- Email: [email protected]
P 40:1) induces mcyD transcription and microcystin synthesis in Microcystis aeruginosa PCC7806
1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55
PLAPHY3543_proof ■ 7 February 2013 ■ 1/5
Plant Physiology and Biochemistry xxx (2013) 1e5
Contents lists available at SciVerse ScienceDirect
Plant Physiology and Biochemistry journal homepage: www.elsevier.com/locate/plaphy
Research article
Phosphate deficiency (N/P 40:1) induces mcyD transcription and microcystin synthesis in Microcystis aeruginosa PCC7806 Q2 Q1
Taís M. Kuniyoshi a, b, Emma Sevilla a, b, M. Teresa Bes a, b, Maria F. Fillat a, b, M. Luisa Peleato a, b, * a b
Departamento de Bioquimica y Biologia Molecular y Celular, Facultad de Ciencias, Universidad de Zaragoza, Pedro Cerbuna 12, 50009 Zaragoza, Spain BIFI, Universidad de Zaragoza, Pedro Cerbuna 12, 50009 Zaragoza, Spain
a r t i c l e i n f o
a b s t r a c t
Article history: Received 5 November 2012 Accepted 15 January 2013 Available online xxx
A real-time RT-PCR analysis of the transcriptional response to phosphate availability of the mcyD gene and microcystin-LR synthesis in Microcystis aeruginosa PCC7806 revealed that no significant changes were observed in the relative quantification of mcyD under excess phosphate (N/P ¼ 1:1), whereas in deficiency of this nutrient (N/P ¼ 40:1), a steady increase of mcyD during the exponential growth phase was detected, showing a maximal level on the 7th day of growth with a 6.8-fold increase over the control cells. The microcystin content in phosphate deficient cells correlates with the trend of mcyD transcription observed. Also, in this work we demonstrate that under phosphate deficiency conditions with a ratio of 40:1 N/P, the growth of M. aeruginosa PCC7806 was not affected when compared to control and phosphate excess samples. When blooms occur, the nutrients become exhausted and therefore phosphate availability will be scarce. In such a complex scenario, microcystin synthesis could be a response to phosphate deficiency, among other stress parameters. Ó 2013 Published by Elsevier Masson SAS.
Keywords: Microcystin mcy Operon Phosphate availability N:P ratio
1. Introduction Cyanobacterial harmful algal blooms (CyanoHABs) and eutrophication are commonly associated [1,2]. However, it has been recognized that the composition of the nutrient pool in freshwater, in both form and compound ratio, has more impact on cyanotoxin synthesis than simply the total quantity of nutrient. Different species groups display preferences for specific nutrient regimes and therefore the effect of phosphate and nitrate availability on growth and toxicity of cyanobacteria varies among species or even strains [3e5]. Microcystins (MCs) are one of the most hazardous and commonly occurring classes of cyanotoxin [6,7]. Since MCs cause hepatotoxicosis through the inhibition of eukaryotic protein phosphatase 1 and 2A [8], it has been considerated a concern for human health. To date, despite the contradictory reports about the bioavailability of these nutrients and MC production [3,4,9e13], several studies indicate the preference of a specific N:P ratio for Microcystis aeruginosa growth and MC synthesis in batch culture [14,15]. Interestingly, in the laboratory assays reported in the cited studies, the P-limited condition does not affect the M. aeruginosa growth rate. Seeing that M. aeruginosa is a non N-fixing cyanobacteria, the possibility of * Corresponding author. Departamento de Bioquimica y Biologia Molecular y Celular, Facultad de Ciencias, Universidad de Zaragoza, Pedro Cerbuna 12, 50009 Zaragoza, Spain. Tel.: þ34 976 762479; fax: þ34 976 762123. E-mail address: [email protected] (M.L. Peleato).
growth in the P-limited condition may favor this species over other N-fixing cyanobacteria and could explain why this species is one of the most common bloom-forming cyanobacteria in freshwater ecosystems [16]. Evidently, the population dynamics of CyanoHABs is governed by a complex range of physicochemical variables, thus the underlying causes of such blooms are poorly understood. Molecular aspects with regard to MC synthesis have been published once the gene cluster mcy was totally sequenced [17], and its organization elucidated. This operon encodes non-ribosomal peptide synthetase (NRPS), polyketide synthetase (PKS) and enzymes involved in the tailoring and transport of microcystin. In M. aeruginosa PCC7806, the mcy operon spans about 50 kb comprising 10 genes embedded in two bidirectional transcribed operons, mcyA-C and mcyD-J [17]. Alternative transcription start sites dependent on light conditions have been identified [18]. Furthermore, a homologue of the ferric uptake regulator (Fur) from M. aeruginosa has been shown to recognize and bind to promoter regions of the mcy operon [19], while an iron deficiency condition triggers an mcyD transcription increase which correlates to microcystin-LR (MC-LR) [20]. The global regulator of nitrogen metabolism, NtcA, has also been demonstrated to interact with mcy promoters [21]. The presence of 2-oxoglutarate increases its binding affinity [22] suggesting that NtcA acts in this case as a repressor of microcystin synthesis, responding to the C/N balance. Moreover, in batch culture of M. aeruginosa, mcyD transcript and MC-LR cell content have not shown significant changes under different nitrate
0981-9428/$ e see front matter Ó 2013 Published by Elsevier Masson SAS. http://dx.doi.org/10.1016/j.plaphy.2013.01.011
Please cite this article in press as: T.M. Kuniyoshi, et al., Phosphate deficiency (N/P 40:1) induces mcyD transcription and microcystin synthesis in Microcystis aeruginosa PCC7806, Plant Physiology and Biochemistry (2013), http://dx.doi.org/10.1016/j.plaphy.2013.01.011
56 57 58 59 60 61 62 63 64 65 66 67 68 69 70 71 72 73 74 75 76 77 78 79 80 81 82 83 84 85 86 87 88 89 90 91 92 93 94 95 96 97 98 99 100 101 102 103 104 105 106 107 108 109 110
111 112 113 114 115 116 117 118 119 120 121 122 123 124 125 126 127 128 129 130 131 132 133 134 135 136 137 138 139 140 141 142 143 144 145 146 147 148 149 150 151 152 153 154 155 156 157 158 159 160 161 162 163 164 165 166 167 168 169 170 171 172 173 174 175
PLAPHY3543_proof ■ 7 February 2013 ■ 2/5
2
T.M. Kuniyoshi et al. / Plant Physiology and Biochemistry xxx (2013) 1e5
regimes [23] and no alternative transcription start points have been detected with respect to control samples [23]. Little is known regarding the molecular response of Microcystis to variation in P concentrations and sources. Harke et al. [24] have examined genes involved in high-affinity phosphate acquisition. Experiments with different clones of M. aeruginosa have shown that these genes are strong upregulated under low inorganic P condition. Higher cellular content of MC has also been observed in P-limited medium, nevertheless, no transcript analysis was done regarding MC synthesis [24]. The aim of this study was to determine whether phosphate deficiency at a ratio of 40:1 N/P or excess of this nutrient at 1:1 N:P induces MC synthesis in M. aeruginosa PCC7806 in batch culture. Furthermore, for the first time we have analyzed mcyD transcript, a key polyketide synthase involved in MC synthesis, under different phosphate conditions by quantitative real-time PCR (q-PCR) as well as semi-quantitative reverse transcription-PCR (RT-PCR). 2. Results 2.1. Growth in presence of different P concentrations To understand how different N: P ratio influence M. aeruginosa PCC7806 growth, cells were cultured in excess and in limited phosphate conditions in relation to the standard medium BG110, in accordance with the Pasteur Institute recommendations. The amount of nitrate was maintained constant, using 10 times more K2HPO4, 2 mM with a ratio of N:P ¼ 1:1 for the phosphate excess growth experiments, and 40 times less K2HPO4, 0.05 mM, with a ratio of N:P ¼ 40:1 for the limited phosphate studies. The control conditions were 0.2 mM K2HPO4, N:P ¼ 10:1. The experiment was performed three different times. Culture growth was monitored by measuring four different parameters: total protein and chlorophyll a content, number of cells and optical density. The results, showing quite good correlations indicated that under excess phosphate conditions, the growth rate of M. aeruginosa showed a slight increase in all the parameters tested compared to two other phosphate availability conditions (supplementary data). Interestingly, the growth rate in the limited phosphate culture did not have a tendency to decrease during the experiments. Moreover, it displayed higher values of chlorophyll a and total protein content and a greater number of cells than the control samples (supplementary data). This phenomenon has been described previously [5,15]. 2.2. mcyD Expression in different phosphate availability conditions Real-time RT-PCR provides a suitable means of studying the response of a gene to changes in the environment. The data are normalized through the housekeeping gene at the last quantification step, considerably reducing any possible error during the experiment. In the present work, a mcyD transcript analysis was carried out. mcyD encodes a modular polyketide synthase involved in the synthesis of the b-amino acid Adda, responsible for the toxicity of the microcystins [17]. Moreover, mcyD expression is essential in microcystin synthesis and the lack of the protein results in the absence of microcystin synthesis [18]. For these reasons we considered this gene a suitable candidate to be used as marker of microcystin induction. The relative levels of mcyD transcription were measured by real-time efficiency (E) and cycle threshold (Ct) values under excess and limited phosphate cultures compared to the control culture values. The normalization of all the samples was performed with the housekeeping gene rrs using the relative expression described previously [27]. Our data in Fig. 1A shows that no significant change was observed in relative quantification of mcyD under excess phosphate, whereas in the case of the deficiency
Fig. 1. Level of mcyD mRNA expression in M. aeruginosa PCC7806 as response to different phosphate nutritional conditions. M. aeruginosa cells were grown in 0.2 mM phosphate, and aliquots of the cell culture were changed to the different phosphate conditions. Panel A: Changes in mcyD mRNA when cells were exposed to different amounts of phosphate. The data are calculated relative to the expression in nonstressed cells, and normalized with the expression of the reference gene 16S rRNA (rrs). The value of fold increase calculated for each time was normalized with regard to the fold increase at the beginning of the experiment, when the ratio was 1 [27]. Panel B: mcyD RT-PCR product in agarose gel electrophoresis. C: Control conditions (0.2 mM). þ: Phosphate excess (2 mM). e: Phosphate deficiency (0.05 mM). Growth of M. aeruginosa and mcyD quantification were performed 3 times and the values presented are representative of the trends observed, all of them congruent.
of this nutrient, a steady increase in mcyD during the exponential growth phase was detected, showing a maximal effect on the 7th day with a 6.8-fold increase compared to the control (Fig. 1A). These results indicate that mcyD gene is upregulated under low phosphate condition. Despite no previous studies on the mcy regulation level as a response to phosphate availability have been done, it is interesting observed that under nitrate [21] and iron [20] stress condition, changes in mcyB and mcyD transcripts have occurred during log phase of growth. Our data support the Kurmayer [30] proposition that assume that the maximum production of microcystins related to physiological stress. Besides, MC net production seems to be related to cell division process [11]. A model based on laboratory batch and continuous experiments reveals that, especially during logarithmic phase, MC production is chiefly influenced by growth rate showing a nearly linear correlation between them [31]. Moreover, many studies under different stress condition have shown a maximus gravimetric MC concentration during mid to late log phase [3,10,11]. Fig. 1, panel B shows that the same trend in the results was obtained through a semi-quantitative RT-PCR assay using gel electrophoresis. In this experiment, we determined the early exponential phase in PCR for the housekeeping gene (data not shown) as well as for the mcyD gene (data not shown). All the samples were normalized by the housekeeping gene rss in order to obtain a suitable quantification of the target transcript of mcyD.
Please cite this article in press as: T.M. Kuniyoshi, et al., Phosphate deficiency (N/P 40:1) induces mcyD transcription and microcystin synthesis in Microcystis aeruginosa PCC7806, Plant Physiology and Biochemistry (2013), http://dx.doi.org/10.1016/j.plaphy.2013.01.011
176 177 178 179 180 181 182 183 184 185 186 187 188 189 190 191 192 193 194 195 196 197 198 199 200 201 202 203 204 205 206 207 208 209 210 211 212 213 214 215 216 217 218 219 220 221 222 223 224 225 226 227 228 229 230 231 232 233 234 235 236 237 238 239 240
PLAPHY3543_proof ■ 7 February 2013 ■ 3/5
T.M. Kuniyoshi et al. / Plant Physiology and Biochemistry xxx (2013) 1e5
241 242 243 244 245 246 247 248 249 250 251 252 253 254 255 256 257 258 259 260 261 262 263 264 265 266 267 268 269 270 271 272 273 274 275 276 277 278 279 280 281 282 283 284 285 286 287 288 289 290 291 292 293 294 295 296 297 298 299 300 301 302 303 304 305
Given the concordance observed in the results, we conclude that it is therefore possible to use both methodologies for mcyD transcript analysis. The data confirms the upregulation of the mcyD gene under phosphate deficiency after 24 h of treatment. 2.3. Microcystin-LR content in cells as response to phosphate availability The effect of phosphate availability on microcystin synthesis has been extensively studied both under laboratory conditions [4,5,9,14,15] and in field analysis [32,33]. Nevertheless, to date, it is still unclear how this nutrient may influence microcystin production. Here, we have quantified intracellular MC through HPLC and PP2A inhibition assays (MicroCystest). The results obtained by HPLC were normalized in regard to the number of cells (Fig. 2). The phosphate availability in the media had a significant effect on MC synthesis, measured as pg per cell (Fig. 2). In the P-limited culture, the cellular toxin concentration increased during the exponential growth phase, whereas under P-excess conditions it displayed the same MC rate as the control samples (Fig. 2). Data obtained using the MicroCystest were similar with the HPLC results (data not shown). 3. Discussion Consistent with our results, Sivonen [5] had shown that lower levels of phosphorus are needed for toxin production while a higher concentration of this nutrient has no additional effect on Oscillatoria agadhii. Besides, another study of M. aeruginosa has demonstrated that P-deficient cells display higher MC content per dry weight than in other phosphate availability regimes [9]. In a yearround field study, Aboal et al. [34] described a negative correlation between orthophosphate and total phosphorous, and microcystin. On the other hand, controversial reports have also been published about the effect of phosphorus on MC synthesis [10]. LD50 analysis has revealed lower toxicity in phosphorus-deficient M. aeruginosa cells [10]. Furthermore, experiments with Anabaena sp. have demonstrated a linear correlation of MC content per dry weight and phosphorus concentration [3]. Conflicting results have been published probably owing to the diversity of methodologies of MC extraction that have been employed and also because of the different parameters used to determine cellular growth and cyanotoxin normalization, i.e., total protein content, number of cells,
3
dry weight, etc. Since dry weight, protein and chlorophyll a content vary independently of the growth rate [35], the number of cells is considered the best parameter for normalizing the MC ratio [35]. Another point that should be considered is the nitrogen fixation capacity of some cyanobacteria genera, i.e. Anabaena, which have different nutrient requirements. Consequently the results are not suitable for comparisons with non nitrogen-fixing cyanobacteria. Recently, several reports have emphasised the importance of the N:P ratio in MC production [4,14,15,36]. Downing et al. [14] have stated that cellular MC content is higher at medium N:P ratios between 18 and 51 [14]. These results suggest that absolute concentrations or addition of either phosphorus or nitrate alone in the medium do not affect MC synthesis. Moreover, either the transcription level of mcyD such as MC-LR per cell has been shown to be independent of nitrate availability, in phosphate sufficient conditions [23]. The regulation factors as a whole governing MC synthesis remain unknown. Nevertheless, in the present work it is possible to verify that P-deficiency in M. aeruginosa PCC7806 leads to an increase in mcyD transcript and MC-LR per cell during the exponential growth phase when the N:P ratio is 40:1. Phosphorus limitation of phytoplankton growth is commonly observed in aquatic environments [37e39]. Moreover, during exponential growth of cyanobacteria, nutrients become exhausted and therefore blooms cannot be sustained for a prolonged time [40]. M. aeruginosa PCC7806 cells seem to have very efficient mechanisms to compete with other members of the phytoplankton population, and under a range of deficiency of nutrients such as phosphate, microcystin would be synthesized. A recent study has revealed the presence of genes involved in high-affinity phosphate acquisition (pstS and sphX) and a putative alkaline phosphatase (phoX) in 10 strains of M. aeruginosa [24]. In contrast, no phoX gene have been identified in Microcystis wesenbergii [24], suggesting that the ability to exploit organic source of P through hydrolysis phosphomonoesterases is not present in all species of Microcystis genus. M. aeruginosa outbreaks have become increasingly common in summer, when low inorganic P levels and, in some cases, high organic P concentration dominates lakes [16]. Such condition of P-loading seems to provide an ecological advantage for M. aeruginosa over other phytoplankton competitors. The role of MC synthesis under this condition remains unclear, nevertheless, it could be suggest a relationship between Pi deplete environments, M. aeruginosa blooms and MC production. In this work we demonstrated that under phosphate deficiency conditions with a ratio of 40:1 N/P, the growth of M. aeruginosa PCC7806 was not affected when compared to control and phosphate excess samples. Besides, in this nutrient condition cells display high levels of mcyD transcript as well as intracellular microcystin-LR content. When blooms occur, the nutrients become exhausted and therefore phosphate availability will be scarce. In such a complex scenario, microcystin synthesis could be a response to phosphate deficiency, among other parameters. 4. Materials and methods 4.1. Growth
Fig. 2. Time course of microcystin-LR present in M. aeruginosa PCC7806 cells, as response to different phosphate conditions. Microcystin content was determined by HPLC and expressed as pg of microcystin-LR per cell.
Cells of M. aeruginosa PCC7806 provided by the Pasteur Culture Collection (Paris, France) were rendered axenically in BG110 medium in batch culture, with aeration and continuous illumination (16 mmol of photons m2 s1) at 25 C as indicated by Ref. [25]. For the comparative experiments in this study, different phosphate availability conditions were set using 0.2 mM of K2HPO4 as the control culture medium (BG11o). Growth was monitored on days 1,4,7,10 and 14 by determining the optical density at 600 nm, direct cell counts were performed using a Neubauer haemocytometer,
Please cite this article in press as: T.M. Kuniyoshi, et al., Phosphate deficiency (N/P 40:1) induces mcyD transcription and microcystin synthesis in Microcystis aeruginosa PCC7806, Plant Physiology and Biochemistry (2013), http://dx.doi.org/10.1016/j.plaphy.2013.01.011
306 307 308 309 310 311 312 313 314 315 316 317 318 319 320 321 322 323 324 325 326 327 328 329 330 331 332 333 334 335 336 337 338 339 340 341 342 343 344 345 346 347 348 349 350 351 352 353 354 355 356 357 358 359 360 361 362 363 364 365 366 367 368 369 370
PLAPHY3543_proof ■ 7 February 2013 ■ 4/5
4
371 372 373 374 375 376 377 378 379 380 381 382 383 384 385 386 387 388 389 390 391 392 393 394 395 396 397 398 399 400 401 402 403 404 405 406 407 408 409 410 411 412 413 414 415 416 417 418 419 420 421 422 423 424 425 426 427 428 429 430 431 432 433 434 435
T.M. Kuniyoshi et al. / Plant Physiology and Biochemistry xxx (2013) 1e5
chlorophyll a was quantified in accordance with the procedure described by Ref. [26] and protein content was analyzed using the bicinchoninic acid method (BCAÔProtein Assay Reagent Kit from Pierce) as previous described [20]. 4.2. Microcystin content The purification and analysis of intracellular MC-LR were carried out by the method developed by Ref. [20] with some modifications. Aliquots of 10 ml of cells were pelleted and stored at 20 C until microcystin extraction. The samples were incubated during 30 min in 500 ml of 70% methanol and 0.1% trifluoroacetic acid (TFA) while being stirred. After centrifugation at 12,000 g for 5 min, the pellets were re-extracted and both supernatants were pooled. The toxin content was measured by C18 HPLC reverse phase (Waters Symmetry 300) and quantified using commercial microcystin-LR standards (Alexis Biochemicals). 4.3. RNA extraction and transcript analysis For the transcript analysis, total RNA was extracted from 25 ml of cyanobacterial control cells and stress-treated cultures following the procedure described previously [20,23]. Cells were lysed using a “FastRNA Pro Blue kit” (Qbiogene, Inc.) following the manufacturer’s instructions. Total RNA samples were treated with 20 U of DNase I RNase-free (Roche, Basel, Switzerland) to avoid genomic DNA contamination in subsequent RT-PCR. RNA integrity was verified by agarose electrophoresis with ethidium bromide staining and its concentration was measured spectrophotometrically (NanoVue, GE Healthcare). One microgram of the total RNA was reverse-transcribed using SuperScript Retrotranscriptase (Invitrogen) in a 20 ml final reaction containing 150 ng of random primer (Invitrogen), 1 mM deoxyribonucleotide triphosphate mix (GE Healthcare) and 10 mM DTT. cDNA samples were analyzed using an ABI Prism 7000 HT Sequence Detection System with TaqMan Universal PCR master mix (Applied Biosystems), unlabeled primers (Table 1) and TaqMan MGB probes e FAM dye-labelled (Table 1) as described by Refs. Table 1 Oligonucleotides used as primers and TaqMan MGB probes in the real-time analysis and semi-quantitative RT-PCR. Primer designation
Primer sequences (50 / 30 )
Description
MCYD-For
GAGCATTAAGGGCTAAATCG
MCYD-Rer
CTTGGTTGCTTCATCAACTC
R16S-For
CAAGTCGAACGGGAATCTTC
R16S-Ver
CTCAAGTACCGTCAGA ACTTC
RmcyD- For
ACCCGGAACGGTCATAAATTGG
RmcyD-Rer
CGGCTAATCTCTCCAAAACATTGC
mcyD MGB probe 16S- For
CTGCTGCACCTATTTCA TGCGTAGAGATTGGGAAGAACATC
16S-Rer
GCTTTCGTCCCTGAGTGTCA
16s MGB probe
CCAGTAGCACGCTTTC
Forward primer for mcyD semi-quantitative PCR Reverse primer for mcyD semi-quantitative PCR Forward primer for rss semi-quantitative PCR Reverse primer for rrs semi-quantitative PCR Forward primer for mcyD real-time PCR Reverse primer for mcyD real-time PCR Probe for mcyD real-time PCR Forward primer for rrs real-time PCR Reverse primer for rrs real-time PCR Probe for rrs real-time PCR
[20,23]. The real-time efficiency for each primer set was calculated by its slope in the exponential phase according to the equation: E ¼ 10 [1/slope], as described by Ref. [27]. The expression of a housekeeping gene, rrs (AF139299) was simultaneously analyzed as the internal control in the same batch of cDNA, and each mRNA expression level was normalized to this internal control. Relative quantification of the mcyD target gene in excess or deficient phosphate conditions were compared with control mcyD transcript samples and normalized for the expression of the endogenous reference gene rrs following the mathematical model described by Ref. [27]. Moreover, the relative expression level of each gene was shown as a relative value when the expression level of day 0 of the experiment was set at 1. Semi-quantitative RT-PCR assays were also performed with the same cDNA samples. A specific primer set was designed to amplify the mcyD gene and rrs housekeeping gene (Table 1). The exponential phase of each gene was determined by measuring the amount of PCR products for different numbers of cycles, and the endogenous reference gene rrs was used to normalize the possible variation in cDNA concentration as previously described [28,29]. PCR-amplified DNA fragments were observed by 1% agarose gel electrophoresis, stained with ethidium bromide and analyzed using a Gel Doc 2000 Image Analyzer (Bio-Rad). Acknowledgements This work was funded by the Spanish Ministerio de Educación y Ciencia (BFU2006-03454 and BFU2009-07424). Taís M. Kuniyoshi was partially supported by a fellowship from the BIFI (Zaragoza, Spain). Appendix A. Supplementary data Supplementary data related to this article can be found in the online version at doi:10.1016/j.plaphy.2013.01.011. References [1] H.W. Paerl, R.S. Fulton, P.H. Moisander, J. Dyble, Harmful freshwater algal blooms, with an emphasis on cyanobacteria, Scientific World J. 1 (2001) 76e113. [2] R. Philipp, M.G. Rowland, P.J. Baxter, C. McKenzie, R.H. Bell, Health risks from exposure to algae, CDR 1 (1991) R67eR68. discussion R68. [3] J. Rapala, K. Sivonen, C. Lyra, S.I. Niemela, Variation of microcystins, cyanobacterial hepatotoxins, in Anabaena spp. as a function of growth stimuli, Appl. Environ. Microbiol. 63 (1997) 2206e2212. [4] C. Vezie, J. Rapala, J. Vaitomaa, J. Seitsonen, K. Sivonen, Effect of nitrogen and phosphorus on growth of toxic and nontoxic Microcystis strains and on intracellular microcystin concentrations, Microb. Ecol. 43 (2002) 443e454. [5] K. Sivonen, Effects of light, temperature, nitrate, orthophosphate, and bacteria on growth of and hepatotoxin production by Oscillatoria agardhii strains, Appl. Environ. Microbiol. 56 (1990) 2658e2666. [6] R. Luukkainen, M. Namikoshi, K. Sivonen, K.L. Rinehart, S.I. Niemela, Isolation and identification of 12 microcystins from four strains and two bloom samples of Microcystis spp.: structure of a new hepatotoxin, Toxicon: Off. J. Int. Soc. Toxinology 32 (1994) 133e139. [7] K. Rinehart, M. Namikoshi, B. Choi, Structure and biosynthesis of toxins from blue-green algae (cyanobacteria), J. Appl. Phycol. 6 (1994) 159e176. [8] C. Mackintosh, K.A. Beattie, S. Klumpp, P. Cohen, G.A. Codd, Cyanobacterial microcystin-LR is a potent and specific pnhibitor of protein phosphatase-1 and phosphatase-2a from both mammals and higher-plants, FEBS Lett. 264 (1990) 187e192. [9] H.M. Oh, S.J. Lee, M.H. Jang, B.D. Yoon, Microcystin production by Microcystis aeruginosa in a phosphorus-limited chemostat, Appl. Environ. Microbiol. 66 (2000) 176e179. [10] M.F. Watanabe, S. Oishi, Effects of environmental factors on toxicity of a cyanobacterium (Microcystis aeruginosa) under culture conditions, Appl. Environ. Microbiol. 49 (1985) 1342e1344. [11] P.T. Orr, G.J. Jones, Relationship between microcystin production and cell division rates in nitrogen-limited Microcystis aeruginosa cultures, Limnol. Oceanogr. 43 (1998) 1604e1614.
Please cite this article in press as: T.M. Kuniyoshi, et al., Phosphate deficiency (N/P 40:1) induces mcyD transcription and microcystin synthesis in Microcystis aeruginosa PCC7806, Plant Physiology and Biochemistry (2013), http://dx.doi.org/10.1016/j.plaphy.2013.01.011
436 437 438 439 440 441 442 443 444 445 446 447 448 449 450 451 452 453 454 455 456 457 458 459 460 461 462 463 464 465 466 467 468 469 470 471 472 473 474 475 476 477 478 479 480 481 482 483 484 485 486 487 488 489 490 491 492 493 494 495 496 497 498 499 500
PLAPHY3543_proof ■ 7 February 2013 ■ 5/5
T.M. Kuniyoshi et al. / Plant Physiology and Biochemistry xxx (2013) 1e5
501 502 503 504 505 506 507 508 509 510 511 512 513 514 515 516 517 518 519 520 521 522 523 524 525 526 527 528 529 530 531 532 533 534 535 536
[12] B.M. Long, G.T. Jones, P.T. Orr, Cellular microcystin content in N-limited Microcystis aeruginosa can be predicted from growth rate, Appl. Environ. Microbiol. 67 (2001) 278e283. [13] H. Utkilen, N. Gjolme, Iron-stimulated toxin production in Microcystis aeruginosa, Appl. Environ. Microbiol. 61 (1995) 797e800. [14] T.G. Downing, C.S. Sember, M.N. Gehringer, W. Leukes, Medium N: P ratios and specific growth rate comodulate microcystin and protein content in Microcystis aeruginosa PCC7806 and M. aeruginosa UV027, Microb. Ecol. 49 (2005) 468e473. [15] S.J. Lee, M.H. Jang, H.S. Kim, B.D. Yoon, H.M. Oh, Variation of microcystin content of Microcystis aeruginosa relative to medium N: P ratio and growth stage, J. Appl. Microbiol. 89 (2000) 323e329. [16] A.J. Ouellette, S.M. Handy, S.W. Wilhelm, Toxic Microcystis is widespread in Lake Erie: PCR detection of toxin genes and molecular characterization of associated cyanobacterial communities, Microb. Ecol. 51 (2006) 154e165. [17] D. Tillett, E. Dittmann, M. Erhard, H. von Dohren, T. Borner, B.A. Neilan, Structural organization of microcystin biosynthesis in Microcystis aeruginosa PCC7806: an integrated peptide-polyketide synthetase system, Chem. Biol. 7 (2000) 753e764. [18] M. Kaebernick, E. Dittmann, T. Borner, B.A. Neilan, Multiple alternate transcripts direct the biosynthesis of microcystin, a cyanobacterial nonribosomal peptide, Appl. Environ. Microbiol. 68 (2002) 449e455. [19] B. Martin-Luna, J.A. Hernandez, M.T. Bes, M.F. Fillat, M.L. Peleato, Identification of a ferric uptake regulator from Microcystis aeruginosa PCC7806, FEMS Microbiol. Lett. 254 (2006) 63e70. [20] E. Sevilla, B. Martin-Luna, L. Vela, M.T. Bes, M.F. Fillat, M.L. Peleato, Iron availability affects mcyD expression and microcystin-LR synthesis in Microcystis aeruginosa PCC7806, Environ. Microbiol. 10 (2008) 2476e2483. [21] H.P. Ginn, L.A. Pearson, B.A. Neilan, NtcA from Microcystis aeruginosa PCC 7806 is autoregulatory and binds to the microcystin promoter, Appl. Environ. Microbiol. 76 (2010) 4362e4368. [22] T.M. Kuniyoshi, A. Gonzalez, S. Lopez-Gomollon, A. Valladares, M.T. Bes, M.F. Fillat, M.L. Peleato, 2-oxoglutarate enhances NtcA binding activity to promoter regions of the microcystin synthesis gene cluster, FEBS Lett. 585 (2011) 3921e3926. [23] E. Sevilla, B. Martin-Luna, L. Vela, M.T. Bes, M.L. Peleato, M.F. Fillat, Microcystin-LR synthesis as response to nitrogen: transcriptional analysis of the mcyD gene in Microcystis aeruginosa PCC7806, Ecotoxicology 19 (2010) 1167e 1173. [24] M.J. Harke, D.L. Berry, J.W. Ammerman, C.J. Gobler, Molecular response of the bloom-forming cyanobacterium, Microcystis aeruginosa, to phosphorus limitation, Microb. Ecol. 63 (2012) 188e198. [25] R. Rippka, J. Deruelles, J.B. Waterbury, M. Herdman, R.Y. Stanier, Generic assignments, strain histories and properties of pure cultures of cyanobacteria, J. Gen. Microbiol. 111 (1979) 1e61.
5
[26] G. Mackinney, Absorption of light by chlorophyll solutions, J. Biol. Chem. 140 (1941) 315e322. [27] M.W. Pfaffl, A new mathematical model for relative quantification in real-time RT-PCR, Nucleic Acids Res. 29 (2001) e45. [28] D. Breljak, A. Ambriovíc-Ristov, S. Kapitanovic, T. Cacev, J. Gabrilovac, Comparison of three RT-PCR based methods for relative quantification of mRNA, Food Technol. Biotechnol. 43 (2005) 379e388. [29] A. Gonzalez, M.T. Bes, F. Barja, M.L. Peleato, M.F. Fillat, Overexpression of FurA in Anabaena sp. PCC 7120 reveals new targets for this regulator involved in photosynthesis, iron uptake and cellular morphology, Plant Cell. Physiol. 51 (2010) 1900e1914. [30] R. Kurmayer, The toxin cyanobacterium Nostoc sp. strain 152 produces highest amounts of microcystin and nostophycin under stress conditions, J. Phycol 47 (2011) 200e207. [31] S. Jähnichen, T. Ihle, T. Petzoldt, Variability of microcystin cell quota: a small model explains dynamics and equilibria, Limnologica e Ecol. Manage. Inland Waters 38 (2008) 339e349. [32] T.W. Davis, D.L. Berry, G.L. Boyer, C.J. Gobler, The effects of temperature and nutrients on the growth and dynamics of toxic and non-toxic strains of Microcystis during cyanobacteria blooms, Harmful Algae 8 (2009) 715e725. [33] C.J. Gobler, T.W. Davis, K.J. Coyne, G.L. Boyer, Interactive influences of nutrient loading, zooplankton grazing, and microcystin synthetase gene expression on cyanobacterial bloom dynamics in a eutrophic New York lake, Harmful Algae 6 (2007) 119e133. [34] M. Aboal, M.A. Puig, Production of microcystins in calcareous Mediterranean streams: the Alharabe River, Segura River basin in south-east Spain, J. Appl. Phycol. 17 (2005) 231e243. [35] R. Molica, S. Azevedo, Ecofisiologia de cianobactérias produtoras de cianotoxinas, Oecol. Bras. 13 (2009) 229e246. [36] J. Heisler, P.M. Glibert, J.M. Burkholder, D.M. Anderson, W. Cochlan, W.C. Dennison, Q. Dortch, C.J. Gobler, C.A. Heil, E. Humphries, A. Lewitus, R. Magnien, H.G. Marshall, K. Sellner, D.A. Stockwell, D.K. Stoecker, M. Suddleso, Eutrophication and harmful algal blooms: a scientific consensus, Harmful Algae 8 (2008) 3e13. [37] D.W. Schindler, Eutrophication and recovery in experimental lakes: implications for lake management, Science 184 (1974) 897e899. [38] J.J. Elser, E.R. Marzolf, C.R. Goldman, Phosphorus and nitrogen limitation of phytoplankton growth in the fresh-waters of North-America e a review and critique of experimental enrichments, Can. J. Fish. Aquat. Sci. 47 (1990) 1468e 1477. [39] D.W. Schindler, Evolution of phosphorus limitation in lakes, Science 195 (1977) 260e262. [40] J. Huisman, F. Hulot, in: J. Huisman, H. Matthijs, P. Visser (Eds.), Population Dynamics of Harmful Cyanobacteria. Harmful Cyanobacteria, vol. 3, Springer, Netherlands, 2005, pp. 143e176.
Please cite this article in press as: T.M. Kuniyoshi, et al., Phosphate deficiency (N/P 40:1) induces mcyD transcription and microcystin synthesis in Microcystis aeruginosa PCC7806, Plant Physiology and Biochemistry (2013), http://dx.doi.org/10.1016/j.plaphy.2013.01.011
537 538 539 540 541 542 543 544 545 546 547 548 549 550 551 552 553 554 555 556 557 558 559 560 561 562 563 564 565 566 567 568 569 570 571 572
PLAPHY3543_proof ■ 7 February 2013 ■ 1/5
Plant Physiology and Biochemistry xxx (2013) 1e5
Contents lists available at SciVerse ScienceDirect
Plant Physiology and Biochemistry journal homepage: www.elsevier.com/locate/plaphy
Research article
Phosphate deficiency (N/P 40:1) induces mcyD transcription and microcystin synthesis in Microcystis aeruginosa PCC7806 Q2 Q1
Taís M. Kuniyoshi a, b, Emma Sevilla a, b, M. Teresa Bes a, b, Maria F. Fillat a, b, M. Luisa Peleato a, b, * a b
Departamento de Bioquimica y Biologia Molecular y Celular, Facultad de Ciencias, Universidad de Zaragoza, Pedro Cerbuna 12, 50009 Zaragoza, Spain BIFI, Universidad de Zaragoza, Pedro Cerbuna 12, 50009 Zaragoza, Spain
a r t i c l e i n f o
a b s t r a c t
Article history: Received 5 November 2012 Accepted 15 January 2013 Available online xxx
A real-time RT-PCR analysis of the transcriptional response to phosphate availability of the mcyD gene and microcystin-LR synthesis in Microcystis aeruginosa PCC7806 revealed that no significant changes were observed in the relative quantification of mcyD under excess phosphate (N/P ¼ 1:1), whereas in deficiency of this nutrient (N/P ¼ 40:1), a steady increase of mcyD during the exponential growth phase was detected, showing a maximal level on the 7th day of growth with a 6.8-fold increase over the control cells. The microcystin content in phosphate deficient cells correlates with the trend of mcyD transcription observed. Also, in this work we demonstrate that under phosphate deficiency conditions with a ratio of 40:1 N/P, the growth of M. aeruginosa PCC7806 was not affected when compared to control and phosphate excess samples. When blooms occur, the nutrients become exhausted and therefore phosphate availability will be scarce. In such a complex scenario, microcystin synthesis could be a response to phosphate deficiency, among other stress parameters. Ó 2013 Published by Elsevier Masson SAS.
Keywords: Microcystin mcy Operon Phosphate availability N:P ratio
1. Introduction Cyanobacterial harmful algal blooms (CyanoHABs) and eutrophication are commonly associated [1,2]. However, it has been recognized that the composition of the nutrient pool in freshwater, in both form and compound ratio, has more impact on cyanotoxin synthesis than simply the total quantity of nutrient. Different species groups display preferences for specific nutrient regimes and therefore the effect of phosphate and nitrate availability on growth and toxicity of cyanobacteria varies among species or even strains [3e5]. Microcystins (MCs) are one of the most hazardous and commonly occurring classes of cyanotoxin [6,7]. Since MCs cause hepatotoxicosis through the inhibition of eukaryotic protein phosphatase 1 and 2A [8], it has been considerated a concern for human health. To date, despite the contradictory reports about the bioavailability of these nutrients and MC production [3,4,9e13], several studies indicate the preference of a specific N:P ratio for Microcystis aeruginosa growth and MC synthesis in batch culture [14,15]. Interestingly, in the laboratory assays reported in the cited studies, the P-limited condition does not affect the M. aeruginosa growth rate. Seeing that M. aeruginosa is a non N-fixing cyanobacteria, the possibility of * Corresponding author. Departamento de Bioquimica y Biologia Molecular y Celular, Facultad de Ciencias, Universidad de Zaragoza, Pedro Cerbuna 12, 50009 Zaragoza, Spain. Tel.: þ34 976 762479; fax: þ34 976 762123. E-mail address: [email protected] (M.L. Peleato).
growth in the P-limited condition may favor this species over other N-fixing cyanobacteria and could explain why this species is one of the most common bloom-forming cyanobacteria in freshwater ecosystems [16]. Evidently, the population dynamics of CyanoHABs is governed by a complex range of physicochemical variables, thus the underlying causes of such blooms are poorly understood. Molecular aspects with regard to MC synthesis have been published once the gene cluster mcy was totally sequenced [17], and its organization elucidated. This operon encodes non-ribosomal peptide synthetase (NRPS), polyketide synthetase (PKS) and enzymes involved in the tailoring and transport of microcystin. In M. aeruginosa PCC7806, the mcy operon spans about 50 kb comprising 10 genes embedded in two bidirectional transcribed operons, mcyA-C and mcyD-J [17]. Alternative transcription start sites dependent on light conditions have been identified [18]. Furthermore, a homologue of the ferric uptake regulator (Fur) from M. aeruginosa has been shown to recognize and bind to promoter regions of the mcy operon [19], while an iron deficiency condition triggers an mcyD transcription increase which correlates to microcystin-LR (MC-LR) [20]. The global regulator of nitrogen metabolism, NtcA, has also been demonstrated to interact with mcy promoters [21]. The presence of 2-oxoglutarate increases its binding affinity [22] suggesting that NtcA acts in this case as a repressor of microcystin synthesis, responding to the C/N balance. Moreover, in batch culture of M. aeruginosa, mcyD transcript and MC-LR cell content have not shown significant changes under different nitrate
0981-9428/$ e see front matter Ó 2013 Published by Elsevier Masson SAS. http://dx.doi.org/10.1016/j.plaphy.2013.01.011
Please cite this article in press as: T.M. Kuniyoshi, et al., Phosphate deficiency (N/P 40:1) induces mcyD transcription and microcystin synthesis in Microcystis aeruginosa PCC7806, Plant Physiology and Biochemistry (2013), http://dx.doi.org/10.1016/j.plaphy.2013.01.011
56 57 58 59 60 61 62 63 64 65 66 67 68 69 70 71 72 73 74 75 76 77 78 79 80 81 82 83 84 85 86 87 88 89 90 91 92 93 94 95 96 97 98 99 100 101 102 103 104 105 106 107 108 109 110
111 112 113 114 115 116 117 118 119 120 121 122 123 124 125 126 127 128 129 130 131 132 133 134 135 136 137 138 139 140 141 142 143 144 145 146 147 148 149 150 151 152 153 154 155 156 157 158 159 160 161 162 163 164 165 166 167 168 169 170 171 172 173 174 175
PLAPHY3543_proof ■ 7 February 2013 ■ 2/5
2
T.M. Kuniyoshi et al. / Plant Physiology and Biochemistry xxx (2013) 1e5
regimes [23] and no alternative transcription start points have been detected with respect to control samples [23]. Little is known regarding the molecular response of Microcystis to variation in P concentrations and sources. Harke et al. [24] have examined genes involved in high-affinity phosphate acquisition. Experiments with different clones of M. aeruginosa have shown that these genes are strong upregulated under low inorganic P condition. Higher cellular content of MC has also been observed in P-limited medium, nevertheless, no transcript analysis was done regarding MC synthesis [24]. The aim of this study was to determine whether phosphate deficiency at a ratio of 40:1 N/P or excess of this nutrient at 1:1 N:P induces MC synthesis in M. aeruginosa PCC7806 in batch culture. Furthermore, for the first time we have analyzed mcyD transcript, a key polyketide synthase involved in MC synthesis, under different phosphate conditions by quantitative real-time PCR (q-PCR) as well as semi-quantitative reverse transcription-PCR (RT-PCR). 2. Results 2.1. Growth in presence of different P concentrations To understand how different N: P ratio influence M. aeruginosa PCC7806 growth, cells were cultured in excess and in limited phosphate conditions in relation to the standard medium BG110, in accordance with the Pasteur Institute recommendations. The amount of nitrate was maintained constant, using 10 times more K2HPO4, 2 mM with a ratio of N:P ¼ 1:1 for the phosphate excess growth experiments, and 40 times less K2HPO4, 0.05 mM, with a ratio of N:P ¼ 40:1 for the limited phosphate studies. The control conditions were 0.2 mM K2HPO4, N:P ¼ 10:1. The experiment was performed three different times. Culture growth was monitored by measuring four different parameters: total protein and chlorophyll a content, number of cells and optical density. The results, showing quite good correlations indicated that under excess phosphate conditions, the growth rate of M. aeruginosa showed a slight increase in all the parameters tested compared to two other phosphate availability conditions (supplementary data). Interestingly, the growth rate in the limited phosphate culture did not have a tendency to decrease during the experiments. Moreover, it displayed higher values of chlorophyll a and total protein content and a greater number of cells than the control samples (supplementary data). This phenomenon has been described previously [5,15]. 2.2. mcyD Expression in different phosphate availability conditions Real-time RT-PCR provides a suitable means of studying the response of a gene to changes in the environment. The data are normalized through the housekeeping gene at the last quantification step, considerably reducing any possible error during the experiment. In the present work, a mcyD transcript analysis was carried out. mcyD encodes a modular polyketide synthase involved in the synthesis of the b-amino acid Adda, responsible for the toxicity of the microcystins [17]. Moreover, mcyD expression is essential in microcystin synthesis and the lack of the protein results in the absence of microcystin synthesis [18]. For these reasons we considered this gene a suitable candidate to be used as marker of microcystin induction. The relative levels of mcyD transcription were measured by real-time efficiency (E) and cycle threshold (Ct) values under excess and limited phosphate cultures compared to the control culture values. The normalization of all the samples was performed with the housekeeping gene rrs using the relative expression described previously [27]. Our data in Fig. 1A shows that no significant change was observed in relative quantification of mcyD under excess phosphate, whereas in the case of the deficiency
Fig. 1. Level of mcyD mRNA expression in M. aeruginosa PCC7806 as response to different phosphate nutritional conditions. M. aeruginosa cells were grown in 0.2 mM phosphate, and aliquots of the cell culture were changed to the different phosphate conditions. Panel A: Changes in mcyD mRNA when cells were exposed to different amounts of phosphate. The data are calculated relative to the expression in nonstressed cells, and normalized with the expression of the reference gene 16S rRNA (rrs). The value of fold increase calculated for each time was normalized with regard to the fold increase at the beginning of the experiment, when the ratio was 1 [27]. Panel B: mcyD RT-PCR product in agarose gel electrophoresis. C: Control conditions (0.2 mM). þ: Phosphate excess (2 mM). e: Phosphate deficiency (0.05 mM). Growth of M. aeruginosa and mcyD quantification were performed 3 times and the values presented are representative of the trends observed, all of them congruent.
of this nutrient, a steady increase in mcyD during the exponential growth phase was detected, showing a maximal effect on the 7th day with a 6.8-fold increase compared to the control (Fig. 1A). These results indicate that mcyD gene is upregulated under low phosphate condition. Despite no previous studies on the mcy regulation level as a response to phosphate availability have been done, it is interesting observed that under nitrate [21] and iron [20] stress condition, changes in mcyB and mcyD transcripts have occurred during log phase of growth. Our data support the Kurmayer [30] proposition that assume that the maximum production of microcystins related to physiological stress. Besides, MC net production seems to be related to cell division process [11]. A model based on laboratory batch and continuous experiments reveals that, especially during logarithmic phase, MC production is chiefly influenced by growth rate showing a nearly linear correlation between them [31]. Moreover, many studies under different stress condition have shown a maximus gravimetric MC concentration during mid to late log phase [3,10,11]. Fig. 1, panel B shows that the same trend in the results was obtained through a semi-quantitative RT-PCR assay using gel electrophoresis. In this experiment, we determined the early exponential phase in PCR for the housekeeping gene (data not shown) as well as for the mcyD gene (data not shown). All the samples were normalized by the housekeeping gene rss in order to obtain a suitable quantification of the target transcript of mcyD.
Please cite this article in press as: T.M. Kuniyoshi, et al., Phosphate deficiency (N/P 40:1) induces mcyD transcription and microcystin synthesis in Microcystis aeruginosa PCC7806, Plant Physiology and Biochemistry (2013), http://dx.doi.org/10.1016/j.plaphy.2013.01.011
176 177 178 179 180 181 182 183 184 185 186 187 188 189 190 191 192 193 194 195 196 197 198 199 200 201 202 203 204 205 206 207 208 209 210 211 212 213 214 215 216 217 218 219 220 221 222 223 224 225 226 227 228 229 230 231 232 233 234 235 236 237 238 239 240
PLAPHY3543_proof ■ 7 February 2013 ■ 3/5
T.M. Kuniyoshi et al. / Plant Physiology and Biochemistry xxx (2013) 1e5
241 242 243 244 245 246 247 248 249 250 251 252 253 254 255 256 257 258 259 260 261 262 263 264 265 266 267 268 269 270 271 272 273 274 275 276 277 278 279 280 281 282 283 284 285 286 287 288 289 290 291 292 293 294 295 296 297 298 299 300 301 302 303 304 305
Given the concordance observed in the results, we conclude that it is therefore possible to use both methodologies for mcyD transcript analysis. The data confirms the upregulation of the mcyD gene under phosphate deficiency after 24 h of treatment. 2.3. Microcystin-LR content in cells as response to phosphate availability The effect of phosphate availability on microcystin synthesis has been extensively studied both under laboratory conditions [4,5,9,14,15] and in field analysis [32,33]. Nevertheless, to date, it is still unclear how this nutrient may influence microcystin production. Here, we have quantified intracellular MC through HPLC and PP2A inhibition assays (MicroCystest). The results obtained by HPLC were normalized in regard to the number of cells (Fig. 2). The phosphate availability in the media had a significant effect on MC synthesis, measured as pg per cell (Fig. 2). In the P-limited culture, the cellular toxin concentration increased during the exponential growth phase, whereas under P-excess conditions it displayed the same MC rate as the control samples (Fig. 2). Data obtained using the MicroCystest were similar with the HPLC results (data not shown). 3. Discussion Consistent with our results, Sivonen [5] had shown that lower levels of phosphorus are needed for toxin production while a higher concentration of this nutrient has no additional effect on Oscillatoria agadhii. Besides, another study of M. aeruginosa has demonstrated that P-deficient cells display higher MC content per dry weight than in other phosphate availability regimes [9]. In a yearround field study, Aboal et al. [34] described a negative correlation between orthophosphate and total phosphorous, and microcystin. On the other hand, controversial reports have also been published about the effect of phosphorus on MC synthesis [10]. LD50 analysis has revealed lower toxicity in phosphorus-deficient M. aeruginosa cells [10]. Furthermore, experiments with Anabaena sp. have demonstrated a linear correlation of MC content per dry weight and phosphorus concentration [3]. Conflicting results have been published probably owing to the diversity of methodologies of MC extraction that have been employed and also because of the different parameters used to determine cellular growth and cyanotoxin normalization, i.e., total protein content, number of cells,
3
dry weight, etc. Since dry weight, protein and chlorophyll a content vary independently of the growth rate [35], the number of cells is considered the best parameter for normalizing the MC ratio [35]. Another point that should be considered is the nitrogen fixation capacity of some cyanobacteria genera, i.e. Anabaena, which have different nutrient requirements. Consequently the results are not suitable for comparisons with non nitrogen-fixing cyanobacteria. Recently, several reports have emphasised the importance of the N:P ratio in MC production [4,14,15,36]. Downing et al. [14] have stated that cellular MC content is higher at medium N:P ratios between 18 and 51 [14]. These results suggest that absolute concentrations or addition of either phosphorus or nitrate alone in the medium do not affect MC synthesis. Moreover, either the transcription level of mcyD such as MC-LR per cell has been shown to be independent of nitrate availability, in phosphate sufficient conditions [23]. The regulation factors as a whole governing MC synthesis remain unknown. Nevertheless, in the present work it is possible to verify that P-deficiency in M. aeruginosa PCC7806 leads to an increase in mcyD transcript and MC-LR per cell during the exponential growth phase when the N:P ratio is 40:1. Phosphorus limitation of phytoplankton growth is commonly observed in aquatic environments [37e39]. Moreover, during exponential growth of cyanobacteria, nutrients become exhausted and therefore blooms cannot be sustained for a prolonged time [40]. M. aeruginosa PCC7806 cells seem to have very efficient mechanisms to compete with other members of the phytoplankton population, and under a range of deficiency of nutrients such as phosphate, microcystin would be synthesized. A recent study has revealed the presence of genes involved in high-affinity phosphate acquisition (pstS and sphX) and a putative alkaline phosphatase (phoX) in 10 strains of M. aeruginosa [24]. In contrast, no phoX gene have been identified in Microcystis wesenbergii [24], suggesting that the ability to exploit organic source of P through hydrolysis phosphomonoesterases is not present in all species of Microcystis genus. M. aeruginosa outbreaks have become increasingly common in summer, when low inorganic P levels and, in some cases, high organic P concentration dominates lakes [16]. Such condition of P-loading seems to provide an ecological advantage for M. aeruginosa over other phytoplankton competitors. The role of MC synthesis under this condition remains unclear, nevertheless, it could be suggest a relationship between Pi deplete environments, M. aeruginosa blooms and MC production. In this work we demonstrated that under phosphate deficiency conditions with a ratio of 40:1 N/P, the growth of M. aeruginosa PCC7806 was not affected when compared to control and phosphate excess samples. Besides, in this nutrient condition cells display high levels of mcyD transcript as well as intracellular microcystin-LR content. When blooms occur, the nutrients become exhausted and therefore phosphate availability will be scarce. In such a complex scenario, microcystin synthesis could be a response to phosphate deficiency, among other parameters. 4. Materials and methods 4.1. Growth
Fig. 2. Time course of microcystin-LR present in M. aeruginosa PCC7806 cells, as response to different phosphate conditions. Microcystin content was determined by HPLC and expressed as pg of microcystin-LR per cell.
Cells of M. aeruginosa PCC7806 provided by the Pasteur Culture Collection (Paris, France) were rendered axenically in BG110 medium in batch culture, with aeration and continuous illumination (16 mmol of photons m2 s1) at 25 C as indicated by Ref. [25]. For the comparative experiments in this study, different phosphate availability conditions were set using 0.2 mM of K2HPO4 as the control culture medium (BG11o). Growth was monitored on days 1,4,7,10 and 14 by determining the optical density at 600 nm, direct cell counts were performed using a Neubauer haemocytometer,
Please cite this article in press as: T.M. Kuniyoshi, et al., Phosphate deficiency (N/P 40:1) induces mcyD transcription and microcystin synthesis in Microcystis aeruginosa PCC7806, Plant Physiology and Biochemistry (2013), http://dx.doi.org/10.1016/j.plaphy.2013.01.011
306 307 308 309 310 311 312 313 314 315 316 317 318 319 320 321 322 323 324 325 326 327 328 329 330 331 332 333 334 335 336 337 338 339 340 341 342 343 344 345 346 347 348 349 350 351 352 353 354 355 356 357 358 359 360 361 362 363 364 365 366 367 368 369 370
PLAPHY3543_proof ■ 7 February 2013 ■ 4/5
4
371 372 373 374 375 376 377 378 379 380 381 382 383 384 385 386 387 388 389 390 391 392 393 394 395 396 397 398 399 400 401 402 403 404 405 406 407 408 409 410 411 412 413 414 415 416 417 418 419 420 421 422 423 424 425 426 427 428 429 430 431 432 433 434 435
T.M. Kuniyoshi et al. / Plant Physiology and Biochemistry xxx (2013) 1e5
chlorophyll a was quantified in accordance with the procedure described by Ref. [26] and protein content was analyzed using the bicinchoninic acid method (BCAÔProtein Assay Reagent Kit from Pierce) as previous described [20]. 4.2. Microcystin content The purification and analysis of intracellular MC-LR were carried out by the method developed by Ref. [20] with some modifications. Aliquots of 10 ml of cells were pelleted and stored at 20 C until microcystin extraction. The samples were incubated during 30 min in 500 ml of 70% methanol and 0.1% trifluoroacetic acid (TFA) while being stirred. After centrifugation at 12,000 g for 5 min, the pellets were re-extracted and both supernatants were pooled. The toxin content was measured by C18 HPLC reverse phase (Waters Symmetry 300) and quantified using commercial microcystin-LR standards (Alexis Biochemicals). 4.3. RNA extraction and transcript analysis For the transcript analysis, total RNA was extracted from 25 ml of cyanobacterial control cells and stress-treated cultures following the procedure described previously [20,23]. Cells were lysed using a “FastRNA Pro Blue kit” (Qbiogene, Inc.) following the manufacturer’s instructions. Total RNA samples were treated with 20 U of DNase I RNase-free (Roche, Basel, Switzerland) to avoid genomic DNA contamination in subsequent RT-PCR. RNA integrity was verified by agarose electrophoresis with ethidium bromide staining and its concentration was measured spectrophotometrically (NanoVue, GE Healthcare). One microgram of the total RNA was reverse-transcribed using SuperScript Retrotranscriptase (Invitrogen) in a 20 ml final reaction containing 150 ng of random primer (Invitrogen), 1 mM deoxyribonucleotide triphosphate mix (GE Healthcare) and 10 mM DTT. cDNA samples were analyzed using an ABI Prism 7000 HT Sequence Detection System with TaqMan Universal PCR master mix (Applied Biosystems), unlabeled primers (Table 1) and TaqMan MGB probes e FAM dye-labelled (Table 1) as described by Refs. Table 1 Oligonucleotides used as primers and TaqMan MGB probes in the real-time analysis and semi-quantitative RT-PCR. Primer designation
Primer sequences (50 / 30 )
Description
MCYD-For
GAGCATTAAGGGCTAAATCG
MCYD-Rer
CTTGGTTGCTTCATCAACTC
R16S-For
CAAGTCGAACGGGAATCTTC
R16S-Ver
CTCAAGTACCGTCAGA ACTTC
RmcyD- For
ACCCGGAACGGTCATAAATTGG
RmcyD-Rer
CGGCTAATCTCTCCAAAACATTGC
mcyD MGB probe 16S- For
CTGCTGCACCTATTTCA TGCGTAGAGATTGGGAAGAACATC
16S-Rer
GCTTTCGTCCCTGAGTGTCA
16s MGB probe
CCAGTAGCACGCTTTC
Forward primer for mcyD semi-quantitative PCR Reverse primer for mcyD semi-quantitative PCR Forward primer for rss semi-quantitative PCR Reverse primer for rrs semi-quantitative PCR Forward primer for mcyD real-time PCR Reverse primer for mcyD real-time PCR Probe for mcyD real-time PCR Forward primer for rrs real-time PCR Reverse primer for rrs real-time PCR Probe for rrs real-time PCR
[20,23]. The real-time efficiency for each primer set was calculated by its slope in the exponential phase according to the equation: E ¼ 10 [1/slope], as described by Ref. [27]. The expression of a housekeeping gene, rrs (AF139299) was simultaneously analyzed as the internal control in the same batch of cDNA, and each mRNA expression level was normalized to this internal control. Relative quantification of the mcyD target gene in excess or deficient phosphate conditions were compared with control mcyD transcript samples and normalized for the expression of the endogenous reference gene rrs following the mathematical model described by Ref. [27]. Moreover, the relative expression level of each gene was shown as a relative value when the expression level of day 0 of the experiment was set at 1. Semi-quantitative RT-PCR assays were also performed with the same cDNA samples. A specific primer set was designed to amplify the mcyD gene and rrs housekeeping gene (Table 1). The exponential phase of each gene was determined by measuring the amount of PCR products for different numbers of cycles, and the endogenous reference gene rrs was used to normalize the possible variation in cDNA concentration as previously described [28,29]. PCR-amplified DNA fragments were observed by 1% agarose gel electrophoresis, stained with ethidium bromide and analyzed using a Gel Doc 2000 Image Analyzer (Bio-Rad). Acknowledgements This work was funded by the Spanish Ministerio de Educación y Ciencia (BFU2006-03454 and BFU2009-07424). Taís M. Kuniyoshi was partially supported by a fellowship from the BIFI (Zaragoza, Spain). Appendix A. Supplementary data Supplementary data related to this article can be found in the online version at doi:10.1016/j.plaphy.2013.01.011. References [1] H.W. Paerl, R.S. Fulton, P.H. Moisander, J. Dyble, Harmful freshwater algal blooms, with an emphasis on cyanobacteria, Scientific World J. 1 (2001) 76e113. [2] R. Philipp, M.G. Rowland, P.J. Baxter, C. McKenzie, R.H. Bell, Health risks from exposure to algae, CDR 1 (1991) R67eR68. discussion R68. [3] J. Rapala, K. Sivonen, C. Lyra, S.I. Niemela, Variation of microcystins, cyanobacterial hepatotoxins, in Anabaena spp. as a function of growth stimuli, Appl. Environ. Microbiol. 63 (1997) 2206e2212. [4] C. Vezie, J. Rapala, J. Vaitomaa, J. Seitsonen, K. Sivonen, Effect of nitrogen and phosphorus on growth of toxic and nontoxic Microcystis strains and on intracellular microcystin concentrations, Microb. Ecol. 43 (2002) 443e454. [5] K. Sivonen, Effects of light, temperature, nitrate, orthophosphate, and bacteria on growth of and hepatotoxin production by Oscillatoria agardhii strains, Appl. Environ. Microbiol. 56 (1990) 2658e2666. [6] R. Luukkainen, M. Namikoshi, K. Sivonen, K.L. Rinehart, S.I. Niemela, Isolation and identification of 12 microcystins from four strains and two bloom samples of Microcystis spp.: structure of a new hepatotoxin, Toxicon: Off. J. Int. Soc. Toxinology 32 (1994) 133e139. [7] K. Rinehart, M. Namikoshi, B. Choi, Structure and biosynthesis of toxins from blue-green algae (cyanobacteria), J. Appl. Phycol. 6 (1994) 159e176. [8] C. Mackintosh, K.A. Beattie, S. Klumpp, P. Cohen, G.A. Codd, Cyanobacterial microcystin-LR is a potent and specific pnhibitor of protein phosphatase-1 and phosphatase-2a from both mammals and higher-plants, FEBS Lett. 264 (1990) 187e192. [9] H.M. Oh, S.J. Lee, M.H. Jang, B.D. Yoon, Microcystin production by Microcystis aeruginosa in a phosphorus-limited chemostat, Appl. Environ. Microbiol. 66 (2000) 176e179. [10] M.F. Watanabe, S. Oishi, Effects of environmental factors on toxicity of a cyanobacterium (Microcystis aeruginosa) under culture conditions, Appl. Environ. Microbiol. 49 (1985) 1342e1344. [11] P.T. Orr, G.J. Jones, Relationship between microcystin production and cell division rates in nitrogen-limited Microcystis aeruginosa cultures, Limnol. Oceanogr. 43 (1998) 1604e1614.
Please cite this article in press as: T.M. Kuniyoshi, et al., Phosphate deficiency (N/P 40:1) induces mcyD transcription and microcystin synthesis in Microcystis aeruginosa PCC7806, Plant Physiology and Biochemistry (2013), http://dx.doi.org/10.1016/j.plaphy.2013.01.011
436 437 438 439 440 441 442 443 444 445 446 447 448 449 450 451 452 453 454 455 456 457 458 459 460 461 462 463 464 465 466 467 468 469 470 471 472 473 474 475 476 477 478 479 480 481 482 483 484 485 486 487 488 489 490 491 492 493 494 495 496 497 498 499 500
PLAPHY3543_proof ■ 7 February 2013 ■ 5/5
T.M. Kuniyoshi et al. / Plant Physiology and Biochemistry xxx (2013) 1e5
501 502 503 504 505 506 507 508 509 510 511 512 513 514 515 516 517 518 519 520 521 522 523 524 525 526 527 528 529 530 531 532 533 534 535 536
[12] B.M. Long, G.T. Jones, P.T. Orr, Cellular microcystin content in N-limited Microcystis aeruginosa can be predicted from growth rate, Appl. Environ. Microbiol. 67 (2001) 278e283. [13] H. Utkilen, N. Gjolme, Iron-stimulated toxin production in Microcystis aeruginosa, Appl. Environ. Microbiol. 61 (1995) 797e800. [14] T.G. Downing, C.S. Sember, M.N. Gehringer, W. Leukes, Medium N: P ratios and specific growth rate comodulate microcystin and protein content in Microcystis aeruginosa PCC7806 and M. aeruginosa UV027, Microb. Ecol. 49 (2005) 468e473. [15] S.J. Lee, M.H. Jang, H.S. Kim, B.D. Yoon, H.M. Oh, Variation of microcystin content of Microcystis aeruginosa relative to medium N: P ratio and growth stage, J. Appl. Microbiol. 89 (2000) 323e329. [16] A.J. Ouellette, S.M. Handy, S.W. Wilhelm, Toxic Microcystis is widespread in Lake Erie: PCR detection of toxin genes and molecular characterization of associated cyanobacterial communities, Microb. Ecol. 51 (2006) 154e165. [17] D. Tillett, E. Dittmann, M. Erhard, H. von Dohren, T. Borner, B.A. Neilan, Structural organization of microcystin biosynthesis in Microcystis aeruginosa PCC7806: an integrated peptide-polyketide synthetase system, Chem. Biol. 7 (2000) 753e764. [18] M. Kaebernick, E. Dittmann, T. Borner, B.A. Neilan, Multiple alternate transcripts direct the biosynthesis of microcystin, a cyanobacterial nonribosomal peptide, Appl. Environ. Microbiol. 68 (2002) 449e455. [19] B. Martin-Luna, J.A. Hernandez, M.T. Bes, M.F. Fillat, M.L. Peleato, Identification of a ferric uptake regulator from Microcystis aeruginosa PCC7806, FEMS Microbiol. Lett. 254 (2006) 63e70. [20] E. Sevilla, B. Martin-Luna, L. Vela, M.T. Bes, M.F. Fillat, M.L. Peleato, Iron availability affects mcyD expression and microcystin-LR synthesis in Microcystis aeruginosa PCC7806, Environ. Microbiol. 10 (2008) 2476e2483. [21] H.P. Ginn, L.A. Pearson, B.A. Neilan, NtcA from Microcystis aeruginosa PCC 7806 is autoregulatory and binds to the microcystin promoter, Appl. Environ. Microbiol. 76 (2010) 4362e4368. [22] T.M. Kuniyoshi, A. Gonzalez, S. Lopez-Gomollon, A. Valladares, M.T. Bes, M.F. Fillat, M.L. Peleato, 2-oxoglutarate enhances NtcA binding activity to promoter regions of the microcystin synthesis gene cluster, FEBS Lett. 585 (2011) 3921e3926. [23] E. Sevilla, B. Martin-Luna, L. Vela, M.T. Bes, M.L. Peleato, M.F. Fillat, Microcystin-LR synthesis as response to nitrogen: transcriptional analysis of the mcyD gene in Microcystis aeruginosa PCC7806, Ecotoxicology 19 (2010) 1167e 1173. [24] M.J. Harke, D.L. Berry, J.W. Ammerman, C.J. Gobler, Molecular response of the bloom-forming cyanobacterium, Microcystis aeruginosa, to phosphorus limitation, Microb. Ecol. 63 (2012) 188e198. [25] R. Rippka, J. Deruelles, J.B. Waterbury, M. Herdman, R.Y. Stanier, Generic assignments, strain histories and properties of pure cultures of cyanobacteria, J. Gen. Microbiol. 111 (1979) 1e61.
5
[26] G. Mackinney, Absorption of light by chlorophyll solutions, J. Biol. Chem. 140 (1941) 315e322. [27] M.W. Pfaffl, A new mathematical model for relative quantification in real-time RT-PCR, Nucleic Acids Res. 29 (2001) e45. [28] D. Breljak, A. Ambriovíc-Ristov, S. Kapitanovic, T. Cacev, J. Gabrilovac, Comparison of three RT-PCR based methods for relative quantification of mRNA, Food Technol. Biotechnol. 43 (2005) 379e388. [29] A. Gonzalez, M.T. Bes, F. Barja, M.L. Peleato, M.F. Fillat, Overexpression of FurA in Anabaena sp. PCC 7120 reveals new targets for this regulator involved in photosynthesis, iron uptake and cellular morphology, Plant Cell. Physiol. 51 (2010) 1900e1914. [30] R. Kurmayer, The toxin cyanobacterium Nostoc sp. strain 152 produces highest amounts of microcystin and nostophycin under stress conditions, J. Phycol 47 (2011) 200e207. [31] S. Jähnichen, T. Ihle, T. Petzoldt, Variability of microcystin cell quota: a small model explains dynamics and equilibria, Limnologica e Ecol. Manage. Inland Waters 38 (2008) 339e349. [32] T.W. Davis, D.L. Berry, G.L. Boyer, C.J. Gobler, The effects of temperature and nutrients on the growth and dynamics of toxic and non-toxic strains of Microcystis during cyanobacteria blooms, Harmful Algae 8 (2009) 715e725. [33] C.J. Gobler, T.W. Davis, K.J. Coyne, G.L. Boyer, Interactive influences of nutrient loading, zooplankton grazing, and microcystin synthetase gene expression on cyanobacterial bloom dynamics in a eutrophic New York lake, Harmful Algae 6 (2007) 119e133. [34] M. Aboal, M.A. Puig, Production of microcystins in calcareous Mediterranean streams: the Alharabe River, Segura River basin in south-east Spain, J. Appl. Phycol. 17 (2005) 231e243. [35] R. Molica, S. Azevedo, Ecofisiologia de cianobactérias produtoras de cianotoxinas, Oecol. Bras. 13 (2009) 229e246. [36] J. Heisler, P.M. Glibert, J.M. Burkholder, D.M. Anderson, W. Cochlan, W.C. Dennison, Q. Dortch, C.J. Gobler, C.A. Heil, E. Humphries, A. Lewitus, R. Magnien, H.G. Marshall, K. Sellner, D.A. Stockwell, D.K. Stoecker, M. Suddleso, Eutrophication and harmful algal blooms: a scientific consensus, Harmful Algae 8 (2008) 3e13. [37] D.W. Schindler, Eutrophication and recovery in experimental lakes: implications for lake management, Science 184 (1974) 897e899. [38] J.J. Elser, E.R. Marzolf, C.R. Goldman, Phosphorus and nitrogen limitation of phytoplankton growth in the fresh-waters of North-America e a review and critique of experimental enrichments, Can. J. Fish. Aquat. Sci. 47 (1990) 1468e 1477. [39] D.W. Schindler, Evolution of phosphorus limitation in lakes, Science 195 (1977) 260e262. [40] J. Huisman, F. Hulot, in: J. Huisman, H. Matthijs, P. Visser (Eds.), Population Dynamics of Harmful Cyanobacteria. Harmful Cyanobacteria, vol. 3, Springer, Netherlands, 2005, pp. 143e176.
Please cite this article in press as: T.M. Kuniyoshi, et al., Phosphate deficiency (N/P 40:1) induces mcyD transcription and microcystin synthesis in Microcystis aeruginosa PCC7806, Plant Physiology and Biochemistry (2013), http://dx.doi.org/10.1016/j.plaphy.2013.01.011
537 538 539 540 541 542 543 544 545 546 547 548 549 550 551 552 553 554 555 556 557 558 559 560 561 562 563 564 565 566 567 568 569 570 571 572