Phenotyping of sensory and sympathetic ganglion neurons of a galanin-overexpressing mouse—Possible implications for pain processing

Journal of Chemical Neuroanatomy 31 (2006) 243–262 www.elsevier.com/locate/jchemneu

Phenotyping of sensory and sympathetic ganglion neurons of a galanin-overexpressing mouse—Possible implications for pain processing Pablo Brumovsky a,b,*, Karin Hygge-Blakeman c, Marcelo J. Villar b, Masahiko Watanabe d, Zsuzsanna Wiesenfeld-Hallin c, Tomas Ho¨kfelt a a Department of Neuroscience, Karolinska Institutet, Stockholm, Sweden Faculty of Biomedical Sciences, Austral University, Buenos Aires, Argentina c Department of Medical Laboratory Sciences and Technology, Division of Clinical Neurophysiology, Karolinska Institutet, Huddinge, Sweden d Department of Anatomy, Hokkaido University School of Medicine, Sapporo, Japan b

Received 15 December 2005; received in revised form 3 February 2006; accepted 4 February 2006 Available online 20 March 2006

Abstract The distribution of galanin was studied in the lumbar 5 dorsal root ganglia (DRGs) and spinal cord, superior cervical ganglia (SCGs), and skin of transgenic mice overexpressing galanin under the dopamine b-hydroxylase (DBH) promoter (GalOE-DBH mice) and in wild type (WT) mice. The DRGs and spinal cord were analysed before and after a unilateral, complete transection (axotomy) of the sciatic nerve and after dorsal rhizotomy. Both galanin protein and transcript were studied by, respectively, immunohistochemistry and in situ hybridization. Increased galanin expression was observed in several small, medium-sized and large DRG neuron profiles (NPs) in the naı¨ve transgenic mouse, frequently in neurons lacking calcitonin gene-related peptide (CGRP) and isolectin B4-binding. This lack of coexistence was particularly evident in the medium-sized/large NPs. In the dorsal horn of the spinal cord, no differences were detected between GalOE-DBH and WT mice, both displaying a strong galanin-positive neuropil in the superficial laminae of the dorsal horn, but the transgenic mice showed a more abundant galanin-positive innervation of the ventral horn. A 12-day dorsal rhizotomy, surprisingly, failed to alter the galanin staining patterns in the dorsal (and ventral) dorsal horn. Unilateral axotomy induced upregulation of galanin in DRG NPs of all sizes in both types of mouse. In the hindpaw skin, a profuse galanin-positive fiber plexus was observed in sweat glands and around blood vessels of the transgenic mice, being much more restricted in WT mice. Finally, GalOE mice exhibited a strong galanin-like immunoreactivity in most SCG NPs. The overexpression of the peptide in DRGs and SCGs was paralleled by increased mRNA levels. The present results show that overexpression of galanin under the control of the DBH promoter does not only occur, as expected in these mice, in noradrenline/adrenaline neurons but also in DRG neurons, particularly in large and medium-sized NPs. To what extent and how this overexpression pattern is related to the previously shown elevated pain threshold under normal and lesion conditions is discussed [Grass, S., Crawley, J.N., Xu, X.J., Wiesenfeld-Hallin, Z., 2003a. Reduced spinal cord sensitization to C-fibre stimulation in mice over-expressing galanin. Eur. J. Neurosci. 17, 1829–1832; Hygge-Blakeman, K., Brumovsky, P., Hao, J.X., Xu, X.J., Ho¨kfelt, T., Crawley, J.N., Wiesenfeld-Hallin, Z., 2004. Galanin over-expression decreases the development of neuropathic pain-like behaviour in mice after partial sciatic nerve injury. Brain Res. 1025, 152–158]. # 2006 Elsevier B.V. All rights reserved. Keywords: Dorsal root ganglion; Ectopic expression; Nerve injury; Neuropeptide; Transgenic mouse

1. Introduction Galanin has been described as a multi-functional neuropeptide, including the recent demonstration of its involvement in

* Corresponding author. Tel. +46 8 52487070; fax: +46 8 331692. E-mail address: [email protected] (P. Brumovsky). 0891-0618/$ – see front matter # 2006 Elsevier B.V. All rights reserved. doi:10.1016/j.jchemneu.2006.02.001

developmental processes and trophic actions (see Bartfai et al., 1993; Merchenthaler et al., 1993; Crawley, 1995; Wynick et al., 2001; Vrontakis, 2002; Counts et al., 2003; Robinson, 2004; Ho¨kfelt and Crawley, 2005). In the peripheral nervous system of both rat and mouse, expression of galanin can normally only be detected in a few small neurons in dorsal root ganglia (DRGs) (Ch’ng et al., 1985; Skofitsch and Jacobowitz, 1985; Corness et al., 1996; Shi et al., 1998). However, axotomy

244

P. Brumovsky et al. / Journal of Chemical Neuroanatomy 31 (2006) 243–262

(Ho¨kfelt et al., 1987; Villar et al., 1989; Shi et al., 1999) and chronic nerve compression (Nahin et al., 1994; Ma and Bisby, 1997; Shi et al., 1999) of the sciatic nerve of rat and axotomy in mouse (Corness et al., 1996; Shi et al., 1998) induce a dramatic increase in galanin expression in small and medium-sized as well as in some large lumbar DRG neurons. It has been suggested that galanin at the spinal level is linked to modulation of pain (see Xu et al., 2000; Wiesenfeld-Hallin and Xu, 2001; Liu and Ho¨kfelt, 2002; Hua et al., 2005) and to survival and regeneration of lesioned neurons (Kerr et al., 2000; Mahoney et al., 2003; Holmes et al., 2005). In recent years, several galanin mutant mice have been generated, both galanin overexpressing (GalOE) (see Crawley et al., 2002; Holmes et al., 2005) and galanin knock-out (GalKO) (see Wynick and Bacon, 2002; Holmes et al., 2005) mice. They have been extensively used to study the possible functional role(s) of this peptide in pain mechanisms, neuronal survival as well as central functions, and pathologies such as epilepsy. In mice overexpressing galanin under the control of the platelet-derived growth factor-b (PDGF-B) many galaninpositive (+) neurons are present in the DRGs, in contrast to the low expression usually observed in wild-type (WT) mice (Holmberg et al., 2005). Thus, in the transgenic mice at least two thirds of all DRG neurons, of all sizes, express galanin (Holmberg et al., 2005). These mice exhibit a modest decrease in their heat sensibility to pain (Hygge-Blakeman et al., 2001), a decrease in plasma extravasation after the application of mustard oil to the plantar aspect of the hindpaw, but seem to be more sensitive to pain in the formalin test than WT mice (Holmberg et al., 2005). Another line of mice overexpresses galanin under the control of the c-RET promoter (GalOE-c-Ret) (Holmes et al., 2003), which has been demonstrated to target isolectin B4+ (IB4) DRG neurons (Sukumaran et al., 2001). These mice constitutively and ectopically overexpress galanin and exhibit elevated mechanical and thermal thresholds (Holmes et al., 2003). In a further line, galanin overexpression is induced in DRGs after nerve injury. In these mice, the reduced mechanical threshold after peripheral nerve injury recovers faster than in WT mice (Holmes et al., 2005). Finally, a mouse overexpressing galanin under the control of the dopamine b-hydroxylase (DBH) promoter (GalOE-DBH; in the following termed GalOE mice) (Steiner et al., 2001), display an increased number of galanin+ DRG NPs and are more resistant to pain than WT mice, showing only moderate mechano-allodynia and thermic hyperalgesia after partial sciatic nerve lesion (Hygge-Blakeman et al., 2004). Furthermore, these mice exhibit a stronger reduction in spinal sensitisation induced by repetitive stimulation of C-type fibers as compared to WT mice (Grass et al., 2003). At present, most of the information concerning this latter type of GalOE mouse and its response to pain relies on behavioural data (HyggeBlakeman et al., 2004), and possible phenotypic changes in galanin expression in the peripheral nervous system and the spinal cord have only been explored to a limited extent. In the present study we have therefore studied the expression of galanin in the GalOE mouse, particularly in DRG and

trigeminal ganglion (TG) neurons and spinal cord, as well as in the skin and, for comparison, the superior cervical ganglia (SCGs). Furthermore, we have defined the phenotype of the GalOE neurons by means of colocalization with several different markers, including DBH, tyrosine hydroxylase (TH) and the vesicular glutamate transporter-1 (VGLUT1). Finally, the effect of peripheral axotomy and dorsal rhizotomy was also studied. 2. Materials and methods 2.1. Animals The experiments were performed on 32-male GalOE (Steiner et al., 2001; Hygge-Blakeman et al., 2004) and 29-male WT littermate mice (20–30 g; Jackson Laboratories, Bar Harbour, MA, USA). The galanin gene expression was targeted to noradrenergic neurons by coupling the mouse galanin gene to the human DBH promoter (Steiner et al., 2001). Transgenic mice were backcrossed into C57BL/6J for seven generations, to avoid complications of mixed genetic background and strains with unusual alleles relevant to memory tasks (Mazarati et al., 2000; Crawley et al., 2002). Also, some C57Bl/6J naı¨ve WT mice were analyzed in parallel. All animals were maintained on a 12 h day/night cycle (light on 7.00 a.m.), with water and food ad libitum. 2.1.1. Axotomy Complete transection of the right sciatic nerve was performed in GalOE (n = 12) and WT (12) mice, previously anaesthetized with a mixture of Hypnorm (fentanyl citrate/fluanisone; Janssen, Saunderton, High Wycombe, Buckinghamshire, UK) and Dormicum (Midazolam; Roche, Basel, Switzerland), diluted in normal saline (7–10 ml/kg; i.p.). Briefly, the right sciatic nerve was exposed at the mid-thigh level and a 5- to 8-mm-long segment dissected free from the surrounding tissue using sharp microscissors. The nerve was then strongly ligated and transected distal to the ligation. In all cases, a 5 mm-long segment was resected distal to the transection. Finally, muscles and skin were sutured in layers, and the animals were allowed to recover from anaesthesia in a warmed cage, and were perfused through the heart seven days after surgery. For in situ hybridization eight GalOE and eight WT littermates were used. Four mice from each group received a unilateral axotomy (as above). Seven days later the axotomized and the remaining mice were sacrificed by decapitation. 2.1.2. Dorsal rhizotomy In deeply anaesthetized GalOE (3) and WT (2) mice (Isoflurane; Baxter Medical AB, Sweden; 2% for induction and 0.6% for maintenance of anaesthesia), the lumbar spinal cord was exposed by laminectomy at the level of the lumbar (L)4 DRG, and all the exposed right dorsal roots were transected. The animals were perfused through the heart twelve days later (see below). All procedures and lesions practiced in the animals were approved by the local ethical committee (Stockholms Norra Djurfo¨rso¨ksetiska Na¨mnd) (# 130/ 02, 219/03 and 385/04), and in accordance with the policy of the Society of Neuroscience on the use of animals in neuroscience research. 2.1.3. Tissue preparation All lesioned animals, as well as 16 naı¨ve (unlesioned) mice (9 GalOE; 7 WT) were deeply anaesthetized using sodium pentobarbital (60 mg/kg i.p.; Karolinska Sjukhuset, Apoteket, Stockholm, Sweden) and perfused via the ascending aorta with 20 ml of Tyrode’s buffer (37 8C), followed by 20 ml of a mixture of 4% para-formaldehyde and 0.2% picric acid in 0.16 M phosphate buffer (pH 6.9) (Pease, 1962; Zamboni and De Martino, 1967) and 50 ml of the same fixative at 4 8C, the latter for approximately 5–7 min. The contra- and ipsilateral L5 DRGs, the TGs, the lumbar spinal cord, the SCGs and the glabrous hindpaw skin were dissected out and immersed in the same fixative for 90 min at 4 8C followed by 10% sucrose in phosphate-buffered saline (PBS) (pH 7.4) containing 0.01% sodium azide (Sigma, St. Louis, MO, USA) and 0.02% Bacitracin (Sigma) (4 8C) for 48 h. All tissues were embedded in Tissue-Tek O.C.T. compound (Sakura, Torrence, CA, USA) and serially sectioned in a

P. Brumovsky et al. / Journal of Chemical Neuroanatomy 31 (2006) 243–262 cryostat (Microm, Heidelberg, Germany) at 14 mm (except the spinal cord which was cut at 20 mm) and mounted on aluminum gelatin-coated slides.

2.2. Immunohistochemistry 2.2.1. Incubation protocol 2.2.1.1. Single-staining (TSA Plus; Galanin or DBH). The sections were pretreated with 0.01% H2O2 during 30 min at room temperature (RT), washed twice in PBS and incubated for 24–48 h at 4 8C with rabbit antigalanin (1:4000; Theodorsson and Rugarn, 2000) or rabbit anti-DBH (1:4000; Neuromics, Minneapolis, MN, USA) antisera, diluted in 0.01M PBS containing 0.3% Triton X-100 and 0.5% bovine serum albumin (BSA). To visualize the immunoreactivity, the sections were processed using a commercial kit based on tyramide signal amplification (Adams, 1992) (TSA Plus, NEN Life Science Products, Inc., Boston, MA, USA). Briefly, the sections were washed in TNT buffer (kit; 0.1 M Tris–HCl, pH 7.5; 0.15 M NaCl; 0.05% Tween 20) for 10 min, incubated with TNB buffer (kit; 0.1 M Tris–HCl, pH 7.5; 0.15 M NaCl; 0.5% Dupont Blocking Reagent; NEN) for 30 min at RT and incubated with a swine anti-rabbit/horse-radish peroxidase (HRP) conjugate (Dako, Copenhagen, Denmark) diluted 1:200 in TNB buffer for 30 min. The sections were washed three times in TNT buffer and incubated in a biotinyl tyramidefluorescein isothiocyanate (BT-FITC) conjugate (NEN) diluted 1:700 in amplification diluent for 30 min at RT. Sections selected for quantification were washed twice in PBS and further incubated in 0.001% propidium iodide (PI) (Sigma) for 3 min, or DAPI (1:2000, 30 min; Chemicon International, Temecula, CA, USA), and washed three times in PBS. In addition, using the TSA method as described above, an experiment was carried out on spinal cord sections from normal and dorsal rhizotomized mice, using different dilutions of the galanin antiserum (1:8000; 1:16,000; 1:24,000; 1:32,000; 1:64,000). This was done in order to exclude that too high antibody concentrations prevented detection of a difference between ipsi- and contralateral dorsal horn.

245

mouse brain extracts, and also by immunostaining patterns in the adult mouse brain, showing identical results to previous reports by immunohistochemistry and in situ hybridization (Miyazaki et al., 2003). After incubation for 24 h, the slides underwent exactly the same TSA Plus-steps, except that we used rabbit antiguinea-pig/or donkey anti-goat/HRP conjugates against the primary guinea-pig anti-CGRP or the goat anti-VGLUT1 antibodies, as well as the fluorophore Tetramethylrhodamine (TMR) (TSA Plus; 1:300; 30 min). 2.2.2. Controls In the double-staining experiments some sections were incubated with only one of the previously described primary antibodies and processed using TSA Plus or regular indirect fluorescence techniques to certify the pattern of expression, and to compare it with the double-stained sections. The neuropeptide, as well as Golgin-84 antisera were preadsorbed with the appropriate antigenic peptide at 10
5 and 10
6 M. The VGLUT1 antiserum was studied after preadsorption with the C-terminal, 531–560 amino acid peptide (10
6 and 10
6 M). 2.2.3. Microscopy All sections were coverslipped using 2.5% DABCO in glycerol (Sigma) and examined using a Nikon Microphot-FX microscope (Nikon, Tokyo, Japan) equipped with a Nikon B-1E filter (excitation 480  10 nm with a 520–550 nm emission filter) for the visualization of fluorescence produced by FITC, and a Nikon G-1B filter (excitation 546  5 nm with a 590 nm emission filter). A Nikon Eclipse E600 fluorescence microscope with the appropriate filters and a Nikon DXM 1200 digital camera were used (Tokyo, Japan). Photographs were taken with Kodak T-400 photographic film and digitized using a Nikon Scanner LS-2000, or with the Nikon DXM 1200 digital camera. For colocalization analysis, a Bio-Rad Radiance Plus confocal scanning microscope (Bio-Rad, Hemel Hempstead, UK) was used, installed on a Nikon Eclipse E600 fluorescence microscope equipped with 10 (0.45 N.A.), 20 (0.75 N.A.) and 60 oil (1.40 N.A.) objectives. The FITC labeling was excited using the 488 nm argon laser and its signal detected using the HQ 530/60 (Bio-Rad) emission filter. For the detection of RRX, Cy3 and TMR, the 543 nm HeNe laser was used in combination with HQ 590/70 (Bio-Rad) emission.

2.2.1.2. Double-staining (TSA Plus and indirect immunofluorescence; Galanin + calcitonin gene-related peptide (CGRP), TH, 5-hydroxytryptamine (5-HT), Golgin-84 or isolectin B4 (IB4)). After incubation with galanin antiserum as above, some sections were washed in PBS and processed according to Coons and collaborators (see Coons, 1958), that is incubated for 24–48 h at 4 8C with guinea-pig anti-CGRP (1:400; Peninsula Laboratories, Belmont, CA, USA), sheep anti-TH (1:400; Haycock and Waymire, 1982), guinea-pig anti-5HT (1:400; Steinbusch et al., 1983), or rabbit anti-Golgin-84 (the Golgi autoantigen golgin subfamily A member 5) antibodies (1:500), followed by the TSA Plus technique for visualization of galanin (as above). After the last wash in TNT and two washes in PBS, the sections were further incubated using Rhodamine Red X (RRX) or cyanin 3 (Cy3)-conjugated donkey anti-guinea-pig (for CGRP), anti-sheep (for TH) or anti-rabbit (for Golgin-84) antibodies (1:40 and 1:400 for RRX and Cy3, respectively) (Jackson Immuno-Research, West Grove, PA, USA). Another set of TSA Plus-processed slides (for galanin, as above) was further incubated with the isolectin B4 from Griffonia Simplicifolia I (GSA I) (IB4; 5 mg/ml; Vector Laboratories, Burlingame, CA, USA), followed by incubation with a goat anti-GSA I antiserum (1:2000) (Vector Laboratories). Finally, the sections were incubated for 1 h with a RRX-conjugated, donkey anti-goat antibody (1:200) (Jackson Laboratories) for visualization of the IB4 binding.

All oligonucleotides were chosen in regions presenting few homologies with sequences of related mRNAs, and they were checked against the GenBank database. The oligonucleotides were labeled as previously described (Dagerlind et al., 1992) at the 30 end using terminal deoxynucleotidyl transferase (TdT) (Amersham, Amersham, UK) in a cobalt-containing buffer with either [35S]dATP or 33P-g-dATP (New England Nuclear, Boston, MA) to a specific activity of 1–4  106 cpm/ml and purified using ProbeQuant G50 columns (Amersham, UK).

2.2.1.3. Double-staining (double-TSA plus; Galanin + CGRP or VGLUT1). Some slides were also processed following a double-TSA Plus technique for further colocalization analysis. Briefly, after finishing with the first TSA Plus protocol (for galanin, as above) the sections were washed twice in PBS and incubated with rabbit anti-CGRP (Orazzo et al., 1993) or goat antiVGLUT1 (1:4000) antibodies. The latter antibody was raised against the Cterminal sequence of rat VGLUT1 (531–560 amino acid residues, GenBank accession number U07609), which is identical to the mouse C-terminal sequence (BC054462) and was expressed as glutathione-S transferase fusion protein for immunization. Procedures for the protein expression, immunization and antibody purification were previously reported (Nakamura et al., 2004). The specificity has been tested by immunoblot, in which a single band at 60 kDa was detected in

2.3.2. Protocol All animals were deeply anaesthetized (as above), decapitated, and the left and right L5 DRGs and the SCGs rapidly dissected out and frozen. All tissue was sectioned at 14 mm in a cryostat (as above) and mounted on ProbeOn slides (Fisher Scientific, Pittsburgh, PA, USA). After drying overnight, the sections were processed following the protocol of Dagerlind et al. (1992). Briefly, the sections were incubated with a mixture of galanin oligoprobes (0.5 ng) diluted in hybridization cocktail containing deionized formamide (G.T. Baker Chemicals, Deventer, The Netherlands), 4 SSC (1 SSC = 0.15 M NaCl and 0.0015 M sodium citrate), 1 Denhardt’s solution (0.02% polyvinylpyrrolidone; bovine serum albumin and Ficoll); 1% sarkosyl (N-Lauryl Sarcosine; Sigma, St. Louis, MO, USA); 10% dextran sulfate

2.3. In situ hybridization 2.3.1. Probes A mixture of two oligonucleotides (CyberGene AB, Huddinge, Sweden) complementary to galanin mRNA was used. These were designed from published gene sequences as follows (Landry et al., 2000): (i) 50 CACCCTCTTGCCTGTGAGGCCATGCTTGTCGCT, and (ii) 50 GGCCCCGGCCTCTTTAAGGTGCAAGAAACTGAG.

246

P. Brumovsky et al. / Journal of Chemical Neuroanatomy 31 (2006) 243–262

(Pharmacia, Uppsala, Sweden), denatured salmon testis DNA (Sigma) at a concentration of 500 mg/l and 0.2 M phosphate buffer (pH 7.0). After hybridization in a humid chamber at 42 8C for 18–22 h, the sections were washed in SSC 1 at 55 8C (four times, 15 min each, and 1 h at RT), rapidly dehydrated and dried at RT. Afterwards, the slides were dipped in NTB2 photoemulsion (Kodak, Rochester, NY, USA). After an appropriate exposure time (2–4 weeks), the sections were developed using Kodak D19 developer and Kodak 3000 fixative and coverslipped with glycerol. When necessary, the sections were counterstained using toluidine blue and remounted with Permount (Fisher Scientific Company, Fair Lawn, New Jersey, USA). The sections were examined using a Nikon Eclipse E600 microscope equipped with dark- and brightfield illumination. Photographs were obtained using a Nikon DXM-1200 digital camera. For control, some sections were incubated with a mixture of radioactive oligoprobe and an excess (100) of non-radioactive oligoprobe.

2.4. Image processing Resolution, brightness and contrast of the images were optimized using the Adobe Photoshop 6.0 software (Adobe Systems Inc., San Jose, CA, USA) and printed using an Epson Stylus Photo EX printer (Seiko Epson Corp., Nagano, Japan).

2.5. Quantification Quantification was performed on GalOE and WT L5 DRGs processed for immunohistochemistry, in naı¨ve and lesioned (axotomy; 7 days survival) mice. Every fourth L5 DRG section was used to quantify the number of galanin-, CGRP-, IB4- or TH+ neuron profiles (NPs), as well as the total number of PI/ DAPI-stained NPs, these two giving a typical nuclear staining. In total, 8–10 sections per ganglion (42 mm between each section) were used for quantification. The quantification of CGRP+, IB4+ or TH+ NPs colocalizing galanin or CGRP+ NPs colocalizing IB4 was carried out on every eighth section. In all experiments only nucleated NPs were counted. For the assessment of neuronal size distribution, the area of all nucleated galanin+ NPs in naı¨ve mice was measured using the public domain NIH program (developed at the U.S. National Institutes of Health and available on the Internet at http://rsb.info.nih.gov/nih-image/). A total of 69–217 NPs per mice (GalOE, n = 7; WT, n = 5) was used for this study. In the colocalization assessment (galanin plus CGRP, galanin plus IB4 or galanin plus VGLUT1), as well as the analysis of the effect of axotomy on galanin expression, a semiquantitative estimation was carried out with regard to cell body size, by using a grid showing squares of 40 mm  40 mm (1600 mm2) attached to one of the oculars in the microscope. The different neuronal sizes were separated into two main groups: (1) small NPs, occupying approximately one quarter of the 1600 mm2 square (400 mm2); (2) medium and large NPs, occupying two or more quarters (800 > 1600 mm2), in all cases only including NPs with a nucleus.

2.6. Statistics Data are presented as mean  S.E.M. and were statistically analyzed using the Student’s t-test. The Student’s t-test for dependent samples was used to compare the contra- and ipsilateral side of axotomized mice, whereas the same test for independent samples was chosen when comparing naı¨ve and contralateral or lesioned ganglia.

3. Results 3.1. Dorsal root, trigeminal and superior cervical ganglia—naı¨ve 3.1.1. Immunohistochemstry Around 13% (13.1  1.3%; naı¨ve, n = 10) of all L5 DRG NPs in GalOE mice were galanin+ (Figs. 1a, c, e, f and 2a),

whereas WT mice showed a lower number of galanin+ NPs (6.2  1.6%; naı¨ve, n = 6) (Figs. 1b, d and 2a). Size measurements revealed that a large proportion of the galanin+ NPs in the GalOE mice has an area between 200 and 500 mm2, although several NPs were in the range of 600–1500 mm2, and some even larger (2600 mm2) (Fig. 3). This was in contrast to observations in WT mice, where most of the galanin+ NPs were in the range of 100–400 mm2, that is of the small type (Fig. 3). The subcellular distribution of the immunoreactivity for galanin often differed between large and small neurons. Thus, large neurons in the GalOE mice exhibited an intense galanin-like-immunoreactivity (LI) in the Golgi apparatus (Fig. 1e and f), as shown by double-labeling with a specific Golgi marker, Golgin-84 (Fig. 4a–c). Small neurons in the GalOE mice also exhibited Golgi staining and, in addition, a dotted, vesicle-like galanin-LI (Figs. 1f and 4a–c). In WT mice, the mostly small neurons showed similar characteristics as the small ones in the transgenic mice (Fig. 1d). In most cases, galanin+ fibers were observed running between the cell bodies and fiber bundles within the DRGs in both types of mice (Fig. 1a–d). Double-staining studies revealed that 45.2  1.7% of all galanin+ NPs in naı¨ve GalOE mice (n = 5) expressed CGRP, as compared to 65.2  0.7% in WT mice (n = 3) (P < 0.001; Figs. 4d–i and 5a). Conversely, almost 30% of all CGRP+ DRG neurons coexpressed galanin in both types of mice (29.8  0.7% versus 27  3.3%, respectively) (Fig. 5b). When analyzed by neuronal size, galanin was colocalized with CGRP in 42  1.1% of the small DRG NPs in GalOE mice, versus the 79.3  1.4% observed in WT mice (P < 0.001; Fig. 5c). A few large neurons in the GalOE mice showed coexistence with CGRP (4.4  0.4%), and only 1.44  1.1% of the very few medium-sized neurons detected in WT mice also coexpressed the peptide (P < 0.5; Fig. 5c). Thus, most of the large galanin+ DRG neurons in the GalOE mice were CGRP-negative (Figs. 4d–f and 5c). In the naı¨ve GalOE mice, 27.8  1.3% of all galanin+ NPs (n = 5) were IB4+, whereas WT mice (n = 3) exhibited a 40.8  3.3% coexpression (P < 0.01; Figs. 4j–o and 5a). Conversely, in both the transgenic and WT mice almost 15% of all IB4+ DRG neurons coexpressed galanin (12.9  0.9% versus 14  2.5%) (Fig. 5b). When analyzed by neuronal size, 32.5  1.1% of the small galanin+ DRG neurons in GalOE mice exhibited IB4 binding versus 53.61  1.2% in WT mice (P < 0.001; Fig. 5d). There were virtually no large or mediumsized galanin neurons binding IB4 in either type of mice (0.4  0.4% versus 0.5  0.06%, respectively; Fig. 4j–o and 5d). As a control measure for the colocalization estimations between galanin and CGRP or IB4, we compared the number of CGRP+ or IB4+ NPs against the total number of DRG NPs per section, and no difference between GalOE and WT mice was detected (data not shown). VGLUT1+ neurons were mostly observed in large DRG NPs in GalOE (Fig. 6b) and WT (data not shown) mice. Around 60% (57.1  8%) of the large galanin+ DRG NPs detected in the GalOE mice coexpressed VGLUT1, but VGLUT1 was never detected in small galanin+ neurons (Fig. 6a and b).

P. Brumovsky et al. / Journal of Chemical Neuroanatomy 31 (2006) 243–262

247

Fig. 1. (a–f) Confocal immunofluorescence micrographs of lumbar DRG sections of naı¨ve GalOE (a, c, e, f) and WT (b and d) mice after incubation with galanin antiserum (insets in a, b and e are shown at higher magnification in c, d and f, respectively). (a–d) Note several small (small arrowheads) and large (large arrowheads) galanin+ NPs in GalOE mice (a and c), contrasting only small ones (small arrowheads) in WT mice (b and d). Galanin+ fibers are detected in transgenic (doublearrowhead in a and c) and WT mice (double-arrowheads in b and d). (e and f) In most cases, galanin-LI in large neurons is present in ‘Golgi-like’ structures (asterisks in e and f), whereas small neurons in both types of mouse exhibit not only ‘Golgi’, but also staining in small granules (small arrowheads in f; cf. with d). Scale bars: 50 mm (b = a); 25 mm (d = c); 10 mm (e; f).

248

P. Brumovsky et al. / Journal of Chemical Neuroanatomy 31 (2006) 243–262

Fig. 2. (a–c) Graphs showing the percentage of galanin+ DRG NPs in GalOE (naı¨ve, n = 10; 7-day-axotomy, n = 5) and WT (naı¨ve, n = 6; 7-day-axotomy, n = 5) mice. The total number of galanin+ NPs (a) or of only large (b) or small (c) NPs is shown, respectively. Note the larger number of galanin+ NPs in naı¨ve transgenic compared to the WT mice (a), including several large NPs virtually never observed in WT mice (b). Axotomy induces a marked increase in the expression of galanin in both types of mice (a), most pronounced in the smallneuron population (c). Large neurons also significantly upregulate galanin in GalOE and WT mice (b). Note different scales on the Y-axis. Data are expressed in mean  S.E.M. Comparison between contra- and ipsilateral side in the lesioned groups was analyzed using the paired t-test, whereas for any other comparison, the unpaired t-test was used. P values are as follows: *P < 0.05, ** P < 0.01 and ***P < 0.001.

A subgroup of small DRG NPs was TH+ both in naı¨ve GalOE and naı¨ve WT mice. They occasionally colocalized with galanin in the transgenic (4.2  1.7% n = 5) but never in WT (data not shown) mice. Furthermore, several galanin+/TH+ fibers of probable sympathetic origin were seen in the peripheral projections of the DRGs in the mutant mouse (Fig. 6c and d), but virtually never among the DRG neuronal bodies or nerve bundles within the ganglia (data not shown). Single DBH+ NPs were detected both in transgenic and WT lumbar DRGs. No evidence for DAT expression was obtained in any type of mouse (data not shown). In the SCGs, GalOE mice exhibited a large number of galanin+ NPs, in most cases colocalizing with TH (Fig. 6e and f). Galanin expression in WT mice was, however, moderate and usually present in TH+ NPs (Fig. 6g and h).

Fig. 3. Graph showing the neuronal size-distribution of galanin+ lumbar DRG neurons in naı¨ve GalOE (n = 7) and WT mice (n = 5). GalOE mice exhibit a widespread size-distribution, with neurons peaking between 200 and 500 mm2, and several between 600 and 1400 mm2 and even reaching 2600 mm2. In contrast, most of the galanin+ NPs in WT mice are small with a peak between 200 and 300 mm2, and only few reach the 1300 mm2. Data are expressed in square mm and include 69–217 observations/mice.

Finally, a fairly large number of galanin+ NPs was observed in the TGs of the transgenic mice, including large neurons, in contrast to the few, small neurons observed in the WT mice (data not shown). 3.1.2. In situ hybridization In situ hybridization studies, using the isotope P33, confirmed our immunohistochemical observations, and several medium/large as well as many small NPs were strongly galanin mRNA+ in L5 DRGs of naı¨ve GalOE mice (Fig. 7a, g and h). In WT mice, only a few small and weakly galanin mRNA+ NPs were observed (Fig. 7c, i and j), and they were more easily detected when using the more ‘potent’ isotope S35 (Fig. 7e). In the SCGs, the number of galanin mRNA+ NPs and especially the signal intensity were considerably higher in the transgenic compared to the WT mice (Fig. 7k and l). 3.2. Hindpaw skin GalOE mice exhibited abundant galanin-LI in fibers within sweat gland acini (Fig. 8a, e and f), surrounding blood vessels (Fig. 8c and g), and in nerves/nerve bundles in dermis/hypodermis

Fig. 4. (a–o) Confocal immunofluorescence micrographs of lumbar DRG sections of naı¨ve GalOE (a–f and j–l) and WT (g–i and m–o) mice, co-incubated with galanin and Golgin-84 (a–c) or CGRP (d–i) antisera, or with IB4 (j–o) (c, f, i, l, and o show the respective merged micrographs). (a–c) In transgenic mice, large (large black arrowhead in a–c) and small (double-arrowhead in a–c) galanin+ NPs colocalize Golgin-84, used here as a Golgi marker. Specifically in small neurons of transgenic (and WT) mice, galanin+ staining is observed in granules, and this is virtually never associated with the Golgi apparatus (small arrowheads in insets in c). (d–i) GalOE mice exhibit several small and some medium-sized galanin+ NPs co-stained for CGRP (double arrowheads in d–f), whereas larger neurons virtually never are CGRP+ (large arrowheads in d). In contrast, WT mice only show small-sized galanin+ NPs (small arrowhead in g), frequently colocalizing CGRP (double arrowheads in g–i). In both, transgenic and WT mice, single-stained galanin+ NPs are seen (arrowheads in d, g), as well as many single-stained CGRP+ NPs of different sizes (arrows in e, h). (j–o) Only small neurons coexpress galanin and IB4 in the GalOE and WT mice (double arrowheads in j–o). Large (large arrowheads in j) and small (small arrowheads in j, m) NPs only stained for galanin (arrowheads in j, m), and usually medium to small sized IB4+ NPs (arrows in k, n) are frequently observed. Scale bars: 33 mm (c = a, b); 5 mm (inset in c); 50 mm (o = m, n; d–l).

P. Brumovsky et al. / Journal of Chemical Neuroanatomy 31 (2006) 243–262

249

250

P. Brumovsky et al. / Journal of Chemical Neuroanatomy 31 (2006) 243–262

Fig. 5. (a–d) Graphs showing the percentage of CGRP+ (a and c) or IB4+ (a and d) DRG NPs relative to galanin in naı¨ve GalOE (n = 5) and WT (n = 3) mice. (b) shows the percentage of galanin+ DRG NPs relative to CGRP or IB4. Note that, in general, GalOE mice exhibit a moderately lower proportion of galanin+ NPs colocalizing CGRP or IB4, out of the total population of galanin+ neurons, when compared to WT mice (a). In most cases, colocalization is observed in small and some medium-sized neurons (c and d), whereas larger galanin+ neurons are virtually never CGRP+ (c) or IB+ (d). In contrast, of all CGRP+ or IB4+ neurons, only relatively few colocalize galanin (b). Comparison between GalOE and WT mice was statistically tested using the unpaired t-test, whereas for any other comparison, the paired t-test was used. P values are as follows: *P < 0.05, **P < 0.01 and ***P < 0.001.

(Fig. 8a and c). Some galanin+ fibers were also observed close to the basal lamina between dermis and epidermis, even penetrating into the epithelium (Fig. 8a). In contrast, WT mice showed generally much fewer galanin+ fibers, virtually never in relation to the sweat glands, and only single ones penetrating into the epidermis (Fig. 8b). Also, there was a much less abundant galanin innervation of blood vessels (Fig. 8d). 3.3. L5 dorsal root ganglia—unilateral axotomy Axotomy of the sciatic nerve induced a strong upregulation in number of galanin+ NPs, in both GalOE (11.4  0.4% contralaterally versus 29.9  3.1% ipsilaterally; P < 0.01; n = 5) and WT (4.2  1% contralaterally versus 25.9  2.3%

ipsilaterally; P < 0.001; n = 5) mice (Figs. 2a and 9a–d). These effects were confirmed by in situ hybridization (Fig. 8a–d). The increase was particularly pronounced in the small neurons, both in transgenic (P < 0.01) and WT (P < 0.001) mice (Figs. 2c and 9a–d). In the population of large neurons the increase in galanin+ NPs was comparatively more pronounced in WT than in GalOE mice (P < 0.01; Figs. 2b and 9c, d), but, as said, the large NPs were already abundant in GalOE, in contrast to their virtual absence in WT mice. 3.4. Spinal cord Galanin-LI in the contralateral laminae I–II of the dorsal horn appeared similar in WT and GalOE mice (Fig. 10a and c),

P. Brumovsky et al. / Journal of Chemical Neuroanatomy 31 (2006) 243–262

as was the case in naı¨ve animals (data not shown). Even in the dilution-curve experiments (antiserum diluted up to 1:64,000), this lack of difference between the two groups of mice was still observed (data not shown). Ipsilateral to the lesion, a strong upregulation in galaninLI was seen in deeper layers of the dorsal horn (III-V) in both groups (Fig. 10b and d). Again, no difference was seen between the two sides, even at the highest antiserum dilution (1:64,000). Axotomy also induced upregulation of galanin in motor neurons in the ventral horn of both transgenic and WT mice (Fig. 11b and d), in contrast to the absence

251

of galanin+ motor neurons contralateral to the lesion (Fig. 11a and c). GalOE mice exhibited a more abundant galanin+ neuropil in the ventral horn of the spinal cord, as compared to the sparse network observed in WT mice (Fig. 11a–d). Colocalization studies showed that most of these fibers are negative for 5-HT and TH (data not shown). In situ hybridization did not exhibit any noticeable difference in galanin mRNA levels in dorsal horn neurons, or in motor neurons after axotomy, when comparing WT and transgenic mice (data not shown).

Fig. 6. (a–h) Confocal immunofluorescence micrographs of lumbar DRG (a–d) and SCG (e–h) sections of naı¨ve GalOE (a–f) and WT (g and h) mice, co-incubated with galanin and VGLUT1 (a and b) or TH (c–h) antisera. (a and b) VGLUT1+ NPs are seen in the DRGs of GalOE mice, virtually always present in large neurons (arrow and double arrowheads in b). The immunoreactivity for the transporter appears as a distinctly ‘granular’ staining (b) and is in some cases colocalized with galanin in large neurons (double arrowheads in a, b). Small galanin+ neurons are negative for VGLUT1 (arrowhead in a). (c and d) A galanin+/TH+ nerve bundle (double arrowheads in c, d) of probable sympathetic origin is observed in a lumbar DRG of a GalOE mouse. Some single stained galanin+ (arrowheads in c) or TH+ (arrows in d) fibers are also detected. (e–h) GalOE mice (e) show a considerably higher percentage of galanin+ NPs than WT mice (g). Abundant TH-LI is observed in SCG of both GalOE (f) and WT (h) mice. Numerous Gal+/TH+ NPs are seen in GalOE mice (double arrowheads in e, f). Also in WT mice most of the galanin+ neurons coexpress TH (double arrowheads in g, h). Some Gal+/TH
NPs can be detected in GalOE and WT mice (arrowheads in e, g, respectively), as well as many TH+/Gal
NPs in WT type and a few in GalOE mice (arrows in f, h). Scale bars: 50 mm (b = a), 100 mm (d = e; h = g; e, f).

252

P. Brumovsky et al. / Journal of Chemical Neuroanatomy 31 (2006) 243–262

Fig. 6. (Continued ).

3.5. Dorsal rhizotomy Dorsal rhizotomy of all roots passing the level of the L4 DRG had no effect on galanin-LI in the dorsal horn of the spinal cord (Fig. 10e and f), not even when a dilution curve was practiced, but induced a virtual disappearance of all CGRP-LI (Fig. 10g and h). 3.6. Controls The immunohistochemical patterns observed in doublestained sections for each marker were matched by singlestained sections included in our studies (data not shown), and the neuropeptide, as well as Golgin-84 and VGLUT1 staining patterns were abolished in the preadsorption experiments (data not shown).

In all cases, the incubation with an excess of the unlabelled probe resulted in a complete lack of galanin mRNA signal in DRG and SCG neurons in both types of mouse, including the axotomized DRGs (Fig. 8f). 4. Discussion A main finding in this study is that mice expressing galanin under the control of the DBH promoter synthesize galanin in larger amounts and in many more DRG neurons than WT mice. This is true both for small, medium-sized and large DRG neurons. This was unexpected, since the DBH promoter should specifically target noradrenergic (and adrenergic) neurons (and adrenal medullary catecholamine cells) (see below). Moreover, 55% of the small galanin+ DRG neurons in the transgenic mouse lacked CGRP, and only 30% bound IB4.

P. Brumovsky et al. / Journal of Chemical Neuroanatomy 31 (2006) 243–262

And most of the large galanin+ neurons were virtually never labelled by either one. However, a proportion (60%) coexpressed VGLUT1, a marker for glutamatergic neurons. In addition, the transgenic mice exhibited an increased galanin expression also in the SCG. Surprisingly, even after a 12-day dorsal rhizotomy there was no apparent decrease in

253

galanin-LI in the dorsal horn, although CGRP almost completely disappeared. GalOE mice also exhibited a more profuse galanin+ innervation in the glabrous skin than WT mice, being particularly abundant within the sweat glands and around blood vessels and sometimes penetrating into the epithelium.

Fig. 7. (a–l) Dark-field (a–f and k, l) and bright-field (g–j) micrographs showing galanin mRNA expression in lumbar DRGs of naı¨ve GalOE (a, g, h) and WT (c, e, i, j) or SCG of GalOE (k) and WT (l) mice, or DRGs after a 7-day axotomy of the sciatic nerve (b, d; GalOE and WT, respectively), using P33 (a–d; g, h) or S35 (e, i, j), or S35 after addition of an excess of cold probe (f). (a–f) Several small (small arrowheads) and large (large arrowheads) galanin mRNA+ NPs can be seen in the DRGs of control GalOE mice (a). In comparison, only small galanin mRNA+ NPs are present in control WT mice (small arrowheads in c), more easily detected and moderately more abundant when using S35 (e). After axotomy, a dramatic upregulation in NPs of all sizes is observed in GalOE (b) and WT (d) mice. No galanin signal is seen in a DRG of an axotomized WT mouse after incubation with a mixture of labeled and excess unlabeled probe (f). (g–j) A considerable number of galanin mRNA+ NPs of large (large arrowheads) and small (small arrowheads) size is observed in GalOE mice. In contrast, WT mice only exhibit small galanin mRNA+ NPs (small arrowheads in i, j). (k and l) Galanin transcript is expressed more strongly in many more NPs in SCG of GalOE (k) than WT (l) mice. Scale bars: 100 mm (b = a; c–f; k, I); 20 mm (j = g–i).

254

P. Brumovsky et al. / Journal of Chemical Neuroanatomy 31 (2006) 243–262

Fig. 7. (Continued ).

4.1. Ectopic galanin expression Mice overexpressing galanin under the control of the DBH promoter not only exhibit a strong increase in galanin expression in areas abundant in noradrenergic neurons, such as the locus coeruleus (Steiner et al., 2001), but also show ectopic expression in the piriform, entorhinal and frontal cortices and the hippocampus (Steiner et al., 2001; Wrenn et al., 2002; Hohmann et al., 2003). More recently, ectopic galanin mRNA expression in this transgenic mouse was confirmed in the above-mentioned structures and also in the amygdaloid cortical nucleus, the retrosplenial cortex and the mitral cells of the olfactory bulb (He et al., 2005). Here we confirm and expand earlier preliminary findings (Hygge-Blakeman et al., 2004) and demonstrate a similar phenomenon in peripheral tissues such as DRGs, TGs and SCGs, including presumably cholinergic neurons. Thus, in this transgenic mouse, the DBH promoter can control expression also in neurons not traditionally associated with noradrenergic/ adrenergic activity, so called ectopic expression (Mercer et al., 1991; Hoyle et al., 1994). With the exception of single neurons, we found no evidence for DBH expression in DRG neurons in the GalOE or WT mice. This observation confirms an early study by Mercer et al. (1991) showing, by directed expression of the lacZ gene in transgenic mice using a cloned human DBH gene promoter,

that only some sensory ganglion neurons express lacZ protein, in contrast to its abundancy in several neurons in the locus coeruleus and sympathetic ganglia. Previous studies in rats have shown expression of TH in 1–4% of the small DRG neurons, but they are not DBH+, suggesting a dopaminergic phenotype (Price and Mudge, 1983; Vega et al., 1991; WeilFugazza et al., 1993). In a recent study, we have observed that also adult mice express TH in small and medium-sized DRG neurons (15%) (Brumovsky et al., 2006b). However, we only found few cases of colocalization between TH and galanin in DRG neurons, and only a few in the GalOE mouse. Therefore, it seems most likely that the ectopic expression of galanin in DRG neurons is due to the above reported ability of the DBH promoter to trigger the expression of galanin in neurons other than noradrenergic ones, not resulting in expression of DBH enzyme protein and a noradrenergic phenotype. 4.2. Galanin in DRG neurons and dorsal horn There are two different markers which are often used to ‘phenotype’ DRG neurons: CGRP, characteristic of so called ‘peptidergic’ neurons, and IB4-binding which at least earlier was associated with the ‘non-peptidergic’ population, both related to nociception (see McMahon and Priestley, 2005).

P. Brumovsky et al. / Journal of Chemical Neuroanatomy 31 (2006) 243–262

255

Fig. 8. (a–f) Confocal immunofluorescence micrographs of glabrous skin from the hindpaw of naı¨ve GalOE (a, c, e–g) and WT (b and d) mice, after incubation with galanin antiserum (area boxed in e is shown in f). Note several galanin+ fibers around sweat gland acini of GalOE mice (large arrowheads in a, e, f), virtually never observed in WT mice (b). In addition, thin fibers in close relation to the epidermal layers are detected in both types of mouse (small arrowheads in a, b). In the hypodermis, several vessels (asterisks) show a profuse galanin+ innervation in GalOE mice (arrowheads in c, g), being much more modest in the WT mice (arrowheads in d). In both types of mouse, galanin+ fibers are detected in nerve bundles, but again more abundantly in the transgenic mouse (arrows in c, d). Scale bars: 100 mm (b = a, d = c; e); 55 mm (g); 35 mm (f).

More recently VGLUT1 has become a marker for large DRG neurons producing myelinated touch-responsive Aß-fibers (Li et al., 2003a,b; Oliveira et al., 2003; Todd et al., 2003; Alvarez et al., 2004; Hughes et al., 2004; Landry et al., 2004). Here we show that, in the naı¨ve GalOE mouse, 50% of all galanin

neurons contain CGRP and 30% bind IB4, and of the large DRG neurons 60% express VGLUT1. Thus, galanin is not overexpressed in a specific subpopulation of DRG neurons, but presumably both in nociceptors and in non-nociceptors, terminating in different laminae of the spinal cord.

256

P. Brumovsky et al. / Journal of Chemical Neuroanatomy 31 (2006) 243–262

Fig. 9. (a–d) Immunofluorescence micrographs of contra- (a and c) and ipsilateral (b and d) DRGs of GalOE (a and b) and WT (c and d) mice after a 7-day axotomy and after incubation with galanin antiserum. Note several large galanin+ NPs in the GalOE mice (large arrowheads in a), and many small galanin+ NPs present in both types of mouse (small arrowheads in a, c). Axotomy of the sciatic nerve induces a dramatic increase in the number of galanin+ NPs, involving all kinds of neuronal size, but particularly small neurons in the GalOE (b) and WT (d) mice. Scale bar: 150 mm (d = a–c).

The finding that more than half of the large DRG neurons in the transgenic mice showed coexistence with VGLUT1 suggests a possible galaninergic modulation of glutamate release by Ab-primary afferents, acting perhaps through presynaptic GalRs. So far, three different GalRs have been described (Branchek et al., 1998, 2000), each coupled to diverse intracellular pathways (Iisma and Shine, 1999) and present at different locations of the nervous system (Waters and Krause, 2000). In fact, in the rat GalR1 has been shown to be localized in 50% of the DRG neurons, predominantly in large ones, and the GalR2, presumably both a pre- and postsynaptic receptor, in 80% of all DRG neurons (Xu et al., 1996; Shi et al., 1997; O’Donnell et al., 1999; Kerekes et al., 2003). Since glutamate, the classical excitatory neurotransmitter, is present in primary afferent neurons (De Biasi and Rustioni, 1990; Merighi et al., 1991; Broman et al., 1993; Broman and Adahl, 1994; Valtschanoff et al., 1994; Oliveira et al., 2003; Landry et al., 2004) and local dorsal horn neurons (Todd et al., 1994, 2003), alterations in its release could have consequences for spinal neurotransmission. In our study the distribution and density of galanin-LI in the dorsal horn were approximately similar in WT and

GalOE. This was surprising, since many more DRG neurons, including large ones, synthesize galanin in the transgenic than in the WT mouse. Thus, more galanin+ fibers in the deep dorsal horn would have been expected. It is possible that the very sensitive immunohistochemical technique used here may not be suitable for distinguishing moderate changes in peptide levels. Nevertheless, dilution curve experiments did not reveal any difference between the two groups of mouse. Alternatively, in particular large GalOE neurons may not always have the proper machinery for packaging peptides into the large dense core vesicles which are required for centrifugal transport (cf. Zhang et al., 1995). In fact, galaninLI was, especially in large neurons, mainly present in the Golgi apparatus. Another surprise was that no certain difference was seen in the dorsal horn between ipsi- and contralateral side after a 12-day-dorsal rhizotomy in the GalOE mouse, in spite of galanin expression in high numbers of DRG neurons. This suggests that a large proportion of the galanin-LI in the dorsal horn is expressed in local neurons, described here and previously in the rat (Ro¨kaeus et al., 1984; Ch’ng et al., 1985; Melander et al., 1986; Simmons et al., 1995). On the other hand, it cannot be excluded that the dorsal

P. Brumovsky et al. / Journal of Chemical Neuroanatomy 31 (2006) 243–262

rhizotomy causes upregulation of galanin in local dorsal horn neurons, ‘compensating’ for a decrease due to degeneration of primary afferents. 4.3. Galanin in the ventral horn Here we observed a more abundant galanin+ neuropil in the ventral horn of the transgenic mouse, which could potentially modulate the activity of neurons involved in spinal sensitization and/or spinal reflexes. So far we could not ‘phenotype’ these galanin+ nerve endings. Thus, double-staining experiments using galanin and 5-hydroxytryptamine antisera, a marker for some descending supraspinal fibers (see Melander et al., 1986; Ho¨kfelt et al., 2000), showed virtually no colocalization. Neurons other than supraspinal could give rise to this intricate neuropil.

257

4.4. Galanin overexpression and pain The role of galanin in pain processing is complex, and inhibitory, excitatory or even biphasic actions have been described for this peptide, partly dependent on the type of galanin receptor being activated (see Liu and Ho¨kfelt, 2002; Flatters et al., 2002, 2003). Kerr et al. (2000) even showed that galanin KO mice exhibit a reduced response to nociceptive stimuli. Interestingly, the inhibitory component of galanin is increased after peripheral nerve injury (when galanin is upregulated) (Wiesenfeld-Hallin et al., 1989b). More recently, studies of different types of GalOE mice have shown increased antinociception, including the GalOE mouse analyzed here (Hygge-Blakeman et al., 2001, 2003; Grass et al., 2003; see Holmes et al., 2005; Wiesenfeld-Hallin et al., 2005). However,

Fig. 10. Immunofluorescence micrographs of transverse sections of the contra- (a, c, e and g) and ipsilateral (b, d, f and h) dorsal horn of the spinal cord, after a 7-days axotomy of the sciatic nerve (a–d) or a 12-days dorsal rhizotomy (e–h) of GalOE (a, b; e–h) and WT (c and d) mice, incubated with galanin (a–f) and CGRP (g and h) antisera (g, h are the same section as e, f, respectively). (a–d) Contralateral to the sciatic nerve axotomy, both transgenic and WT mice (a and c) exhibit an abundant galanin+ neuropil in the superficial laminae (I–II) of the dorsal horn, although some fibres are also seen in deeper laminae (arrows in a, c). Ipsilateral to the lesion, a marked increase in galanin-LI can be seen extending into deeper layers (III–V), especially in the mid part of the dorsal horn (arrowheads in b, d) in both the transgenic (b) and WT mice (d). (g–h) Dorsal rhizotomy does apparently not substantially affect the expression of galanin in the dorsal horn of the GalOE mouse (e and f), whereas an almost complete disappearance of CGRP-LI is observed ipsilateral to the lesion (asterisk in h). Scale bars: 100 mm (d = a–c; h = e–g).

258

P. Brumovsky et al. / Journal of Chemical Neuroanatomy 31 (2006) 243–262

Fig. 10. (Continued ).

it is not known how the overexpression of galanin protects these mice from pain. In the rat, the superficial laminae of the dorsal horn contain abundant glutamatergic interneurons, some expressing galanin GalR1 mRNA (Parker et al., 1995; Gustafson et al., 1996; Zhang et al., 1998; O’Donnell et al., 1999; Brumovsky et al., 2006a; Landry et al., 2006). It could thus be speculated that similar GalR1+ interneurons in the mouse may mediate an inhibitory effect on pain transmission (Pooga et al., 1998; Liu et al., 2001; see Liu and Ho¨kfelt, 2002), this effect being potentiated by the increased levels and release of galanin from GalOE unmyelinated C-type fibers. The most distinct behavioural phenotype seen in the GalOE mice studied here is the considerable reduction in the spinal sensitisation induced by the repetitive stimulation of C-type fibers (Grass et al., 2003). This modulation could be related to a direct action of galanin onto superficial glutamatergic GalR1+ dorsal horn neurons involved in pain transmission (so far only shown in rat) (Landry et al., 2006), mimicking the effects seen after intrathecal application of galanin (Wiesenfeld-Hallin et al., 1989a; Xu et al., 1990, 1991). A presynaptic blockade of the release of SP and CGRP (Xu et al., 1990; Hua et al., 2004), by activation of the GalR1 (Hua et al., 2004) may also be possible. In addition, the deep layers of the dorsal horn may be

influenced by increased galanin levels ectopically synthetized in large DRG neurons. In fact, in situ hybridization studies show many GalR1+ neurons also in deeper dorsal horn layers of rat (O’Donnell et al., 1999; Brumovsky et al., 2006a). Interestingly, spinothalamic tract cells located in deep layers, many being wide dynamic-range neurons with long dendritic projections into the superficial dorsal horn and potentially GalR1+ (Brumovsky et al., 2006a), were shown to receive myelinated primary afferent input from cutaneous and deep sources, as well as direct Ad-nociceptor and polysynaptic Cfiber input (see Craig, 2003), and are thought to have a fundamental role in flexor withdrawal mechanisms and somatomotor integration (Perl, 1984; Lundberg et al., 1987; Levinsson et al., 2000). In the present study, we have not tested the expression of galanin receptors in the DRGs and spinal cord of the GalOE mice. However, a ligand-dependent regulation of galanin receptor expression has recently been described in this mouse (Hohmann et al., 2003; He et al., 2005). Thus, up-regulation of GalR1 mRNA occurs in select nuclei of the hypothalamus and the CA1 region of the hippocampus (Hohmann et al., 2003; He et al., 2005). In contrast, the expression of GalR2 and -R3 remained unchanged (He et al., 2005). If a similar regulation is taking place in the GalOE mice analyzed here, is presently unknown.

P. Brumovsky et al. / Journal of Chemical Neuroanatomy 31 (2006) 243–262

259

Fig. 11. Immunofluorescence micrographs of transverse sections of the contra- (a and c) and ipsilateral (b and d) ventral horn of the spinal cord, after a 7-day axotomy of the sciatic nerve of GalOE (a and b) and WT (c and d) mice, and after incubation with galanin antiserum. Contralateral to the lesion, an abundant galanin+ neuropil is observed in the ventral horn of GalOE mice, which is much more sparse in WT mice (c). Ipsilateral to the axotomy both mice display an increased expression of galanin in several motoneurons but no certain change in fiber density (arrowheads in b, d). Scale bar: 100 mm (d = a–c).

5. Conclusions Our study provides further insight into the phenotype of the GalOE (DBH) mouse by mapping the expression of galanin in some peripheral nerve tissues and spinal cord related to pain mechanisms. Galanin’s involvement in nociception has been studied over the past 20 years, and some understanding has been achieved (see Xu et al., 2000; Wiesenfeld-Hallin and Xu, 2001; Liu and Ho¨kfelt, 2002; Holmes et al., 2005; Hua et al., 2005). The selective upregulation of galanin in certain DRG populations of the GalOE mouse studied here most likely leads to increased release of the peptide close to spinal neurons involved in processing of pain impulses, and may advance our understanding of the role of galanin in pain transmission (see Holmes et al., 2005; Wiesenfeld-Hallin et al., 2005). Finally, in addition to the spinal cord level, many rostral brain areas possibly overexpressing galanin could be involved in pain processing in the GalOE mouse. Thus, galanin has

antinociceptive actions in the midbrain periaqueductal gray matter and the hypothalamic arcuate nucleus of rats (Wang et al., 2000; Sun et al., 2003; Sun and Yu, 2005). Also, intrathecal galanin application in the tuberomammillary nucleus, the latter suggested to project towards the periaqueductal gray, induces antinociception (Sun et al., 2004). Taken together, these data suggest that the ‘protection’ against pain in the GalOE mice might be associated with ectopic galanin overexpression in DRGs, spinal cord, and/or several brain areas. Acknowledgments This study was supported by the Swedish Research Council (04X-2887), the Marianne and Marcus Wallenberg Foundation, the Knut and Alice Wallenberg Foundation, a Carrillo On˜ativia Grant and the Austral University. We are grateful for the ˚ man and to excellent technical assistance of the late Katarina A Dr. Jan Mulder for useful advice.

260

P. Brumovsky et al. / Journal of Chemical Neuroanatomy 31 (2006) 243–262

References Adams, J.C., 1992. Biotin amplification of biotin and horseradish peroxidase signals in histochemical stains. J. Histochem. Cytochem. 40, 1457–1463. Alvarez, F.J., Villalba, R.M., Zerda, R., Schneider, S.P., 2004. Vesicular glutamate transporters in the spinal cord, with special reference to sensory primary afferent synapses. J. Comp. Neurol. 472, 257–280. ¨ ., 1993. Galanin—A neuroendocrine peptide. Bartfai, T., Ho¨kfelt, T., Langel, U Curr. Rev. Neurobiol. 7, 229–274. Branchek, T., Smith, K.E., Walker, M.W., 1998. Molecular biology and pharmacology of galanin receptors. Ann. N.Y. Acad. Sci. 863, 94–107. Branchek, T.A., Smith, K.E., Gerald, C., Walker, M.W., 2000. Galanin receptor subtypes. Trends Pharmacol. Sci. 21, 109–117. Broman, J., Adahl, F., 1994. Evidence for vesicular storage of glutamate in primary afferent terminals. Neuroreport 5, 1801–1804. Broman, J., Anderson, S., Ottersen, O.P., 1993. Enrichment of glutamate-like immunoreactivity in primary afferent terminals throughout the spinal cord dorsal horn. Eur. J. Neurosci. 5, 1050–1061. Brumovsky, P., O’Donnell, D., Mennicken, F., Ho¨kfelt, T., 2006a. Localization of galanin receptors 1 and -2 in the spinal cord of rat—widespread distribution for galanin receptor 1. Brain Res., in press. Brumovsky, P., Villar, M.J., Ho¨kfelt, T., 2006b. Tyrosine hydroxilase is expressed in a subpopulation of small dorsal root ganglion neurons in the adult mouse. Exp. Neurol., in press. Ch’ng, J.L.C., Christofides, N.D., Anand, P., Gibson, S.J., Allen, Y.S., Su, H.C., Tatemoto, K., Morrison, J.F.B., Polak, J.M., Bloom, S.R., 1985. Distribution of galanin immunoreactivity in the central nervous system and responses of galanin-containing neuronal pathways to injury. Neuroscience 16, 343–354. Coons, A.H., 1958. Fluorescent antibody methods. In: Danielli, J.F. (Ed.), General Cytochemical Methods. Academic Press, New York, pp. 399–422. Corness, J., Shi, T.-J., Xu, Z.-Q., Brulet, P., Ho¨kfelt, T., 1996. Influence of leukemia inhibitory factor on galanin/GMAP and neuropeptide Y expression in mouse primary sensory neurons after axotomy. Exp. Brain Res. 112, 79–88. Counts, S.E., Perez, S.E., Ginsberg, S.D., De Lacalle, S., Mufson, E.J., 2003. Galanin in Alzheimer disease. Mol. Interv. 3, 137–156. Craig, A.D., 2003. Pain mechanisms: labeled lines versus convergence in central processing. Annu. Rev. Neurosci. 26, 1–30. Crawley, J.N., 1995. Biological actions of galanin. Regul. Pept. 59, 1–16. Crawley, J.N., Mufson, E.J., Hohmann, J.G., Teklemichael, D., Steiner, R.A., Holmberg, K., Xu, Z.Q., Blakeman, K.H., Xu, X.J., Wiesenfeld-Hallin, Z., Bartfai, T., Ho¨kfelt, T., 2002. Galanin overexpressing transgenic mice. Neuropeptides 36, 145–156. ˚ ., Friberg, K., Bean, A.J., Ho¨kfelt, T., 1992. Sensitive mRNA Dagerlind, A detection using unfixed tissue: combined radioactive and non-radioactive in situ hybridization histochemistry. Histochemistry 98, 39–49. De Biasi, S., Rustioni, A., 1990. Ultrastructural immunocytochemical localization of excitatory amino acids in the somatosensory system. J. Histochem. Cytochem. 38, 1745–1754. Flatters, S., Fox, A., Dickenson, A., 2002. Nerve injury induces plasticity that results in spinal inhibitory effects of galanin. Pain 98, 249–258. Flatters, S., Fox, A., Dickenson, A., 2003. In vivo and in vitro effects of peripheral galanin on nociceptive transmission in naive and neuropathic rats. Neuroscience 116, 1005–1012. Grass, S., Crawley, J.N., Xu, X.J., Wiesenfeld-Hallin, Z., 2003. Reduced spinal cord sensitization to C-fibre stimulation in mice over-expressing galanin. Eur. J. Neurosci. 17, 1829–1832. Gustafson, E.L., Smith, K.E., Durkin, M.M., Gerald, C., Branchek, T.A., 1996. Distribution of a rat galanin receptor mRNA in rat brain. Neuroreport 7, 953–957. Haycock, J.W., Waymire, J.C., 1982. Activating antibodies to tyrosine hydroxylase. J. Biol. Chem. 257, 9416–9423. He, B., Counts, S.E., Perez, S.E., Hohmann, J.G., Koprich, J.B., Lipton, J.W., Steiner, R.A., Crawley, J.N., Mufson, E.J., 2005. Ectopic galanin expression and normal galanin receptor 2 and galanin receptor 3 mRNA levels in the forebrain of galanin transgenic mice. Neuroscience 133, 371– 380.

Hohmann, J.G., Jureus, A., Teklemichael, D.N., Matsumoto, A.M., Clifton, D.K., Steiner, R.A., 2003. Distribution and regulation of galanin receptor 1 messenger RNA in the forebrain of wild type and galanin-transgenic mice. Neuroscience 117, 105–117. Holmberg, K., Kuteeva, E., Brumovsky, P., Kahl, U., Karlstro¨m, H., Lucas, G.A., Rodriguez, J., Westerblad, H., Hilke, S., Theodorsson, E., Berge, O.G., Lendahl, U., Bartfai, T., Ho¨kfelt, T., 2005. Generation and phenotypic characterization of a galanin over-expressing mouse. Focus on some peripheral systems and spinal cord. Neuroscience 133, 59–77. Holmes, F.E., Bacon, A., Pope, R.J., Vanderplank, P.A., Kerr, N.C., Sukumaran, M., Pachnis, V., Wynick, D., 2003. Transgenic overexpression of galanin in the dorsal root ganglia modulates pain-related behaviour. Proc. Natl. Acad. Sci. U.S.A. 100, 6180–6185. Holmes, F.E., Mahoney, S., Wynick, D., 2005. Use of genetically engineered transgenic mice to investigate the role of galanin in the peripheral nervous system after injury. Neuropeptides 39, 191–201. Hoyle, G.W., Mercer, E.H., Palmiter, R.D., Brinster, R.L., 1994. Cell-specific expression from the human dopamine beta-hydroxylase promoter in transgenic mice is controlled via a combination of positive and negative regulatory elements. J. Neurosci. 14, 2455–2463. Hua, X.Y., Hayes, C.S., Hofer, A., Fitzsimmons, B., Kilk, K., Langel, U., Bartfai, T., Yaksh, T.L., 2004. Galanin acts at GalR1 receptors in spinal antinociception: synergy with morphine and AP-5. J. Pharmacol. Exp. Ther. 308, 574–582. Hua, X.Y., Salgado, K.F., Gu, G., Fitzsimmons, B., Kondo, I., Bartfai, T., Yaksh, T.L., 2005. Mechanisms of antinociception of spinal galanin: how does galanin inhibit spinal sensitization? Neuropeptides 39, 211–216. Hughes, D.I., Polgar, E., Shehab, S.A., Todd, A.J., 2004. Peripheral axotomy induces depletion of the vesicular glutamate transporter VGLUT1 in central terminals of myelinated afferent fibres in the rat spinal cord. Brain Res. 1017, 69–76. Hygge-Blakeman, K., Brumovsky, P., Hao, J.X., Xu, X.J., Ho¨kfelt, T., Crawley, J.N., Wiesenfeld-Hallin, Z., 2004. Galanin over-expression decreases the development of neuropathic pain-like behaviors in mice after partial sciatic nerve injury. Brain Res. 1025, 152–158. Hygge-Blakeman, K., Hao, J.X., Xu, X.J., Jacoby, A.S., Shine, J., Crawley, J.N., Iismaa, T., Wiesenfeld-Hallin, Z., 2003. Hyperalgesia and increased neuropathic pain-like response in mice lacking galanin receptor 1 receptors. Neuroscience 117, 221–227. Hygge-Blakeman, K., Holmberg, K., Hao, J.X., Xu, X.J., Kahl, U., Lendahl, U., Bartfai, T., Wiesenfeld-Hallin, Z., Ho¨kfelt, T., 2001. Mice over-expressing galanin have elevated heat nociceptive threshold. Neuroreport 12, 423– 425. Ho¨kfelt, T., Arvidsson, U., Cullheim, S., Millhorn, D., Nicholas, A.P., Pieribone, V., Seroogy, K., Ulfhake, B., 2000. Multiple messengers in descending serotonin neurons: localization and functional implications. J. Chem. Neuroanat. 18, 75–86. Ho¨kfelt, T., Crawley, J.N. (Eds.), 2005. Neuropeptides. Special Issue on Galanin, vol. 39. Elsevier, pp. 125–362. Ho¨kfelt, T., Wiesenfeld-Hallin, Z., Villar, M.J., Melander, T., 1987. Increase of galanin-like immunoreactivity in rat dorsal root ganglion cells after peripheral axotomy. Neurosci. Lett. 83, 217–220. Iisma, T.P., Shine, J., 1999. Galanin and galanin receptors. Results Probl. Cell Differ. 26, 257–291. Kerekes, N., Mennicken, F., O’Donnell, D., Ho¨kfelt, T., Hill, R.H., 2003. Galanin increases membrane excitability and enhances Ca(2+) currents in adult, acutely dissociated dorsal root ganglion neurons. Eur. J. Neurosci. 18, 2957–2966. Kerr, B.J., Cafferty, B.W., Gupta, Y.K., Bacon, A., Wynick, D., McMohan, S.B., Thompson, S.W., 2000. Galanin knockout mice reveal nociceptive deficits following peripheral nerve injury. Eur. J. Neurosci. 12, 793–802. Landry, M., Bouali-Benazzouz, R., Andre´, C., Shi, T.J.S., Le´ger, C., Nagy, F., Ho¨kfelt, T., 2006. Galanin receptor 1 is expressed in a subpopulation of glutamatergic interneurons in the dorsal horn of the rat spinal cord. J. Comp. Neurol., submitted for publication. Landry, M., Bouali-Benazzouz, R., El Mestikawy, S., Ravassard, P., Nagy, F., 2004. Expression of vesicular glutamate transporters in rat lumbar spinal cord, with a note on dorsal root ganglia. J. Comp. Neurol. 468, 380–394.

P. Brumovsky et al. / Journal of Chemical Neuroanatomy 31 (2006) 243–262 Landry, M., Holmberg, K., Zhang, X., Ho¨kfelt, T., 2000. Effect of axotomy on expression of NPY, galanin, and NPY Y1 and Y2 receptors in dorsal root ganglia and the superior cervical ganglion studied with double-labeling in situ hybridization and immunohistochemistry. Exp. Neurol. 162, 361–384. Levinsson, A., Holmberg, H., Schouenborg, J., Seiger, A., Aldskogius, H., Kozlova, E.N., 2000. Functional connections are established in the deafferented rat spinal cord by peripherally transplanted human embryonic sensory neurons. Eur. J. Neurosci. 12, 3589–3595. Li, J.L., Fujiyama, F., Kaneko, T., Mizuno, N., 2003a. Expression of vesicular glutamate transporters, VGluT1 and VGluT2, in axon terminals of nociceptive primary afferent fibers in the superficial layers of the medullary and spinal dorsal horns of the rat. J. Comp. Neurol. 457, 236–249. Li, J.L., Xiong, K.H., Dong, Y.L., Fujiyama, F., Kaneko, T., Mizuno, N., 2003b. Vesicular glutamate transporters, VGluT1 and VGluT2, in the trigeminal ganglion neurons of the rat, with special reference to coexpression. J. Comp. Neurol. 463, 212–220. Liu, H.X., Brumovsky, P., Schmidt, R., Brown, W., Payza, K., Hodzic, L., Pou, C., Godbout, C., Ho¨kfelt, T., 2001. Receptor subtype-specific pronociceptive and analgesic actions of galanin in the spinal cord: selective actions via GalR1 and GalR2 receptors. Proc. Natl. Acad. Sci. U.S.A. 98, 9960–9964. Liu, H.X., Ho¨kfelt, T., 2002. The participation of galanin in pain processing at the spinal level. Trends Pharmacol. Sci. 23, 468–474. Lundberg, A., Malmgren, K., Schomburg, E.D., 1987. Reflex pathways from group II muscle afferents. 3. Secondary spindle afferents and the FRA: a new hypothesis. Exp. Brain Res. 65, 294–306. Ma, W., Bisby, M., 1997. Differential expression of galanin immunoreactivities in the primary sensory neurons following partial and complete sciatic nerve injuries. Neuroscience 79, 1183–1195. Mahoney, S.A., Hosking, R., Farrant, S., Holmes, F.E., Jacoby, A.S., Shine, J., Iismaa, T.P., Scott, M.K., Schmidt, R., Wynick, D., 2003. The second galanin receptor GalR2 plays a key role in neurite outgrowth from adult sensory neurons. J. Neurosci. 23, 416–421. Mazarati, A.M., Hohmann, J.G., Bacon, A., Liu, H., Sankar, R., Steiner, R.A., Wynick, D., Wasterlain, C.G., 2000. Modulation of hippocampal excitability and seizures by galanin. J. Neurosci. 20, 6276–6281. McMahon, S.B., Priestley, J.V., 2005. Nociceptor plasticity. In: Hunt, S.P., Koltzenburg, M. (Eds.), The Neurobiology of Pain. Oxford University Press, pp. 35–64. ˚ ., 1986. Distribution of galanin-like Melander, T., Ho¨kfelt, T., Ro¨kaeus, A immunoreactivity in the rat central nervous system. J. Comp. Neurol. 248, 475–517. Mercer, E.H., Hoyle, G.W., Kapur, R.P., Brinster, R.L., Palmiter, R.D., 1991. The dopamine beta-hydroxylase gene promoter directs expression of E. coli lacZ to sympathetic and other neurons in adult transgenic mice. Neuron 7, 703–716. Merchenthaler, I., Lopez, F.J., Negro-Vilar, A., 1993. Anatomy and physiology of central galanin-containing pathways. Prog. Neurobiol. 40, 711–769. Merighi, A., Polak, J.M., Theodosis, D.T., 1991. Ultrastructural visualization of glutamate and aspartate immunoreactivities in the rat dorsal horn, with special reference to the co-localization of glutamate, substance P and calcitonin-gene related peptide. Neuroscience 40, 67–80. Miyazaki, T., Fukaya, M., Shimizu, H., Watanabe, M., 2003. Subtype switching of vesicular glutamate transporters at parallel fibre-Purkinje cell synapses in developing mouse cerebellum. Eur. J. Neurosci. 17, 2563–2572. Nahin, R.L., Ren, K., De Leon, M., Ruda, M., 1994. Primary sensory neurons exhibit altered gene expression in a rat model of neuropathic pain. Pain 58, 95–108. Nakamura, K., Wu, S.X., Fujiyama, F., Okamoto, K., Hioki, H., Kaneko, T., 2004. Independent inputs by VGLUT2- and VGLUT3-positive glutamatergic terminals onto rat sympathetic preganglionic neurons. Neuroreport 15, 431–436. O’Donnell, D., Ahmad, S., Wahlestedt, C., Walker, P., 1999. Expression of the novel galanin receptor subtype GALR2 in the adult rat CNS: distinct distribution from GALR1. J. Comp. Neurol. 409, 469–481. Oliveira, A.L., Hydling, F., Olsson, E., Shi, T., Edwards, R.H., Fujiyama, F., Kaneko, T., Ho¨kfelt, T., Cullheim, S., Meister, B., 2003. Cellular localization of three vesicular glutamate transporter mRNAs and proteins in rat spinal cord and dorsal root ganglia. Synapse 50, 117–129.

261

Orazzo, C., Pieribone, V.A., Ceccatelli, S., Terenius, L., Ho¨kfelt, T., 1993. CGRPlike immunoreactivity in A11 dopamine neurons projecting to the spinal cord and a note on CGRP-CCK cross-reactivity. Brain Res. 600, 39–48. Parker, E.M., Izzarelli, D.G., Nowak, H.P., Mahle, C.D., Iben, L.G., Wang, J., Goldstein, M.E., 1995. Cloning and characterization of the rat GALR1 galanin receptor from Rin14B insulinoma cells. Mol. Brain Res. 34, 179–189. Pease, P.C., 1962. Buffered formaldehyde as a killing agent and primary fixative for electron microscopy. Anat. Rec. 142, 342. Perl, E.R., 1984. Pain and Nociception. In: Darian-Smith, I. (Ed.), Handbook of Physiology, Section I, The Nervous System, Sensory Processes. vol. III. American Physiol Society, Bethesda, pp. 915–975. Pooga, M., Soomets, U., Ha¨llbrink, M., Valkan, A., Saar, K., Rezaei, K., Kahl, U., Hao, J.-X., Xu, X.-J., Wiesenfeld-Hallin, Z., Ho¨kfelt, T., Bartfai, T., ¨ ., 1998. Cell penetrating PNA constructs regulate galanin receptor Langel, U levels and modify pain transmission in vivo. Nat. Biotech. 16, 857–861. Price, J., Mudge, A., 1983. A subpopulation of rat dorsal root ganglion neurons is catecholaminergic. Nature 301, 241–243. Robinson, J.K., 2004. Galanin and cognition. Behav. Cogn. Neurosci. Rev. 3, 222–242. ˚ ., Melander, T., Ho¨kfelt, T., Lundberg, J.M., Tatemoto, K., Carlquist, Ro¨kaeus, A M., Mutt, V., 1984. A galanin-like peptide in the central nervous system and intestine of the rat. Neurosci. Lett. 47, 161–166. Shi, T.-J., Cui, J.-G., Meyerson, B.A., Linderoth, B., Ho¨kfelt, T., 1999. Regulation of galanin and neuropeptide Y in dorsal root ganglia and dorsal horn in rat mononeuropathic models: Possible relation to tactile hypersensitivity. Neuroscience 93, 741–757. Shi, T.-J., Zhang, X., Berge, O.-G., Erickson, J., Palmiter, R., Ho¨kfelt, T., 1998. Effect of peripheral axotomy on dorsal root ganglion neuron phenotype and autotomy behavior in neuropeptide Y-deficient mice. Reg. Peptides 75-76, 161–173. Shi, T.J.S., Zhang, X., Holmberg, K., Xu, Z.Q., Ho¨kfelt, T., 1997. Expression and regulation of galanin-R2 receptors in rat primary sensory neurons: effect of axotomy and inflammation. Neurosci. Lett. 237, 57–60. Simmons, D.R., Spike, R.C., Todd, A.J., 1995. Galanin is contained in GABAergic neurons in the rat spinal dorsal horn. Neurosci. Lett. 187, 119–122. Skofitsch, G., Jacobowitz, D.M., 1985. Galanin-like immunoreactivity in capsaicin sensitive sensory neurons and ganglia. Brain Res. Bull. 15, 191–195. Steinbusch, H.W.M., Verhofstad, A.A.J., Joosten, H.W.J., 1983. Antibodies to serotonin for neuroimmunocytochemical studies: methodological aspects and applications. In: Cuello, A.C. (Ed.), Immunohistochemistry IBRO Handbook Series. Wiley, Chichester, pp. 193–214. Steiner, R.A., Hohmann, J.G., Holmes, A., Wrenn, C.C., Cadd, G., Jureus, A., Clifton, D.K., Luo, M., Gutshall, M., Ma, S.Y., Mufson, E.J., Crawley, J.N., 2001. Galanin transgenic mice display cognitive and neurochemical deficits characteristic of Alzheimer’s disease. Proc. Natl. Acad. Sci. U.S.A. 98, 4184–4189. Sukumaran, M., Waxman, S.G., Wood, J.N., Pachnis, V., 2001. Flanking regulatory sequences of the locus encoding the murine GDNF receptor, c-ret, directs lac Z (beta-galactosidase) expression in developing somatosensory system. Dev. Dyn. 222, 389–402. Sun, Y.G., Gu, X.L., Lundeberg, T., Yu, L.C., 2003. An antinociceptive role of galanin in the arcuate nucleus of hypothalamus in intact rats and rats with inflammation. Pain 106, 143–150. Sun, Y.G., Li, J., Yang, B.N., Yu, L.C., 2004. Antinociceptive effects of galanin in the rat tuberomammillary nucleus and the plasticity of galanin receptor 1 during hyperalgesia. J. Neurosci. Res. 77, 718–722. Sun, Y.G., Yu, L.C., 2005. Interactions of galanin and opioids in nociceptive modulation in the arcuate nucleus of hypothalamus in rats. Regul. Pept. 124, 37–43. Theodorsson, E., Rugarn, O., 2000. Radioimmunoassay for rat galanin: immunochemical and chromatographic characterization of immunoreactivity in tissue extracts. Scand. J. Clin Lab. Invest 60, 411–418. Todd, A.J., Hughes, D.I., Polgar, E., Nagy, G.G., Mackie, M., Ottersen, O.P., Maxwell, D.J., 2003. The expression of vesicular glutamate transporters VGLUT1 and VGLUT2 in neurochemically defined axonal populations in the rat spinal cord with emphasis on the dorsal horn. Eur. J. Neurosci. 17, 13–27.

262

P. Brumovsky et al. / Journal of Chemical Neuroanatomy 31 (2006) 243–262

Todd, A.J., Spike, R.C., Price, R.F., Neilson, M., 1994. Immunocytochemical evidence that neurotensin is present in glutamatergic neurons in the superficial dorsal horn of the rat. J. Neurosci. 14, 774–784. Valtschanoff, J.G., Phend, K.D., Bernardi, P.S., Weinberg, R.J., Rustioni, A., 1994. Amino acid immunocytochemistry of primary afferent terminals in the rat dorsal horn. J. Comp. Neurol. 346, 237–252. Vega, J.A., Amenta, F., Hernandez, L.C., del Valle, M.E., 1991. Presence of catecholamine-related enzymes in a subpopulation of primary sensory neurons in dorsal root ganglia of the rat. Cell Mol. Biol. 37, 519–530. Villar, M.J., Corte´s, R., Theodorsson, E., Wiesenfeld-Hallin, Z., Schalling, M., Fahrenkrug, J., Emson, P.C., Ho¨kfelt, T., 1989. Neuropeptide expression in rat dorsal root ganglion cells and spinal cord after peripheral nerve injury with special reference to galanin. Neuroscience 33, 587–604. Vrontakis, M.E., 2002. Galanin: a biologically active peptide. Curr Drug Targets CNS Neurol Disord. 1, 531–541. Wang, D., Lundeberg, T., Yu, L.C., 2000. Antinociceptive role of galanin in periaqueductal grey of rats with experimentally induced mononeuropathy. Neuroscience 96, 767–771. Waters, S.M., Krause, J.E., 2000. Distribution of galanin-1, -2 and -3 receptor messenger RNAs in central and peripheral rat tissues. Neuroscience 95, 265– 271. Weil-Fugazza, J., Onteniente, B., Audet, G., Philippe, E., 1993. Dopamine as trace amine in the dorsal root ganglia. Neurochem. Res. 18, 965–969. Wiesenfeld-Hallin, Z., Villar, M.J., Ho¨kfelt, T., 1989a. The effects of intrathecal galanin and C-fiber stimulation on the flexor reflex in the rat. Brain Res. 486, 205–213. Wiesenfeld-Hallin, Z., Xu, X.J., 2001. Neuropeptides in neuropathic and inflammatory pain with special emphasis on cholecystokinin and galanin. Eur. J. Pharmacol. 429, 49–59. Wiesenfeld-Hallin, Z., Xu, X.J., Crawley, J.N., Ho¨kfelt, T., 2005. Galanin and spinal nociceptive mechanisms: recent results from transgenic and knockout models. Neuropeptides 39, 207–210. Wiesenfeld-Hallin, Z., Xu, X.J., Villar, M.J., Ho¨kfelt, T., 1989b. The effect of intrathecal galanin on the flexor reflex in rat: increased depression after sciatic nerve section. Neurosci. Lett. 105, 149–154.

Wrenn, C.C., Marriott, L.K., Kinney, J.W., Holmes, A., Wenk, G.L., Crawley, J.N., 2002. Galanin peptide levels in hippocampus and cortex of galaninoverexpressing transgenic mice evaluated for cognitive performance. Neuropeptides 36, 413–426. Wynick, D., Bacon, A., 2002. Targeted disruption of galanin: new insights from knock-out studies. Neuropeptides 36, 132–144. Wynick, D., Thompson, S.W., McMahon, S.B., 2001. The role of galanin as a multi-functional neuropeptide in the nervous system. Curr. Opin. Pharmacol. 1, 73–77. Xu, X.-J., Wiesenfeld-Hallin, Z., Villar, M.J., Fahrenkrug, J., Ho¨kfelt, T., 1990. On the role of galanin, substance P and other neuropeptides in primary sensory neurons of the rat: studies on spinal reflex excitability and peripheral axotomy. Eur. J. Neurosci. 2, 733–743. Xu, X.J., Ho¨kfelt, T., Bartfai, T., Wiesenfeld-Hallin, Z., 2000. Galanin and spinal nociceptive mechanisms: recent advances and therapeutic implications. Neuropeptides 34, 137–147. Xu, X.J., Wiesenfeld-Hallin, Z., Ho¨kfelt, T., 1991. Intrathecal galanin blocks the prolonged increase in spinal cord flexor reflex excitability induced by conditioning stimulation of unmyelinated muscle afferents in the rat. Brain Res. 541, 350–353. Xu, Z.-Q., Shi, T.-J., Landry, M., Ho¨kfelt, T., 1996. Evidence for galanin receptors in primary sensory neurones and effect of axotomy and inflammation. NeuroReport 8, 237–242. Zamboni, I., De Martino, C., 1967. Buffered picric acid formaldehyde. A new rapid fixative for electron microscopy. J. Cell Biol. 35, 148A. Zhang, X., Bean, A.J., Wiesenfeld-Hallin, Z., Ho¨kfelt, T., 1995. Ultrastructural studies on peptides in the dorsal horn of the rat spinal cord. IV. Effects of peripheral axotomy with special reference to neuropeptide Y and vasoactive intestinal polypeptide/peptide histidine isoleucine. Neuroscience 64, 917– 941. Zhang, X., Xu, Z.-Q., Shi, T.-J., Landry, M., Holmberg, K., Ju, G., Tong, Y.-G., Bao, L., Cheng, X.-P., Wiesenfeld-Hallin, Z., Lozano, A., Dostrovsky, J., Ho¨kfelt, T., 1998. Regulation of expression of galanin and galanin receptors in dorsal root ganglia and spinal cord after axotomy and inflammation. Ann. N.Y. Acad. Sci. 863, 402–413.