PHLDA1 is a new therapeutic target of oxidative stress and ischemia reperfusion-induced myocardial injury

Journal Pre-proof PHLDA1 is a new therapeutic target of oxidative stress and ischemia reperfusion-induced myocardial injury

Yuxuan Guo, Pengyu Jia, Yuqiong Chen, Hang Yu, Xin Xin, Yandong Bao, Huimin Yang, Nan Wu, Yingxian Sun, Dalin Jia PII:

S0024-3205(20)30094-1

DOI:

https://doi.org/10.1016/j.lfs.2020.117347

Reference:

LFS 117347

To appear in:

Life Sciences

Received date:

8 October 2019

Revised date:

20 January 2020

Accepted date:

21 January 2020

Please cite this article as: Y. Guo, P. Jia, Y. Chen, et al., PHLDA1 is a new therapeutic target of oxidative stress and ischemia reperfusion-induced myocardial injury, Life Sciences(2020), https://doi.org/10.1016/j.lfs.2020.117347

This is a PDF file of an article that has undergone enhancements after acceptance, such as the addition of a cover page and metadata, and formatting for readability, but it is not yet the definitive version of record. This version will undergo additional copyediting, typesetting and review before it is published in its final form, but we are providing this version to give early visibility of the article. Please note that, during the production process, errors may be discovered which could affect the content, and all legal disclaimers that apply to the journal pertain.

© 2020 Published by Elsevier.

Journal Pre-proof PHLDA1 is a new therapeutic target of oxidative stress and ischemia reperfusion-induced myocardial injury

Yuxuan Guo1, Pengyu Jia1, Yuqiong Chen1, Hang Yu1, Xin Xin1, Yandong Bao1, Huimin Yang1, Nan Wu2, Yingxian Sun1,* and Dalin Jia1,*

1

Department of Cardiology; 2Central Laboratory of The First Affiliated Hospital of

of

China Medical University, Shenyang,110001,Liaoning, China

ro

*Correspondence to: Dalin Jia or Yingxian Sun, Department of Cardiology, The First Affiliated Hospital of China Medical University, 155th North of Nanjing Street,

re

E-mail: [email protected] (Dalin Jia)

-p

Heping District, Shenyang 110001, Liaoning, China.

na

Abstract

lP

E-mail: [email protected] (Yingxian Sun)

Aim: Oxidative stress plays an important role in myocardial ischemia-reperfusion

Jo ur

injury. Pleckstrin homology-like domain, family A, member 1 (PHLDA1) was first identified in apoptosis induced by T cell receptor activation, and was shown to play a different role in different cell types and under different stimuli. The role and mechanism of PHLDA1 in oxidative stress-induced cardiomyocyte injury and cardiac ischemia-reperfusion were therefore determined. Main methods: Cell viability and apoptotic rate were measured by Cell Counting Kit-8 and flow cytometry, respectively. Mitochondrial membrane potential was measured using JC-1 test kit. Reactive oxygen species (ROS) production was detected using ROS kit. HE staining was used to detect histological morphology, 2,3,5-triphenyltetrazolium chloride staining to detect infarct size, terminal deoxynucleotidyl transferase dUTP nick end labeling staining to detect the apoptotic rate, and immunohistochemistry and western blot analysis to detect protein expression. The binding of PHLDA1 to Bcl-2 associated X (Bax) was detected by

Journal Pre-proof immunoprecipitation. Key findings: The results indicated that PHLDA1 is highly expressed in oxidative stress-induced

cardiomyocyte

and

myocardial

ischemia-reperfusion

injuries.

PHLDA1 overexpression in cardiomyocytes promoted oxidative stress-induced cardiomyocyte injury. At the same time, PHLDA1 knockdown improved oxidative stress-induced cardiomyocyte and myocardial ischemia-reperfusion injuries. In addition, PHLDA1 binds to Bax and the interaction is enhanced under H2O2 stimulation.

of

Significance: The present results indicated that PHLDA1 interacts with Bax to

ro

participate in oxidative stress-induced cardiomyocyte injury and myocardial ischemia

-p

reperfusion injury.

re

Key words: PHLDA1, Bax, myocardial ischemic reperfusion injury, oxidative stress,

na

1. Introduction

lP

apoptosis

Myocardial ischemia reperfusion injury (MIRI) is the leading cause of death in

Jo ur

patients with cardiovascular disease (1). An imbalance in metabolic supply and demand within the ischemic organ results in profound tissue hypoxia and microvascular dysfunction. Subsequent reperfusion further enhances the activation of innate and adaptive immune responses and cell death programs (2). Most attempts have failed so far to reduce the infarct size and improve clinical outcomes in myocardial infarction patients. Currently, it appears that remote ischemic conditioning and a few drugs can reduce infarct size, but studies with clinical outcome as the primary endpoint are still underway (3). While a variety of molecular mechanisms have been proposed to explain reperfusion, excess production of reactive oxygen species (ROS) continues to receive much attention as a critical factor in the genesis of reperfusion injury (4). Oxidative stress arises when the system is unable to establish a balance between production and utilization of oxidant molecules. The excess production of ROS during oxidative

Journal Pre-proof stress has the potential to cause protein, DNA and lipid damage, causing cellular injury, as observed in ischemia/reperfusion models (5). The anti-apoptotic protein B cell leukemia/lymphoma 2 (Bcl-2) and pro-apoptotic protein Bcl-2 associated X (Bax) are the key signaling molecules involved in regulating myocardial apoptosis in response to I/R and oxidative damage of cardiomyocytes (6). Pleckstrin homology-like domain, family A, member 1 (PHLDA1; also known as PHRIP, TDAG51, DT1P1B11 and MGC131738) was first identified as a potential transcription factor required for Fas expression and activation-induced apoptosis in

of

mouse T cell hybridomas. PHLDA1 encodes a protein with 401 amino acids and is

ro

located at the 12q15 chromosome (7-8). Considerable evidence has suggested that PHLDA1 plays an important role in cancer (9). PHLDA1 has been implicated in the

-p

regulation of cell death (7), and suppression of metastasis (10). Simultaneously,

re

PHLDA1 has been reported to induce apoptosis in various cells (11). However, the

lP

role of PHLDA1 in oxidative stress-induced cardiomyocyte injury and MIRI is unclear.

oxidative

na

In the current experiment, the role and mechanism of PHLDA1 was explored in stress-induced

apoptosis

of

cardiomyocytes

and

myocardial

Jo ur

ischemia-reperfusion. In vitro and ex vivo experiments found that the knockdown of PHLDA1 can attenuate oxidative stress-induced apoptosis and ROS production in cardiomyocytes and, at the same time, reduce ischemia-reperfusion-induced damage. In addition, it was found that the apoptosis-associated protein Bax binds to PHLDA1, and that PHLDA1 may promote the damage caused by oxidative stress by activating Bax.

2. Materials and methods 2.1. Cell culture and treatment. Adult rat cardiomyocytes (H9c2 cells) were obtained from the Chinese Academy of Sciences (Shanghai, China) and cultured in high-glucose medium containing 10% FBS, and cultured in a 37˚C, 5% CO2 incubator. Hydrogen peroxide (H2O2) induces cell damage. This is a recognized method.

Journal Pre-proof 2.2. Antibodies and reagents. Polyclonal rabbit anti-caspase 3 (#9664), monoclonal rabbit anti-PARP1 (#5625) and mouse anti-Flag (#8146) antibodies were purchased from Cell Signaling Technology Inc. (Danvers, MA, USA). Polyclonal mouse anti-GAPDH (60004-1-Ig), monoclonal rabbit anti-β-tubulin (11224-1-AP), anti-Bax (50599-2-Ig) and anti-PHLDA1 (18263-1-AP) antibodies were purchased from ProteinTech Group, Inc. (Chicago, IL, USA). Protein A/G magnetic beads were purchased from Santa Cruz Biotechnology, Inc. (CA, USA). Β

of

2.3. RNA interference and gene overexpression. PHLDA1-siRNA and scrambled

ro

siRNA (negative control) were designed and synthesized by Shanghai GenePharma Co., Ltd. (Shanghai, China). To prevent off-target effects, three sequences were

-p

synthesized. The transfection reagent used was jetPRIME from Polyplus-transfection

re

SA (Illkirch, France). Transfection was performed when the cell confluence reached

PHLDA1

siRNA-1:

lP

~60%, and the transfection time was 24-48 h. The target sequences were as follows: GGGAAGAGUGCAUUACUAUTT,

na

GCUUGCAGUUCCUCGUAGUTT

CCUUGUAGGAGCAAUUUAUTT.

and pCDNA3.1-3xFlag

siRNA-2: siRNA-3: and

Jo ur

pCDNA3.1-PHLDA1-Flag were designed and synthesized by Shanghai GeneChem Co., Ltd. (Shanghai, China). The transfection reagent used was Lipofectamine® 3000 (Thermo Fisher Scientific, Inc., Waltham, MA, USA), and cells were transfected according to the manufacturer’s instructions.

2.4. Cell viability assay. Cell viability was measured using Cell Counting Kit-8 (CCK-8) from Dojindo Molecular Technologies, Inc. (Kumamoto, Japan). The cells were cultured into 96-well plates. Briefly, 5x103 cells were cultured into each well and divided into different groups for 46 h, and H2O2 (100, 200 and 300 μM) or normal media were used to treat different groups of cells for 90 min. Following treatment, cells were washed once with PBS, and 100 μl of CCK-8 mixed solution was then added and incubated at 37˚C for 1 h. A microplate reader from Bio-Rad Laboratories, Inc. (Hercules, CA, USA) was used to scan cell viability at an absorbance of 450 nm.

Journal Pre-proof

2.5. Flow cytometry annexin-fluorescein isothiocyanate (FITC)/propidium iodide (PI). Apoptosis was detected by Annexin V FITC and PI assay. Briefly, 5x105 cells/well were cultured in 6-well plates and divided into different groups for 46 h. H2O2 (300 μM) or normal media were then used to treat different groups for 90 min. Following washing twice with PBS, the cells were digested with EDTA-free trypsin and collected. They were then incubated in 500 μl of 1 x banding buffer containing 5 μl of Annexin V and 5 μl of PI solution for 15 min in the dark. Finally, the apoptotic rate

of

was measured by flow cytometry (BD LSRFortessa™, BD Biosciences, San Jose, CA,

ro

USA).

-p

2.6. Measurement of mitochondrial membrane potential (ΔΨm). The changes in ΔΨm

re

were detected using 1,1',3,3'-tetraethyl-5,5',6,6'-tetrachloroimidacarbocyanine iodide

lP

(JC1; Beyotime Institute of Biotechnology, Haimen, China). Briefly, 5x105 cells/well were cultured in 6-well plates, and the cells were divided into different groups for 46

na

h. H2O2 (300 μM) or normal media were then used to treat different groups for 90 min. Following washing once with PBS, 1 ml JC-1 working solution was added to each

Jo ur

well. Cells were then incubated for 30 min at 37˚C and washed twice with JC-1 buffer following incubation. Finally, fluorescence was detected using a fluorescent microscope (Nikon Corporation, Ti-e, Tokyo, Japan) and images were captured at a magnification of ×200.

2.7. ROS assay. The ROS assay kit was obtained from Beyotime Institute of Biotechnology (Haimen, China). Briefly, 5x105 cells/well were cultured in 6-well plates, and the cells were divided into different groups for 46 h. H2O2 (300 μM) or normal media were then used to treat different groups for 90 min. Following washing once with PBS, 1 ml of DCFH-DA was added to each well. Next, cells were incubated for 30 min at 37˚C. Finally, fluorescence was detected using a fluorescent microscope (Nikon Corporation, Ti-e, Tokyo, Japan) and images were captured at a magnification of ×200.

Journal Pre-proof

2.8. RT-qPCR. Cells were transfected for 46 h. Total RNA was extracted using TRIzol Reagent (Invitrogen, CA, USA) and RT was performed by the PrimeScript RT kit (Takara Bio, Inc., Otsu, Japan), and amplified by SYBR Premix Ex Taq II (Takara Bio, Inc., Otsu, Japan). The qPCR data are expressed as Ct values, and the crossing threshold of PCR was defined using the 7500 Real-Time PCR System data analysis software. The PHLDA1 mRNA expression in each sample was normalized to the GAPDH expression and calculated using the 2-

△△Ct

method. qPCR was performed

of

using the following primers from Sangon Biotech Co., Ltd. (Shanghai, China): AGCAGCAGCAACAGCAGCAG

TCCACGCAGTCTACAGTCTTCATATTG forward

and

GAPDH,

TCCACCACCCTGTTGCTGTA

lP

re

reverse.

reverse;

and

-p

CACTGAGGACCAGGTTGTCT

forward

ro

PHLDA1,

2.9. Animals and gene therapy. A total of 40 healthy male SD rats weighing 250±10 g

na

were purchased from Liaoning Changsheng Biotechnology Co (Shenyang, China). Rats were injected with AAV9-cTNT-sh-PHLDA1-GFP or AAV9-cTNT-sh-NC-GFP

Jo ur

(1.3x1012 μg/ml) via the tail vein. Each rat was injected with 3.25x1011 μg of AAV9-cTNT-sh-PHLDA1-GFP or AAV9-cTNT-sh-NC-GFP and after 3 weeks, the rats

were

subjected

to

control

treatment

or

ischemia-reperfusion

injury.

AAV9-cTNT-sh-PHLDA1-GFP and AAV9-cTNT-sh-NC-GFP were purchased from Hanheng Biotechnology Co., Ltd., Shanghai, China (12,13). Animal use and treatment in the present study adhered to the Guide for the Care and Use of Laboratory Animals (National Institutes of Health, Bethesda, MD, USA) and was approved by the Institutional Animal Care and Use Committee of the China Medical University (Liaoning, China).

2.10. Isolated heart model. First, rats were intraperitoneally injected with pentobarbital (50 mg/kg) for anesthesia. Following anesthesia, the hearts were removed from the chest and immediately placed in a K-H solution containing heparin

Journal Pre-proof and oxygen at 4˚C. Finally, the aorta was suspended on the Langendorff device. The control group was only subjected to simple perfusion, and the IR injury group to ischemia for 30 min and reperfusion for 60 min.

2.11. Hematoxylin & eosin (HE) staining. For HE staining, paraffin sections were made, dewaxed and hydrated. Then stained with hematoxylin-eosin. After sections are stained, the sections are dehydrated, cleared and mounted. Finally, images are

of

captured under a microscope (Olumpus, BX51, Tokyo, Japan).

ro

2.12. 2,3,5-Triphenyltetrazolium chloride (TTC) staining The heart was first frozen, and then sliced and stained with 2% TTC for 30 min in the dark. It was then washed

-p

in distilled water for 1 min, fixing for 24-72 h in paraformaldehyde, and then

lP

re

photographed.

2.13. Terminal deoxynucleotidyl transferase dUTP nick end labeling (TUNEL) assay

na

Myocardial apoptosis was detected by TUNEL assay using an In Situ Cell Death Detection kit (Roche Diagnostics, Indianapolis, IN, USA). Paraffin sections were

Jo ur

made, dewaxed and hydrated. The sections were treated with Proteinase K working solution at 37˚C for 30 min. The slides were then covered, protected from light in a wet box and treated with TUNEL reaction and converter-POD solutions at 37˚C for 1 h and 30 min. Next, 75 μl DAB was added at 20˚C for 10 min, and images were captured under a microscope (Olumpus, BX51, Tokyo, Japan) following staining.

2.14. Immunohistochemistry. First, sections were sliced, followed by antigen retrieval, H2O2 incubation, blocking, primary antibody incubation, secondary antibody incubation, DAB color development, hematoxylin counterstaining and mounting. Finally, images were captured using the microscope (Olumpus, BX51, Tokyo, Japan).

2.15. Western blot (WB) analysis. The protein was electrophoresed, transferred to membranes and blocked, and the primary antibody was incubated overnight at 4˚C.

Journal Pre-proof On day 2, the secondary antibody was incubated, and the primary and secondary antibodies were washed with TBST for 45 min. After the film was washed, it was developed using an enhanced luminometer.

2.16. Co-immunoprecipitation. Cells were collected either following plasmid transfection for 48 h or directly. They were then lysed with flag lysis buffer. Cell lysates were supplemented with an anti-bax antibody and 25 μl protein A/G immunoprecipitation magnetic (Santa Cruz Biotechnology, Inc. CA, USA) or 25 μl

of

anti-Flag (Merck KGaA, Darmstadt, Germany) beads overnight at 4˚C. The combined

ro

mixture was washed 3 times with flag lysis buffer and then 20 μl of 2×loading buffer

re

PHLDA1 or anti-Flag antibody.

-p

was added. The samples were finally subjected to WB analysis using an anti-bax,

lP

2.17. Statistical analysis. All data are expressed as the mean ± standard deviation, and data analysis was performed using Student's t-test or one-way analysis of variance.

na

SPSS 17 statistical software was used for statistical analysis (SPSS, Inc., Chicago, IL,

3. Results

Jo ur

USA). P<0.05 was considered to indicate a statistically significant difference.

3.1. Expression of PHLDA1 in oxidative stress-induced H9c2 cardiomyocyte injury. CCK8 and flow cytometry were used to examine the effects of different concentrations of H2O2 on H9c2 cardiomyocyte survival and apoptosis. WB analysis was used to detect changes in apoptosis-related genes, as well as changes in PHLDA1 under H2O2 stimulation at different concentrations and times. As shown in Fig. 1, the most significant decrease in H9c2 cardiomyocyte survival and most significant increase in apoptosis and apoptosis-related genes cleaved caspase-3 and cleaved PARP1 was observed following 300-μM H2O2 stimulation. At the same time, changes in PHLDA1 were most obvious following H2O2 stimulation at 300 μM for 90 min. Therefore, stimulation at 300 μM for 90 min was selected for the next experiments, to explore the role of PHLDA1 in H9c2 cardiomyocyte injury induced by oxidative

Journal Pre-proof stress.

3.2.

PHLDA1

overexpression

aggravates

oxidative

stress-induced

H9c2

cardiomyocyte injury. To investigate the role of PHLDA1 in H9c2 cardiomyocytes, we first transfected Flag-PHLDA1 and control plasmids into H9c2 cells. Plasmid transfection was successful and PHLDA1 was overexpressed. Next, H9c2 cardiomyocytes were stimulated for 90 min with or without H2O2 following transfection for 46 h. First, as shown in Fig. 2, the overexpression of PHLDA1 caused

of

a decrease in the survival rate of H9c2 cardiomyocytes. Secondly, an increase in

ro

PHLDA1 caused an increase in the apoptotic rate and expression of apoptosis-related genes cleaved caspase-3 and cleaved PARP1. Thirdly, as shown in Fig. 3, the increase

-p

in PHLDA1 caused a more pronounced decrease in ΔΨm, and ROS production was

re

increased in cardiomyocytes transfected with the Flag-PHLDA1 plasmid, as

lP

compared to the transfected control plasmid. The above experiments suggested that the overexpression of PHLDA1 in H9c2 cardiomyocytes can promote injury caused

na

by oxidative stress.

Jo ur

3.3. PHLDA1 knockdown reduces oxidative stress-induced cardiomyocyte injury. To further demonstrate the role of PHLDA1, we performed experiments using PHLDA1 siRNA. The control siRNA and 3 sequences of PHLDA1 siRNA were transfected into H9c2 cardiomyocytes. Fig. 4A and 4B shows that the knockdown efficiency of the third PHLDA1 siRNA sequence was the highest. H9c2 cardiomyocytes were transfected with control and PHLDA1 siRNA for 46 h, with or without H2O2 stimulation for 90 min. First, as shown in Fig. 4, PHLDA1 knockdown caused an increase in cell viability. Secondly, the decrease in PHLDA1 caused a decrease in the apoptotic rate. At the same time, the expression of the apoptosis-related genes cleaved caspase-3 and cleaved PARP1 was decreased in cells with a PHLDA1 decrease. As shown in Fig. 5, the transfection of PHLDA1 siRNA resulted in the maintenance of ΔΨm, as compared to the transfection of control siRNA, and the loss of PHLDA1 caused a decrease in ROS production. These experiments provided additional

Journal Pre-proof evidence confirming the role of PHLDA1 in oxidative stress-induced cardiomyocyte injury.

3.4. PHLDA1 knockdown alleviated MIRI in an isolated rat heart model. Oxidative stress has been an important mechanism of ischemia-reperfusion injury, so the role of PHLDA1 in MIRI was further explored. In order to verify the role of PHLDA1 in MIRI, we first injected the adenovirus into the tail vein to knock down PHLDA1, and the heart was subjected to MIRI 3 weeks after the injection. Fig. 6A shows GFP

of

fluorescence in myocardial tissue. Fig. 6D shows the low expression of PHLDA1 in

ro

myocardial tissue injected into the PHLDA1 shRNA group. First, as shown in Fig. 6, PHLDA1 knockdown improved the myocardial tissue morphology. Secondly, a

-p

decrease in PHLDA1 caused a decrease in myocardial infarct size and the expression

re

of the apoptosis-related gene cleaved PARP1. As shown in Fig. 7, the apoptotic rate of

lP

myocardial tissue in the PHLDA1 shRNA group decreased and the expression of cleaved caspase-3 decreased, as compared with the control group. In combination,

na

these results indicated that the knockout of PHLDA1 protected the myocardium in an

Jo ur

isolated rat heart ischemia-reperfusion model.

3.5. Identification of Bax as a novel binding protein for PHLDA1 and enhanced binding under oxidative stress conditions. From the above experiments it was confirmed that PHLDA1 plays a role in oxidative stress. But the exact mechanism remains unknown. Immunoprecipitation experiments confirmed Bax as a new binding protein of PHLDA1. As shown in Fig. 8A-F, endogenous and semi-exogenous experiments demonstrated that Bax binds to PHLDA1 and enhances binding under oxidative stress conditions, indicating that the apoptosis-related protein Bax acts as a novel binding protein for PHLDA1, and the binding is enhanced under H2O2 stimulation. Fig. 8G shows that the overexpression of PHLDA1 caused an increase in Bax. whereas Fig. 8H shows that PHLDA1 knockdown caused a decrease in Bax in oxidative stress-induced cardiomyocyte injury. At the same time, Fig. 8I shows that PHLDA1 knockdown caused a decrease in Bax in myocardial ischemia-reperfusion

Journal Pre-proof injury. This indicates that PHLDA1 may aggravate the oxidative stress-induced damage of H9c2 cardiomyocytes by binding to Bax and activating an apoptotic pathway.

3.6 PHLDA1 regulates Bax stability through a proteasomal pathway. We show that PHLDA1 binds to Bax and that PHLDA1 affects Bax expression, but how PHLDA1 affects Bax expression is unknown. Here, in figure 9B, we used cycloheximide (CHX) to inhibit protein transcription and found that compared to

of

the control group, the degradation of Bax was faster in the knockdown group. It is

ro

suggested that knockdown of PHLDA1 expression markedly decreased Bax levels through accelerating Bax protein degradation. Furthermore, in figure 9A, the

-p

degradation of Bax protein by PHLDA1 was obviously abolished by proteasomal

4. Discussion

lP

re

inhibitor MG132.

na

In the present study, the function and mechanism of PHLDA1 was explored in oxidative stress-induced cardiomyocytes and cardiac ischemia-reperfusion injury. It

Jo ur

was found that: i) PHLDA1 is upregulated under oxidative stress-induced cardiomyocyte injury; ii) PHLDA1 overexpression promotes oxidative stress-induced cardiomyocyte injury; iii) PHLDA1 knockdown plays a protective role in oxidative stress-induced cardiomyocytes and MIRI; iv) PHLDA1 binds to Bax. Myocardial damage during acute myocardial infarction involves two processes, ischemia and reperfusion (14). Oxidative stress is a major cause of myocardial damage following ischemia-reperfusion, as reperfusion of the myocardial infarction region inevitably leads to a cascade of I/R lesions (15). The present experiments showed that in H9c2 cells stimulated with different concentrations of H2O2 the cell survival rate decreased and the apoptotic rate increased. The expression of PHLDA1 also increased with the increase in concentration and time of H2O2 stimulation. At the same time, it was found that PHLDA1 is highly expressed in myocardial ischemia-reperfusion injury. Therefore, we hypothesized that PHLDA1 may play a

Journal Pre-proof role in myocardial cell and myocardial ischemia-reperfusion injuries caused by oxidative stress. The role of PHLDA1 in apoptosis and death is controversial. PHLDA1 promotes apoptosis in IMR-32 neuroblastoma cells and metastatic melanoma (10,16). At the same time, cell death is promoted in breast cancer and umbilical vein endothelial cells by overexpression of PHLDA1(17,18). However, in CHP-134 neuroblastoma and oral cancer cells, PHLDA1 played a role in inhibiting apoptosis (19,20). Wang et al found that the expression of Bax was increased following PHLDA1 overexpression in ischemic cardiomyocytes (21). In oxidative

of

stress-induced mouse embryonic fibroblast (MEF) injury, the expression of PHLDA1

ro

was increased under H2O2 stimulation, but PHLDA1 knockdown caused an increase in cell apoptosis in MEF (22). The present study found that PHLDA1 overexpression

-p

lead to a decrease in oxidative stress-induced cardiomyocyte survival, and an increase

re

in the apoptotic rate and ROS production. PHLDA1 knockdown had the opposite

lP

effect. Wang et al found that PHLDA1 was highly expressed in an ischemic myocardium (21). The differential expression of PHLDA1 has been detected in rat

na

kidney and mouse brain models of ischemia-reperfusion injury (23,24). Herein, adenovirus was used to knock down myocardial PHLDA1, and the role of PHLDA1

Jo ur

in myocardial ischemia-reperfusion injury was studied. The decrease in PHLDA1 caused the maintenance of myocardial morphology in ischemia-reperfusion, and decreased myocardial infarct size and apoptosis. The above experimental results indicated that PHLDA1 may be a new target for the treatment of myocardial cell injury caused by oxidative stress and MIRI. This study demonstrated for the first time that PHLDA1 is a binding protein for Bax. Bax was first identified as a mutual binding protein of Bcl-2 (25). Bax is a key regulator of the apoptotic mitochondrial pathway. Under cellular stress, Bax accumulates at different lesions on the surface of the mitochondria, where it undergoes a conformational change, oligomerizes and mediates cytochrome c release, and couples to activate caspase 3, leading to cell death (26). Studies have found that H2O2 causes Bax to undergo a conformational change, mitochondrial translocation, and subsequent oligomerization on the mitochondria (27). The present data indicated

Journal Pre-proof that the Bax and cleaved-caspase 3 expression is reduced in oxidative stress-induced cardiomyocyte and isolated cardiac ischemia-reperfusion injuries following PHLDA1 knockdown. Meanwhile, in oxidative stress-induced cardiomyocyte injury, PHLDA1 knockdown inhibited a decrease in ΔΨm. PHLDA1 overexpression had the opposite effect. These findings suggested that PHLDA1 may, upon binding to Bax, rely on the mitochondrial pathway to promote oxidative stress-induced cardiomyocyte and isolated cardiac ischemia-reperfusion injuries. These findings may provide a basis for exploring the mechanism of myocardial ischemia-reperfusion injury.

of

The results of this study show that knockdown of PHLDA1 can degrade Bax

ro

through the proteasome pathway, suggesting that there may be an E3 ubiquitinase enzyme that binds to PHLDA1 and Bax, which degrades Bax. In the next step, mass

re

verify possible E3 ubiquitinase enzyme .

-p

spectrometry and co-immunoprecipitation experiments will be used to select and

lP

Moreover, it has been reported in the literature that the PH domain of PHLDA1 may be involved in its pro-apoptotic function (7). It has also been reported in the

na

literature that H2O2-induced Bax changes are dependent on cysteine residues 62 (27). Therefore, we aimed at determining whether the PH domain or cysteine residue 62

Jo ur

plays a role in the enhanced binding of PHLDA1 and Bax under H2O2 stimulation. Secondly, our ischemia-reperfusion model is an ex vivo model, lacking the simulation of in

vivo nerves,

body fluids

and other in

vivo

environments.

The

ischemia-reperfusion conditions need to be simulate in vivo to further verify the effect of PHLDA1 on ischemia-reperfusion injury. 5. Conclusion In conclusion, the promoting role of PHLDA1 was demonstrated in oxidative stress-induced cardiomyocyte and cardiac ischemia-reperfusion injuries, and it was proven that PHLDA1 binds to Bax. Damage caused by oxidative stress or ischemia-reperfusion are reduced when PHLDA1 is knocked down. References 1.

Xia Z, Li H, Irwin MG. Myocardial ischaemia reperfusion injury: the challenge of translating ischaemic and anaesthetic protection from animal models to

Journal Pre-proof humans. British journal of anaesthesia. 2016;117 Suppl 2:ii44-ii62. 2. Eltzschig HK, Eckle T. Ischemia and reperfusion--from mechanism to translation. Nature medicine. 2011;17(11):1391-401. 3.

Heusch G, Gersh BJ. The pathophysiology of acute myocardial infarction and strategies of protection beyond reperfusion: a continual challenge. European heart journal. 2017;38(11):774-84.

4.

Granger DN, Kvietys PR. Reperfusion injury and reactive oxygen species: The evolution of a concept. Redox biology. 2015;6:524-51. Ham PB, 3rd, Raju R. Mitochondrial function in hypoxic ischemic injury and

of

5.

Sun G, Ye N, Dai D, Chen Y, Li C, Sun Y. The Protective Role of the TOPK/PBK

Pathway

in

Myocardial

-p

6.

ro

influence of aging. Progress in neurobiology. 2017;157:92-116.

Ischemia/Reperfusion

and

re

H(2)O(2)-Induced Injury in H9C2 Cardiomyocytes. International journal of

7.

lP

molecular sciences. 2016;17(3):267.

Park CG, Lee SY, Kandala G, Lee SY, Choi Y. A novel gene product that couples

na

TCR signaling to Fas(CD95) expression in activation-induced cell death. Immunity. 1996;4(6):583-91.

Kuske MD, Johnson JP. Assignment of the human PHLDA1 gene to

Jo ur

8.

chromosome 12q15 by radiation hybrid mapping. Cytogenetics and cell genetics. 2000;89(1-2):1. 9.

Nagai MA. Pleckstrin homology-like domain, family A, member 1 (PHLDA1) and cancer. Biomedical reports. 2016;4(3):275-81.

10. Neef R, Kuske MA, Prols E, Johnson JP. Identification of the human PHLDA1/TDAG51 gene: down-regulation in metastatic melanoma contributes to

apoptosis

resistance

and

growth

deregulation.

Cancer

research.

2002;62(20):5920-9. 11. Chen Y, Takikawa M, Tsutsumi S, Yamaguchi Y, Okabe A, Shimada M, et al. PHLDA1, another PHLDA family protein that inhibits Akt. Cancer science. 2018;109(11):3532-42. 12. Xie X, Bi HL, Lai S, Zhang YL, Li N, Cao HJ, et al. The immunoproteasome

Journal Pre-proof catalytic beta5i subunit regulates cardiac hypertrophy by targeting the autophagy protein ATG5 for degradation. Science advances. 2019;5(5):eaau0495. 13. Tao L, Bei Y, Chen P, Lei Z, Fu S, Zhang H, et al. Crucial Role of miR-433 in Regulating Cardiac Fibrosis. Theranostics. 2016;6(12):2068-83. 14. Ibanez B, Heusch G, Ovize M, Van de Werf F. Evolving therapies for myocardial ischemia/reperfusion injury. Journal of the American College of Cardiology. 2015;65(14):1454-71. 15. Sinning C, Westermann D, Clemmensen P. Oxidative stress in ischemia and

of

reperfusion: current concepts, novel ideas and future perspectives. Biomarkers in

ro

medicine. 2017;11(11):11031-1040.

16. Durbas M, Horwacik I, Boratyn E, Rokita H. Downregulation of the PHLDA1

-p

gene in IMR-32 neuroblastoma cells increases levels of Aurora A, TRKB and

re

affects proteins involved in apoptosis and autophagy pathways. International

lP

journal of oncology. 2016;49(2):823-37.

17. Johnson EO, Chang KH, de Pablo Y, Ghosh S, Mehta R, Badve S, et al.

na

PHLDA1 is a crucial negative regulator and effector of Aurora A kinase in breast cancer. Journal of cell science. 2011;124(Pt 16):2711-22.

Jo ur

18. Hossain GS, van Thienen JV, Werstuck GH, Zhou J, Sood SK, Dickhout JG, et al. TDAG51 is induced by homocysteine, promotes detachment-mediated programmed cell death, and contributes to the cevelopment of atherosclerosis in hyperhomocysteinemia.

The

Journal

of

biological

chemistry.

2003;278(32):30317-27.

19. Durbas M, Pabisz P, Wawak K, Wisniewska A, Boratyn E, Nowak I, et al. GD2 ganglioside-binding antibody 14G2a and specific aurora A kinase inhibitor MK-5108 induce autophagy in IMR-32 neuroblastoma cells. Apoptosis : an international journal on programmed cell death. 2018;23(9-10):492-511. 20. Murata T, Sato T, Kamoda T, Moriyama H, Kumazawa Y, Hanada N. Differential susceptibility

to

hydrogen

sulfide-induced

apoptosis

between

PHLDA1-overexpressing oral cancer cell lines and oral keratinocytes: role of PHLDA1

as

an

apoptosis

suppressor.

Experimental

cell

research.

Journal Pre-proof 2014;320(2):247-57. 21. Wang J, Wang F, Zhu J, Song M, An J, Li W. Transcriptome Profiling Reveals PHLDA1 as a Novel Molecular Marker for Ischemic Cardiomyopathy. Journal of molecular neuroscience : MN. 2018;65(1):102-9. 22. Park ES, Kim J, Ha TU, Choi JS, Soo Hong K, Rho J. TDAG51 deficiency promotes oxidative stress-induced apoptosis through the generation of reactive oxygen species in mouse embryonic fibroblasts. Experimental & molecular medicine. 2013;45:e35.

of

23. Lin JY, Mao X, Wu HJ, Xue AM. [Genes Expression in the Early Stage of Acute

ro

Renal Ischemia-reperfusion Injury in Rats]. Fa yi xue za zhi. 2016;32(6):401-5. 24. Nagata T, Takahashi Y, Sugahara M, Murata A, Nishida Y, Ishikawa K, et al.

after

transient

forebrain

ischemia

using

high-density

re

hippocampus

-p

Profiling of genes associated with transcriptional responses in mouse

lP

oligonucleotide DNA array. Brain research Molecular brain research. 2004;121(1-2):1-11.

na

25. Oltvai ZN, Milliman CL, Korsmeyer SJ. Bcl-2 heterodimerizes in vivo with a conserved homolog, Bax, that accelerates programmed cell death. Cell.

Jo ur

1993;74(4):609-19.

26. Cosentino K, Garcia-Saez AJ. Bax and Bak Pores: Are We Closing the Circle? Trends in cell biology. 2017;27(4):266-75. 27. Nie C, Tian C, Zhao L, Petit PX, Mehrpour M, Chen Q. Cysteine 62 of Bax is critical for its conformational activation and its proapoptotic activity in response to

H2O2-induced

apoptosis.

2008;283(22):15359-69.

The

Journal

of

biological

chemistry.

Journal Pre-proof Acknowledgements The present study was supported by the National Natural Science Foundation of China (grant no. 81670320). Availability of data All data generated or analyzed during this study are included in this published article. Authors’ contributions Dalin Jia contributed to the conception, data curation, formal analysis, funding acquisition, investigation, methodology, project administration, resources, software,

of

supervision, validation, visualization, roles/writing of the original draft. Yingxian Sun

ro

contributed to the conception, data curation, formal analysis, investigation, methodology, project administration, resources, software, supervision, validation,

-p

visualization, roles/writing of the original draft.Yuxuan Guo contributed to the

re

conception, data curation, formal analysis, methodology, project administration,

lP

resources, software, supervision, validation, visualization, roles/writing of the original draft, as well as writing, reviewing and editing the final manuscript. Pengyu Jia

na

contributed to the acquisition of resources and data curation. Yuqiong Chen and Hang Yu contributed to the methodology. Xin Xin contributed to the acquisition of software.

Jo ur

Yandong Bao and Huimin Yang supervised the experiments. Nan Wu contributed to formal analysis and supervision of the experiments.

Competing interests

The authors declare that they have no competing interests.

Figure legends Figure 1. Expression of PHLDA1 in oxidative stress-induced H9c2 cardiomyocyte injury. H9c2 cardiomyocytes were stimulated with 0, 100, 200 and 300 μM H2O2 for 90 min. Changes in (A) cell survival rate (B) apoptotic rate and (C) protein expression of PHLDA1, cleaved-caspase 3 and cleaved PARP1. H9c2 cardiomyocytes were stimulated with 300 μM H2O2 for 0, 15, 30, 60 and 90 min. (D) Changes in the PHLDA1 protein expression. Data are expressed as the mean ± standard deviation

Journal Pre-proof (n=3). ***P<0.001, **P<0.01 and *P<0.05. PHLDA1, pleckstrin homology-like domain, family A, member 1; H2O2, hydrogen peroxide.

Figure 2. PHLDA1 overexpression aggravates oxidative stress-induced H9c2 cardiomyocyte injury. Transfection of Flag or Flag-PHLDA1 in H9c2. (A) Changes in cell viability following the stimulation of H9c2 cells with 0, 100, 200 and 300 μM H2O2 for 90 min. (B) Changes in the apoptotic rate following the stimulation of H9c2 with 300 μM H2O2 for 90 min. (C) Changes in the protein expression of

of

cleaved-caspase 3, and cleaved PARP1 following the stimulation of H9c2 cells with

***

P<0.001,

**

ro

300 μM H2O2 for 90 min. Data are expressed as the mean ± standard deviation (n=3). P<0.01 and *P<0.05. PHLDA1, pleckstrin homology-like domain,

re

-p

family A, member 1; H2O2, hydrogen peroxide.

lP

Figure 3. Overexpression of PHLDA1 aggravates oxidative stress-induced H9c2 cardiomyocyte injury. Transfection of Flag or Flag-PHLDA1 in H9c2. (A) Changes of mitochondrial membrane potential following the stimulation of H9c2 cells with 300

na

μM for 90 min. The first column represents the JC-1 monomer in green color, the

Jo ur

second column the JC-1 polymer in red color, and the third column is a combination of green and red. (B) ROS changes following the stimulation of H9c2 cells with 300 μM for 90 min. Data are expressed as the mean ± standard deviation (n=3). ***

P<0.001,

**

P<0.01 and *P<0.05. PHLDA1, pleckstrin homology-like domain,

family A, member 1; ROS, reactive oxygen species.

Figure 4. PHLDA1 knockdown reduces oxidative stress-induced cardiomyocyte injury. (A) Three PHLDA1 siRNA sequences were transfected into H9c2 cells, mRNA expression of PHLDA1. (B) Protein expression of PHLDA1 following the transfection of 3 PHLDA1 siRNA sequences. The third sequence was the most efficient, as compared to control siRNA. Transfection of control or PHLDA1 siRNA into H9c2 cells. (C) Changes in cell viability following the stimulation of H9c2 cells with 0, 100, 200 and 300 μM H2O2 for 90 min. (D) Changes in the apoptotic rate

Journal Pre-proof following the stimulation of H9c2 cells with 300 μM H2O2 for 90 min. (E) Changes in the protein expression of cleaved-caspase 3 and cleaved PARP1 following the stimulation of H9c2 cells with 300 μM for 90 min. Data are expressed as the mean ± standard deviation (n=3).

***

P<0.001,

**

P<0.01 and *P<0.05. PHLDA1, pleckstrin

homology-like domain, family A, member 1; H2O2, hydrogen peroxide.

Figure 5. PHLDA1 knockdown reduced oxidative stress-induced cardiomyocyte injury. Transfection of control or PHLDA1 siRNA in H9c2. (A) Changes in

of

mitochondrial membrane potential following the stimulation of H9c2 cells with 300

ro

μM H2O2 for 90 min. The first column represents the JC-1 monomer in green color, the second column the JC-1 polymer and red color, and the third column is a

-p

combination of green and red. (B) ROS changes following the stimulation of H9c2

(n=3).

***

P<0.001,

**

P<0.01

and

*

P<0.05.

PHLDA1,

pleckstrin

lP

deviation

re

cells with 300 μM H2O2 for 90 min. Data are expressed as the mean ± standard

homology-like domain, family A, member 1; H2O2, hydrogen peroxide; ROS, reactive

na

oxygen species.

Jo ur

Figure 6. PHLDA1 knockdown reduced myocardial ischemia-reperfusion injury. Following the tail vein injection of adenovirus to knock down PHLDA1, the isolated heart was injured by ischemia-reperfusion. (A) GFP fluorescence detection and Changes in (B) organizational form, (C) myocardial infarct size, and (D) protein expression of PHLDA1 and cleaved PARP1. Data are expressed as the mean ± standard deviation (n=6).

***

P<0.001,

**

P<0.01 and *P<0.05. PHLDA1, pleckstrin

homology-like domain, family A, member 1.

Figure 7. PHLDA1 knockdown reduced myocardial ischemia-reperfusion injury. Following the tail vein injection of adenovirus to knock down PHLDA1, the isolated heart was injured by ischemia-reperfusion. Changes in (A) apoptotic rate and (B) cleaved-caspase 3 expression. Data are expressed as the mean ± standard deviation (n=6). ***P<0.001, **P<0.01 and *P<0.05. PHLDA1, pleckstrin homology-like domain,

Journal Pre-proof family A, member 1.

Figure 8. Identification of Bax as a novel binding protein for PHLDA1 and enhanced binding

under

oxidative

stress

conditions.

(A,B)

Semi-exogenous

co-immunoprecipitation confirmed that PHLDA1 and Bax bind to each other. Flag or Flag-PHLDA1 was transfected in H9c2, and H9c2 lysate was immunoprecipitated with Bax or Flag antibody and then detected with Flag or Bax antibody. (C) Endogenous co-immunoprecipitation confirmed that PHLDA1 and Bax bind to each

of

other. The H9c2 lysate was immunoprecipitated with a Bax antibody and then

ro

detected with a PHLDA1 antibody. (D,E) Semi-exogenous co-immunoprecipitation confirmed that the binding of PHLDA1 to Bax was enhanced under H2O2 stimulation.

-p

(F) Endogenous co-immunoprecipitation confirmed that the binding of PHLDA1 to

re

Bax was enhanced under H2O2 stimulation. Change in the protein expression of Bax

lP

following (G) the transfection of Flag or Flag-PHLDA1 in H9c2 cells, (H) the transfection of control or PHLDA1 siRNA in H9c2 cells, and (I) PHLDA1 knockdown in the myocardium. Data are expressed as the mean ± standard deviation. P<0.001,

**

P<0.01 and *P<0.05. Bax, B-cell lymphoma 2-associated X protein;

na

***

peroxide.

Jo ur

PHLDA1, pleckstrin homology-like domain, family A, member 1; H2O2, hydrogen

Figure 9. PHLDA1 regulates Bax stability through a proteasomal pathway. Transfection of control or PHLDA1 siRNA in H9c2. Changes in (A) the protein expression of Bax after the stimulation of H9c2 cells with 100 μM MG132 for 6h. (B) the protein expression of Bax after the stimulation of H9c2 cells with 100 μM CHX for 3h and 6h. Data are expressed as the mean ± standard deviation.

***

**

P<0.001,

P<0.01 and *P<0.05. Bax, B-cell lymphoma 2-associated X protein; PHLDA1,

pleckstrin homology-like domain, family A, member 1;CHX, cycloheximide;

Journal Pre-proof

Conflicts of Interest The authors declare that there is no conflict of interest regarding the publication of this paper.

Authorship Conceptualization; Data curation; Formal analysis; Funding acquisition; Investigation; Methodology; Project administration; Resources; Software; Supervision; Validation; Visualization; Roles/Writing - original draft; Writing - review & editing：Dalin Jia.

of

Conceptualization; Data curation; Formal analysis; Investigation; Methodology;

ro

Project administration; Resources; Software; Supervision; Validation; Visualization; Roles/Writing - original draft; Writing - review & editing: Yingxian Sun.

Resources;

curation;

Formal

Software;

analysis;

Supervision;

Methodology;

Validation;

Project

Visualization;

re

administration;

Data

-p

Conceptualization;

Roles/Writing - original draft; Writing - review & editing：Yuxuan Guo. Resources;

lP

Data curation: Pengyu Jia. Methodology: Yuqiong Chen, Hang Yu. Software: Xin Xin.

Jo ur

na

Supervision: Yandong Bao, Huimin Yang. Formal analysis; Supervision: Nan Wu.

Figure 1

Figure 2

Figure 3

Figure 4

Figure 5

Figure 6

Figure 7

Figure 8

Figure 9