1.8 0.9

**

**

**

0.0 Chl a Chl b Chl T Car Photosynthesis-related pigment

WT mps1

3.6 2.7

**

**

1.8 *

0.9

**

0.0 Chl a D Content (mg g–1)

Content (mg g–1)

C

Chl a Chl b Chl T Car Photosynthesis-related pigment

4.5

Chl b Chl T Car Photosynthesis-related pigment

4.5

WT mps1

3.6 2.7

*

1.8 **

0.9

**

0.0 Chl a

Chl b Chl T Car Photosynthesis-related pigment

Fig. 2 Changes of photosynthesis-related pigment content in the leaves of mutant mps1 and WT of rice at the booting stage. ** and * indicate significance levels of 0.01 and 0.05, respectively. A–D, Top 1st, Top 2nd, Top 3rd, and Top 4th, respectively. Chl a, chlorophyll a; Chl b, chlorophyll b; Chl T, total chlorophyll content; Car, carotenoid. Bar on the top of each column refers to SD.

of WT, but no statistical differences were detected except Top 2nd (Fig. 2-A, C, D). In contrast to the results of Top 1st, Top 3rd and Top 4th, both the chlorophyll and carotenoid contents of Top 2nd of mps1 were significantly lower than those of WT (Fig. 2-B). Apart from the chlorophyll and carotenoid contents, significant differences were also detected between mps1 and WT among the four photosynthetic parameters. At the heading stage, the levels of Pn of Top 3rd and Top 4th were significantly higher than those of WT at the middle and the base, while they were significantly lower than those of WT at the other parts from Top 1st to Top 4th (Table 2). In contrast to the case for Pn, the levels of Gs of mps1 from Top 1st to Top 4th at all leaf parts except the middle of Top 1st and Top 2nd, base of Top 1st, and tip of Top 2nd were significantly higher than those of WT (P<0.01). No significant difference

was detected at the tip of Top 2nd between mps1 and WT (Table 2). The levels of Ci of mps1 at 11 parts of these four measured leaves, except the middle of Top 1st, were significantly higher than those of WT (P<0.01); in addition, the levels of Tr at eight parts of these leaves except those of the middle and base of Top 1st, and the tip and middle of Top 2nd were also significantly higher than those of WT (P<0.01, Table 2).

3.3. Microstructure of leaf cells of mps1 To reveal the cell microstructure of mps1 by TEM, leaves selected from the tip, middle and base of both mps1 and WT at the grain filling stage were used (Fig. 3-A, H, O). The results showed that the cytoplasm of WT distributed normally within the cells, and the chloroplasts, covered by

1949

LIU Zhong-xian et al. Journal of Integrative Agriculture 2016, 15(9): 1944–1954

their membrane, also distributed regularly close to the cell

of 2 301 individuals of the F2 population, 573 exhibited a

wall. A normally and regularly arranged lamellar structure

similar phenotype to that of mps1 and were recorded as

of the thylakoid was also observed within the chloroplasts

mutant individuals, the rest as WT-like ones. The ratio of

(Fig. 3-B–D, I–K, P–R). Different features were observed

WT-like to mutant individuals was 3.02:1 (1 728:573), which

by TEM within the cells of mps1. An abnormal distribution

matched well with the theoretical ratio of 3:1 (χ2=0.0071,

of the cytoplasm was observed within the cells of mps1, and

P=0.93). This result indicated that the premature senes-

the chloroplasts were also observed to be separated from

cence phenotype of mps1 is controlled by one recessive

the cell wall. The lamellar structure of the thylakoid arranged

nuclear gene.

loosely within the chloroplasts. A few starch granules and osmiophilic granules were also observed within the chloro-

3.5. Fine mapping of MPS1

plasts (Fig. 3-E–G, L–N, P–U). These results suggested that the chloroplasts of mps1 had begun to concentrate

To determine the chromosome position of MPS1, 250

and disassemble.

recessive individuals with the mutant phenotype were randomly selected in order to detect the rate of recombination

3.4. Genetic analysis of mutant phenotype

of MPS1 between the SSRs of RM19241 and RM587, which exhibited polymorphism between two gene pools of

All of the F1 plants of Xinong 1A×mps1 showed a normal

WT and mutant. Among the 250 selected plants, 28 and

phenotype, whereas two different phenotypes were ob-

26 recombinant individuals were detected by the SSRs of

served among the individuals of the F2 population from

RM19241 and RM587, respectively, which indicated that

the growth stages of tillering to maturity. Among a total

MPS1 is located on chromosome 6, and the distances be-

Table 2 Differences among the photosynthetic efficiency parameters of four detected leaves between mps1 and WT of rice at the heading stage1) Functional leaf2) Top 1st Tip Middle Base Top 2nd Tip Middle Base Top 3rd Tip Middle Base Top 4th Tip Middle Base 1) 2)

**

Material

Pn (μmol m−2 s−1)

Gs (mmol m−2 s−1)

Ci (μmol mol−1)

Tr (mmol m−2 s−1)

WT mps1 WT mps1 WT mps1

17.16±0.04 12.54±0.01** 19.27±0.08 14.01±1.61** 21.23±0.06 9.59±0.01**

0.56±0.00 0.61±0.00** 0.76±0.01 0.48±0.03** 0.62±0.01 0.42±0.00**

279.80±0.25 311.91±0.07** 299.55±0.91 275.99±10.76** 267.71±0.86 301.50±0.03**

9.50±0.02 11.36±0.00** 11.16±0.11 9.00±0.46** 10.30±0.06 7.54±0.00**

WT mps1 WT mps1 WT mps1

18.03±0.01 9.95±0.01** 17.95±0.08 9.16±0.03** 16.19±0.02 14.47±0.02**

0.63±0.00 0.62±0.00 0.49±0.00 0.42±0.00** 0.44±0.00 0.57±0.00**

286.73±0.17 316.87±0.056** 278.41±0.29 312.67±0.14** 277.37±0.14 301.18±0.20**

10.82±0.01 9.47±0.01** 11.17±0.00 8.70±0.00** 9.06±0.01 11.11±0.01**

WT mps1 WT mps1 WT mps1

14.97±0.05 10.88±0.03** 9.92±0.05 10.10±0.01** 17.36±0.07 12.67±0.01**

0.40±0.00 0.69±0.00** 0.19±0.00 0.55±0.00** 0.68±0.01 0.72±0.00**

278.54±0.21 315.83±0.11** 261.39±0.35 314.78±0.06** 300.00±0.68 317.72±0.04**

8.46±0.04 12.00±0.00** 4.90±0.01 11.72±0.00** 11.41±0.10 12.46±0.02**

WT mps1 WT mps1 WT mps1

10.46±0.01 9.50±0.00** 11.98±0.09 6.98±0.01** 10.13±0.12 12.82±0.03**

0.24±0.00 0.48±0.00** 0.20±0.00 0.28±0.00** 0.24±0.00 0.68±0.00**

277.18±0.03 314.65±0.04** 248.50±0.49 305.46±0.13** 280.79±1.55 314.11±0.34**

5.78±0.01 10.15±0.01** 4.98±0.00 7.74±0.01** 5.66±0.00 12.43±0.02**

Pn, net photosynthetic rate; Gs, stomatal conductance; Ci, changes of intercellular CO2 concentration; Tr, transpiration rate.

Top 1st, the first leaf from the top; Top 2nd, the second leaf from the top; Top 3rd, the 3rd leaf from the top; Top 4th, the 4th leaf from the top. refers to the provability level of 0.01.

1950

LIU Zhong-xian et al. Journal of Integrative Agriculture 2016, 15(9): 1944–1954

A

B

C

n

D os

ch E

thy

ch

F

n

sg

G

ch

sg

WT mps1 H

thy

I

J

ch

n

K ch

os

L

M

ch

ch

n

thy

N

os thy

sg

WT mps1 O

P

Q

R

n

thy

ch ch

S

T

sg

n WT mps1

ch

U thy

os

Fig. 3 Leaf microstructure of WT and mutant (mps1) of rice at the grain filling stage. A, H and O, the leaf blade tip, middle and base of WT and mps1, respectively. B–D, structure of mesophyll cell, the chloroplast and thylakoid lamellar structure of WT in leaf blade tip, respectively. E–G, structure of mesophyll cell, the chloroplast and thylakoid lamellar structure of mps1 in leaf blade tip, respectively. I–K, structure of mesophyll cell, the chloroplast and thylakoid lamellar structure of WT in the middle of leaves, respectively. L–N, structure of mesophyll cell, the chloroplast and thylakoid lamellar structure of mps1 in the middle of leaves, respectively. P–R, structure of mesophyll cell, the chloroplast and thylakoid lamellar structure of WT in blade base, respectively. S–U, structure of mesophyll cell, the chloroplast and thylakoid lamellar structure of mps1 in blade base, respectively. Bars, B–G, 2 μm; I–N, 1 μm; P–U, 200 nm. n, nucleus; ch, chloroplast; sg, starch granule; thy, thylakoid lamellar structure; os, osmiophilic granule.

tween two flanking SSRs were 5.6 and 5.2 cM, respectively (Fig. 4-A). New markers were developed according to the genome sequence of Nipponbare (Oryza sativa L.) between RM19241 and RM587, and four, namely, Indel136, Indel145, Indel149, and Indel156, were screened for the presence of polymorphism between Xinong 1A and mps1. Among all of the 573 recessive individuals with the mutant phenotype, 17 recombination events were detected by Indel145 (forward and reverse primers: TTGCTACTTGTAATCCTCTCGGAG and CACATAGCCCACATCAAGCAA) and 3 by Indel149 (forward and reverse primers: CGTAGATCCCTAAGGCAG CAGT and GCTCAAGTTAATTTGTTATAGTGGTTCTC) (Fig. 4-B). The physical interval covered two (bacterial

artificial chromosomes (BACs) in rice, and the estimated distance was about 37.4 kb according to the reference genome of Nipponbare (Fig. 4-C).

4. Discussion A number of mutants for SAGs, including lad (leaf apex dead), esl2 (early senescence leaf 2), esl3 (early senescence leaf 3), esl4 (early senescence leaf 4), esl5 (early senescence leaf 5), psl3 (presenescing leaf 3), and spl31 (spotted leaf 31), were identified from the mutant library of Jinhui 10 subjected to EMS treatment (Fang et al. 2010; Du et al. 2012; Xu et al. 2012; Dai et al. 2013; Miao et al. 2013;

LIU Zhong-xian et al. Journal of Integrative Agriculture 2016, 15(9): 1944–1954

1951

Fig. 4 Molecular mapping of MPS1. BAC, bacterial artificial chromosome.

Guo et al. 2014; Sang et al. 2014). Among these mutants, lad, esl2, esl3, esl4, esl5, and spl31 were significantly shorter in terms of plant height; the numbers of grains per panicle of lad, esl2, esl3, and esl5 were also markedly lower than that of WT (Jinhui 10) (P<0.01) (Xu et al. 2012; Dai et al. 2013; Miao et al. 2013; Guo et al. 2014; Sang et al. 2014); and esl2, esl4, esl5, and spl31 showed lower seed-setting rates and 1 000-grain weights (P<0.01) (Xu et al. 2012; Dai et al. 2013; Guo et al. 2014; Sang et al. 2014). Significant differences were also observed for the traits of number of effective panicles per plant, panicle length, number of grains per panicle, and number of filled grains per panicle among these mutants. Apart from the number of grains per panicle and number of filled grains per panicle, mps1 showed similar performance to WT (Table 1), showing differences from the previous premature senescence-related mutants derived from Jinhui 10. In addition, the mutant phenotype of mps1 began at the tillering stage, similarly to the mutants of lad, esl5, and spl31 (Du et al. 2012; Dai et al. 2013; Sang et al. 2014), whereas that of psl3 began at the seedling stage (Fang et al. 2010), esl2 at the heading stage (Xu et al. 2012), and esl3 showed a premature senescence phenotype at all growth stages (Miao et al. 2013). Among these eight mutants, including mps1, derived from Jinhui 10, only psl3 was controlled by a dominant gene, and the other seven were all controlled by recessive nuclear genes. In addition, mps1 also showed unique characteristics when compared with the premature senescence-related mutants derived from different ancestors. Mutants of psl1 and es-t showed their premature senescence phenotype at the seedling stage (Wang et al. 2006; Yang et al. 2011). In addition, the mutant phenotype of es-t was accompanied by rust-like spots (Yang et al. 2011) and that of sms1 by

male sterility (Yan et al. 2010). Mutants of pgl2 and Pse(t) showed their mutant phenotype at the heading stage, and the premature senescence phenotype of pgl2 was observed initially on Top 4th, and then Top 3rd, whereas that of Pse(t) appeared initially as brown spots, and then the whole leaf with spots turned yellow and began to senesce (Li et al. 2005; Zhu et al. 2007). Differing from these mutants, the premature senescence phenotype of mps1 was observed initially on functional leaves at the tillering stage. Mapping results showed that the candidate gene of mps1 is located on the short arm of chromosome 6 in the rice genome; eight open reading frames (ORFs) were annotated within the physical interval, but none of these ORFs was reported previously as being associated with a premature senescence phenotype in rice. In addition, in both delayed and premature senescence-related mutants, all of these SAGs were involved in the pathways of chlorophyll biosynthesis/degradation, stress response, and plant hormone and signal transport, with the involvement of few other pathways apart from these having been reported in rice. Among these eight ORFs, ORF1 encodes oligopeptide transporter (OPT), that associated with leaves senescing (Liu et al. 2012), and also reported as one of the most heavily down-regulated genes in rice leaves under the highest Cu excess condition (130 μmol L–1) (Sudo et al. 2008). Production of ORF2, DELLA protein SLR1, belongs to the GRAS gene family in rice. Members of this gene family possess diverse and important functions in plant growth and development, including signal transduction of gibberellin and phytochrome A, formation of axillary meristem, and root distribution in the soil (Sato et al. 2014). The ORF2 was also identified as the candidate gene for dwarf mutant by affecting the gibberellin metabolism in rice (Li et al. 2010).

1952

LIU Zhong-xian et al. Journal of Integrative Agriculture 2016, 15(9): 1944–1954

ORF3 encodes the small subunit of ribonucleoside-diphosphate reductase (RNR), which can interact with the large subunit of RNR that regulates the leaf development in rice (Yoo et al. 2009). ORF4 encodes folic acid-binding protein, which also known as folate-binding protein (FBP) or folate receptor (FR). FBP or FR is one class of Cys-rich glycoproteins that bind with folate, and its main function is to regulate folate content within cells via endocytosis (Jaiswal et al. 2012; Chen et al. 2013). Two recent reports documented that folate is involved in chlorophyll synthesis in etiolating pea seedlings (Van Wilder et al. 2009; Webb and Smith 2009). ORF5 encodes dehydration response-related protein, which was detected among the differentially expressed genes between the superhybrid rice LYP9 and its parents at seedling shoot and panicles at filling sate (Wei et al. 2009). Productions of ORF6 and ORF7 are LMBR1 integral membrane protein and ATP-binding protein (ABP), respectively. The most important function of ABP is to interact with ATP, so as to provide energy by releasing the ATP molecule for proteins and enzymes in most bio-pathways (Chauhan et al. 2009). ORF8 encodes NUC153 domain-containing protein. Of these eight ORFs annotated within the fine mapped physiological region of MPS1, only two associated with leaf senescence or chlorophyll biosynthesis, none of which was previously reported in rice. Expression analysis, associated with the sequence comparison and complementary analysis of these ORFs might provide convincing proofs for the candidate gene determination of MPS1, and will also facilitate the further researches of leaf senescence controlled by MPS1 in rice.

5. Conclusion mps1 is a newly identified premature senescence mutant allele in rice. The mutant phenotype of mps1 showed when the plant grew to the tillering stage. Compared with the wild type, mps1 showed significantly reduced chlorophyll content and photosynthetic efficiency. The candidate gene for the premature senescence phenotype of mps1 was found to be located within a physical interval of 37.4 kb on the short arm of chromosome 6 in rice, containing eight annotated open reading frames.

Acknowledgements This work was supported by grants from the National Natural Science Foundation of China (31371597), the Fundamental Research Funds for the Central Universities, Ministry of Education of China (XDJK2014C147) and the Chongqing Key Laboratory Capacity Upgrade Program of China (cstc2014pt-sy80001).

References Ansari M I, Chen S C G. 2009. Biochemical characterization of gamma-aminobutyric acid (GABA): Pyruvate transaminase during rice leaf senescence. International Journal of Integrative Biology, 6, 27–32. Ansari M I, Chen S C G. 2011. Leaf senescence - An overview. International Journal of Recent Trends in Science and Technology, 1, 110–114. Ansari M I, Lee R H, Chen S C G. 2005. A novel senescenceassociated gene encoding γ-aminobutyric acid (GABA): Pyruvate transaminase is upregulated during rice leaf senescence. Physiologia Plantarum, 123, 1–8. Chauhan J S, Mishra N K, Raghava G P S. 2009. Identification of ATP binding residues of a protein from its primary sequence. BMC Bioinformatics, 10, 434–452. Chen C, Ke J, Zhou X E, Yi W, Brunzelle J S, Li J, Yong E L, Xu H E, Melcher K. 2013. Structural basis for molecular recognition of folic acid folate receptors. Nature, 500, 486–490. Dai G M, Zhu X Y, Ling Y H, Zhao F M, Yang Z L, He G H. 2013. Genetic analysis and fine mapping of a lesion mimic mutant spl31 in rice. Acta Agronomica Sinica, 39, 1223–1230. (in Chinese) Du Q, Fang L K, Sang X C, Ling Y H, Li Y F, Yang Z L, He G H, Zhao F M. 2012. Analysis of phenotype and physiology of leaf apex dead mutant (lad) in rice and mapping of mutant gene. Acta Agronomica Sinica, 38, 168–173. (in Chinese) Fang L K, Li Y F, Gong X P, Sang X C, Ling Y H, Wang X W, Cong Y F, He G H. 2010. Genetic analysis and gene mapping of dominant presenescing leaf gene PSL3 in rice (Oryza sativa L.). Chinese Science Bulletin, 55, 2517–2521. Gan S, Amasino R M. 1997. Making sense of senescence. Plant Physiology, 113, 313–319. Gepstein S, Sabehi G, Carp M J, Hajouj T, Mesher M F O, Yariv I, Dor C, Bassani M. 2003. Large-scale identification of leaf senescence-associated genes. The Plant Journal, 36, 629–642. Guo S, Zhang T, Xing Y, Zhu X, Sang X, Ling Y, Wang N, He G. 2014. Identification and gene mapping of an early senescence leaf 4 mutant of rice. Crop Science, 54, 2713–2723. Huang Q N, Shi Y F, Zhang X B, Song L X, Feng B H, Wang H M, Xu X, Li X H, Guo D, Wu J L. 2015. Single base substitution in OsCDC48 is responsible for premature senescence and death phenotype in rice. Journal of Integrative Plant Biology, 58, 12–28. Jaiswal N, Saraswat S, Ratnam M, Isailovic D. 2012. Analysis of folate binding protein N-linked glycans by mass spectrometry. Journal of Proteome Research, 11, 1551–1560. Jiang H, Chen Y, Li M, Xu X, Wu G. 2011. Overexpression of SGR results in oxidative stress and lesion-mimic cell death in rice seedlings. Journal of Integrative Plant Biology, 53, 375–387.

LIU Zhong-xian et al. Journal of Integrative Agriculture 2016, 15(9): 1944–1954

Jiao B B, Wang J J, Zhu X D, Zeng L J, Li Q, He Z H. 2012. A novel protein RLS1 with NB-ARM domains is involved in chloroplast degradation during leaf senescence in rice. Molecular Plant, 5, 205–217. Kobayashi N I, Saito T, Iwata N, Ohmae Y, Iwata R, Tanoi K, Makanishi T M. 2012. Leaf senescence in rice due to magnesium deficiency mediated defect in transpiration rate before sugar accumulation and chlorosis. Physiologia Plantarum, 148, 490–501. Lee R H, Chen S C G. 2002. Programmed cell death during rice leaf senescence is nonapoptotic. New Phytologist, 155, 25–32. Li F Z, Hu G C, Fu Y P, Si H M, Bai X M, Sun Z X. 2005. Genetic analysis and high-resolution mapping of a premature senescence gene Pse(t) in rice (Oryza sativa L.). Genome, 48, 738–746. Li W, Wu J, Weng S, Zhang Y, Zhang D, Shi C. 2010. Identification and characterization of dwarf 62, a loss-offunction mutation in DLT/OsGRAS-32 affecting gibberellin metabolism in rice. Planta, 232, 1383–1396. Li Y, Wang J K, Qiu L J, Ma Y Z, Li X H, Wan J M. 2010. Crop molecular breeding in China: Current status and perspectives. Acta Agronomica Sinica, 36, 1425–1430. (in Chinese) Li Z, Zhao Y, Liu X, Peng J, Guo H, Luo J. 2013. LSD 2.0: An update of the leaf senescence database. Nucleic Acids Research, 42, D1200–D1205. Liang C, Wang Y, Zhu Y, Tang J, Hu B, Liu L, Ou S, Wu H, Sun X, Chu J, Chu C. 2014. OsNAP connects abscisic acid and leaf senescence by fine-tuning abscisic acid biosynthesis and directly targeting senescence-associated genes in rice. Proceedings of the National Academy of Sciences of the United States of America, 111, 10013–10018. Lim P O, Kim H J, Nam H G. 2007. Leaf senescence. Annual Review of Plant Biology, 58, 115–136. Lin A H, Wang Y Q, Tang J Y, Xue P, Li C L, Liu L C, Hu B, Yang F Q, Loake G J, Chu C C. 2012. Nitric oxide and protein S-nitrosylation are integral to hydrogen peroxide induced leaf cell death in rice. Plant Physiology, 158, 1451–1464. Liu T, Zeng J, Xia K, Fan T, Li Y, Wang Y, Xu X, Zhang M. 2012. Evolutionary expansion and functional diversification of oligopeptide transporter gene family in rice. Rice, 5, 12–26. Liu X, Li Z, Jiang Z, Zhao Y, Peng J, Jin J, Guo H, Luo J. 2011. LSD: A leaf senescence database. Nucleic Acids Research, 39, D1103–D1107. Miao R L, Jiang Y D, Liao H X, Xu F F, He G H, Yang Z L, Zhao F M, Sang X C. 2013. Identification and gene mapping of rice early senescence leaf (esl3) mutant. Acta Agronomica Sinica, 39, 862–867. (in Chinese) Morita R, Sato Y, Masuda Y, Nishimura M, Kusaba M. 2009. Defect in non-yellow coloring 3, an α/β hydrolase-fold family protein, causes a stay-green phenotype during leaf senescence in rice. The Plant Journal, 59, 940–952. Nooden L D, Guiamet J J, John I. 1997. Senescence mechanisms. Physiological Planta, 101, 746–753.

1953

Park S Y, Yu J W, Park J S, Li J J, Yoo S C, Lee N Y, Lee S K, Jeong S W, Seo H S, Koh H J, Jeon J S, Park Y, Paek N C. 2007. The senescence-induced stay green protein regulates chlorophyll degradation. The Plant Cell, 19, 1649–1664. Qiao Y, Jiang W, Lee J, Park B, Choi M S, Piao R, Woo M O, Roh J H, Han L Z, Paek N C, Seo H S, Koh H J. 2010. SPL28 encodes a clathrin-associated adaptor protein complex 1, medium subunit mu1 (AP1M1) and is responsible for spotted leaf and early senescence in rice (Oryza sativa). New Phytologist, 185, 258–274. Rong H, Tang Y, Zhang H, Wu P, Chen Y, Li M, Wu G, Jiang H. 2013. The stay-green rice like (SGRL) gene regulates chlorophyll degradation in rice. Journal of Plant Physiology, 170, 1367–1373. Saghai-Maroof M A, Soliman K M, Jorgenson R, Allward R W. 1984. Ribosomal DNA spacer length polymorphisms in barley: Mendelian inheritance, chromosomal location and population dynamics. Proceedings of National Academy of Sciences of the United States of America, 81, 8014–8018. Sang X C, Xu F F, Zhu X Y, Xing Y D, He P L, Zhang C W, Yang Z L, He G H. 2014. Identification and gene fine mapping of early senescence leaf mutant esl5 in Oryza sativa. Acta Agronomica Sinica, 40, 1182–1189. (in Chinese) Sato T, Miyanoiri Y, Takeda M, Naoe Y, Mitani R, Hirano K, Takehara S, Kainosho M, Matsuoka M, Ueguchi-Tanaka M, Kato H. 2014. Expression and purification of a GRAS domain of SLR1, the rice DELLA protein. Protein Expression and Purification, 95, 248–258. Sato Y, Morita R, Katsuma S, Nishimura M, Tanaka A, Kusaba M. 2009. Two short-chain dehydrogenase/reductase, NONYELLOW COLORING 1 and NYC1-LIKE, are required for chlorophyll b and light-harvesting complex II degradation during senescence in rice. The Plant Journal, 57, 120–131. Schippers J H M. 2015. Transcriptional networks in leaf senescence. Current Opinion in Plant Biology, 27, 77–83. Shi B, Ni L, Zhang A, Cao J, Zhang H, Qin T, Tan M, Zhang J, Jiang M. 2012. OsDMI3 is a novel component of abscisic acid signaling in the induction of antioxidant defense in leaves of rice. Molecular Plant, 5, 1359–1374. Shi B, Ni L, Zhang A, Tan M, Jiang M. 2014. OsDMI3 is a novel component of abscisic acid signaling in the induction of antioxidant defense in leaves of rice. Plant, Cell and Environment, 37, 341–352. Sudo E, Itouga M, Yoshida-Hatanaka K, Ono Y, Sakakibara H. 2008. Gene expression and sensitivity in response to copper stress in rice leaves. Journal of Experimental Botany, 59, 3465–3474. Tester M, Langridge P. 2010. Breeding technologies to increase crop production in a changing world. Science, 327, 818–822. Van Wilder, De Brouwer V, Loizeau K, Gambonner B, Albrieux C, Van Der Straeten D, Lambert W E, Douce R, Block M A, Rebeille F, Ravanel S. 2009. C1 metabolism and chlorophyll synthesis: The Mg-protoporphyrin IX methyltransferase activity is dependent on the folate status. New Phytologist, 182, 137–145.

1954

LIU Zhong-xian et al. Journal of Integrative Agriculture 2016, 15(9): 1944–1954

Wang J, Wu S J, Zhou Y, Zhou L H, Xu J F, Hu J, Fang Y X, Gu M H, Liang G H. 2006. Genetic analysis and molecular mapping of a presenescing leaf gene psl1 in rice (Oryza sativa L.). Chinese Science Bulletin, 51, 2986–2992. Webb M E, Smith A G. 2009. Cholophyll and folate: Intimate link revealed by drug treatment. New Phytologist, 182, 3–5. Wei G, Tao Y, Liu G, Chen C, Luo R, Xia H, Gan Q, Zeng H, Lu Z, Han Y, Li X, Song G, Zhai H, Peng Y, Li D, Xu H, Wei X, Cao M, Deng H, Xin Y, et al. 2009. A transcriptomic analysis of superhybrid rice LYP9 and its panrets. Proceedings of the National Academy of Sciences of the United States of America, 106, 7695–7701. Wu X Y, Kuai B K, Jia J Z, Jing H C. 2012. Regulation of leaf senescence and crop genetic improvement. Journal of Integrative Plant Biology, 54, 936–952. Xu F F, Sang X C, Ren D Y, Tang Y Q, Hu H W, Yang Z L, Zhao F M, He G H. 2012. Genetic analysis and gene mapping of early senescence leaf mutant esl2 in rice. Acta Agronomica Sinica, 38, 1347–1353. (in Chinese) Yamatani H, Sato Y, Masuda Y, Kato Y, Moria R, Fukunaga K, Nagamura Y, Nishimura M, Sakamoto W, Tanaka A, Kusaba M. 2013. NYC4, the rice ortholog of Arabidopsis THF1, is involved in the degradation of chlorophyll-protein complexes during leaf senescence. The Plant Journal, 74, 652–662. Yan W Y, Ye S H, Jin Q S, Zeng L J, Peng Y, Yan D W, Yang W B, Yang D L, He Z H, Dong Y J, Zhang X M. 2010. Characterization and mapping of a novel mutant sms1 (senescence and male sterility 1) in rice. Journal of Genetics and Genomics, 37, 47–55.

Yang Y L, Rao Y C, Liu H J, Fang Y X, Dong G J, Huang L C, Leng Y J, Guo L B, Zhang G H, Hu J, Gao Z Y, Qian Q, Zeng D L. 2011. Characterization and fine mapping of an early senescence mutant (es-t) in Oryza sativa L. Chinese Science Bulletin, 56, 2437–2443. Yoo S C, Cho S H, Sugimoto H, Li J, Jusumi K, Koh H J, Iba K, Paek N C. 2009. Rice virescent3 and stripe1 encoding the large and small subunits of ribonucleotide reductase are required for chloroplast biogenesis during early leaf development. Plant Physiology, 150, 388–401. Yoshida S. 2003. Molecular regulation of leaf senescence. Current Opinion in Plant Biology, 6, 79–84. Zhang T, Sun Y Y, Zheng J M, Cheng Z J, Jiang K F, Yang L, Cao Y J, You S M, Wan J M, Zheng J K. 2014. Genetic analysis and fine mapping of a premature leaf senescence mutant in rice (Oryza sativa L.). Acta Agronomica Sinica, 40, 2070–2080. (in Chinese) Zhao C C, Huang F D, Gong P, Yang X, Cheng F M, Pan G. 2014. Physiological characteristics and gene mapping of a leaf early-senescence mutant osled in rice. Acta Agronomica Sinica, 40, 1946–1955. (in Chinese) Zhou Y, Liu L, Huang W, Yuan M, Zhou F, Li X, Lin Y. 2013. Overexpression of OsSWEET5 in rice causes growth retardation and precocious senescence. PLOS ONE, 9, e94210. Zhu L, Liu W Z, Wu C, Luan W J, Fu Y P, Hu G C, Si H M, Sun Z X. 2007. Identification and fine mapping of a gene related to pale green leaf phenotype near centromere region in rice (Oryza sativa L.). Rice Science, 14, 172–180. (Managing editor WANG Ning)