- Email: [email protected]
Phenylalanine to leucine point mutation in oxyanion hole improved catalytic efficiency of Lip12 from Yarrowia lipolytica
Enzyme and Microbial Technology 53 (2013) 386–390
Contents lists available at ScienceDirect
Enzyme and Microbial Technology journal homepage: www.elsevier.com/locate/emt
Phenylalanine to leucine point mutation in oxyanion hole improved catalytic efficiency of Lip12 from Yarrowia lipolytica Arti Kumari, Rani Gupta ∗ Department of Microbiology, University of Delhi South Campus, New Delhi 110021, India
a r t i c l e
i n f o
Article history: Received 1 April 2013 Received in revised form 12 August 2013 Accepted 21 August 2013 Keywords: Yarrowia lipolytica Lipase Oxyanion hole Catalytic efficiency Differential activation energy
a b s t r a c t In lipases, oxyanion hole has crucial role in the stabilisation of enzyme–substrate complex. Majority of lipases from Yarrowia lipolytica consist of two oxyanion hole residues viz.; Thr and Leu. However, Lip12 has Phe instead of Leu at second oxyanion hole residue. It was observed that Lip12 has lower specific activity and catalytic efficiency than other lipases of Yarrowia. In silico analysis of Phe to Leu mutation revealed improved binding energy of Lip12 for p-np palmitate. This was validated by Phe148 to Leu point mutation where, specific activity of mutant was 401 U/mg on olive oil, which was two fold higher in comparison to wild-type. Kcat , remained unaltered, while decrease in Km was predominant for all the substrates used in the study. Improved catalytic efficiency of mutant was a function of chain length in case of p-np esters, with 73% improvement for p-np stearate. However, hydrolysis of triacylglycerides improved by 20%, irrespective of chain length. Decrease in activation energy for all the substrates, was observed in mutant in comparison to wild-type, indicating better stabilisation of transition state complex. Further, unaltered differential activation energy for mutant depicts that substrate specificity of enzyme remained same after mutation. © 2013 Elsevier Inc. All rights reserved.
1. Introduction Lipases are triacylglycerol hydrolases of serine hydrolase group with E.C 3.1.1.3 [1]. These enzymes are composed of Ser-HisAsp triad [2]. Serine is present in lipid contact zone in elongated hydrophobic binding-pocket. The active-site serine is a part of GXSXG penta peptide, which is conserved in most of the lipases, whereas His and Asp are present at variable positions. There is a formation of tetrahedral complex during catalysis which is stabilised by oxyanion hole residues [3]. The mechanism of hydrolysis of substrate by lipase begins with the deprotonation of serine for which histidine and aspartate are required [4]. Hence, nucleophilicity of hydroxyl residue of serine increases and attacks on the carboxyl group of the substrate leading to the formation of acyl-enzyme intermediate, which is stabilised by oxyanion hole residues [4]. The first residue of oxyanion hole is present near N-terminal, it is well conserved among most of the lipase families with the three consensus sequences viz.; GX, GGGX and Y [4,5]. Most of the fungal lipases have conserved GX sequence, while GGGX and Y is present in carboxylesterase and esterases respectively. The second residue of the oxyanion hole is present in the signature sequence of lipase
i.e. GXSXG [5]. For most of the fungal lipases like Rhizomucor, Saccharomyces and Yarrowia lipases it was found to be “GHSLG”, where Leu is second oxyanion hole residue [5]. Yarrowia produces as many as 16 lipases [6]. Of them only eight have been biochemically characterised namely Lip2, Lip7, Lip8, Lip9, Lip11, Lip12, Lip14 and Lip18 [6–9]. In our previous study it was found that all these lipases have Leu as a second oxyanion hole residue except Lip12, where Leu is replaced by Phe [8]. Lip12 was found to be short to mid chain specific and had lower catalytic efficiency than other reported lipases from Yarrowia [8]. In this respect, the present study focuses to provide the molecular explanation for Phe to Leu point mutation at oxyanion hole of Lip12. Major focus will be on the catalytic efficiency and substrate specificity. The orientation of protein–substrate complex was studied by docking analysis, which allow to predict the effect of point mutation on substrate binding and hence on kinetic parameters of the enzyme. This was experimentally validated by site-directed mutagenesis. 2. Materials and methods 2.1. Material
∗ Corresponding author. Tel.: +91 11 24111933; fax: +91 11 24115270. E-mail addresses: [email protected], [email protected] (R. Gupta). 0141-0229/$ – see front matter © 2013 Elsevier Inc. All rights reserved. http://dx.doi.org/10.1016/j.enzmictec.2013.08.004
X-Gal, isopropyl -d-thio-galactopyranoside (IPTG) from Sigma–Aldrich (USA). IgG sepharose purchased from G-Bioseciences, USA. p-nitrophenyl esters, triacylglycerides were purchased from Sigma. Genomic DNA was isolated by conventional method. Plasmid extraction and gel elution were performed using the mini prep and gel elution kits purchased from Qiagen, Hilden, Germany. LB broth (10 g of tryptone,
A. Kumari, R. Gupta / Enzyme and Microbial Technology 53 (2013) 386–390
387
5 g of yeast extract, and 10 g of NaCl per litre, pH 7.0; Hi-media), ampicillin from Hi-media. 2.2. Site-directed mutagenesis Site-directed mutagenesis was carried out in pEZZ18-lip12 harboured in E. coli HB101 [8], using the kit Quick ChangeTM Site-Directed Mutagenesis kit (Stratagene). Primer sequences were as follows: Flip12L forward: GTTACAGGCCATTCTCTTGGTGGAGCGTCA; Tm = 74.0 ◦ C Flip12L reverse: TGACGCTCCACCAAGAGAATGGCCTGTAAC; Tm = 74.0 ◦ C Polymerase chain reaction (PCR) was setup using pEZZ18-lip12 recombinant plasmid according to manufacturer’s instruction. PCR products were digested with the Dpn I, to remove methylated parental plasmid and mutated plasmid was transformed into E. coli XL-10 cells. Colonies obtained were grown in LB media supplemented with 0.1 mM ampicillin and plasmids were isolated. The positive clones were sequenced at Central Instrumental Facility (CIF), University of Delhi South Campus, New Delhi.
Fig. 1. Alignment of oxyanion hole residues of different lipases from Yarrowia lipolytica using ClustalW. Sequence of lipases was taken from Genolevures consortium where gene I.D YALI0A20350g, YALI0D09064g, YALI0D15906g, YALI0D19184g, YALI0B09361g, YALI0B1185g, YALI0D18480g and YALI0B20350g corresponds to Lip2, Lip11, Lip12, Lip7, Lip8, Lip14, Lip9 and Lip18, respectively.
2.3. Expression and purification Mutated plasmids were then transformed in expression host, E. coli HB101. Mutant protein was purified by IgG-sepharose as describe earlier [8,9].
oil, olive oil, neem oil, karanja oil, cotton seed oil, groundnut oil, sunflower oil and mustard oil. Emulsions were prepared in 50 mM citrate-phosphate buffer pH 7.0 using 2% gum acacia. The reaction was carried out as described earlier [9].
2.4. Activity assays
2.6. Sequence and structure inspection
Lipase activity was determined by spectrophotometric p-nitrophenyl palmitate assay [10] and confirmed by titrimetry [11] using 10% (v/v) olive oil as substrate at pH 7 and 40 ◦ C. One international unit of lipase was defined as the amount of enzyme required to release 1 mole of p-nitrophenol or fatty acid, respectively, per ml per min. The total protein was estimated by Bradford assay using Bovine serum albumin (BSA) as the standard protein.
Multiple sequence alignment was performed by using ClustalW [14]. Homology models for wild-type and mutant (F148L) Lip12 were build by using Lip2 (3O0D) as template and modeller 9.10 as tool [8]. PDB for p-np palmitate was generated from PRODRG (http://davapc1.bioch.dundee.ac.uk/prodrg/). Docking with p-np palmitate was performed using Patch Dock tool (http://bioinfo3d.cs.tau.ac.il/PatchDock/). 2.7. Statistical analysis
2.5. Characterisation of mutated lipase Temperature optima of mutated lipase was studied by incubating the reaction mixture at different temperatures ranges from 30 ◦ C to 70 ◦ C at pH 7.0 as describe earlier [9]. Kinetic parameters were determined using different p-np esters and triacylglycerides with varying concentrations. Km and Vmax were calculated using Lineweaver–Burk plot as well as by Eadie–Hofstee plot (v vs. v/[S]) both. Kcat was calculated using standard formula Vmax /Et . Catalytic efficiency was calculated by Kcat /Km . The activation energy for enzyme catalysed reactions was calculated using [12]:
G# = −RT × ln
Kcat Km
The substrate specificity of the wild-type and mutant was compared by the differential activation energy which was calculated as follows [13] mut−wt S1−S2 G# = −RT × In
(((Kcat /Km )S1 )/(Kcat /Km )S2 )mut
All the above experiments were done in triplicate and the final values have been presented as mean ± standard deviation.
3. Results 3.1. Sequence analysis Multiple sequence alignment of Lip2, Lip 7, Lip8, Lip9, Lip11, Lip12 shows that Thr which is first oxyanion hole residue of all the lipases is well conserved and defines the category of GX type consensus. The second residue was found in the lipase signature sequence GHSLG, where Lip12 has Phe 148 instead of Leu (Fig. 1). 3.2. Structure analysis
(((Kcat /Km )S1 )/(Kcat /Km )S2 )wt
where S1 and S2 are different substrate used. Substrate specificity of lipases for oils was checked by using 10% oil emulsions viz.; coconut oil, corn oil, linseed
Docking of wild-type and mutant Lip12 was performed with pnp palmitate. This gave various binding styles and energy, which
Table 1 Comparison of kinetic parameters of different triacylglycerides (A) and p-np esters (B). (See supplementary data S1a, b, c and S2a, b and c). Kinetic parameter
C10 Wild
A Kcat (S−1 ) × 104 Km (mM)
3.1 ± 0.3 2.4 ± 0.1
Kcat /Km × 104 (S−1 mM1 )
1.3
B Kcat (S−1 ) × 103 Km (mM)
2.0 ± 0.3 5.8 ± 0.2
Kcat /Km × 104 (S−1 mM−1 )
3.44
Cl6 Mutant 2.7 ± 0.2 1.7 ± 0.1 1.59
2.1 ± 0.4 5.4 ± 0.1 3.88
Wild
C18
Inference
Mutant
Wild
Mutant
8.4 ± 0.5 3.7 ± 0.3
8.2 ± 0.4 3.3 ± 0.2
11.2 ± 0.3 5.1 ± 0.4
10.8 ± 0.4 4.0 ± 0.2
2.3
2.5
28.3 ± 0.4 11.28 ± 0.4 2.52
28.9 ± 0.4 8.6 ± 0.3 3.4
2.2
2.7
3.7 ± 0.3 38.0 ± 0.5
3.7 ± 0.2 22.0 ± 0.3
0.98
1.69
No change Decrease in Km for all triacylglycerides Increase in catalytic efficiency of triacylglycerides by approximately 20% No change Decrease in Km for all p-np esters Increase in catalytic efficiency by 7%, 36% and 73% for C10 , C16 and C18 respectively
388
A. Kumari, R. Gupta / Enzyme and Microbial Technology 53 (2013) 386–390
Fig. 2. Docking analysis of Lip12 representing binding mode of p-np palmitate inside the cavity (a) wild-type and (b) mutant. (a) p-npp (black) is shown to be held by four hydrogen bonds, namely: One each with Tyr 79, His146 and two with Thr82. (b) p-npp (black) is shown to be held by six hydrogen bonds, namely: one each with Leu148, His146, Asn14 and Ser284 and two with Gly 77.
was visually analysed on the basis of following parameters: (1) Localisation of hydroxyl group with respect to the region comprised between histidine and serine residues present in the catalytic triad. (2) Proximity of oxyanion hole residues with the complex [15]. Only one combination each from mutant and wild-type suited this criteria depicted in Fig. 2a and b. It is clear from Fig. 2a and b that substrate showed better alignment with mutant having six hydrogen bonds; two with Gly 77, one each with Leu 148, His 146, Asn 14 and Ser 284, whereas only four hydrogen bond were observed
with wild-type i.e., two with Thr 82, one each with Tyr 79 and His 146 (Fig. 2). 3.3. Kinetic analysis of mutant vs wild-type Temperature optima of mutated lipases was found to be same as that of wild-type i.e. 40 ◦ C [8]. However, there were significant changes in the kinetic parameters of the mutated enzyme, which are depicted in Table 1a and b (S1a, b and c; S2a, b and c). Kinetic
A. Kumari, R. Gupta / Enzyme and Microbial Technology 53 (2013) 386–390
389
Fig. 3. Activation energy of wild-type and mutant for the hydrolysis of p-np esters and triacylglycerides. Numerals written on the top of the bars indicate difference in activation energy of wild-type and mutant (KJ/moles).
parameters with respect to p-np esters showed that there was lowering of Km , this lowering was a function of chain length. The maximum lowering was reported in case of C18 where Km lowered from 38.0 mM to 22.0 mM, followed by C16 with Km 11.0 mM to 8.6 mM and for C10 it decreased from 5.8 to 5.4. Likewise, catalytic efficiency was much improved for p-np esters with maximum upsurge of 73% for p-np stearate followed by 36 and 7.5% enhancement for C16 and C10 , respectively. In case of triacylglycerides, Km for C10 , C16 and C18 was lowered from 2.4 mM to 1.7 mM; 3.7 mM to 3.3 mM and 5.1 mM to 4.0 mM, respectively. Catalytic efficiency of mutant for each substrate was improved by nearly 20% with that of wild-type. Further, −G# (activation energy) was calculated to determine the changes in transition state stabilisation. Decrease in activation energy of mutant for, p-np esters and triacylglycerides, is in agreement with the stabilisation of transition state in the mutant (Fig. 3). Difference in activation energy of wild-type and mutant for p-np esters increased in the order C18 > C16 > C10 while for, triaclyglycerides the difference was again irrespective of chain length. In order to study the substrate specificity, differential activation energy for p-np esters and triaclyglycerides was calculated. It was found that there was not much change in the differential energy of wild-type and mutant for various substrates used in the study. This suggested that there was no alteration in the substrate specificity of lipase. This was confirmed by substrate specificity towards different oils (Table 2). It can be observed that though
Table 2 Substrate specificity of wild-type and mutant enzymes on various oils. Oils
Enzyme activity (U/mg) Wild-type
Coconut oil Corn oil Lenseed oil Olive oil Neem oil Karanja oil Cotton seed oil Groundnut oil Sunflower oil Mustard oil
279.2 267.3 237.0 198.2 180.2 140.6 136.6 124.7 94.0 79.2
± ± ± ± ± ± ± ± ± ±
3.4 4.1 5.1 2.6 4.3 1.9 2.1 3.8 4.9 2.9
Fold enhancement
Mutant 649.6 657.7 449.1 401.0 405.0 345.1 317.0 306.9 200.9 180.4
± ± ± ± ± ± ± ± ± ±
6.1 4.2 3.7 2.9 3.1 2.4 3.5 4.5 3.8 2.9
2.3 2.4 1.8 2.0 2.2 2.4 2.3 2.4 2.1 2.2
there was nearly 2–2.4 fold enhancement in the specific activity of the mutated enzyme as compared to wild-type for each of the oil, but hydrolysis pattern for oils by wild-type and mutant was similar i.e., coconut oil > corn oil > linseed oil > olive oil > neem oil > karanja oil > cotton seed oil > groundnut oil > sunflower oil > mustered oil. 4. Discussion The biochemical properties of all the enzymes depend on the amino acid sequences and architecture of the enzyme. These factors are responsible for protein’s interaction with their respective substrate. However, only few residues present in the oxyanion hole and catalytic centre of the enzyme interact with the substrate and catalyse the reaction. In case of lipases, there are two residues of oxyanion hole which are responsible for the stabilisation of the enzyme–substrate complex [3]. Literature suggested that most of the yeast lipases come under the GX class of lipases, where first amino acid of oxyanion hole is present near the N-terminal end of the primary sequence, which could be serine or threonine [5]. The conserved second oxyanion hole residue is located in the signature sequence “GXSXG” of lipases. The multiple sequence alignment of lipases from Yarrowia revealed that all lipases reported from Yarrowia have threonine as their first and leucine as second oxyanion residues, except Lip12 where Leu is replaced by Phe (Fig. 1). In our previous study it was found that Lip12 has relatively lower specific activity and catalytic efficiency than other lipase [8]. In this reference, in silico F148L point mutation on Lip12, was obtained and homology model for the mutant was developed. The docking study revealed that p-np palmitate was better stabilised in the mutant than in wild-type protein. There were prominent two hydrogen bonds with catalytic serine, which was not in wild-type enzyme. This suggested that the present point mutation would lead to some conformational changes in the protein for better substrate binding. Experimental data substantiate in silico findings where nearly 2 fold enhanced specific activity was obtained in case of mutant enzyme during the hydrolysis of oils. Likewise, catalytic efficiency for p-np esters and triacylglycerides was significantly improved. The F148L point mutation led to improved substrate binding as evident by lowering of Km for each of the substrates. However, a noteworthy observation was that in case of p-np esters, where
390
A. Kumari, R. Gupta / Enzyme and Microbial Technology 53 (2013) 386–390
high catalytic efficiency was a function of chain length and significant increase was observed in case of C16 and C18. This can be explained by the fact that phenylalanine being a bulky molecule will create hindrance in substrate acquisition of longer fatty acid esters in case of wild-type protein and there by its replacement with leucine led to improved substrate binding. This is in confirmation with the earlier report on Geobacillus zalihae where presence of bulky group like; Phe and Trp were responsible for inferior enzyme characteristics [16]. In addition, the activation energy of mutant was again lowered in comparison to wild-type. This further supports that not only binding has improved in mutant but also, there was better stabilisation of transition state complex. The chemistry of leucine also suggests that it has multiple ionisable hydrogen atoms in comparison to phenylalanine, which are required during the stabilisation of enzyme–substrate complex. In addition to this, leucine and phenylalanine have comparable hydrophobicity, however phenylalanine is more sterically hindered in comparison to leucine. This is evident from higher difference in activation energy of mutant and wild-type enzyme for the longer fatty acid esters. This is in confirmation with the similar report on proteases from NS2B-NS2 virus where mutant having leucine at oxyanion hole had lower Km and high catalytic efficiency in comparison to other mutant [17]. 5. Conclusion Second oxyanion hole residue present in signature sequence GXSXG was distinctly different as Phe 148 in Lip12 in compare to Leu in Lip2 and all other functionally characterised Y. lipolytica lipases. Docking analysis indicated its influence on substrate binding and hence on catalytic efficiency. It was experimentally validated, where improved specific activity and catalytic efficiency were observed when Phe 148 was replaced by Leu in Lip12 by site-directed mutagenesis. However, this mutation did not change substrate specificity. Finally, overall study concluded that, phenylalanine being a bulky amino acid is not a good stabiliser of the enzyme–substrate complex as compared to leucine. Acknowledgments Council of Scientific and Industrial Research and R & D grant from Delhi University, India are duly acknowledged for financial assistance. Author would like to acknowledge Mr. Ved Vrat Verma PhD. Scholar University of Delhi South Campus for assisting in bioinformatics work.
Appendix A. Supplementary data Supplementary data associated with this article can be found, in the online version, at http://dx.doi.org/10.1016/j.enzmictec. 2013.08.004. References [1] Bordes F, Barbe S, Escalie P, Mourey L, Andre I, Marty A, et al. Exploring the conformational states and rearrangements of Yarrowia lipolytica Lipase. Biophys J 2010;99:2225–34. [2] Joseph B, Ramteke PW, Thomas G. Cold active microbial lipases: some hot issues and recent developments. Biotechnol Adv 2008;26:457–70. [3] Pleiss J, Fischer M, Peiker M, Thiele C, Schmid RD. Lipase engineering database: understanding and exploiting sequence–structure–function relationships. J Mol Catal B 2000;10:491–508. [4] Pleiss J, Fischer M, Schimid RD. Anatomy of lipase binding sites: the scissile fatty acid binding site. Chem Phys Lipids 1998;93:67–80. [5] Beer HD, Wohlfahrt G, McCarthy JEG, Schomburg D, Schmid RD. Analysis of the catalytic mechanism of a fungal lipase using computer-aided design and structural mutants. Protein Eng 1996;9:507–17. [6] Fickers P, Marty A, Nicaud TM. The lipases from Yarrowia lipolytica: genetics, production, regulation, biochemical characterization and biotechnological applications. Biotechnol Adv 2011;29:632–44. [7] Zhao H, Zheng L, Wang X, Liu Y, Xu L, Yan Y. Cloning, expression and characterization of new lipases from Yarrowia lipolytica. Biotechnol Lett 2011;33:2445–52. [8] Kumari A, Gupta R. Comparative biochemical characterization and in-silico analysis of novel lipases Lip11 and Lip12 with Lip2 from Yarrowia lipolytica. World J Microbiol Biotechnol 2012;28:3103–11. [9] Kumari A, Gupta R. Extracellular expression and characterisation of thermostable Lip8, Lip14 and Lip18 from Yarrowia lipolytica. Biotechnol Lett 2012;34:1733–9. [10] Wrinkler UK, Stuckman M. Glycogen, hyaluronate and some other polysaccharides greatly enhance the formation of exolipase by Serratia marcescens. J Bacteriol 1979;138:663–79. [11] Naka Y, Nakamura T. The effect of serum albumin and related amino acid on pancreatic lipase and biles salts inhibited microbial lipases. Biosci Biotechnol Biochem 1992;56:1066–70. [12] Zheng F, Yang W, Xeu L, Hou S, Liu J, Zhan CG. Design of high-activity mutants of human butyrylcholinesterase against (−)-cocaine: structural and energetic factors affecting the catalytic efficiency. Biochemistry 2010;49:9113–9. [13] Magnusson A, Mulder R, Santagostino A, Hult K. Creating space for large secondary alcohols by rational redesign of Candida antartica Lipase B. Chem Bio Chem 2005;6:1051–6. [14] Higgins DG, Sarp PM. Clustal: a package for performing multiple sequence alignment on a microcomputer. Gene 1988;73(1):237–44. [15] DeOliveira EB, Humeau C, Chebil L, Maia ER, Dehez F, Maigret B, et al. A molecular modelling study to rationalize the regioselectivity in acylation of flavonoid glycosides catalyzed by Candida antartica Lipase B. J Mol Cat B 2009;59:96–105. [16] Wahab RA, Basir M, Rahman MBA, Rahman RNZRA, Salleh AB, Chor LT. Engineering catalytic efficiency of thermophilic lipase for Geobacillus zalihae by hydrophobic residue mutation near the catalytic pocket. Adv Biosci Biotechnol 2012;3:158–67. [17] Salaemae W, Junaid M, Angsuthanasombat C, Katzenmeier G. Structure-guided mutagenesis of active site residues in the dengue virus two-component protease NS2B-NS3. J Biomed Sci 2010;17:68–76.
Contents lists available at ScienceDirect
Enzyme and Microbial Technology journal homepage: www.elsevier.com/locate/emt
Phenylalanine to leucine point mutation in oxyanion hole improved catalytic efficiency of Lip12 from Yarrowia lipolytica Arti Kumari, Rani Gupta ∗ Department of Microbiology, University of Delhi South Campus, New Delhi 110021, India
a r t i c l e
i n f o
Article history: Received 1 April 2013 Received in revised form 12 August 2013 Accepted 21 August 2013 Keywords: Yarrowia lipolytica Lipase Oxyanion hole Catalytic efficiency Differential activation energy
a b s t r a c t In lipases, oxyanion hole has crucial role in the stabilisation of enzyme–substrate complex. Majority of lipases from Yarrowia lipolytica consist of two oxyanion hole residues viz.; Thr and Leu. However, Lip12 has Phe instead of Leu at second oxyanion hole residue. It was observed that Lip12 has lower specific activity and catalytic efficiency than other lipases of Yarrowia. In silico analysis of Phe to Leu mutation revealed improved binding energy of Lip12 for p-np palmitate. This was validated by Phe148 to Leu point mutation where, specific activity of mutant was 401 U/mg on olive oil, which was two fold higher in comparison to wild-type. Kcat , remained unaltered, while decrease in Km was predominant for all the substrates used in the study. Improved catalytic efficiency of mutant was a function of chain length in case of p-np esters, with 73% improvement for p-np stearate. However, hydrolysis of triacylglycerides improved by 20%, irrespective of chain length. Decrease in activation energy for all the substrates, was observed in mutant in comparison to wild-type, indicating better stabilisation of transition state complex. Further, unaltered differential activation energy for mutant depicts that substrate specificity of enzyme remained same after mutation. © 2013 Elsevier Inc. All rights reserved.
1. Introduction Lipases are triacylglycerol hydrolases of serine hydrolase group with E.C 3.1.1.3 [1]. These enzymes are composed of Ser-HisAsp triad [2]. Serine is present in lipid contact zone in elongated hydrophobic binding-pocket. The active-site serine is a part of GXSXG penta peptide, which is conserved in most of the lipases, whereas His and Asp are present at variable positions. There is a formation of tetrahedral complex during catalysis which is stabilised by oxyanion hole residues [3]. The mechanism of hydrolysis of substrate by lipase begins with the deprotonation of serine for which histidine and aspartate are required [4]. Hence, nucleophilicity of hydroxyl residue of serine increases and attacks on the carboxyl group of the substrate leading to the formation of acyl-enzyme intermediate, which is stabilised by oxyanion hole residues [4]. The first residue of oxyanion hole is present near N-terminal, it is well conserved among most of the lipase families with the three consensus sequences viz.; GX, GGGX and Y [4,5]. Most of the fungal lipases have conserved GX sequence, while GGGX and Y is present in carboxylesterase and esterases respectively. The second residue of the oxyanion hole is present in the signature sequence of lipase
i.e. GXSXG [5]. For most of the fungal lipases like Rhizomucor, Saccharomyces and Yarrowia lipases it was found to be “GHSLG”, where Leu is second oxyanion hole residue [5]. Yarrowia produces as many as 16 lipases [6]. Of them only eight have been biochemically characterised namely Lip2, Lip7, Lip8, Lip9, Lip11, Lip12, Lip14 and Lip18 [6–9]. In our previous study it was found that all these lipases have Leu as a second oxyanion hole residue except Lip12, where Leu is replaced by Phe [8]. Lip12 was found to be short to mid chain specific and had lower catalytic efficiency than other reported lipases from Yarrowia [8]. In this respect, the present study focuses to provide the molecular explanation for Phe to Leu point mutation at oxyanion hole of Lip12. Major focus will be on the catalytic efficiency and substrate specificity. The orientation of protein–substrate complex was studied by docking analysis, which allow to predict the effect of point mutation on substrate binding and hence on kinetic parameters of the enzyme. This was experimentally validated by site-directed mutagenesis. 2. Materials and methods 2.1. Material
∗ Corresponding author. Tel.: +91 11 24111933; fax: +91 11 24115270. E-mail addresses: [email protected], [email protected] (R. Gupta). 0141-0229/$ – see front matter © 2013 Elsevier Inc. All rights reserved. http://dx.doi.org/10.1016/j.enzmictec.2013.08.004
X-Gal, isopropyl -d-thio-galactopyranoside (IPTG) from Sigma–Aldrich (USA). IgG sepharose purchased from G-Bioseciences, USA. p-nitrophenyl esters, triacylglycerides were purchased from Sigma. Genomic DNA was isolated by conventional method. Plasmid extraction and gel elution were performed using the mini prep and gel elution kits purchased from Qiagen, Hilden, Germany. LB broth (10 g of tryptone,
A. Kumari, R. Gupta / Enzyme and Microbial Technology 53 (2013) 386–390
387
5 g of yeast extract, and 10 g of NaCl per litre, pH 7.0; Hi-media), ampicillin from Hi-media. 2.2. Site-directed mutagenesis Site-directed mutagenesis was carried out in pEZZ18-lip12 harboured in E. coli HB101 [8], using the kit Quick ChangeTM Site-Directed Mutagenesis kit (Stratagene). Primer sequences were as follows: Flip12L forward: GTTACAGGCCATTCTCTTGGTGGAGCGTCA; Tm = 74.0 ◦ C Flip12L reverse: TGACGCTCCACCAAGAGAATGGCCTGTAAC; Tm = 74.0 ◦ C Polymerase chain reaction (PCR) was setup using pEZZ18-lip12 recombinant plasmid according to manufacturer’s instruction. PCR products were digested with the Dpn I, to remove methylated parental plasmid and mutated plasmid was transformed into E. coli XL-10 cells. Colonies obtained were grown in LB media supplemented with 0.1 mM ampicillin and plasmids were isolated. The positive clones were sequenced at Central Instrumental Facility (CIF), University of Delhi South Campus, New Delhi.
Fig. 1. Alignment of oxyanion hole residues of different lipases from Yarrowia lipolytica using ClustalW. Sequence of lipases was taken from Genolevures consortium where gene I.D YALI0A20350g, YALI0D09064g, YALI0D15906g, YALI0D19184g, YALI0B09361g, YALI0B1185g, YALI0D18480g and YALI0B20350g corresponds to Lip2, Lip11, Lip12, Lip7, Lip8, Lip14, Lip9 and Lip18, respectively.
2.3. Expression and purification Mutated plasmids were then transformed in expression host, E. coli HB101. Mutant protein was purified by IgG-sepharose as describe earlier [8,9].
oil, olive oil, neem oil, karanja oil, cotton seed oil, groundnut oil, sunflower oil and mustard oil. Emulsions were prepared in 50 mM citrate-phosphate buffer pH 7.0 using 2% gum acacia. The reaction was carried out as described earlier [9].
2.4. Activity assays
2.6. Sequence and structure inspection
Lipase activity was determined by spectrophotometric p-nitrophenyl palmitate assay [10] and confirmed by titrimetry [11] using 10% (v/v) olive oil as substrate at pH 7 and 40 ◦ C. One international unit of lipase was defined as the amount of enzyme required to release 1 mole of p-nitrophenol or fatty acid, respectively, per ml per min. The total protein was estimated by Bradford assay using Bovine serum albumin (BSA) as the standard protein.
Multiple sequence alignment was performed by using ClustalW [14]. Homology models for wild-type and mutant (F148L) Lip12 were build by using Lip2 (3O0D) as template and modeller 9.10 as tool [8]. PDB for p-np palmitate was generated from PRODRG (http://davapc1.bioch.dundee.ac.uk/prodrg/). Docking with p-np palmitate was performed using Patch Dock tool (http://bioinfo3d.cs.tau.ac.il/PatchDock/). 2.7. Statistical analysis
2.5. Characterisation of mutated lipase Temperature optima of mutated lipase was studied by incubating the reaction mixture at different temperatures ranges from 30 ◦ C to 70 ◦ C at pH 7.0 as describe earlier [9]. Kinetic parameters were determined using different p-np esters and triacylglycerides with varying concentrations. Km and Vmax were calculated using Lineweaver–Burk plot as well as by Eadie–Hofstee plot (v vs. v/[S]) both. Kcat was calculated using standard formula Vmax /Et . Catalytic efficiency was calculated by Kcat /Km . The activation energy for enzyme catalysed reactions was calculated using [12]:
G# = −RT × ln
Kcat Km
The substrate specificity of the wild-type and mutant was compared by the differential activation energy which was calculated as follows [13] mut−wt S1−S2 G# = −RT × In
(((Kcat /Km )S1 )/(Kcat /Km )S2 )mut
All the above experiments were done in triplicate and the final values have been presented as mean ± standard deviation.
3. Results 3.1. Sequence analysis Multiple sequence alignment of Lip2, Lip 7, Lip8, Lip9, Lip11, Lip12 shows that Thr which is first oxyanion hole residue of all the lipases is well conserved and defines the category of GX type consensus. The second residue was found in the lipase signature sequence GHSLG, where Lip12 has Phe 148 instead of Leu (Fig. 1). 3.2. Structure analysis
(((Kcat /Km )S1 )/(Kcat /Km )S2 )wt
where S1 and S2 are different substrate used. Substrate specificity of lipases for oils was checked by using 10% oil emulsions viz.; coconut oil, corn oil, linseed
Docking of wild-type and mutant Lip12 was performed with pnp palmitate. This gave various binding styles and energy, which
Table 1 Comparison of kinetic parameters of different triacylglycerides (A) and p-np esters (B). (See supplementary data S1a, b, c and S2a, b and c). Kinetic parameter
C10 Wild
A Kcat (S−1 ) × 104 Km (mM)
3.1 ± 0.3 2.4 ± 0.1
Kcat /Km × 104 (S−1 mM1 )
1.3
B Kcat (S−1 ) × 103 Km (mM)
2.0 ± 0.3 5.8 ± 0.2
Kcat /Km × 104 (S−1 mM−1 )
3.44
Cl6 Mutant 2.7 ± 0.2 1.7 ± 0.1 1.59
2.1 ± 0.4 5.4 ± 0.1 3.88
Wild
C18
Inference
Mutant
Wild
Mutant
8.4 ± 0.5 3.7 ± 0.3
8.2 ± 0.4 3.3 ± 0.2
11.2 ± 0.3 5.1 ± 0.4
10.8 ± 0.4 4.0 ± 0.2
2.3
2.5
28.3 ± 0.4 11.28 ± 0.4 2.52
28.9 ± 0.4 8.6 ± 0.3 3.4
2.2
2.7
3.7 ± 0.3 38.0 ± 0.5
3.7 ± 0.2 22.0 ± 0.3
0.98
1.69
No change Decrease in Km for all triacylglycerides Increase in catalytic efficiency of triacylglycerides by approximately 20% No change Decrease in Km for all p-np esters Increase in catalytic efficiency by 7%, 36% and 73% for C10 , C16 and C18 respectively
388
A. Kumari, R. Gupta / Enzyme and Microbial Technology 53 (2013) 386–390
Fig. 2. Docking analysis of Lip12 representing binding mode of p-np palmitate inside the cavity (a) wild-type and (b) mutant. (a) p-npp (black) is shown to be held by four hydrogen bonds, namely: One each with Tyr 79, His146 and two with Thr82. (b) p-npp (black) is shown to be held by six hydrogen bonds, namely: one each with Leu148, His146, Asn14 and Ser284 and two with Gly 77.
was visually analysed on the basis of following parameters: (1) Localisation of hydroxyl group with respect to the region comprised between histidine and serine residues present in the catalytic triad. (2) Proximity of oxyanion hole residues with the complex [15]. Only one combination each from mutant and wild-type suited this criteria depicted in Fig. 2a and b. It is clear from Fig. 2a and b that substrate showed better alignment with mutant having six hydrogen bonds; two with Gly 77, one each with Leu 148, His 146, Asn 14 and Ser 284, whereas only four hydrogen bond were observed
with wild-type i.e., two with Thr 82, one each with Tyr 79 and His 146 (Fig. 2). 3.3. Kinetic analysis of mutant vs wild-type Temperature optima of mutated lipases was found to be same as that of wild-type i.e. 40 ◦ C [8]. However, there were significant changes in the kinetic parameters of the mutated enzyme, which are depicted in Table 1a and b (S1a, b and c; S2a, b and c). Kinetic
A. Kumari, R. Gupta / Enzyme and Microbial Technology 53 (2013) 386–390
389
Fig. 3. Activation energy of wild-type and mutant for the hydrolysis of p-np esters and triacylglycerides. Numerals written on the top of the bars indicate difference in activation energy of wild-type and mutant (KJ/moles).
parameters with respect to p-np esters showed that there was lowering of Km , this lowering was a function of chain length. The maximum lowering was reported in case of C18 where Km lowered from 38.0 mM to 22.0 mM, followed by C16 with Km 11.0 mM to 8.6 mM and for C10 it decreased from 5.8 to 5.4. Likewise, catalytic efficiency was much improved for p-np esters with maximum upsurge of 73% for p-np stearate followed by 36 and 7.5% enhancement for C16 and C10 , respectively. In case of triacylglycerides, Km for C10 , C16 and C18 was lowered from 2.4 mM to 1.7 mM; 3.7 mM to 3.3 mM and 5.1 mM to 4.0 mM, respectively. Catalytic efficiency of mutant for each substrate was improved by nearly 20% with that of wild-type. Further, −G# (activation energy) was calculated to determine the changes in transition state stabilisation. Decrease in activation energy of mutant for, p-np esters and triacylglycerides, is in agreement with the stabilisation of transition state in the mutant (Fig. 3). Difference in activation energy of wild-type and mutant for p-np esters increased in the order C18 > C16 > C10 while for, triaclyglycerides the difference was again irrespective of chain length. In order to study the substrate specificity, differential activation energy for p-np esters and triaclyglycerides was calculated. It was found that there was not much change in the differential energy of wild-type and mutant for various substrates used in the study. This suggested that there was no alteration in the substrate specificity of lipase. This was confirmed by substrate specificity towards different oils (Table 2). It can be observed that though
Table 2 Substrate specificity of wild-type and mutant enzymes on various oils. Oils
Enzyme activity (U/mg) Wild-type
Coconut oil Corn oil Lenseed oil Olive oil Neem oil Karanja oil Cotton seed oil Groundnut oil Sunflower oil Mustard oil
279.2 267.3 237.0 198.2 180.2 140.6 136.6 124.7 94.0 79.2
± ± ± ± ± ± ± ± ± ±
3.4 4.1 5.1 2.6 4.3 1.9 2.1 3.8 4.9 2.9
Fold enhancement
Mutant 649.6 657.7 449.1 401.0 405.0 345.1 317.0 306.9 200.9 180.4
± ± ± ± ± ± ± ± ± ±
6.1 4.2 3.7 2.9 3.1 2.4 3.5 4.5 3.8 2.9
2.3 2.4 1.8 2.0 2.2 2.4 2.3 2.4 2.1 2.2
there was nearly 2–2.4 fold enhancement in the specific activity of the mutated enzyme as compared to wild-type for each of the oil, but hydrolysis pattern for oils by wild-type and mutant was similar i.e., coconut oil > corn oil > linseed oil > olive oil > neem oil > karanja oil > cotton seed oil > groundnut oil > sunflower oil > mustered oil. 4. Discussion The biochemical properties of all the enzymes depend on the amino acid sequences and architecture of the enzyme. These factors are responsible for protein’s interaction with their respective substrate. However, only few residues present in the oxyanion hole and catalytic centre of the enzyme interact with the substrate and catalyse the reaction. In case of lipases, there are two residues of oxyanion hole which are responsible for the stabilisation of the enzyme–substrate complex [3]. Literature suggested that most of the yeast lipases come under the GX class of lipases, where first amino acid of oxyanion hole is present near the N-terminal end of the primary sequence, which could be serine or threonine [5]. The conserved second oxyanion hole residue is located in the signature sequence “GXSXG” of lipases. The multiple sequence alignment of lipases from Yarrowia revealed that all lipases reported from Yarrowia have threonine as their first and leucine as second oxyanion residues, except Lip12 where Leu is replaced by Phe (Fig. 1). In our previous study it was found that Lip12 has relatively lower specific activity and catalytic efficiency than other lipase [8]. In this reference, in silico F148L point mutation on Lip12, was obtained and homology model for the mutant was developed. The docking study revealed that p-np palmitate was better stabilised in the mutant than in wild-type protein. There were prominent two hydrogen bonds with catalytic serine, which was not in wild-type enzyme. This suggested that the present point mutation would lead to some conformational changes in the protein for better substrate binding. Experimental data substantiate in silico findings where nearly 2 fold enhanced specific activity was obtained in case of mutant enzyme during the hydrolysis of oils. Likewise, catalytic efficiency for p-np esters and triacylglycerides was significantly improved. The F148L point mutation led to improved substrate binding as evident by lowering of Km for each of the substrates. However, a noteworthy observation was that in case of p-np esters, where
390
A. Kumari, R. Gupta / Enzyme and Microbial Technology 53 (2013) 386–390
high catalytic efficiency was a function of chain length and significant increase was observed in case of C16 and C18. This can be explained by the fact that phenylalanine being a bulky molecule will create hindrance in substrate acquisition of longer fatty acid esters in case of wild-type protein and there by its replacement with leucine led to improved substrate binding. This is in confirmation with the earlier report on Geobacillus zalihae where presence of bulky group like; Phe and Trp were responsible for inferior enzyme characteristics [16]. In addition, the activation energy of mutant was again lowered in comparison to wild-type. This further supports that not only binding has improved in mutant but also, there was better stabilisation of transition state complex. The chemistry of leucine also suggests that it has multiple ionisable hydrogen atoms in comparison to phenylalanine, which are required during the stabilisation of enzyme–substrate complex. In addition to this, leucine and phenylalanine have comparable hydrophobicity, however phenylalanine is more sterically hindered in comparison to leucine. This is evident from higher difference in activation energy of mutant and wild-type enzyme for the longer fatty acid esters. This is in confirmation with the similar report on proteases from NS2B-NS2 virus where mutant having leucine at oxyanion hole had lower Km and high catalytic efficiency in comparison to other mutant [17]. 5. Conclusion Second oxyanion hole residue present in signature sequence GXSXG was distinctly different as Phe 148 in Lip12 in compare to Leu in Lip2 and all other functionally characterised Y. lipolytica lipases. Docking analysis indicated its influence on substrate binding and hence on catalytic efficiency. It was experimentally validated, where improved specific activity and catalytic efficiency were observed when Phe 148 was replaced by Leu in Lip12 by site-directed mutagenesis. However, this mutation did not change substrate specificity. Finally, overall study concluded that, phenylalanine being a bulky amino acid is not a good stabiliser of the enzyme–substrate complex as compared to leucine. Acknowledgments Council of Scientific and Industrial Research and R & D grant from Delhi University, India are duly acknowledged for financial assistance. Author would like to acknowledge Mr. Ved Vrat Verma PhD. Scholar University of Delhi South Campus for assisting in bioinformatics work.
Appendix A. Supplementary data Supplementary data associated with this article can be found, in the online version, at http://dx.doi.org/10.1016/j.enzmictec. 2013.08.004. References [1] Bordes F, Barbe S, Escalie P, Mourey L, Andre I, Marty A, et al. Exploring the conformational states and rearrangements of Yarrowia lipolytica Lipase. Biophys J 2010;99:2225–34. [2] Joseph B, Ramteke PW, Thomas G. Cold active microbial lipases: some hot issues and recent developments. Biotechnol Adv 2008;26:457–70. [3] Pleiss J, Fischer M, Peiker M, Thiele C, Schmid RD. Lipase engineering database: understanding and exploiting sequence–structure–function relationships. J Mol Catal B 2000;10:491–508. [4] Pleiss J, Fischer M, Schimid RD. Anatomy of lipase binding sites: the scissile fatty acid binding site. Chem Phys Lipids 1998;93:67–80. [5] Beer HD, Wohlfahrt G, McCarthy JEG, Schomburg D, Schmid RD. Analysis of the catalytic mechanism of a fungal lipase using computer-aided design and structural mutants. Protein Eng 1996;9:507–17. [6] Fickers P, Marty A, Nicaud TM. The lipases from Yarrowia lipolytica: genetics, production, regulation, biochemical characterization and biotechnological applications. Biotechnol Adv 2011;29:632–44. [7] Zhao H, Zheng L, Wang X, Liu Y, Xu L, Yan Y. Cloning, expression and characterization of new lipases from Yarrowia lipolytica. Biotechnol Lett 2011;33:2445–52. [8] Kumari A, Gupta R. Comparative biochemical characterization and in-silico analysis of novel lipases Lip11 and Lip12 with Lip2 from Yarrowia lipolytica. World J Microbiol Biotechnol 2012;28:3103–11. [9] Kumari A, Gupta R. Extracellular expression and characterisation of thermostable Lip8, Lip14 and Lip18 from Yarrowia lipolytica. Biotechnol Lett 2012;34:1733–9. [10] Wrinkler UK, Stuckman M. Glycogen, hyaluronate and some other polysaccharides greatly enhance the formation of exolipase by Serratia marcescens. J Bacteriol 1979;138:663–79. [11] Naka Y, Nakamura T. The effect of serum albumin and related amino acid on pancreatic lipase and biles salts inhibited microbial lipases. Biosci Biotechnol Biochem 1992;56:1066–70. [12] Zheng F, Yang W, Xeu L, Hou S, Liu J, Zhan CG. Design of high-activity mutants of human butyrylcholinesterase against (−)-cocaine: structural and energetic factors affecting the catalytic efficiency. Biochemistry 2010;49:9113–9. [13] Magnusson A, Mulder R, Santagostino A, Hult K. Creating space for large secondary alcohols by rational redesign of Candida antartica Lipase B. Chem Bio Chem 2005;6:1051–6. [14] Higgins DG, Sarp PM. Clustal: a package for performing multiple sequence alignment on a microcomputer. Gene 1988;73(1):237–44. [15] DeOliveira EB, Humeau C, Chebil L, Maia ER, Dehez F, Maigret B, et al. A molecular modelling study to rationalize the regioselectivity in acylation of flavonoid glycosides catalyzed by Candida antartica Lipase B. J Mol Cat B 2009;59:96–105. [16] Wahab RA, Basir M, Rahman MBA, Rahman RNZRA, Salleh AB, Chor LT. Engineering catalytic efficiency of thermophilic lipase for Geobacillus zalihae by hydrophobic residue mutation near the catalytic pocket. Adv Biosci Biotechnol 2012;3:158–67. [17] Salaemae W, Junaid M, Angsuthanasombat C, Katzenmeier G. Structure-guided mutagenesis of active site residues in the dengue virus two-component protease NS2B-NS3. J Biomed Sci 2010;17:68–76.