- Email: [email protected]
Phoenixin-20 suppresses lipopolysaccharide-induced inflammation in dental pulp cells
Journal Pre-proof Phoenixin-20 suppresses lipopolysaccharide-induced inflammation in dental pulp cells Guohui Sun, Qihui Ren, Li Bai, Lin Zhang PII:
S0009-2797(19)31636-9
DOI:
https://doi.org/10.1016/j.cbi.2020.108971
Reference:
CBI 108971
To appear in:
Chemico-Biological Interactions
Received Date: 27 September 2019 Revised Date:
19 December 2019
Accepted Date: 31 January 2020
Please cite this article as: G. Sun, Q. Ren, L. Bai, L. Zhang, Phoenixin-20 suppresses lipopolysaccharide-induced inflammation in dental pulp cells, Chemico-Biological Interactions (2020), doi: https://doi.org/10.1016/j.cbi.2020.108971. This is a PDF file of an article that has undergone enhancements after acceptance, such as the addition of a cover page and metadata, and formatting for readability, but it is not yet the definitive version of record. This version will undergo additional copyediting, typesetting and review before it is published in its final form, but we are providing this version to give early visibility of the article. Please note that, during the production process, errors may be discovered which could affect the content, and all legal disclaimers that apply to the journal pertain. © 2020 Published by Elsevier B.V.
Author statement Guohui Sun: Conceptualization, Methodology, Software, Investigation, Data curation, Visualization, Writing- Original draft preparation, Writing- Reviewing and Editing; Qihui Ren: Methodology, Software, Investigation, Validation; Li Bai: Resources, Resources, Validation; Lin Zhang: Software, Investigation.
Title: Phoenixin-20 suppresses lipopolysaccharide-induced inflammation in dental pulp cells Authors: Guohui Sun, Qihui Ren, Li Bai, Lin Zhang Affiliations Department of stomatology, The First Affiliated Hospital, College of Clinical Medicine of Henan University of Science and Technology, Luoyang, 471003, China Corresponding to: Guohui Sun Department of stomatology, The First Affiliated Hospital, College of Clinical Medicine of Henan University of Science and Technology, #24 Jinghua road, Jianxi District, Luoyang, Henan province, 471003, China Tel./Fax: +8618837980077 Email: [email protected]
1
Abstract Pulpal infection is one of the most common causes of dental emergency admission. Tooth pain due to infection caused by gram-negative bacteria is the main manifestation of this sort of dental problem. The GPR173 signaling pathway is a highly conserved G-protein-coupled receptor that mediates neurological and reproductive function. In this study, we found that GPR173 was fairly expressed in isolated human dental pulp cells, and its expression was reduced in response to pro-inflammatory lipopolysaccharide (LPS) treatment. The activation of GPR173 by its ligand Phoenixin-20 reduced LPS-induced cytotoxicity, as revealed by a reduction in the release of LDH. Additionally, Phoenixin-20 suppressed LPS-induced release of pro-inflammatory cytokines and inflammatory mediators, including IL-6, MCP-1, VCAM-1, and ICAM-1, as well as MMP-2 and MMP-9. Mechanistically, we showed the suppressive action of Phoenixin-20 on LPS-induced activation of TLR-4 and Myd88 as well as the activation of the NF-κB pathway. Collectively, our study demonstrates that the GPR173 signaling pathway is an important mediator of LPS-induced inflammation, and the activation of GPR173 by its natural ligand Phoenixin-20 exhibits robust anti-inflammatory effects in dental pulp cells, suggesting that GPR173 is an interesting target molecule in the development of pulp cell-based therapies. Keywords: GPR173; Phoenixin-20; Lipopolysaccharide (LPS); Inflammation; Human dental pulp cells (hDPCs)
2
1. Introduction Pulpal infection-induced tooth pain is a common reason for dental emergency admission [1]. Healthy tooth pulp is composed of dense blood vessels, nerves, and other connective tissues. The soft tissues of dental pulp are enclosed within other surrounding hard gum tissues, which act as a natural protective barrier to the pulp. However, untreated dental caries and dental procedures can expose pulpal tissues to the risk of microbial infection. Once the pulpal tissue is infected, the inflammatory response can cause rapid damage to the pulpal tissues [2]. A common cause of pulpal infection is gram-negative anaerobic bacteria [3]. Lipopolysaccharide (LPS), also called endotoxin, is an integral part of the cell wall in gram-negative bacteria. This type of bacteria produces toxic LPS during multiplication or death, which induces an acute inflammatory reaction [4]. LPS released from dental pulp is closely associated with the development of clinical symptoms [5]. LPS acts to activate immune and pulp cells to release major pro-inflammatory cytokines such as TNF-α and IL-1β, which further induce the release of countless other inflammatory mediators and chemokines, such as IL-6, MCP-1, MMPs, and other inflammatory markers, thereby amplifying the inflammatory response [6]. The LPS-activated acute inflammatory response in pulpal tissue can lead to the resorption of the hard tissues in the gums, or consequently, the loss of teeth [7]. Studies have shown that LPS-induced NF-κB activation plays a central role in dental pulp infection [8]. GPR173 is a member of the specific G-protein-coupled receptor (GPCR) family, which has been named as super conserved receptor expressed in the brain (SREB) [9].
3
The receptors in this family are highly conserved across species and strongly expressed in the central neural system. In recent years, GPR173 has been identified as the cognate receptor of a newly discovered hormone referred to as Phoenixin-20 [10]. Previous work has linked the Pheonixin/GPR173 pathway to many biological functions, such as cognitive function, depression, reproduction, and food-intake [11; 12; 13]. The discovery of the natural hormone Pheonixin-20 and its receptor provides a powerful tool to elucidate their function at the molecular level. In this study, we present our finding that GPR173 and its ligand hormone Phoenixin-20 play a critical role in modulating the function of dental pulp cells. 2. Materials and methods 2.1 Isolation of human dental pulp cells (hDPCs) and treatment Human dental pulp tissues were collected from extracted wisdom teeth (third molar) after approval by the institutional review board (IRB) of our university. All donors signed the informed consent form. Briefly, dental pulp tissues were separated from the tooth and digested by collagenase type I for 1 h at 37 °C. The digested cell suspension was incubated with DMEM containing 20% fetal bovine serum and antibiotics (Hyclone) in 5% CO2 at 37 °C. The isolated cells were maintained in 20% serum growth media supplemented with all of the applicable growth factors and used in low passage numbers. Lipopolysaccharide (LPS) was purchased from R&D Systems and dissolved in PBS with 0.1% BSA. Phoenixin-20 was purchased from Sigma-Aldrich and dissolved in DMSO solution. The hDPCs were treated with LPS (20 µg/ml) in the
4
presence or absence of Phoenixin-20 (15, 30 nM) for 24 hours. Lenti-viral GPR173 was transducted into hDPCs to knock down the expression of GPR173.
2.2 Lactate dehydrogenase (LDH) assay
The cytotoxicity of treated hDPCs was measured by LDH assay. The results are based on the measurement of LDH released into the culture medium. The cell culture medium was collected and centrifuged to obtain the cell-free supernatants. The activity of LDH in the medium was determined using a commercially available kit from Thermo Fisher Scientific, USA.
2.3 RNA isolation The total RNAs from the treated hDPCs were extracted using Qiazol reagent from Qiagen (Hilden, Germany). Briefly, the cells were lysed with 1 ml Qiazol and mixed with 0.2 ml chloroform to obtain the supernatant. Afterwards, 0.5 ml isopropanol was added to the collected aqueous phase portion. The pelleted nucleic acid was dissolved in 20 nM Tris-EDTA buffer. The DNA contaminates were removed by digesting the samples with 1 µg/ml of DNase I for 15 minutes. The RNA concentrations were then determined using a Nanadrop 2000 spectrophotometer from Thermo Fisher Scientific (Waltham, MA). 2.4 Real-time polymerase chain reaction (PCR) analysis A total of 1 µg RNA sample was used to reverse transcribe cDNA using an iScript™ cDNA Synthesis Kit from Bio-Rad (Hercules, CA) according to the product’s manual. The synthesized cDNA was diluted 1:10 with ddH2O. SYBR Green-based real time 5
PCR reactions were performed on an ABI 7500 Fast PCR instrument, all amplifications were run for 40 cycles at 95°C for 5 sec, 60°C for 20 sec, and 72°C for 30 sec. The expression levels of the following genes were monitored: GPR173, IL-6, MCP-1, VCAM-1, ICAM-1, MMP-2, MMP-9, TLR-4, and Myd88. The expression of GAPDH served as a quality control. The Ct values of the above genes were normalized to GAPHD and presented as fold-changes versus the control sample. The primer sequences are listed in Table 1. 2.5 Western blot analysis The treated hDPCs were lysed by RIPA buffer supplemented with protease inhibitor cocktail (Roche). Then, a total of 10 µg cell lysate from each sample was loaded into 4-12% precasted NU-PAGE gel (Themo Fisher Scientific, USA) to reach optimal separation. The gel was then transferred to a PVDF membrane followed by blocking for 1 h with 5% BSA-PBST. The cells were then incubated for 2 h with primary antibodies and reacted for 1 h with the corresponding chemiluminescence-labelled secondary antibodies at room temperature. The reacted blots were processed using an automatic iBright Imager (Themo Fisher Scientific). The densitometry of the blots was quantitated by Image J software (NIH).
2.6 Enzyme-linked immunosorbent assay (ELISA)
The culture media of hDPCs was collected to analyze the levels of secreted IL-6 and MCP-1. Two ELISA kits were purchased from R&D Systems. The experiments were performed following the manufacturer’s instructions. The relative levels of IL-6 and
6
MCP-1 were normalized to total the protein amounts, as represented by fold-change. In brief, the ELISA plates were incubated with blocking buffer and reacted with the collected samples. The captured antigen molecules were then detected using fluorescence-labelled antibodies. The data were recorded using 96-plate reader spectrometry. The absolute values were obtained from a standardized 4-PL curve.
2.7 Nuclear extracts The nuclear protein fractions from hDPCs were isolated using a commercial nuclear extraction kit from Thermo Fisher Scientific in accordance with the manufacturer’s instructions. The quality of the extracted nuclear protein was determined using lamin B1, and the expression of nuclear p65 was analyzed by western blot analysis and presented as the fold-change versus control sample. 2.8 Promoter assay NFκB-luciferase fused promoter vector was purchased from Clontech, USA. The hDPCs were co-transfected with NFκB promoter and a control vector containing vanilla luciferase promoter using Lipofectamine 2000 reagent (Thermo Fisher Scientific, USA). At 24 h post-transfection, the cells were subjected to treatment with 20 µg/ml LPS in the presence or absence of Phoenixin-20 at 15 and 30 nM concentrations for an additional 24 h. At 48-72 h post-transfection, the cells were lysed to measure the luciferase activity of firefly and renilla luciferases using a Dual Luciferase Kit (Promega). The relative luciferase activity was calculated by normalizing the activity of firefly luciferase to that of renilla luciferase. The data are presented as fold-changes compared to the control. 7
2.9 Statistics All data were collected based on experiments repeated in triplicate and presented as means ± standard deviation (S.D.). ANOVA followed by Tukey’s post-hoc test was used to compare differences between three or more groups. A P value of less than 0.05 was considered statistically significant.
3. Results 3.1 LPS suppresses GPR173 expression To test the effect of LPS stimulation on pulpal GPR173 expression, we performed both dose-response and time-course experiments in cultured hDPCs. The results indicate that treatment with the three doses of LPS (5, 10, and 20 µg/mL) for 24 h had a dose-dependent inhibitory effect on the mRNA (Figure 1A) and protein expression (Figure 1B) of GPR173. Next, we used a fixed LPS concentration of 20 µg/mL to perform a 12, 24, and 36 h time-course experiment. The results show that the best inhibitory effect occurred at 24 h at both the mRNA (Figure 1C) and protein levels (Figure 1D). 3.2 Phoenixin-20 mitigates LPS-induced cytotoxicity Next, we co-treated hDPCs with the GPR173 ligand Phoenixin-20. Our results show that 20 µg/mL LPS induced roughly 6-fold more LDH release, but the addition of the two doses of Phoenixin-20 (15, 30 nM) dramatically decreased the LPS-induced increase in LDH release in a dose-responsive manner (Figure 2), indicating that the activation of GPR173 by Phoenixin-20 is mitigated by LPS-induced cytotoxicity.
8
3.3 Phoenixin-20 suppresses LPS-induced cytokines production Next, we assessed the influence of Phoenixin-20 on the production of two key pro-inflammatory cytokines, IL-6 and MCP-1. At the mRNA level, Phoenixin-20 displayed dose-responsive suppression of the LPS-induced expression of both of these cytokines (Figure 3A). Through ELISA assay, we confirmed the suppressive effect of Phoenixin-20 on the protein production of IL-6 and MCP-1 (Figure 3B). 3.4 Phoenixin-20 suppresses LPS-induced expression of VCAM-1 and ICAM-1 We also measured the expression of two major pro-inflammatory adhesion molecules (VCAM-1 and ICAM-1) among our treatment groups. As expected, the results show that Phoenixin-20 dose-responsively suppressed LPS-induced mRNA transcription of both VCAM-1 and ICAM-1 (Figure 4A). Meanwhile, we demonstrated that Phoenixin-20 exerted very similar suppressive effect on the protein expression of these two molecules (Figure 4B). 3.5 Phoenixin-20 inhibits LPS-induced expression of MMP-2 and MMP-9 Additionally, we tested whether Phoenixin-20 had an influence on LPS-induced expression of matrix metalloproteinases. Indeed, the same treatment with Phoenixin-20 dose-responsively inhibited LPS-induced mRNA transcripions of both MMP-2 and MMP-9 (Figure 5A). At the protein level, Phoenixin-20 exhibited a very similar inhibitory effect on these two metalloproteiniases (Figure 5B) 3.6 Phoenixin-20 suppresses LPS-induced TLR4 expression Next, we explored the molecular mechanism involved in the effects of Phoenixin-20. LPS is known to activate toll-like receptor (TLR) proteins in immune cells. Our
9
experiment found that Phoenixin-20 dramatically suppressed LPS-induced TLR-4 expression. Again, this suppressive effect is dose-responsive at both the mRNA (Figure 6A) and protein levels (Figure 6B). 3.7 Phoenixin-20 suppresses LPS-induced expression of MyD88 MyD88 mediates the downstream response to LPS stimulation. Thus, we hypothesized that Phoenixin-20 could have some impact on the expression of this molecule. Indeed, we confirmed that the presence of Phoenixin-20 dose-responsively suppressed LPS-induced MyD88 expression at both the mRNA (Figure 7A) and protein levels (Figure 7B). 3.8 Phoenixin-20 mitigates LPS-induced activation of NF-kB We assessed the impact of Phoenixin-20 on the transcription of the inflammatory regulator NF-κB. LPS-induced NF-kB activation begins with the translocation of the NF-κB precursor protein p65. Thus, we examined the nuclear portion of p65 and the activity of transfected NF-kB luciferase promoter. As expected, Phoenixin-20 dose-responsively inhibited LPS-induced p65 nuclear deposition (Figure 8A). Furthermore, Phoenixin-20 displayed a strong suppressive effect on transfected NF-kB activity by dose-responsively suppressing the LPS-induced reporter activity of NF-κB (Figure 8B). 3.9 The effect of Phoenixin-20 requires GPR173 Finally, we investigated the dependency of Phoenixin-20 on the GPR173 signaling pathway. By delivering GPR173-specific shRNA into hDPCs, we achieved highly successful GPR173 silencing. We found that Phoenixin-20 completely lost its
10
inhibitory effect on MMP-2 and MMP-9 in GPR173-silent hDPCs, both at the mRNA (Figure 9A) and protein levels (Figure 9B). Meanwhile, our promoter assay demonstrated that the silencing of GPR173 completely abolished the suppressive effect of Phoenixin-20 on NF-kB activation (Figure 9C). 4. Discussion Dental pulp cells (DPCs) are pluripotent stem cells that have the potential to differentiate into different cell linages [14]. In healthy conditions, DPCs usually remain quiescent in the dental pulp, but can be quickly activated when the pulp is injured or stimulated by bacterial infection. DPCs have the capacity to differentiate into odontoblasts, osteoblasts, and chondrocytes to produce dentin, bone, and cartilage tissues, respectively, as required for the processes of repair or remodeling. Because of their differentiation potential, DPC regeneration represents a new direction in dental tissue engineering or cell-based therapy [15; 16]. Phoenixins represent a class of newly identified pleiotropic hormones. So far, two active isoforms of phoenixins have been identified, including a 20 amino acid peptide Phoenixin-20 and a 14 amino acid peptide Phoenixin-14. Phonexin-14 is the truncated form of Phoenixin-20, and they share similar biological actions in many aspects [17]. Recent work shows that both Phoenixin-20 and Phoenixin-14 can be isolated from brain, heart, thymus, lung, and kidney tissues, suggesting that Phoenixin/GPR173 signaling could mediate different functions depending on the context of the local environment [18]. In our study, we evaluated the expression of the GPR173 receptor in dental pulp cells. We found that GPR173 was fairly expressed in isolated dental
11
pulp cells. Also, when the dental pulp cells were stimulated by LPS, the expression of GPR173 was time- and dose-responsively repressed. These findings imply that GPR173 might be an inflammatory response effector, and therefore, could have a potential role in the inflammation-mediated activation of pulp cells. Thus, we conducted a full investigation of pulpal GPR173 by stimulating human dental pulp cells with the natural ligand of GPR173, Phoenixin-20. Our data indicate that the activation of GPR173 by Phoenixin-20 resulted in a series of protective effects in the context of LPS stimulation. A representative sketch of the underlying molecular mechanism is shown in Figure 10. Firstly, we showed that the presence of Phoenixin-20 reduced LPS-induced cytotoxicity as evidenced by the reduced release of LDH. Secondly, we showed that Phoenixin-20 suppressed the expression of all of the examined pro-inflammatory cytokines and mediators induced by LPS, including IL-6, MCP-1, VCAM-1, ICAM-1, MMP-2, and MMP-9. Mechanistically, we showed that the action of Phoenixin-20 suppressed the LPS-induced activation of TLR-4 and MyD88 as well as the NF-κB pathway. The wide range of inhibitive effects of Phoenixin-20 on these inflammatory mediators indicates that Phoenixin/GPR173 signaling is a critical pathway in LPS-induced dental pulp inflammation.
TLR-4 on the cell surface is known to recognize LPS produced by gram-negative bacteria [19], and TLR-4 activation is induced by LPS and acts as the immune sensor in dental pulp cells [20; 21]. Upon its binding to LPS, MyD88 is recruited as an adaptor to activate cellular inflammatory signals. The activation of these
12
inflammatory cascades leads to the translocation of NF-κB protein into the nuclei of pulp cells, where it transcribes numerous cytokines and mediators. Previous work has shown that the expression of IL-6, MCP-1, VCAM-1, and ICAM-1 is a direct response of NFκB activation, and their induction contributes to both destructive and reparative processes in the pulp [22]. The activation of pulpal MMP-2 and MMP-9 has been shown to be involved in the degradation of collagenous tissue and tissue remodeling [23]. Finally, we found that knockdown of GPR173 completely abolished the anti-inflammatory effect of Phoenixin-20 in dental pulp cells. Thus, we conclude that the beneficial effect of Phoenixin-20 is dependent on GPR173 expression. Based on this evidence, we affirm that the Phoenixin/GPR173 signaling axis is an important regulatory mechanism of pulpal inflammation. Although we still lack an understanding of the mechanism of GPR173-mediated inflammatory signaling involving molecules such as TLR-4, MyD88, and the NF-κB pathway, our study demonstrates that Phoenixin-20-GPR173 signaling is another vital node in the regulatory network of inflammation in dental pulp cells.
Dental pulp is known for its capacity to self-regenerate, and it is the most natural source through which to obtain dental stem cells. Dental stem cells have been shown to promote bone augmentation and healing in periodontal diseases, and cell-based therapeutic trials have shown the potential of dental stem cells to restore structural defects (15, 24). The inflammatory response is traditionally labelled as a “bad response” in pulpal infection, but recent research has elucidated that a proper low
13
level of inflammation is essential for the processes of pulpal tissue repair and regeneration. Therefore, the cellular inflammatory level must be maintained at a low level in order to guide pulp cells toward regeneration [25; 26]. The involvement of G-protein-coupled receptors in stem cells has been investigated extensively. There is evidence that GPR173 is one of the regulated G-protein-coupled receptors involved in stem cell maintenance and somatic reprogramming to iPSCs [27]. Our study indicates that the activation of GPR173 by its natural ligand Phonexin-20 protects pulp cells from excess inflammation and evokes the potential for pulpal regeneration. Unlike many synthesized compounds, Phoenixin-20 is a natural hormone which makes it a perfect choice to protect stem cells from inflammatory stimuli and promote their regeneration. Thus, Phoenixin-20 could have potential therapeutic implications in pulp stem cell-based treatment trials.
Conflicts None. References 1. Roberts G, Scully C, Shotts R. ABC of oral health. Dental emergencies. BMJ. 2000; 321(7260):559-62. 2. Park SH, Ye L, Love RM, Farges JC, Yumoto H. Inflammation of the Dental Pulp. Mediators Inflamm. 2015; 2015:980196. 3. Rechenberg DK, Galicia JC, Peters OA. Biological Markers for Pulpal Inflammation: A Systematic Review. PLoS One. 2016;11(11):e0167289.
14
4. Bindal P, Ramasamy TS, Kasim NHA, Gnanasegaran N, Chai WL. Immune responses of human dental pulp stem cells in lipopolysaccharide-induced microenvironment. Cell Biol Int. 2018; 42(7):832-840. 5. Narayanan LL, Vaishnavi C. Endodontic microbiology. J Conserv Dent. 2010; 13(4):2339. 6. Coil J, Tam E, Waterfield JD. Proinflammatory cytokine profiles in pulp fibroblasts stimulated with lipopolysaccharide and methyl mercaptan. J Endod. 2004; 30(2):88-91. 7. Kamat M, Puranik R, Vanaki S, Kamat S. An insight into the regulatory mechanisms of cells involved in resorption of dental hard tissues. J Oral Maxillofac Pathol. 2013; 17(2):228-33. 8. Chang J, Zhang C, Tani-Ishii N, Shi S, Wang CY. NF-kappaB activation in human dental pulp stem cells by TNF and LPS. J Dent Res. 2005; 84(11):994-8. 9. Matsumoto M, Beltaifa S, Weickert CS, Herman MM, Hyde TM, Saunders RC, Lipska BK, Weinberger DR, Kleinman JE. A conserved mRNA expression profile of SREB2(GPR85) in adult human, monkey, and rat forebrain. Brain Res Mol Brain Res. 2005;138(1):58-69. 10. Yosten GL, Lyu RM, Hsueh AJ, Avsian-Kretchmer O, Chang JK, Tullock CW, Dun SL, Dun N, Samson WK. A novel reproductive peptide, phoenixin. J Neuroendocrinol. 2013; 25(2):206-15. 11. Mcilwraith EK, Belsham DD. Phoenixin: uncovering its receptor, signaling and functions. Acta Pharmacol Sin. 2018; 39(5):774-778.
15
12. Schalla MA, Stengel A. The role of phoenixin in behavior and food intake. Peptides. 2019; 114:38-43. 13. Stein LM, Haddock CJ, Samson WK, Kolar GR, Yosten GLC. The phoenixins: From discovery of the hormone to identification of the receptor and potential physiologic actions. Peptides. 2018; 106:45-48. 14. Tatullo M, Marrelli M, Shakesheff KM, White LJ. Dental pulp stem cells: function, isolation and applications in regenerative medicine. J Tissue Eng Regen Med. 2015; 9(11):1205-16. 15. Potdar PD, Jethmalani YD. Human dental pulp stem cells: Applications in future regenerative medicine. World J Stem Cells. 2015; 7(5):839-51. 16. Cooper PR, Holder MJ, Smith AJ. Inflammation and regeneration in the dentin-pulp complex: a double-edged sword. J Endod. 2014; 40(4 Suppl):S46-51. 17. Yuan T, Sun Z, Zhao W, Wang T, Zhang J, Niu D. Phoenixin: A Newly Discovered Peptide with Multi-Functions. Protein Pept Lett. 2017; 24(6):472-475. 18. Lyu RM, Cowan A, Zhang Y, Chen YH, Dun SL, Chang JK, Dun NJ, Luo JJ. Phoenixin: a novel brain-gut-skin peptide with multiple bioactivity. Acta Pharmacol Sin. 2018; 39(5):770-773 19. Laird MH, Rhee SH, Perkins DJ, Medvedev AE, Piao W, Fenton MJ, Vogel SN. TLR4/MyD88/PI3K interactions regulate TLR4 signaling. J Leukoc Biol. 2009; 85(6):966-77. 20. Schmalz G, Krifka S, Schweikl H. Toll-like receptors, LPS, and dental monomers. Adv Dent Res. 2011; 23(3):302-6.
16
21. Staquet MJ, Carrouel F, Keller JF, Baudouin C, Msika P, Bleicher F, Kufer TA, Farges JC. Pattern-recognition receptors in pulp defense. Adv Dent Res. 2011; 23(3):296-301. 22. Kokkas A, Goulas A, Stavrianos C, Anogianakis G. The role of cytokines in pulp inflammation. J Biol Regul Homeost Agents. 2011; 25(3):303-11. 23. Jain A, Bahuguna R. Role of matrix metalloproteinases in dental caries, pulp and periapical inflammation: An overview. J Oral Biol Craniofac Res. 2015; 5(3):212-8. 24 Morsczeck C, Reichert TE. Dental stem cells in tooth regeneration and repair in the future. Expert Opin Biol Ther. 2018 Feb;18(2):187-196. 25. Cooper PR, Chicca IJ, Holder MJ, Milward MR. Inflammation and Regeneration in the Dentin-pulp Complex: Net Gain or Net Loss? J Endod. 2017; 43(9S):S87-S94. 26. Fawzy El-Sayed KM, Elsalawy R, Ibrahim N, Gadalla M, Albargasy H, Zahra N, Mokhtar S, Elnahhas N, Elkaliouby Y, Doerfer C. The dental pulp stem/progenitor cells-mediated
inflammatory-regenerative
axis.
Tissue
Eng
Part
B
Rev.
2019;25(5):445-460. 27 Choi HY, Saha SK, Kim K, Kim S, Yang GM, Kim B, Kim JH, Cho SG. G protein-coupled receptors in stem cell maintenance and somatic reprogramming to pluripotent or cancer stem cells. BMB Rep. 2015 Feb;48(2):68-80. Figure legends Figure 1. Lipopolysaccharide (LPS) reduced the expression of GPR173 in human dental pulp cells (hDPCs). hDPCs were treated with 5, 10, and 20 µg/mL LPS for 24 h. (A). mRNA levels of GPR173, n=5 for each group; (B). Protein levels of GPR173,
17
n=3 for each group; (C-D). Time-course experiment performed with 20 µg/mL LPS for 12, 24 and 48 hr. mRNA (n=5) and protein (n=3) expression of GPR173 was measured (*, P<0.01; **, P<0.001; ***, P<0.0001 vs. vehicle group).. Figure 2. Phoenixin-20 reduced lipopolysaccharide (LPS)-induced release of lactate dehydrogenase (LDH). hDPCs were treated with 20 µg/mL LPS in the presence or absence of Phoenixin-20 (15, 30 nM) for 24 h. The release of LDH was measured using a commercial kit (***, P<0.0001 vs. vehicle group; ##, P<0.001 vs. LPS group, $$, P<0.001 vs LPS+15 nM Phoenixin-20 group, n=3 for each group). Figure 3. Phoenixin-20 reduced lipopolysaccharide (LPS)-induced expression of pro-inflammatory cytokines. hDPCs were treated with 20 µg/mL LPS in the presence or absence of Phoenixin-20 (15, 30 nM) for 24 h. (A). mRNA of IL-6 and MCP-1, n=5 for each group; (B). Secretions of IL-6, n=3 for each group; (***, P<0.0001 vs. vehicle group; ##, P<0.001 vs. LPS group; $$, P<0.001 vs LPS+15 nM Phoenixin-20 group; $, P<0.01 vs. LPS+15 nM Phoenixin-20 group). Figure 4. Phoenixin-20 reduced lipopolysaccharide (LPS)-induced expression of VCAM-1 and ICAM-1. hDPCs were treated with 20 µg/mL LPS in the presence or absence of Phoenixin-20 (15, 30 nM) for 24 h. (A). mRNA of VCAM-1 and ICAM-1, n=5 for each group; (B). Protein levels of VCAM-1 and ICAM-1 as measured by western blot analysis, n=3 for each group (***, P<0.0001 vs. vehicle group; ##, P<0.001 vs. LPS group; $$, P<0.001 vs LPS+15 nM Phoenixin-20 group). Figure 5. Phoenixin-20 prevented lipopolysaccharide (LPS)- induced expression of MMP-2 and MMP-9. hDPCs were treated with 20 µg/mL LPS in the presence or
18
absence of Phoenixin-20 (15, 30 nM) for 24 h. (A). mRNA of MMP-2 and MMP-9, n=5 for each group; (B). Protein of MMP-2 and MMP-9, n=3 for each group (***, P<0.0001 vs. vehicle group; ##, P<0.001 vs. LPS group; $$, P<0.001 vs LPS+15 nM Phoenixin-20 group; $, P<0.01 vs. LPS+15 nM Phoenixin-20 group). Figure 6. Phoenixin-20 reduced lipopolysaccharide (LPS)-induced expression of TLR-4. hDPCs were treated with 20 µg/mL LPS in the presence or absence of Phoenixin-20 (15, 30 nM) for 24 h. (A). mRNA of TLR4, n=5 for each group; (B). Protein of TLR4, n=3 for each group (***, P<0.0001 vs. vehicle group; ##, P<0.001 vs. LPS group; $$, P<0.001 vs LPS+15 nM Phoenixin-20 group; $, P<0.01 vs. LPS+15 nM Phoenixin-20 group). Figure 7. Phoenixin-20 reduced lipopolysaccharide (LPS)-induced expression of MyD88. hDPCs were treated with 20 µg/mL LPS in the presence or absence of Phoenixin-20 (15, 30 nM) for 24 h. (A). mRNA of Myd-88, n=5 for each group; (B). Protein of MyD88, n=3 for each group (***, P<0.0001 vs. vehicle group; ##, P<0.001 vs. LPS group; $$, P<0.001 vs LPS+15 nM Phoenixin-20 group; $, P<0.01 vs. LPS+15 nM Phoenixin-20 group). Figure 8. Phoenixin-20 prevented lipopolysaccharide (LPS)-induced activation of NF-κB. hDPCs were treated with 20 µg/mL LPS in the presence or absence of Phoenixin-20 (15, 30 nM) for 24 h. (A). Nuclear levels of NF-κB p65, n=3 for each group; (B). Luciferase activity of NF-κB promoter, n=4 for each condition (***, P<0.0001 vs. vehicle group; ##, P<0.001 vs. LPS group; $$, P<0.001 vs LPS+15 nM Phoenixin-20 group; ###, P<0.0001 vs. LPS group; $$$, P<0.0011 vs. LPS+15 nM
19
Phoenixin-20 group). Figure 9 Silencing of GPR173 abolished the anti-inflammatory effect of Phoenixin-20 in hDPCs. Lenti-viral GPR173 was transducted into hDPCs to knock down the expression of GPR173. At 12h post-transfection, hDPCs were treated with 20 µg/mL LPS and Phoenixin-20 (15, 30 nM) for 24 h. (A). MMP-2 and MMP-9 mRNA change, n=5 for each group; (B). MMP-2 and MMP-9 protein expression, n=3 for each group; (C) NF-κB promoter assay in GPR173-expressing and GPR173-silent hDPCs, n=4 for each group. Figure 10. A representative sketch of the underlying molecular mechanism.
20
Table 1 Primers sequences used for real time PCR Target gene
Upstream Sequence (5’-3’)
Downstream Sequence (5’-3’)
GPR173
TGCCCGGTGCACACACGTAA
TCGACTTCCTACCACGGGCAC
MMP-2
TAACCTGGATGCCGTCGT
TTCAGGTAATAAGCACCCTTGAA
MMP-9
GAACCAATCTCACCGACAGG
GCCACCCGAGTGTAACCATA
MCP-1 IL-6 VCAM-1
TTCTGTGCCTGCTGCTCAT TTGGGAAGGTTACATCAGATCAT TGAATCTAGGAAATTGGAAAAAGG
GGGGCATTGATTTGCATCT GGGTTGGTCCATGTCAATTT AACAAATACATGGATGGGCTTT
ICAM-1
CCTTCCTCACCGTGTACTGG
AGCGTAGGGTAAGGTTCTTGC
TLR4
CCCTGAGGCATTTAGGCAGCTA
AGGTAGAGAGGTGGCTTAGGCT
MyD88
GAGGCTGAGAAGCCTTTACAGG
GCAGATGAAGGCATCGAAACGC
GAPDH
AGCCACATCGCTCAGACAC
GCCCAATACGACCAAATCC
Highlights LPS reduced the expression of GPR173 in human dental pulp cells (hDPCs); Phoenixin-20 reduced LPS- induced release of LDH in hDPCs; Phoenixin-20 reduced LPS- induced IL-6, MCP-1, VCAM-1, ICAM-1, MMP-2, and MMP-9; Phoenixin-20 abolished LPS- induced activation of TLR4/ Myd-88/ NF-kB in hDPCs.
Declaration of interests ☑ The authors declare that they have no known competing financial interests or personal relationships that could have appeared to influence the work reported in this paper. ☐The authors declare the following financial interests/personal relationships which may be considered as potential competing interests:
S0009-2797(19)31636-9
DOI:
https://doi.org/10.1016/j.cbi.2020.108971
Reference:
CBI 108971
To appear in:
Chemico-Biological Interactions
Received Date: 27 September 2019 Revised Date:
19 December 2019
Accepted Date: 31 January 2020
Please cite this article as: G. Sun, Q. Ren, L. Bai, L. Zhang, Phoenixin-20 suppresses lipopolysaccharide-induced inflammation in dental pulp cells, Chemico-Biological Interactions (2020), doi: https://doi.org/10.1016/j.cbi.2020.108971. This is a PDF file of an article that has undergone enhancements after acceptance, such as the addition of a cover page and metadata, and formatting for readability, but it is not yet the definitive version of record. This version will undergo additional copyediting, typesetting and review before it is published in its final form, but we are providing this version to give early visibility of the article. Please note that, during the production process, errors may be discovered which could affect the content, and all legal disclaimers that apply to the journal pertain. © 2020 Published by Elsevier B.V.
Author statement Guohui Sun: Conceptualization, Methodology, Software, Investigation, Data curation, Visualization, Writing- Original draft preparation, Writing- Reviewing and Editing; Qihui Ren: Methodology, Software, Investigation, Validation; Li Bai: Resources, Resources, Validation; Lin Zhang: Software, Investigation.
Title: Phoenixin-20 suppresses lipopolysaccharide-induced inflammation in dental pulp cells Authors: Guohui Sun, Qihui Ren, Li Bai, Lin Zhang Affiliations Department of stomatology, The First Affiliated Hospital, College of Clinical Medicine of Henan University of Science and Technology, Luoyang, 471003, China Corresponding to: Guohui Sun Department of stomatology, The First Affiliated Hospital, College of Clinical Medicine of Henan University of Science and Technology, #24 Jinghua road, Jianxi District, Luoyang, Henan province, 471003, China Tel./Fax: +8618837980077 Email: [email protected]
1
Abstract Pulpal infection is one of the most common causes of dental emergency admission. Tooth pain due to infection caused by gram-negative bacteria is the main manifestation of this sort of dental problem. The GPR173 signaling pathway is a highly conserved G-protein-coupled receptor that mediates neurological and reproductive function. In this study, we found that GPR173 was fairly expressed in isolated human dental pulp cells, and its expression was reduced in response to pro-inflammatory lipopolysaccharide (LPS) treatment. The activation of GPR173 by its ligand Phoenixin-20 reduced LPS-induced cytotoxicity, as revealed by a reduction in the release of LDH. Additionally, Phoenixin-20 suppressed LPS-induced release of pro-inflammatory cytokines and inflammatory mediators, including IL-6, MCP-1, VCAM-1, and ICAM-1, as well as MMP-2 and MMP-9. Mechanistically, we showed the suppressive action of Phoenixin-20 on LPS-induced activation of TLR-4 and Myd88 as well as the activation of the NF-κB pathway. Collectively, our study demonstrates that the GPR173 signaling pathway is an important mediator of LPS-induced inflammation, and the activation of GPR173 by its natural ligand Phoenixin-20 exhibits robust anti-inflammatory effects in dental pulp cells, suggesting that GPR173 is an interesting target molecule in the development of pulp cell-based therapies. Keywords: GPR173; Phoenixin-20; Lipopolysaccharide (LPS); Inflammation; Human dental pulp cells (hDPCs)
2
1. Introduction Pulpal infection-induced tooth pain is a common reason for dental emergency admission [1]. Healthy tooth pulp is composed of dense blood vessels, nerves, and other connective tissues. The soft tissues of dental pulp are enclosed within other surrounding hard gum tissues, which act as a natural protective barrier to the pulp. However, untreated dental caries and dental procedures can expose pulpal tissues to the risk of microbial infection. Once the pulpal tissue is infected, the inflammatory response can cause rapid damage to the pulpal tissues [2]. A common cause of pulpal infection is gram-negative anaerobic bacteria [3]. Lipopolysaccharide (LPS), also called endotoxin, is an integral part of the cell wall in gram-negative bacteria. This type of bacteria produces toxic LPS during multiplication or death, which induces an acute inflammatory reaction [4]. LPS released from dental pulp is closely associated with the development of clinical symptoms [5]. LPS acts to activate immune and pulp cells to release major pro-inflammatory cytokines such as TNF-α and IL-1β, which further induce the release of countless other inflammatory mediators and chemokines, such as IL-6, MCP-1, MMPs, and other inflammatory markers, thereby amplifying the inflammatory response [6]. The LPS-activated acute inflammatory response in pulpal tissue can lead to the resorption of the hard tissues in the gums, or consequently, the loss of teeth [7]. Studies have shown that LPS-induced NF-κB activation plays a central role in dental pulp infection [8]. GPR173 is a member of the specific G-protein-coupled receptor (GPCR) family, which has been named as super conserved receptor expressed in the brain (SREB) [9].
3
The receptors in this family are highly conserved across species and strongly expressed in the central neural system. In recent years, GPR173 has been identified as the cognate receptor of a newly discovered hormone referred to as Phoenixin-20 [10]. Previous work has linked the Pheonixin/GPR173 pathway to many biological functions, such as cognitive function, depression, reproduction, and food-intake [11; 12; 13]. The discovery of the natural hormone Pheonixin-20 and its receptor provides a powerful tool to elucidate their function at the molecular level. In this study, we present our finding that GPR173 and its ligand hormone Phoenixin-20 play a critical role in modulating the function of dental pulp cells. 2. Materials and methods 2.1 Isolation of human dental pulp cells (hDPCs) and treatment Human dental pulp tissues were collected from extracted wisdom teeth (third molar) after approval by the institutional review board (IRB) of our university. All donors signed the informed consent form. Briefly, dental pulp tissues were separated from the tooth and digested by collagenase type I for 1 h at 37 °C. The digested cell suspension was incubated with DMEM containing 20% fetal bovine serum and antibiotics (Hyclone) in 5% CO2 at 37 °C. The isolated cells were maintained in 20% serum growth media supplemented with all of the applicable growth factors and used in low passage numbers. Lipopolysaccharide (LPS) was purchased from R&D Systems and dissolved in PBS with 0.1% BSA. Phoenixin-20 was purchased from Sigma-Aldrich and dissolved in DMSO solution. The hDPCs were treated with LPS (20 µg/ml) in the
4
presence or absence of Phoenixin-20 (15, 30 nM) for 24 hours. Lenti-viral GPR173 was transducted into hDPCs to knock down the expression of GPR173.
2.2 Lactate dehydrogenase (LDH) assay
The cytotoxicity of treated hDPCs was measured by LDH assay. The results are based on the measurement of LDH released into the culture medium. The cell culture medium was collected and centrifuged to obtain the cell-free supernatants. The activity of LDH in the medium was determined using a commercially available kit from Thermo Fisher Scientific, USA.
2.3 RNA isolation The total RNAs from the treated hDPCs were extracted using Qiazol reagent from Qiagen (Hilden, Germany). Briefly, the cells were lysed with 1 ml Qiazol and mixed with 0.2 ml chloroform to obtain the supernatant. Afterwards, 0.5 ml isopropanol was added to the collected aqueous phase portion. The pelleted nucleic acid was dissolved in 20 nM Tris-EDTA buffer. The DNA contaminates were removed by digesting the samples with 1 µg/ml of DNase I for 15 minutes. The RNA concentrations were then determined using a Nanadrop 2000 spectrophotometer from Thermo Fisher Scientific (Waltham, MA). 2.4 Real-time polymerase chain reaction (PCR) analysis A total of 1 µg RNA sample was used to reverse transcribe cDNA using an iScript™ cDNA Synthesis Kit from Bio-Rad (Hercules, CA) according to the product’s manual. The synthesized cDNA was diluted 1:10 with ddH2O. SYBR Green-based real time 5
PCR reactions were performed on an ABI 7500 Fast PCR instrument, all amplifications were run for 40 cycles at 95°C for 5 sec, 60°C for 20 sec, and 72°C for 30 sec. The expression levels of the following genes were monitored: GPR173, IL-6, MCP-1, VCAM-1, ICAM-1, MMP-2, MMP-9, TLR-4, and Myd88. The expression of GAPDH served as a quality control. The Ct values of the above genes were normalized to GAPHD and presented as fold-changes versus the control sample. The primer sequences are listed in Table 1. 2.5 Western blot analysis The treated hDPCs were lysed by RIPA buffer supplemented with protease inhibitor cocktail (Roche). Then, a total of 10 µg cell lysate from each sample was loaded into 4-12% precasted NU-PAGE gel (Themo Fisher Scientific, USA) to reach optimal separation. The gel was then transferred to a PVDF membrane followed by blocking for 1 h with 5% BSA-PBST. The cells were then incubated for 2 h with primary antibodies and reacted for 1 h with the corresponding chemiluminescence-labelled secondary antibodies at room temperature. The reacted blots were processed using an automatic iBright Imager (Themo Fisher Scientific). The densitometry of the blots was quantitated by Image J software (NIH).
2.6 Enzyme-linked immunosorbent assay (ELISA)
The culture media of hDPCs was collected to analyze the levels of secreted IL-6 and MCP-1. Two ELISA kits were purchased from R&D Systems. The experiments were performed following the manufacturer’s instructions. The relative levels of IL-6 and
6
MCP-1 were normalized to total the protein amounts, as represented by fold-change. In brief, the ELISA plates were incubated with blocking buffer and reacted with the collected samples. The captured antigen molecules were then detected using fluorescence-labelled antibodies. The data were recorded using 96-plate reader spectrometry. The absolute values were obtained from a standardized 4-PL curve.
2.7 Nuclear extracts The nuclear protein fractions from hDPCs were isolated using a commercial nuclear extraction kit from Thermo Fisher Scientific in accordance with the manufacturer’s instructions. The quality of the extracted nuclear protein was determined using lamin B1, and the expression of nuclear p65 was analyzed by western blot analysis and presented as the fold-change versus control sample. 2.8 Promoter assay NFκB-luciferase fused promoter vector was purchased from Clontech, USA. The hDPCs were co-transfected with NFκB promoter and a control vector containing vanilla luciferase promoter using Lipofectamine 2000 reagent (Thermo Fisher Scientific, USA). At 24 h post-transfection, the cells were subjected to treatment with 20 µg/ml LPS in the presence or absence of Phoenixin-20 at 15 and 30 nM concentrations for an additional 24 h. At 48-72 h post-transfection, the cells were lysed to measure the luciferase activity of firefly and renilla luciferases using a Dual Luciferase Kit (Promega). The relative luciferase activity was calculated by normalizing the activity of firefly luciferase to that of renilla luciferase. The data are presented as fold-changes compared to the control. 7
2.9 Statistics All data were collected based on experiments repeated in triplicate and presented as means ± standard deviation (S.D.). ANOVA followed by Tukey’s post-hoc test was used to compare differences between three or more groups. A P value of less than 0.05 was considered statistically significant.
3. Results 3.1 LPS suppresses GPR173 expression To test the effect of LPS stimulation on pulpal GPR173 expression, we performed both dose-response and time-course experiments in cultured hDPCs. The results indicate that treatment with the three doses of LPS (5, 10, and 20 µg/mL) for 24 h had a dose-dependent inhibitory effect on the mRNA (Figure 1A) and protein expression (Figure 1B) of GPR173. Next, we used a fixed LPS concentration of 20 µg/mL to perform a 12, 24, and 36 h time-course experiment. The results show that the best inhibitory effect occurred at 24 h at both the mRNA (Figure 1C) and protein levels (Figure 1D). 3.2 Phoenixin-20 mitigates LPS-induced cytotoxicity Next, we co-treated hDPCs with the GPR173 ligand Phoenixin-20. Our results show that 20 µg/mL LPS induced roughly 6-fold more LDH release, but the addition of the two doses of Phoenixin-20 (15, 30 nM) dramatically decreased the LPS-induced increase in LDH release in a dose-responsive manner (Figure 2), indicating that the activation of GPR173 by Phoenixin-20 is mitigated by LPS-induced cytotoxicity.
8
3.3 Phoenixin-20 suppresses LPS-induced cytokines production Next, we assessed the influence of Phoenixin-20 on the production of two key pro-inflammatory cytokines, IL-6 and MCP-1. At the mRNA level, Phoenixin-20 displayed dose-responsive suppression of the LPS-induced expression of both of these cytokines (Figure 3A). Through ELISA assay, we confirmed the suppressive effect of Phoenixin-20 on the protein production of IL-6 and MCP-1 (Figure 3B). 3.4 Phoenixin-20 suppresses LPS-induced expression of VCAM-1 and ICAM-1 We also measured the expression of two major pro-inflammatory adhesion molecules (VCAM-1 and ICAM-1) among our treatment groups. As expected, the results show that Phoenixin-20 dose-responsively suppressed LPS-induced mRNA transcription of both VCAM-1 and ICAM-1 (Figure 4A). Meanwhile, we demonstrated that Phoenixin-20 exerted very similar suppressive effect on the protein expression of these two molecules (Figure 4B). 3.5 Phoenixin-20 inhibits LPS-induced expression of MMP-2 and MMP-9 Additionally, we tested whether Phoenixin-20 had an influence on LPS-induced expression of matrix metalloproteinases. Indeed, the same treatment with Phoenixin-20 dose-responsively inhibited LPS-induced mRNA transcripions of both MMP-2 and MMP-9 (Figure 5A). At the protein level, Phoenixin-20 exhibited a very similar inhibitory effect on these two metalloproteiniases (Figure 5B) 3.6 Phoenixin-20 suppresses LPS-induced TLR4 expression Next, we explored the molecular mechanism involved in the effects of Phoenixin-20. LPS is known to activate toll-like receptor (TLR) proteins in immune cells. Our
9
experiment found that Phoenixin-20 dramatically suppressed LPS-induced TLR-4 expression. Again, this suppressive effect is dose-responsive at both the mRNA (Figure 6A) and protein levels (Figure 6B). 3.7 Phoenixin-20 suppresses LPS-induced expression of MyD88 MyD88 mediates the downstream response to LPS stimulation. Thus, we hypothesized that Phoenixin-20 could have some impact on the expression of this molecule. Indeed, we confirmed that the presence of Phoenixin-20 dose-responsively suppressed LPS-induced MyD88 expression at both the mRNA (Figure 7A) and protein levels (Figure 7B). 3.8 Phoenixin-20 mitigates LPS-induced activation of NF-kB We assessed the impact of Phoenixin-20 on the transcription of the inflammatory regulator NF-κB. LPS-induced NF-kB activation begins with the translocation of the NF-κB precursor protein p65. Thus, we examined the nuclear portion of p65 and the activity of transfected NF-kB luciferase promoter. As expected, Phoenixin-20 dose-responsively inhibited LPS-induced p65 nuclear deposition (Figure 8A). Furthermore, Phoenixin-20 displayed a strong suppressive effect on transfected NF-kB activity by dose-responsively suppressing the LPS-induced reporter activity of NF-κB (Figure 8B). 3.9 The effect of Phoenixin-20 requires GPR173 Finally, we investigated the dependency of Phoenixin-20 on the GPR173 signaling pathway. By delivering GPR173-specific shRNA into hDPCs, we achieved highly successful GPR173 silencing. We found that Phoenixin-20 completely lost its
10
inhibitory effect on MMP-2 and MMP-9 in GPR173-silent hDPCs, both at the mRNA (Figure 9A) and protein levels (Figure 9B). Meanwhile, our promoter assay demonstrated that the silencing of GPR173 completely abolished the suppressive effect of Phoenixin-20 on NF-kB activation (Figure 9C). 4. Discussion Dental pulp cells (DPCs) are pluripotent stem cells that have the potential to differentiate into different cell linages [14]. In healthy conditions, DPCs usually remain quiescent in the dental pulp, but can be quickly activated when the pulp is injured or stimulated by bacterial infection. DPCs have the capacity to differentiate into odontoblasts, osteoblasts, and chondrocytes to produce dentin, bone, and cartilage tissues, respectively, as required for the processes of repair or remodeling. Because of their differentiation potential, DPC regeneration represents a new direction in dental tissue engineering or cell-based therapy [15; 16]. Phoenixins represent a class of newly identified pleiotropic hormones. So far, two active isoforms of phoenixins have been identified, including a 20 amino acid peptide Phoenixin-20 and a 14 amino acid peptide Phoenixin-14. Phonexin-14 is the truncated form of Phoenixin-20, and they share similar biological actions in many aspects [17]. Recent work shows that both Phoenixin-20 and Phoenixin-14 can be isolated from brain, heart, thymus, lung, and kidney tissues, suggesting that Phoenixin/GPR173 signaling could mediate different functions depending on the context of the local environment [18]. In our study, we evaluated the expression of the GPR173 receptor in dental pulp cells. We found that GPR173 was fairly expressed in isolated dental
11
pulp cells. Also, when the dental pulp cells were stimulated by LPS, the expression of GPR173 was time- and dose-responsively repressed. These findings imply that GPR173 might be an inflammatory response effector, and therefore, could have a potential role in the inflammation-mediated activation of pulp cells. Thus, we conducted a full investigation of pulpal GPR173 by stimulating human dental pulp cells with the natural ligand of GPR173, Phoenixin-20. Our data indicate that the activation of GPR173 by Phoenixin-20 resulted in a series of protective effects in the context of LPS stimulation. A representative sketch of the underlying molecular mechanism is shown in Figure 10. Firstly, we showed that the presence of Phoenixin-20 reduced LPS-induced cytotoxicity as evidenced by the reduced release of LDH. Secondly, we showed that Phoenixin-20 suppressed the expression of all of the examined pro-inflammatory cytokines and mediators induced by LPS, including IL-6, MCP-1, VCAM-1, ICAM-1, MMP-2, and MMP-9. Mechanistically, we showed that the action of Phoenixin-20 suppressed the LPS-induced activation of TLR-4 and MyD88 as well as the NF-κB pathway. The wide range of inhibitive effects of Phoenixin-20 on these inflammatory mediators indicates that Phoenixin/GPR173 signaling is a critical pathway in LPS-induced dental pulp inflammation.
TLR-4 on the cell surface is known to recognize LPS produced by gram-negative bacteria [19], and TLR-4 activation is induced by LPS and acts as the immune sensor in dental pulp cells [20; 21]. Upon its binding to LPS, MyD88 is recruited as an adaptor to activate cellular inflammatory signals. The activation of these
12
inflammatory cascades leads to the translocation of NF-κB protein into the nuclei of pulp cells, where it transcribes numerous cytokines and mediators. Previous work has shown that the expression of IL-6, MCP-1, VCAM-1, and ICAM-1 is a direct response of NFκB activation, and their induction contributes to both destructive and reparative processes in the pulp [22]. The activation of pulpal MMP-2 and MMP-9 has been shown to be involved in the degradation of collagenous tissue and tissue remodeling [23]. Finally, we found that knockdown of GPR173 completely abolished the anti-inflammatory effect of Phoenixin-20 in dental pulp cells. Thus, we conclude that the beneficial effect of Phoenixin-20 is dependent on GPR173 expression. Based on this evidence, we affirm that the Phoenixin/GPR173 signaling axis is an important regulatory mechanism of pulpal inflammation. Although we still lack an understanding of the mechanism of GPR173-mediated inflammatory signaling involving molecules such as TLR-4, MyD88, and the NF-κB pathway, our study demonstrates that Phoenixin-20-GPR173 signaling is another vital node in the regulatory network of inflammation in dental pulp cells.
Dental pulp is known for its capacity to self-regenerate, and it is the most natural source through which to obtain dental stem cells. Dental stem cells have been shown to promote bone augmentation and healing in periodontal diseases, and cell-based therapeutic trials have shown the potential of dental stem cells to restore structural defects (15, 24). The inflammatory response is traditionally labelled as a “bad response” in pulpal infection, but recent research has elucidated that a proper low
13
level of inflammation is essential for the processes of pulpal tissue repair and regeneration. Therefore, the cellular inflammatory level must be maintained at a low level in order to guide pulp cells toward regeneration [25; 26]. The involvement of G-protein-coupled receptors in stem cells has been investigated extensively. There is evidence that GPR173 is one of the regulated G-protein-coupled receptors involved in stem cell maintenance and somatic reprogramming to iPSCs [27]. Our study indicates that the activation of GPR173 by its natural ligand Phonexin-20 protects pulp cells from excess inflammation and evokes the potential for pulpal regeneration. Unlike many synthesized compounds, Phoenixin-20 is a natural hormone which makes it a perfect choice to protect stem cells from inflammatory stimuli and promote their regeneration. Thus, Phoenixin-20 could have potential therapeutic implications in pulp stem cell-based treatment trials.
Conflicts None. References 1. Roberts G, Scully C, Shotts R. ABC of oral health. Dental emergencies. BMJ. 2000; 321(7260):559-62. 2. Park SH, Ye L, Love RM, Farges JC, Yumoto H. Inflammation of the Dental Pulp. Mediators Inflamm. 2015; 2015:980196. 3. Rechenberg DK, Galicia JC, Peters OA. Biological Markers for Pulpal Inflammation: A Systematic Review. PLoS One. 2016;11(11):e0167289.
14
4. Bindal P, Ramasamy TS, Kasim NHA, Gnanasegaran N, Chai WL. Immune responses of human dental pulp stem cells in lipopolysaccharide-induced microenvironment. Cell Biol Int. 2018; 42(7):832-840. 5. Narayanan LL, Vaishnavi C. Endodontic microbiology. J Conserv Dent. 2010; 13(4):2339. 6. Coil J, Tam E, Waterfield JD. Proinflammatory cytokine profiles in pulp fibroblasts stimulated with lipopolysaccharide and methyl mercaptan. J Endod. 2004; 30(2):88-91. 7. Kamat M, Puranik R, Vanaki S, Kamat S. An insight into the regulatory mechanisms of cells involved in resorption of dental hard tissues. J Oral Maxillofac Pathol. 2013; 17(2):228-33. 8. Chang J, Zhang C, Tani-Ishii N, Shi S, Wang CY. NF-kappaB activation in human dental pulp stem cells by TNF and LPS. J Dent Res. 2005; 84(11):994-8. 9. Matsumoto M, Beltaifa S, Weickert CS, Herman MM, Hyde TM, Saunders RC, Lipska BK, Weinberger DR, Kleinman JE. A conserved mRNA expression profile of SREB2(GPR85) in adult human, monkey, and rat forebrain. Brain Res Mol Brain Res. 2005;138(1):58-69. 10. Yosten GL, Lyu RM, Hsueh AJ, Avsian-Kretchmer O, Chang JK, Tullock CW, Dun SL, Dun N, Samson WK. A novel reproductive peptide, phoenixin. J Neuroendocrinol. 2013; 25(2):206-15. 11. Mcilwraith EK, Belsham DD. Phoenixin: uncovering its receptor, signaling and functions. Acta Pharmacol Sin. 2018; 39(5):774-778.
15
12. Schalla MA, Stengel A. The role of phoenixin in behavior and food intake. Peptides. 2019; 114:38-43. 13. Stein LM, Haddock CJ, Samson WK, Kolar GR, Yosten GLC. The phoenixins: From discovery of the hormone to identification of the receptor and potential physiologic actions. Peptides. 2018; 106:45-48. 14. Tatullo M, Marrelli M, Shakesheff KM, White LJ. Dental pulp stem cells: function, isolation and applications in regenerative medicine. J Tissue Eng Regen Med. 2015; 9(11):1205-16. 15. Potdar PD, Jethmalani YD. Human dental pulp stem cells: Applications in future regenerative medicine. World J Stem Cells. 2015; 7(5):839-51. 16. Cooper PR, Holder MJ, Smith AJ. Inflammation and regeneration in the dentin-pulp complex: a double-edged sword. J Endod. 2014; 40(4 Suppl):S46-51. 17. Yuan T, Sun Z, Zhao W, Wang T, Zhang J, Niu D. Phoenixin: A Newly Discovered Peptide with Multi-Functions. Protein Pept Lett. 2017; 24(6):472-475. 18. Lyu RM, Cowan A, Zhang Y, Chen YH, Dun SL, Chang JK, Dun NJ, Luo JJ. Phoenixin: a novel brain-gut-skin peptide with multiple bioactivity. Acta Pharmacol Sin. 2018; 39(5):770-773 19. Laird MH, Rhee SH, Perkins DJ, Medvedev AE, Piao W, Fenton MJ, Vogel SN. TLR4/MyD88/PI3K interactions regulate TLR4 signaling. J Leukoc Biol. 2009; 85(6):966-77. 20. Schmalz G, Krifka S, Schweikl H. Toll-like receptors, LPS, and dental monomers. Adv Dent Res. 2011; 23(3):302-6.
16
21. Staquet MJ, Carrouel F, Keller JF, Baudouin C, Msika P, Bleicher F, Kufer TA, Farges JC. Pattern-recognition receptors in pulp defense. Adv Dent Res. 2011; 23(3):296-301. 22. Kokkas A, Goulas A, Stavrianos C, Anogianakis G. The role of cytokines in pulp inflammation. J Biol Regul Homeost Agents. 2011; 25(3):303-11. 23. Jain A, Bahuguna R. Role of matrix metalloproteinases in dental caries, pulp and periapical inflammation: An overview. J Oral Biol Craniofac Res. 2015; 5(3):212-8. 24 Morsczeck C, Reichert TE. Dental stem cells in tooth regeneration and repair in the future. Expert Opin Biol Ther. 2018 Feb;18(2):187-196. 25. Cooper PR, Chicca IJ, Holder MJ, Milward MR. Inflammation and Regeneration in the Dentin-pulp Complex: Net Gain or Net Loss? J Endod. 2017; 43(9S):S87-S94. 26. Fawzy El-Sayed KM, Elsalawy R, Ibrahim N, Gadalla M, Albargasy H, Zahra N, Mokhtar S, Elnahhas N, Elkaliouby Y, Doerfer C. The dental pulp stem/progenitor cells-mediated
inflammatory-regenerative
axis.
Tissue
Eng
Part
B
Rev.
2019;25(5):445-460. 27 Choi HY, Saha SK, Kim K, Kim S, Yang GM, Kim B, Kim JH, Cho SG. G protein-coupled receptors in stem cell maintenance and somatic reprogramming to pluripotent or cancer stem cells. BMB Rep. 2015 Feb;48(2):68-80. Figure legends Figure 1. Lipopolysaccharide (LPS) reduced the expression of GPR173 in human dental pulp cells (hDPCs). hDPCs were treated with 5, 10, and 20 µg/mL LPS for 24 h. (A). mRNA levels of GPR173, n=5 for each group; (B). Protein levels of GPR173,
17
n=3 for each group; (C-D). Time-course experiment performed with 20 µg/mL LPS for 12, 24 and 48 hr. mRNA (n=5) and protein (n=3) expression of GPR173 was measured (*, P<0.01; **, P<0.001; ***, P<0.0001 vs. vehicle group).. Figure 2. Phoenixin-20 reduced lipopolysaccharide (LPS)-induced release of lactate dehydrogenase (LDH). hDPCs were treated with 20 µg/mL LPS in the presence or absence of Phoenixin-20 (15, 30 nM) for 24 h. The release of LDH was measured using a commercial kit (***, P<0.0001 vs. vehicle group; ##, P<0.001 vs. LPS group, $$, P<0.001 vs LPS+15 nM Phoenixin-20 group, n=3 for each group). Figure 3. Phoenixin-20 reduced lipopolysaccharide (LPS)-induced expression of pro-inflammatory cytokines. hDPCs were treated with 20 µg/mL LPS in the presence or absence of Phoenixin-20 (15, 30 nM) for 24 h. (A). mRNA of IL-6 and MCP-1, n=5 for each group; (B). Secretions of IL-6, n=3 for each group; (***, P<0.0001 vs. vehicle group; ##, P<0.001 vs. LPS group; $$, P<0.001 vs LPS+15 nM Phoenixin-20 group; $, P<0.01 vs. LPS+15 nM Phoenixin-20 group). Figure 4. Phoenixin-20 reduced lipopolysaccharide (LPS)-induced expression of VCAM-1 and ICAM-1. hDPCs were treated with 20 µg/mL LPS in the presence or absence of Phoenixin-20 (15, 30 nM) for 24 h. (A). mRNA of VCAM-1 and ICAM-1, n=5 for each group; (B). Protein levels of VCAM-1 and ICAM-1 as measured by western blot analysis, n=3 for each group (***, P<0.0001 vs. vehicle group; ##, P<0.001 vs. LPS group; $$, P<0.001 vs LPS+15 nM Phoenixin-20 group). Figure 5. Phoenixin-20 prevented lipopolysaccharide (LPS)- induced expression of MMP-2 and MMP-9. hDPCs were treated with 20 µg/mL LPS in the presence or
18
absence of Phoenixin-20 (15, 30 nM) for 24 h. (A). mRNA of MMP-2 and MMP-9, n=5 for each group; (B). Protein of MMP-2 and MMP-9, n=3 for each group (***, P<0.0001 vs. vehicle group; ##, P<0.001 vs. LPS group; $$, P<0.001 vs LPS+15 nM Phoenixin-20 group; $, P<0.01 vs. LPS+15 nM Phoenixin-20 group). Figure 6. Phoenixin-20 reduced lipopolysaccharide (LPS)-induced expression of TLR-4. hDPCs were treated with 20 µg/mL LPS in the presence or absence of Phoenixin-20 (15, 30 nM) for 24 h. (A). mRNA of TLR4, n=5 for each group; (B). Protein of TLR4, n=3 for each group (***, P<0.0001 vs. vehicle group; ##, P<0.001 vs. LPS group; $$, P<0.001 vs LPS+15 nM Phoenixin-20 group; $, P<0.01 vs. LPS+15 nM Phoenixin-20 group). Figure 7. Phoenixin-20 reduced lipopolysaccharide (LPS)-induced expression of MyD88. hDPCs were treated with 20 µg/mL LPS in the presence or absence of Phoenixin-20 (15, 30 nM) for 24 h. (A). mRNA of Myd-88, n=5 for each group; (B). Protein of MyD88, n=3 for each group (***, P<0.0001 vs. vehicle group; ##, P<0.001 vs. LPS group; $$, P<0.001 vs LPS+15 nM Phoenixin-20 group; $, P<0.01 vs. LPS+15 nM Phoenixin-20 group). Figure 8. Phoenixin-20 prevented lipopolysaccharide (LPS)-induced activation of NF-κB. hDPCs were treated with 20 µg/mL LPS in the presence or absence of Phoenixin-20 (15, 30 nM) for 24 h. (A). Nuclear levels of NF-κB p65, n=3 for each group; (B). Luciferase activity of NF-κB promoter, n=4 for each condition (***, P<0.0001 vs. vehicle group; ##, P<0.001 vs. LPS group; $$, P<0.001 vs LPS+15 nM Phoenixin-20 group; ###, P<0.0001 vs. LPS group; $$$, P<0.0011 vs. LPS+15 nM
19
Phoenixin-20 group). Figure 9 Silencing of GPR173 abolished the anti-inflammatory effect of Phoenixin-20 in hDPCs. Lenti-viral GPR173 was transducted into hDPCs to knock down the expression of GPR173. At 12h post-transfection, hDPCs were treated with 20 µg/mL LPS and Phoenixin-20 (15, 30 nM) for 24 h. (A). MMP-2 and MMP-9 mRNA change, n=5 for each group; (B). MMP-2 and MMP-9 protein expression, n=3 for each group; (C) NF-κB promoter assay in GPR173-expressing and GPR173-silent hDPCs, n=4 for each group. Figure 10. A representative sketch of the underlying molecular mechanism.
20
Table 1 Primers sequences used for real time PCR Target gene
Upstream Sequence (5’-3’)
Downstream Sequence (5’-3’)
GPR173
TGCCCGGTGCACACACGTAA
TCGACTTCCTACCACGGGCAC
MMP-2
TAACCTGGATGCCGTCGT
TTCAGGTAATAAGCACCCTTGAA
MMP-9
GAACCAATCTCACCGACAGG
GCCACCCGAGTGTAACCATA
MCP-1 IL-6 VCAM-1
TTCTGTGCCTGCTGCTCAT TTGGGAAGGTTACATCAGATCAT TGAATCTAGGAAATTGGAAAAAGG
GGGGCATTGATTTGCATCT GGGTTGGTCCATGTCAATTT AACAAATACATGGATGGGCTTT
ICAM-1
CCTTCCTCACCGTGTACTGG
AGCGTAGGGTAAGGTTCTTGC
TLR4
CCCTGAGGCATTTAGGCAGCTA
AGGTAGAGAGGTGGCTTAGGCT
MyD88
GAGGCTGAGAAGCCTTTACAGG
GCAGATGAAGGCATCGAAACGC
GAPDH
AGCCACATCGCTCAGACAC
GCCCAATACGACCAAATCC
Highlights LPS reduced the expression of GPR173 in human dental pulp cells (hDPCs); Phoenixin-20 reduced LPS- induced release of LDH in hDPCs; Phoenixin-20 reduced LPS- induced IL-6, MCP-1, VCAM-1, ICAM-1, MMP-2, and MMP-9; Phoenixin-20 abolished LPS- induced activation of TLR4/ Myd-88/ NF-kB in hDPCs.
Declaration of interests ☑ The authors declare that they have no known competing financial interests or personal relationships that could have appeared to influence the work reported in this paper. ☐The authors declare the following financial interests/personal relationships which may be considered as potential competing interests: