Phosphorylation of claudin-4 is required for tight junction formation in a human keratinocyte cell line

EX PE R IM E NTAL CE L L RE S E ARCH 314 ( 2 0 0 8 ) 332 6 –333 9

a v a i l a b l e a t w w w. s c i e n c e d i r e c t . c o m

w w w. e l s e v i e r. c o m / l o c a t e / y e x c r

Research Article

Phosphorylation of claudin-4 is required for tight junction formation in a human keratinocyte cell line Shinya Aono⁎, Yohei Hirai Department of Morphoregulation, Institute for Frontier Medical Sciences, Kyoto University, Shogoinkawahara-cho 53, Sakyo-Ku, Kyoto 606-8507, Japan

AR T IC L E I NF O R M AT IO N

AB ST R AC T

Article Chronology:

Extensive studies have identified a large number of the molecular components of cellular tight

Received 3 March 2008

junctions (TJ), including the claudins, occludin and ZO-1/2, and also many of the physical

Revised version received

interactions between these molecules. However, the regulatory mechanisms of TJ formation are as

13 August 2008

yet poorly understood. In HaCaT, a human epidermal keratinocyte cell line, TJ were newly formed

Accepted 13 August 2008

when cells were cultured in the presence of SP600125, a JNK inhibitor. Moreover, claudin-4 was

Available online 28 August 2008

newly phosphorylated during this process. We found that claudin-4 contains a sequence which is phosphorylated by atypical PKC (aPKC). Kinase assay demonstrated that the 195th serine

Keywords:

(serine195) of mouse claudin-4 was phosphorylated by aPKC in vitro. The 194th serine

Claudin

(serine194) of human claudin-4 corresponding to serine195 of mouse claudin-4 was

aPKC

phosphorylated in HaCaT cells when TJ were formed, and the phosphorylated claudin-4 co-

Tight junction

localized with ZO-1 at TJ. aPKC activity was required for both the claudin-4 phosphorylation and TJ

Keratinocyte

formation in HaCaT. Furthermore, overexpression of mutant claudin-4 protein S195A, which was not phosphorylated by aPKC, perturbed the TJ formation mediated by SP600125. These findings suggest that aPKC regulates TJ formation through the phosphorylation of claudin-4. © 2008 Elsevier Inc. All rights reserved.

Introduction In vertebrate epithelial cells, the tight junction (TJ) is one of the major intercellular adhesive structures. This structure is observed in the most apical region of the lateral membranes in simple epithelial cells and creates a primary barrier to the diffusion of solutes by the paracellular route. This TJ-based intercellular sealing is indispensable for creating compartments within the body [1,2]. Intensive studies have uncovered a large number of the molecular components of TJ, including ZO-1/2, occludin and the claudins, as well as the physical interactions between these molecules [3]. The claudins are integral membrane proteins containing four trans-

membrane domains and comprise a large gene family consisting of at least 24 members in mice/humans [2]. Claudin possesses a cytoplasmic tail at the carboxyl terminus and is known to bind to ZO-1/2 directly. Recent gene knockout studies of these components clearly demonstrated the physiological importance of certain individual components of TJ, along with TJ itself [4–9]. For example, epithelial cells, in which the expression of ZO-1 and ZO-2 has been suppressed, lack TJ [8]. Another example is that transgenic mice lacking claudin-1 expression exhibit post-natal lethality because of the lack of an epidermal diffusion barrier [4]. Mouse (or human) epidermal tissue consists of four cell layers with distinct histological features, the basal layer, spinous layer,

⁎ Corresponding author. Fax: +81 75 751 4601. E-mail address: [email protected] (S. Aono). Abbreviations: TJ, tight junctions; aPKC, atypical protein kinase C; C-DMEM, DMEM containing 9.8 mM of calcium; SPC-DMEM, C-DMEM containing 40 μM of SP600125; AJ, adherens junctions; NHEK, normal human epidermal keratinocyte; TER, transepithelial resistance ^ 0014-4827/$ – see front matter © 2008 Elsevier Inc. All rights reserved. doi:10.1016/j.yexcr.2008.08.012

EX PE R IM E NTAL CE LL RE S E ARCH 314 ( 2 0 0 8 ) 332 6 –333 9

granular layer, and stratum corneum. During the skin renewal process, stem cells located in the basal layer continue to proliferate while the newly produced cells start to differentiate, migrating from the basal layer into the spinous layer, granular layer, and stratum corneum, in that order [10–12]. In these tissues, the expression of claudin-1 is detectable in cells located in the spinous layer and granular layer, while that of ZO-1, occludin and claudin-4 are detectable only in cells of the granular layer [4,13,14]. Interestingly, the TJ are formed in cells located in the granular layer [4,13,14]. These observations strongly suggest TJ formation is temporally and spatially regulated in epidermal keratinocytes in the course of skin tissue homeostasis. TJ formation is regarded as one of the critical steps in establishing cellular asymmetry in highly polarized epithelial cells, as TJ localizes asymmetrically at the apical side of the basolateral membrane. Therefore, defects in TJ formation and mislocalization of ZO-1 are often attributed to defective establishment of cellular asymmetry, although recent reports demonstrated that an absence of ZO proteins disrupts TJ formation but not cellular asymmetry in highly polarized epithelial cells [8]. A large number of the molecular components required for establishing cellular asymmetry, as well as TJ formation, have been reported [15–18]. aPKC, “atypical protein kinase C”, comprises a special subgroup of the PKC family because of its distinct protein structure and regulatory mechanisms [19–20]. aPKC consists of two isoforms, PKCζ and PKCλ/ι. Recent studies have demonstrated that these isoforms are required for the establishment of cellular asymmetry [21–23]. Perturbation of the activity of aPKC or either of its associated proteins, Par-3 and Lgl, results in the mislocalization of ZO-1 [21,22,24–26]. The mislocalization of aPKC caused by the expression of a truncated form of PATJ results in the mislocalization of ZO-1 [27]. In addition, overexpression of aPKC is sufficient for TJ formation in primary keratinocytes in which TJ formation is defective as a result of the elimination of the rac-specific guanine nucleotide exchange factor Tiam-1 [28]. These findings suggest that aPKC (and/or Par-3, Lgl) plays a critical role not only in the establishment of cellular asymmetry, but also in TJ formation. However, the specific roles of aPKC in these physiological phenomena have not yet been elucidated. In this study, we analysed the unique properties of TJ formation in HaCaT, a human epidermal keratinocyte cell line. In this cell line, the localization of ZO-1 and claudin-4 changed dramatically when cells were cultured in the presence of the JNK inhibitor SP600125. These results show that TJ are newly formed in HaCaT when the cells are cultured in DMEM containing SP600125, and that the TJ formation in HaCaT is a model system for analysing the details of TJ formation. Further analysis revealed that serine194 of human claudin-4 was phosphorylated during TJ formation and the phosphorylated claudin-4 was co-localized with ZO-1 at TJ. In vitro kinase assay demonstrated serine195 of mouse claudin-4, which corresponds with the serine194 of human claudin-4, was phosphorylated by aPKC. When aPKC activity was suppressed by a specific inhibitor, serine194 of claudin-4 was not phosphorylated and the TJ formation was not observed, even when cells were cultured in the presence of SP600125. Furthermore, the mutant claudin-4 protein S195A, in which the potential target of aPKC is substituted to alanine, exhibited a dominant-negative effect on TJ formation. These results suggest aPKC regulates TJ formation through the phosphorylation of claudin-4.

3327

Materials and methods Cells and cell culture The human keratinocyte cell line HaCaT [29] and normal human primary epidermal keratinocyte cells (NHEK; Lonza) were used. These cells were cultured in DMEM (Sigma) with 10% FCS or KGM-2 BulletKit (Takara), respectively. KGM-2 contains 0.15 mM calcium.

Antibodies and other reagents The following primary antibodies were used; anti-ZO-1 mAb (#339100; Zymed), anti-claudin-1 pAb (#51-9000; Zymed), antioccludin pAb (#71-1500; Zymed), anti-claudin-4 mAb (#329400; Zymed), anti-claudin-4 pAb (#36-4800; Zymed), anti-PKCζ pAb (#sc-216; Santa Cruz), anti-phospho-PKCζ/λ pAb (#9387; Cell Signaling), anti-β-catenin pAb (#C2206; Sigma) and anti-FLAG pAb (#F7425; Sigma). The antibody specific for claudin-4 phosphorylated on serine195 (pAb195PS) was generated by immunizing a rabbit with the phosphopeptide TDKPY-pS-AKYSA conjugated with KLH (Keyhole Limpet Haemocyanin). For eliminating antibodies bound to non-phosphorylated claudin-4, antibodies which were purified by being incubated with phosphorylated peptide conjugated beads were incubated with non-phosphorylated claudin-4 peptide (TDKPY-S-AKYSA). The antibodies used for the detection of the primary antibodies were as follows: goat Cy-3-labeled antibody to mouse IgG (Amersham), AlexaFluor488-labeled antibody to mouse IgG (Chemicon), sheep HRP-linked antibody to mouse IgG (Amersham), goat HRP-linked antibody to rabbit IgG (Amersham). The following protein kinase inhibitors were used: SP600125 (Calbiochem), and myristoylated PKCζ pseudosubstrate (Biosource). This peptide inhibitor also blocks the activity of PKCλ/ι [25,30].

Evaluation of the barrier functions of TJ in HaCaT cells For monitoring transepithelial electrical resistance (TER) of HaCaT cells, 6.0 × 104 of cells were cultured in DMEM on collagen-coated Millicell-CM (#PICM01250) for 3 d. Then the culture medium was exchanged to SPC-DMEM to promote TJ formation. TER was measured every 24 h using an ERS electrical resistance system (Millipore) as described elsewhere [21,31]. TER values were obtained by subtracting the contribution of the filter and bathing solution and are expressed in Ohm × cm2.

Phosphoprotein purification Phosphoprotein purification was performed with a kit provided by QIAGEN (#37101). Proteins solubilized in lysis buffer were incubated by means of columns, and phosphorylated proteins bound to the beads were eluted after washing.

SDS-PAGE, immunoblotting and immunofluorescence Proteins were separated on SDS-PAGE, and electrophoretically transferred to membranes. For blocking, 5% skim milk in PBS or 1:10 diluted 1% casein in PBS (Pierce) were used. The transferred

3328

EX PE R IM E NTAL CE L L RE S E ARCH 314 ( 2 0 0 8 ) 332 6 –333 9

proteins were detected by the enhanced chemiluminescence system (Amersham). For immunohistochemical detection, cells were spread on coverslips with a density of 5.0 × 104/cm2 and were cultured for 3 d. They were fixed with 2.0% paraformaldehyde in PBS at 4 °C for 20 min and permeabilized by treatment with methanol at −20 °C for 20 min. For the detection with pAb195PS, cells were fixed and permeabilized by treatment with methanol at −20 °C for 30 min. For blocking, 5% skim milk in PBS or 1:10 diluted 1% casein in PBS (Pierce) were used. The immunostained samples were examined under MRC-1024 confocal microscopy (Bio-Rad) and the collected data was analysed with ImageJ (http://rsb.info.nih.gov/ij/).

Vector construction For stable expression of FLAG-tagged claudin-4 proteins in HaCaT cells, a retroviral expression system was utilized. For generating retroviral expression vectors, mouse claudin-4 (GenBank accession number Z17804) was amplified by the use of primers incorporating EcoRI restriction sites and cDNA as the template. Amplified fragments were inserted into a pFLAG-CMV-1 vector (Sigma) to construct pFLAG-CMV-cla4WT. The restriction fragment of pFLAG-CMV-cla4WT digested by SpeI/BamHI was inserted into pQCXIN (Clontech) digested by XbaI/BamHI. To make expression vectors for mutated claudin-4 S195A (i.e. with serine195 substituted to alanine) and S195D (i.e. with the serine195 substituted to aspartic acid), a QuickChange II SiteDirected Mutagenesis Kit (Stratagene) was used with the following primers: 5′-CGACAAGCCCTACGCGGCCAAGTACTCC-3′ and 5′GGAGTACTTGGCCGCGTAGGGCTTGTCG-3′ for S195A and 5′-CAACGACAAGCCCTACGACGCCAAGTACTCCGCCG-3′ and 5′-CGGCGGAGTACTTGGCGTCGTAGGGCTTGTCGTTG-3′ for S195D. Vectors encoding fusion proteins between GST and the C-terminal cytoplasmic domain of claudin-4 were constructed by inserting annealed oligonucleotides corresponding to the claudin-4 sequence into pGEX4T1 (Pharmacia). The sequences of the oligonucleotides inserted into pGEX4T1 were as follows. 5 ′ - A AT T C C G T A G C A A C G A C A A G C C C T A C T C G G C C A A G TACTCCGCCGCCCGCTCTGTCCCCGCCAGCAACTATGTGTAATCTAGAG-3′ and 5′-TCGACTCTAGATTACACATAGTTGCTGGCGGGGACAGAGCGGGCGGCGGAGTACTTGGCCGAGTAGGGCTTGTCGTTGCTACGG -3′ for WT, 5′-AATTCCGTAGCAACGACAAGCC CTACGC CGC CAAGTACTCCGCCGCCCGCTCTGTCCCCGCCAGCAACTATGTGTAATCTAGAG-3′ and 5′-TCGACTCTAGATTACACATAGTTGCTGGCGGGGACAGAGCGGGCGGCGGAGTACTTGGCGGCGTAGGGCTTGTCGTTGCTACGG-3′ for S195A, 5 ′ - A AT T C C G T A G C A A C G A C A A G C C C T A C T C G G C C A A G TACGCCGCCGCCCGCGCCGTCCCCGCCGCCAACTATGTGTAATCTAGAG-3′ and 5′-TCGACTCTAGATTACACATAGTTGGCGGCGGGGACGGCGCGGGCGGCGGCGTACTTGGCCGAGTAGGGCTTGTCGTTGCTACGG-3′ for AAA (with the 199th, 203rd and 207th serine substituted to alanine).

Adenovirus infection Adenovirus AxCA-pkcλwt for expressing aPKC [21] was kindly provided by Dr. Shigeo Ohno. For adenoviral infection, cells were seeded on plates (1.25 × 105cells/cm2) 1 d before infection. The cells were incubated for 1 h with appropriate virus solution diluted to

5 × 108 pfu/ml in culture medium. After 48 h incubation with fresh medium, cells were subjected to the analysis.

In vitro kinase assay The C-terminal cytoplasmic fragments of claudin-4 WT, S195A or AAA (see Fig. 4A) fused with GST were expressed in Escherichia coli DH5α and purified. 1.0 μg of either protein was mixed with 40 μl of kinase reaction buffer (20 mM Tris–Cl pH7.5, 5 mM Mg(OAc)2, 25 μg/ml phosphatidylserine, 0.1 μg/ml leupeptin and 4 μg/ml aprotinin) containing 1 μg of recombinant aPKCζ or PKC β1 (Upstate). The reaction was started by adding 10 μl of ATP mix (final concentration: 20 μM) and samples were incubated at 30 °C for 30 min. Assay was terminated by adding Laemmli sample buffer and analysed by SDS-PAGE and immunoblotting.

Immunoprecipitation HaCaT cells were lysed in TBS-T (50 mM Tris–HCl pH 7.6, 150 mM NaCl, 1 mM CaCl2, 1% Triton X-100, 1% NP-40, 1 mM PMSF, 1 mM NaVO3, 50 mM NaF) for 30 min at 4 °C on a rocking platform. For the immunoprecipitation with claudin-4 pAb (#sc-17664; Santa Cruz) or claudin-1 pAb (#sc-17658; Santa Cruz), the soluble fraction was collected, and pre-incubated with 50 μl of streptavidin agarose (Invitrogen) and 5% BSA on ice for 20 min. After preincubation, incubation steps with primary antibody, secondary biotin-conjugated donkey antibody to goat IgG (Santa Cruz), and streptavidin agarose were sequentially performed on ice for 1 h each, followed by washing three times with TBS-T. Finally, samples were boiled in 150 μl of Laemmli sample buffer for 5 min.

Phosphatase treatment The claudin-4 proteins purified with immunoprecipitation were separated by SDS-PAGE and electrophoretically transferred to membrane. The membrane was incubated with calf intestine alkaline phosphatase (Takara) at 30 °C for 2 h. The membrane was subjected to immunoblotting.

Results Re-localization of ZO-1 and claudins in a keratinocyte cell line As TJ formation is temporally and spatially regulated in epidermal keratinocytes during skin tissue homeostasis [4,10– 14], we expected TJ formation in keratinocytes would be an excellent model system for analysing the regulatory mechanisms of TJ formation. To address TJ formation in keratinocytes in vitro, we observed the localization of ZO-1 in HaCaT, a nontumorigenic human keratinocyte cell line widely utilized as a model system for the study of the structural and regulatory aspects of epithelial cell physiology and pathology [29,32]. While many keratinocyte cell lines stop proliferating and develop TJ when cultured in a medium containing a high level of calcium, we found that HaCaT cells can be maintained in normal DMEM containing 1.8 mM calcium without developing TJ. A previous study demonstrated that HaCaT cells develop functional TJ when cultured in DMEM containing vitamin C, and this culture system is a good model system for understanding the regulatory

EX PE R IM E NTAL CE LL RE S E ARCH 314 ( 2 0 0 8 ) 332 6 –333 9

mechanisms of TJ formation in keratinocytes [33]. HaCaT cells retained cell–cell adhesion and exhibited discontinuous punctate localization of ZO-1 along the cytoplasmic surface of the cell membrane (Fig. 1A; left), when they were cultured in DMEM. This localization of ZO-1 suggests the characteristic feature of an adhesion zipper or spot-like AJ which is observed in differentiating primary keratinocytes or polarizing epithelial cells [22,34– 36]. However, once cells were cultured for 24 h in DMEM containing 9.8 mM calcium (hereafter, we term this medium “CDMEM”), some of the cells began stratification and certain cells

3329

at the top of these stratified cell layers displayed a string-like localization pattern of ZO-1 (Fig. 1A; center). For further analysis, we examined whether chemical reagents would exhibit a similar effect on the localization of ZO-1. Among the tested reagents, SP600125, one of the JNK inhibitors, has demonstrated a significant effect on the localization of ZO-1. We tested SP600125 as a previous study had demonstrated that JNK activity is required for differentiation of keratinocytes [37]. We originally expected that SP600125 would suppress the TJ formation promoted by C-DMEM as TJ is developed in differentiated cells located in the granular layer of skin tissue. However, when cells were cultured for 24 h in C-DMEM containing 40 μM of SP600125 (hereafter, “SPC-DMEM”), many cells began to stratify and not only

Fig. 1 – Re-localization of ZO-1 and TJ formation in a keratinocyte cell line. (A) The human keratinocyte cell line HaCaT was cultured in DMEM, C-DMEM (DMEM containing 9.8 mM of calcium) or SPC-DMEM (C-DMEM containing 40 μM of the JNK inhibitor SP600125) for 24 h, and the localization of ZO-1 was examined by immunofluorescence. Multiple optical sections were stacked in each panel for analysis. A string-like localization of ZO-1 was observed when cells were cultured in C-DMEM for 24 h. This re-localization of ZO-1 was promoted when cells were cultured in SPC-DMEM for 24 h. Scale bar, 10 μm. (B) Primary human keratinocyte cells were cultured in low calcium KGM-2, KGM-2 containing 40 μM of the JNK inhibitor SP600125 (SP-KGM-2) or DMEM for 24 h, and the localization of ZO-1 was examined by immunofluorescence. Multiple optical sections were stacked in each panel for analysis. A string-like localization of ZO-1 was observed when cells were cultured in SP-KGM-2 for 24 h. In this experiment, some of the additional calcium was not mixed because precipitates formed. Original KGM-2 medium contains 0.15 mM calcium. Scale bar, 10 μm. (C) The localization of ZO-1 (red) was examined and compared with that of β-catenin (green) for visualizing lateral membranes by immunofluorescence in HaCaT cells cultured in SPC-DMEM for 24 h. XZ-section views were taken for the analysis. Arrows indicate the position selected for XZ-section analysis. The string-like localization of ZO-1 was detected in cells cultured in SPC-DMEM for 24 h (top). In the stratified cell layers, certain cells at the top these cell layers (asterisks) displayed string-like localization of ZO-1 (arrowheads). Multiple optical sections were stacked in each panel of the XY-view. Scale bar, 10 μm. (D) Expression of TJ proteins and aPKC in HaCaT. Whole cell lysate from HaCaT cells cultured in SPC-DMEM for 0, 6 or 24 h was separated by SDS-PAGE and analysed by immunoblotting with the antibodies indicated. The amount of these proteins did not change dramatically during TJ formation, although both claudins were slightly increased. The rabbit pAb to aPKC used in this experiment recognizes both PKCζ and PKCλ/ι. (E) TER measurement in HaCaT cells cultured in SPC-DMEM. 3 d after cell seeding (1.0 × 105 cells/cm2), the cells were cultured in DMEM (gray) or SPC-DMEM (black) for 0, 24, 48 and 72 h and subjected to TER analysis. The TER of cells cultured in SPC-DMEM developed after the medium was exchanged. Error bars represent the mean ± the SD. n = 15 in 3 independent experiments.

3330

EX PE R IM E NTAL CE L L RE S E ARCH 314 ( 2 0 0 8 ) 332 6 –333 9

certain cells at the top of these stratified cell layers but also cells still in the monolayer sheet exhibited the string-like localization of ZO-1 (Fig. 1A; right: Fig. 1C for pictures of the XZ section). A similar re-localization of ZO-1 was observed when cells were cultured in DMEM containing 40 μM of SP600125 (data not shown). On the other hand, this re-localization of ZO-1 was not observed when cells were cultured in C-DMEM containing 10 μM of SP600125 or DMSO (data not shown). To evaluate the biological significance of the re-localization of ZO-1 mediated by SPC-DMEM in HaCaT cells, we monitored the localization of ZO-1 in differentiating normal human epidermal keratinocytes. A similar re-localization of ZO-1 was observed in normal human epidermal keratinocytes (NHEK; Fig. 1B). NHEK cultured in KGM-2 containing 40 μM of SP600125 (SP-KGM-2) or DMEM for 24 h displayed a string-like localization pattern of ZO-1, while most of the NHEK cells cultured in KGM-2 for 3 d demonstrated discontinuous punctate localization of ZO-1 (Fig. 1B). To test whether the re-localization of ZO-1 correlated with TJ formation, transepithelial resistance (TER; [31]) of a HaCaT cell layer grown on a permeable support was measured. When the culture medium was changed from DMEM to SPC-DMEM, cells displayed TER development within 24 h and high TER values were maintained for at least 48 h after the medium exchange (Fig. 1E). These findings strongly suggest that TJ were newly formed in the HaCaT cells cultured in SPC-DMEM. Next, we observed the subcellular localization of other TJ components, especially the claudins, in HaCaT cells displaying the string-like localization of ZO-1. Previous reports had demonstrated that HaCaT cells express claudin-1, 3, 4 and 7 [33,38]. Among these claudins, we examined the behavior of claudin-1 and 4 in detail. While both claudins were localized at the basolateral membrane and the co-localization with ZO-1 was not evident in HaCaT cells cultured in DMEM, they were re-localized and co-localized with ZO-1 in cells cultured in SPC-DMEM for 24 h (Fig. 2). The

subcellular localization of ZO-1, claudin-1 and 4 were also examined in cells cultured in SPC-DMEM for 6 h. In these cells, ZO-1 still displayed discontinuous punctate localization and both claudins localized to the basolateral membrane (Fig. 2), although the pattern did display a string-like localization in some of the cells (Fig. 2, arrowheads). Based on these findings, the research became focused on understanding the physiological significance of the relocalization of ZO-1 and the claudins, and the regulatory mechanisms of TJ formation in HaCaT cells cultured for 24 h in SPC-DMEM.

Claudin-4 was highly phosphorylated after TJ formation We undertook examination of the molecular mechanisms of the TJ formation observed in HaCaT expecting to uncover the physiological regulatory mechanisms of TJ. First, we addressed the possibility that TJ formation is regulated through a modulation of the expression levels of TJ proteins. The amounts of ZO-1, claudin1,-4, and occludin during the TJ formation were analysed by immunoblotting. We also analysed the amount of aPKC with antibodies which can recognize both isoforms, PKCλ/ι and PKCζ. The amounts of these proteins did not change dramatically during TJ formation, although those of both claudins were slightly increased (Fig. 1D). The possibility that TJ formation is regulated through posttranscriptional protein modification was addressed, especially protein de-phosphorylation during TJ formation, as a kinase inhibitor was shown to promote TJ formation. To find these key proteins, phosphorylated proteins were purified from HaCaT cells both before and after TJ formation, and the amount of the individually purified proteins was compared by immunoblotting. Among the TJ components examined, the amount of bead-bound phosphorylated claudin-4 was dramatically increased during TJ formation, although the amount of claudin-4 solubilized in the

Fig. 2 – Re-localization of ZO-1 and claudins in a keratinocyte cell line. (A, B) Subcellular localization of ZO-1, claudin-1 and claudin-4 in HaCaT. HaCaT were cultured in DMEM (0 h) or SPC-DMEM (6 h and 24 h, respectively) and the localization of ZO-1 (green), claudin-1 and -4 (red in A and B, respectively) was examined by immunofluorescence. When cells were cultured in SPC-DMEM for 6 h, ZO-1 exhibited punctate localization in most of the cells, as observed in cells cultured in DMEM, although it did exhibit a string-like localization in some of the cells (arrowheads). Both claudins were co-localized with ZO-1 in cells cultured in SPC-DMEM for 24 h. Scale bar, 10 μm.

EX PE R IM E NTAL CE LL RE S E ARCH 314 ( 2 0 0 8 ) 332 6 –333 9

3331

binding buffer was unchanged (Fig. 3). In contrast, claudin-1 and ZO-1 were neither phosphorylated nor de-phosphorylated during TJ formation (Fig. 3). The amount of phosphorylated occludin protein with the smaller molecular weight (asterisks in Fig. 3) was slightly increased during TJ formation. However the amount of the smaller occludin in whole cell extracts (Fig. 1D) or solubilized in the binding buffer was also increased. Because we were not convinced that occludin proteins were newly phosphorylated during the TJ formation from these observations, we did not examine the occludin phosphorylation further.

aPKC phosphorylates the serine195 of claudin-4 We examined the physiological significance of claudin-4 phosphorylation during TJ formation. Claudin-4, a four membrane spanning transmembrane protein, has two cytoplasmic domains which interact and are phosphorylated by cytoplasmic protein kinases. Four serine, one threonine and three tyrosine residues, which are conserved in the human, rodent, dog and chimpanzee, are found in these two cytoplasmic domains, and all of them are located in the carboxyl terminal cytoplasmic domain except for the 105th threonine. Among them, serine195 of mouse claudin-4 (or serine194 of human claudin-4) is involved in the amino acid sequence matched to the consensus sequence for phosphorylation by aPKC (S-X-K/R; [39]), and this sequence is likewise conserved in the human, rodent, dog and chimpanzee (Fig. 4A).

Fig. 3 – Claudin-4 was highly phosphorylated after TJ formation. Phosphorylated proteins were collected with a PhosphoProtein Purification Kit (QIAGEN) from HaCaT cultured in DMEM (−TJ) or SPC-DMEM (+TJ) for 24 h. The amount of claudin-1, -4, ZO-1 and occludin proteins in lysate (sup) or purified phosphoprotein (PP) was examined by immunoblotting (A). The amount of purified claudin-4 protein dramatically increased after TJ formation, while that of claudin-1 and ZO-1 protein did not. The asterisks indicate the occludin protein with the smaller molecular weight. The purified phosphoproteins were also examined by silver staining to verify the proteins analysed by immunoblotting (B). According to this staining, it was demonstrated that almost equal amounts of phosphoproteins were present in each lane. The positions of molecular weight markers are 220, 97, 66, 45, 30, 20 and 14.3 10 × 103.

Fig. 4 – Physiological interaction between claudin-4 and aPKC. (A) Multiple sequence alignments for the carboxyl terminus cytoplasmic domain of claudin-4 from the mouse, human, dog, chimpanzee and rat. All of the nucleotide sequence data for claudin-4 are available from NCBI under the accession numbers NP_034033, NM_001305, XP_546920, XP_001148118, and NP_001012022, respectively. The amino acid sequence matched to the consensus sequence for phosphorylation by aPKC is represented in black. (B) Multiple sequence alignments for the carboxyl terminus cytoplasmic domain of the wild type (WT) and mutated mouse claudin-4 used for the kinase assay and extopically expressed in HaCaT cells. In S195A, the serine195 is substituted to alanine. In AAA, the 199th, 203rd and 207th serines are substituted to alanine. The peptide sequence of human claudin-4 used for the construction of pAb195PS is also aligned. (C) GST-cla4-WT, GST-cla4-S195A and GST-cla4-AAA were expressed by E. coli, purified and incubated with PKCζ or PKCβ1 in vitro. The substrate incubated with (or without) PKC was separated with SDS-PAGE and subjected to immunoblotting with pAb195PS or Coomassie Brilliant Blue staining for the verification of the equal protein amounts in the kinase assays. The CBB staining revealed that almost equal amounts of kinase and substrate were incubated. GST-cla4-WT and GST-cla-4AAA incubated with PKCζ were detected by pAb195PS, while GST-cla4-S195A was not. GST-cla4-WT incubated with PKCβ1 was also detected by pAb195PS. The positions of molecular weight markers are 100, 75, 50, 37, 25, 20, and 15 × 103.

3332

EX PE R IM E NTAL CE L L RE S E ARCH 314 ( 2 0 0 8 ) 332 6 –333 9

These findings prompted assessment of the physiological interaction between claudin-4 and aPKC. To address this question, we examined whether aPKC phosphorylates claudin-4 in vitro. In vitro kinase assay was performed using GST fused with the carboxyl terminal cytoplasmic domain of mouse claudin-4 (GSTcla4-WT; Fig. 4B) as the substrate, and commercially available aPKC. Phosphorylation of serine195 was analysed with antibodies (pAb195PS) constructed for detecting claudin-4 in which serine195 was specifically phosphorylated (see Materials and methods for the antibody construction procedure). The substrate incubated

with aPKC was recognized by pAb195PS, while the substrate incubated without aPKC was not (Fig. 4C). In contrast, when the kinase assay was performed with the substrate in which serine195 was substituted to alanine, this substrate (GST-cla4-S195A; Fig. 4B) was not recognized by pAb195PS, although it was incubated with aPKC (Fig. 4C). Furthermore, when the kinase assay was performed with the substrate in which the 199th, 203rd and 207th serines were substituted to alanine, this substrate (GST-cla4-AAA; Fig. 4B) was recognized by pAb195PS when it was incubated with aPKC (Fig. 4C). These results strongly suggest that aPKC phosphorylated

EX PE R IM E NTAL CE LL RE S E ARCH 314 ( 2 0 0 8 ) 332 6 –333 9

the serine195 of claudin-4 in vitro. At the same time, these results also demonstrate the specificity of the newly constructed pAb195PS to the phosphorylated serine195 of claudin-4. When in vitro kinase assay was performed with GST-cla4-WT and PKCβ1, PKCβ1 also phosphorylated GST-cla4-WT (Fig. 4C).

Serine194 of claudin-4 is phosphorylated in HaCaT cells We investigated whether the serine residue of claudin-4 phosphorylated in vitro was phosphorylated in HaCaT cells. Since HaCaT cells are derived from human epidermal tissue, the serine195 of mouse claudin-4 examined in the previous section corresponds to serine194 of human claudin-4. Claudin-4 proteins were purified from HaCaT cells cultured in SPC-DMEM for 24 h by immunoprecipitation. This purified claudin-4 was recognized by pAb195PS (Fig. 5A, left). To demonstrate that pAb195PS specifically recognized phosphorylated claudin-4, purified claudin-4 proteins transferred onto a PDVF membrane were incubated with alkaline phosphatase for 2 h. When these claudin-4 proteins were detected by pAb195PS, the intensity of the signals detected were decreased compared to that of the claudin-4 proteins which had not been incubated with alkaline phosphatase (Fig. 5A). It is also demonstrated that pAb195PS did not react with claudin-1 proteins or proteins which are non-specifically purified during the immunoprecipitation (Fig. 5A). Moreover pre-immune serum did not react with all of purified protein samples. These results strongly suggest that serine194 of human claudin-4 was phosphorylated in HaCaT cells. At the same time, these results demonstrated that in HaCaT cells pAb195PS preferentially recognizes the human claudin-4 in which serine194 is phosphorylated. An attempt was then made to confirm the physiological significance of the phosphorylation of serine194 in HaCaT cells, especially the correlation with TJ formation. While the protein

3333

samples collected from cells cultured in SPC-DMEM for 0, 6 or 24 h which were loaded as the amount of claudin-4 in each lane was essentially equal, a protein with a molecular weight 18 kDa corresponding to the claudin-4 protein was only recognized with pAb195PS, and this protein was not recognized with pre-immune rabbit serum (Figs. 5B, B’, B”). Moreover, the claudin-4 taken from cells in which TJ had formed after 24 h culture in SPC-DMEM reacted with pAb195PS more tightly than those of the other two samples (Fig. 5B). A similar phosphorylation of claudin-4 was observed in NHEK cultured in SP-KGM-2 or DMEM for 24 h (Fig. 5D). As was also made evident in this study, the string-like localization of ZO-1 and re-localization of claudin-4 was observed in HaCaT cells cultured in SPC-DMEM for 24 h, but was not evident in cells cultured for 6 h (Fig. 2B). Therefore, these results suggest that the phosphorylation of serine194 is correlated with the re-localization of claudin-4 and also TJ formation in HaCaT and NHEK cells. The subcellular localization of claudin-4 in which serine194 was phosphorylated was compared with that of claudin-4, including non-phosphorylated and phosphorylated proteins, and ZO-1. Few signals were detected with pAb195PS antibodies in cells cultured in normal DMEM, although claudin-4 proteins were detected at the lateral membrane. In contrast, string-like signals were detected by pAb195PS antibodies as a small amount of cytoplasmic signal in cells cultured in SPC-DMEM for 24 h (Fig. 5C), although claudin-4 proteins were localized not only at TJ, but also at the basolateral membrane (Fig. 5C). The string-like signals detected by pAb195PS antibodies were not detected by preimmune serum. The accumulation of phosphorylated claudin-4 detected with pAb195PS antibodies at the apical side of the basolateral membrane was clearly demonstrated when subcellular localizations were compared with non-phosphorylated claudin protein in the pictures of the XZ section. The string-like signals visualized by pAb195PS antibodies were perfectly co-localized

Fig. 5 – Serine194 of human claudin-4 was highly phosphorylated after TJ formation in HaCaT and NHEK. (A) pAb195PS specifically recognized human claudin-4 proteins in which serine194 was phosphorylated in vivo. Claudin-4 proteins purified from HaCaT cells cultured in SPC-DMEM for 24 h by immunoprecipitation were separated by SDS-PAGE and electrically blotted onto a PVDF membrane. The proteins on the membrane were incubated with alkaline phosphatase for 2 h, blocked with 0.5% casein in PBS, and analysed by immunoblotting with antibodies indicated. After the phosphatase treatment, the signal recognized by pAb195PS weakened. pAb195PS did not react with the immunoprecipitates collected with anti-claudin-1 pAb or the immunoprecipitates collected without cell lysate. Pre-immune serum did not react with the immunoprecipitates collected in this experiment. (B, B’, B”) Whole cell lysate from HaCaT cells cultured in SPC-DMEM for 0, 6 or 24 h was separated by SDS-PAGE and analysed by immunoblotting with anti-claudin-4 pAb (B), pAb195PS (B’) or pre-immune serum (B”). The protein samples loaded as claudin-4 in each lane were approximately equal. pAb195PS recognized a protein of 18 kDa in molecular weight which was not detected by pre-immune rabbit serum. Serine195 of claudin-4 was phosphorylated after cells had been cultured in SPC-DMEM for 24 h. The positions of molecular weight markers are 150, 100, 75, 50, 37, 25, 20, 15, and 10 × 103. (C, C’) The localization of claudin-4 in which serine194 was phosphorylated. The localization of phosphorylated claudin-4 (red in C) was examined and compared with that of claudin-4 (including non-phosphorylated and phosphorylated forms; green) or ZO-1 (green) by immunofluorescence in HaCaT cells cultured in SPC-DMEM for 0 or 24 h. XZ-section views were also taken for the analysis. Arrows indicate the position selected for XZ-section analysis. Phosphorylated claudin-4 was detected in cells cultured in SPC-DMEM for 24 h. In these cells, phosphorylated claudin-4 accumulated at the apical edge of the lateral membrane (arrowheads) and co-localized with ZO-1. These signals detected by pAb195PS were not detected by pre-immune serum (red in C’). Multiple optical sections were stacked in each panel to analyse the localization of non-phosphorylated claudin-4 and phosphorylated claudin-4. Scale bars, 10 μm. (D) Whole cell lysate from NHEK cells cultured in SP-KGM-2 for 0 or 24 h, or cultured in DMEM for 24 h was separated by SDS-PAGE and analysed by immunoblotting with anti-claudin-4 pAb and pAb195PS. The protein samples loaded as claudin-4 in each lane were approximately equal. pAb195PS recognized a protein of 18 kDa in molecular weight. Serine195 of claudin-4 was phosphorylated after cells had been cultured in SP-KGM-2 or DMEM for 24 h.

3334

EX PE R IM E NTAL CE L L RE S E ARCH 314 ( 2 0 0 8 ) 332 6 –333 9

with ZO-1 (Fig. 5C). These observations suggest that claudin-4 in which serine194 was phosphorylated preferentially accumulated at TJ in HaCaT cells when these cells were induced to form TJ.

aPKC is required for TJ formation in HaCaT Previous studies have demonstrated that aPKC localizes at TJ in simple monolayered epithelial cells and participates in the TJ formation observed in these cells [21,22]. To investigate the contribution of aPKC to the TJ formation in stratified epithelium, the subcellular localization of aPKC was observed in HaCaT cells. aPKC did not exhibit cytoplasmic accumulation in HaCaT cells when cells were cultured in DMEM (Fig. 6A). However, when cells were cultured in SPC-DMEM for 24 h, aPKC co-localized with ZO-1 in TJ-forming HaCaT cells, even though this accumulation of aPKC at TJ was somewhat obscure due to the remarkable cytoplasmic distribution of aPKC (Fig. 6A). The co-localization of aPKC with ZO-1 at TJ in HaCaT cells prompted the investigation of whether aPKC plays a key role

during TJ formation in HaCaT cells. To address this question, an attempt was made to monitor the TJ formation of cells in which kinase activity of aPKC was specifically elevated or repressed. HaCaT cells did not demonstrate the re-localization of ZO-1 when aPKC proteins were ectopically expressed so as to elevate the activities of aPKC (Figs. 6C, H), although overexpression of aPKC promoted the phosphorylation of serine194 of claudin-4 (Fig. 6H). We also treated cells with PMA to activate PKCs and see their effects on TJ formation. However these cells did not demonstrate the re-localization of ZO-1 (Fig. 6D) and the treatment with PMA did not promote the phosphorylation of serine194 of claudin-4 (Fig. 6H). To block the activities of aPKC, we decided to utilize a cell permeable peptide inhibitor. The sequence of this peptide inhibitor corresponds to that of the regulatory domain of PKCζ, which can bind to the catalytic domain of PKCζ and block the kinase activity specifically [30,40]. Because the sequence of the regulatory domain of PKCζ is utilized in the peptide inhibitor which is conserved in PKCλ/ι, this peptide inhibitor can block the activity of PKCλ/ι [25,30]. When cells were cultured in the presence of

EX PE R IM E NTAL CE LL RE S E ARCH 314 ( 2 0 0 8 ) 332 6 –333 9

100 μM of this aPKC peptide inhibitor, cells demonstrated discontinuous localization of ZO-1, even when they were cultured in SPC-DMEM for 24 h (Fig. 6B). In these cells, development of TER corresponding to TJ formation was not observed (Fig. 6E). These results suggest that the activity of aPKC is required for the TJ formation and activation of aPKC, or PKCs are not sufficient for the TJ formation in HaCaT cells. We also examined whether serine194 of claudin-4 was phosphorylated in HaCaT cells when the kinase activity of aPKC was repressed. While each protein sample was loaded so that the amount of claudin-4 in each lane was essentially equal, claudin-4 from parental cells reacted with pAb195PS more tightly than that from cells in which aPKC activity was repressed by a specific inhibitor of aPKC (Fig. 6F). These results suggest that serine194 of claudin-4 was phosphorylated by aPKC in HaCaT cells during TJ formation. We investigated whether aPKC was activated during TJ formation by immunoblotting with a phospho-aPKC antibody. Since the protein samples collected from cells cultured in SPCDMEM for 0, 6 or 24 h as the amount of aPKC in each lane were approximately the same, and the intensity of the bands in each lane detected with the phospho-aPKC antibody was not observably changed, the activation of aPKC was not demonstrated (Fig. 6G).

Dominant-negative effect of a claudin-4 mutant (S195A) on TJ formation For the further analysis of the functional consequences between the phosphorylation of serine194 and TJ formation, HaCaT cells expressing mouse claudin-4 protein in which serine195 was substituted to alanine (S195A) were generated and TJ formation in these cells was observed. As the transfection efficiency was not

3335

sufficiently high to examine the effect of transiently expressed exogenous gene products in HaCaT cells, cells stably expressing exogenous gene products were isolated for this experiment. To exclude clonal artifacts, we monitored the TJ formation in multiple independent clones for each of the transfectants and obtained consistent results with these clones. We first examined the amount of the transgene products in HWT and HS195A cells, HaCaT clone cells ectopically expressing wildtype mouse claudin-4 or S195A, respectively. Essentially similar amounts of the transgene products, which migrated more slowly than the endogenous claudin-4 gene products, were expressed in the HWT and HS195A cells. While the amount of endogenous claudin-4 in HWT was slightly increased, as observed in parental HaCaT cells (Fig. 7A), the amount in HS195A was not. Next we examined the TJ formation of the HWT and HS195A cells. All of the three independent HWT cell lines exhibited discontinuous punctate localization of ZO-1 when they were cultured in DMEM as parental HaCaT cells (data not shown). These observations support the idea that elevation of claudin-4 expression during the 24 h culture in SPC-DMEM (Fig. 1D) is not essential for TJ formation. These HWT cells displayed a stringlike localization of ZO-1 when they were cultured in SPC-DMEM for 24 h as parental HaCaT cells (Fig. 7B). HS195A cells exhibited discontinuous localization of ZO-1 even after they were cultured in SPC-DMEM for 24 h (Fig. 7B). The same result was obtained from five independent clones expressing S195A proteins (data not shown). When the TJ formation in HWT or HS195A cells cultured in SPC-DMEM was monitored through TER development, the TER of HWT was developed while that of HS195A was not (Fig. 7C). These results suggest that exogenous S195A proteins perturb the TJ formation mediated by endogenous claudin-4 in HS195A cells.

Fig. 6 – Contribution of aPKC on TJ formation in HaCaT cells. (A) Localization of aPKC in HaCaT cells. HaCaT cells were cultured in SPC-DMEM for 24 h. The localization of aPKC (red) and ZO-1 (green) was examined by immunofluorescence. Co-localization of aPKC and ZO-1 was confirmed. Multiple optical sections were stacked in each panel for analysis. The rabbit pAb to aPKC used in this experiment recognizes both PKCζ and PKCλ/ι. Scale bar, 10 μm. (B) aPKC activity was required for TJ formation in HaCaT cells. HaCaT cells were cultured in SPC-DMEM or SPC-DMEM with 100 μM of an aPKC inhibitor peptide for 24 h. The localization of ZO-1 was examined by immunofluorescence. Multiple optical sections were stacked in each panel for analysis. In the presence of the aPKC inhibitor, the string-like localization of ZO-1 was not detected. Scale bar, 10 μm. (C) HaCaT cells were incubated for 1 h with the aPKC adenovirus solution. After a 48 h incubation with fresh medium, cells were subjected to the analysis. Ectopically expressed molecules were detected by the rabbit pAb to aPKC (red). Multiple optical sections were stacked in each panel for analysis. Cells ectopically expressing aPKC (asterisks) did not display a string-like localization of ZO-1 (green; arrow). Scale bar, 10 μm. (D) HaCaT were cultured in DMEM, or DMEM containing 1 μg/ml of PMA, the PKC activator, for 24 h, and the localization of ZO-1 was examined by immunofluorescence. Multiple optical sections were stacked in each panel for analysis. A string-like localization of ZO-1 was not observed when cells were cultured in DMEM containing 1 μg/ml of PMA for 24 h. Scale bar, 10 μm. (E) TER measurement in HaCaT cells cultured in SPC-DMEM. 3 d after cell seeding (1.0 × 105 cells/cm2), the cells were cultured in DMEM, SPC-DMEM or SPC-DMEM with 100 μM of an aPKC inhibitor peptide inhibitor for 24 h and subjected to TER analysis. The TER of cells cultured in SPC-DMEM did not develop when the aPKC activity was suppressed by the inhibitor. Error bars represent the mean ± the SD. ⁎P < 0.001; ⁎⁎P > 0.01. n = 6 in 2 independent experiments. (F) Whole cell lysate from HaCaT cells cultured in SPC-DMEM or SPC-DMEM with 100 μM of the aPKC inhibitor peptide for 24 h was separated by SDS-PAGE and analysed by immunoblotting with anti-claudin-4 pAb and pAb195PS. The serine195 of claudin-4 was not phosphorylated when the aPKC activity was suppressed by the inhibitor. (G) Whole cell lysate from HaCaT cells cultured in SPC-DMEM for 0, 6 or 24 h was separated by SDS-PAGE and analysed by immunoblotting with anti-aPKC pAb (Santa Cruz) and phospho-aPKC pAb which specifically recognizes active aPKC. The activation of aPKC was not exhibited during TJ formation. (H) Whole cell lysate from HaCaT cells cultured in DMEM, SPC-DMEM or DMEM containing PMA for 24 h (lane 1, 2 and 3, respectively) and that of HaCaT cells cultured for 48 h after 1 h incubation with the aPKC adenovirus solution (lane 4), was separated by SDS-PAGE and analysed by immunoblotting with anti-aPKC pAb (Santa Cruz), anti-phospho-aPKC pAb which specifically recognizes active aPKC, anti-claudin-4 pAb and pAb195PS. The aPKC activity was elevated and serine195 of claudin-4 was phosphorylated when HaCaT cells were incubated with the aPKC adenovirus solution (lane 4). Serine195 of claudin-4 was not phosphorylated when HaCaT cells were cultured with DMEM containing PMA (lane 3).

3336

EX PE R IM E NTAL CE L L RE S E ARCH 314 ( 2 0 0 8 ) 332 6 –333 9

We also examined the TJ formation of the HaCaT cells expressing mouse claudin-4 protein S195D in which serine195 was substituted to aspartic acid (S195D). This mutant molecule is expected to act as a claudin-4 whose serine195 is phosphorylated. The cells expressing S195D (HS195D) exhibited discontinuous localization of ZO-1 when they were cultured in DMEM (Figs. 7A, D). The same result was obtained from three independent clones expressing S195D proteins. These results suggest that phosphorylation of serine195 of claudin-4 is not sufficient for TJ formation in HaCaT cells.

Discussion The post-transcriptional regulation of TJ formation through phosphorylation of TJ proteins still remains to be addressed. There are several reports that phosphorylation of TJ components modulate the permeability of TJ without affecting the subcellular localizations of TJ components [41–47], while there are few reports that phosphorylation of these molecules affects either TJ formation or the localization of other TJ components [40,48–51]. In this study, we examined TJ formation in a human keratinocyte cell line mediated by a JNK inhibitor. We demonstrated that ZO-1 and claudin-1, 4 were re-localized (Fig. 1A, Fig. 2) and the serine194 of human claudin-4 was newly phosphorylated during TJ formation in HaCaT cells (Figs. 5B, B’). This phosphorylated claudin-4 was colocalized with ZO-1 at TJ (Fig. 5C). In vitro kinase assay demonstrated that the serine195 of mouse claudin-4 was phosphorylated by aPKC (Fig. 4C). When aPKC activity was suppressed by a specific peptide inhibitor, claudin-4 was not phosphorylated and the TJ formation was not observed (Figs. 6B, F). Overexpression of aPKC promoted the phosphorylation of serine194 of claudin-4 (Fig. 6H). We also demonstrated that the claudin-4 S195A mutant perturbed TJ formation in HaCaT cells (Fig. 7B). These results provide the first evidence that the serine194 of claudin-4 is phosphorylated by aPKC, and that this phosphorylation is required for TJ formation in keratinocytes. TJ formation in HaCaT cells is tightly linked to claudin-4 phosphorylation and aPKC activity. From our observations, we propose that TJ formation is regulated by the phosphorylation of claudin-4 by aPKC in HaCaT cells. We have not yet succeeded in detecting an elevation of aPKC activity by immunoblotting during TJ formation in HaCaT cells (Fig. 6G). It is possible that the activity of aPKC is specifically elevated at the locations where TJ are formed through the local accumulation of aPKC, and the claudin-4 proteins which are phosphorylated by locally accumulated aPKC participate in TJ formation. This idea is consistent with the observation that non-phosphorylated claudin-4 proteins localizing at the lateral membrane did not exhibit a dominant-negative effect on TJ formation in cells cultured in SPC-DMEM. HaCaT cells did not demonstrate the relocalization of ZO-1 (Figs. 6C, H) when ectopically expressed aPKC promoted the phosphorylation of serine194 of claudin-4 (Fig. 6H) or claudin-4 mutant protein S195D was ectopically expressed (Fig. 7D). These results suggest that the regulatory mechanism of TJ formation is more complex and that phosphorylation of serine194 of claudin-4 is not sufficient for TJ formation. In this study, we focused on the biological significances of the phosphorylation of serine194 of claudin-4 by aPKC in TJ forma-

tion, as we had found serine194 involved in consensus sequence for phosphorylation by aPKC. Therefore, the phosphorylation of claudin-4 was examined by pAb195PS antibody and kinase assay was mainly performed with aPKC. Our results do not exclude the possibility that other serine, threonine or tyrosine residues of claudin-4 are phosphorylated by other kinases, and this phosphorylation plays some role in TJ formation in HaCaT cells. It is worthy of note that PKCβ1 phosphorylated GST-cla4-WT in vitro (Fig. 4C), although TJ formation and the phosphorylation of serine194 of claudin-4 were not observed in HaCaT cells treated with PMA (Figs. 6D, H). We identified a number of similarities in the regulatory mechanism of TJ formation between HaCaT and NHEK. In HaCaT, TJ formation is promoted when cells are cultured with SPC-DMEM (Fig. 1A). In NHEK cultured in KGM-2 containing 0.15 mM calcium, TJ formation is promoted when SP600125 is supplemented to the medium (Fig. 1B). During these TJ formation promoted by SP600125, the phosphorylation of serine194 is observed in both cell types (Figs. 5B, B’, D). Overexpression of aPKC or supplementation of PMA to the culture medium did not promote the TJ formation of HaCaT cells cultured in DMEM or NHEK cells cultured in KGM-2 (Figs. 6C, D, H, data not shown). A previous study demonstrated that PKCλ/ι and PKCζ are expressed and activated in newborn mouse skin [14,30]. Based on these observations, we consider the regulatory mechanism of TJ formation in HaCaT to not be observably different from that in either NHEK or that which occurs during skin tissue morphogenesis. We also found certain differences in TJ formation between HaCaT and NHEK. It is an interesting phenomena that when cultured in DMEM for 3–5 d, HaCaT do not develop TJ (Fig. 1A), while NHEK develop TJ within 24 h (Fig. 1B) [28,30,52]. We have confirmed that 5–10% of HaCaT cells demonstrate string-like localization of ZO-1 when they are cultured for 10–14 d in DMEM without trypsinization (data not shown). Brandner's group demonstrated that HaCaT cells develop TJ when cultured in DMEM containing vitamin C [33]. These results suggest that HaCaT cells retain the ability to form TJ, but develop TJ more slowly than NHEK for unknown reasons. SP600125 seems to accelerate the development of TJ in HaCaT cells by unknown mechanisms. The slower development of TJ may correlate with the slower differentiation of HaCaT cells. The result that overexpression of aPKC enhances barrier formation in primary keratinocytes [30] is not consistent with our observation in HaCaT. It is likely that some unknown switch must be triggered by SP600125 in addition to activating aPKC for TJ formation in HaCaT cells. The precise regulatory mechanism of TJ formation in HaCaT cells is worth investigating further to obtain a more comprehensive understanding of TJ formation in keratinocytes and developing skin. The values of TER observed in this study were not as large as those observed in previous studies [30]. The TJ of HaCaT cells developed during the culture in SPC-DMEM may be immature. Is the phosphorylation of claudin associated with TJ formation in other cell lines? We found that overexpression of mutant claudin-4 S195A proteins did not affect TJ formation in MDCK cells (data not shown). It is possible that the regulatory mechanism of TJ formation in stratified epithelial keratinocytes is different from that of simple epithelium, that is, keratinocyte TJ formation is regulated through the phosphorylation of claudin-4, while that of simple epithelium is regulated through the phosphorylation of other claudins. A previous study demonstrated that PKC regulates

EX PE R IM E NTAL CE LL RE S E ARCH 314 ( 2 0 0 8 ) 332 6 –333 9

3337

Fig. 7 – Dominant-negative effect of a claudin-4 mutant (S195A) on TJ formation. (A) A HaCaT cell line expressing wildtype mouse claudin-4, S195A or S195D (HWT, HS195A and HS195D, respectively) was isolated. The relative amount of endogenous claudin-4 and ectopically expressed claudin-4 was compared by immunoblotting. The asterisk indicates the transgene products. Whole cell lysates were collected from HWT and HS195A cells cultured in SPC-DMEM for 0, 6 or 24 h, subjected to SDS-PAGE and detected with anti-claudin-4 pAb. Similar amounts of the transgene products were expressed in the HWT and HS195A cell lines. While the amount of endogenous claudin-4 in HWT was slightly increased, that in HS195A was not. Whole cell lysates were also collected from parental HaCaT and HS195D cells cultured in DMEM, subjected to SDS-PAGE and detected with anti-claudin-4 pAb. (B) TJ formation HWT and HS195A cells were examined after 24 h culture in SPC-DMEM. Ectopically expressed molecules were detected with FLAG-tag (red), which was connected at the N-terminal of these molecules. Cells expressing wildtype claudin-4 displayed the re-localization of ZO-1 (green), while cells expressing mutant claudin-4 did not. Scale bar, 10 μm. (C) TER measurement in HWT or HS195A cells cultured in SPC-DMEM. 3 d after cell seeding (1.0 × 105 cells/cm2), the cells were cultured in SPC-DMEM and subjected to TER analysis. The TER of HWT cells (gray) developed as parental HaCaT cells, while that of HS195A cells (black) did not, even when cultured in SPC-DMEM. Error bars represent the mean ± the SD. n = 10 in 2 independent experiments. (D) TJ formation of HS195D cells cultured in DMEM was examined. Ectopically expressed molecules were detected with FLAG-tag (red), which was connected at the N-terminal of these molecules. Cells expressing mutant claudin-4 did not display the re-localization of ZO-1 (green). Scale bar, 10 μm.

the assembly of TJ proteins through phosphorylation of ZO-1 [48]. It was also demonstrated that inhibition of PP2A by okadaic acid promotes the phosphorylation and recruitment of ZO-1, occludin, and claudin-1 to the TJ in MDCK cells in an aPKC dependent manner [40]. These observations suggest that TJ formation in MDCK cells is associated with the phosphorylation of TJ proteins, including the phosphorylation of claudin-1 by aPKC. Indeed, claudin-1, which is widely expressed in simple epithelial cells, contains a match to the consensus sequence for phosphorylation by aPKC. Morin's group demonstrated that the phosphorylation of threonine189 and serine194 of human claudin-4 by PKCɛ disrupts the barrier function of TJ, with an effect on the subcellular localization of claudin-4 in human ovarian cancer cells treated with PMA [50]. These results are inconsistent with our results demonstrating that the serine194 of claudin-4 is phosphorylated by aPKC and this phosphorylation is required for TJ formation. In several cancers, the expression of claudins has been found to be

increased and these proteins may exert a positive effect on tumorigenesis, affecting invasion, motility, and cell survival [41]. In the ovarian cancers examined by Morin's group, the expression of claudin-4 proteins were often increased, as is also the case in breast, pancreatic, and prostate cancers [41,50]. It is perhaps not surprising that the regulatory mechanism of TJ formation and/or the physiological interpretation of claudin phosphorylation would be altered in cells in which the amount of claudins are increased. How is TJ formation regulated through claudin phosphorylation? The phosphorylation of serine217 of claudin-16 (or paracellin-1) is required for its localization at TJ when ectopically expressed in MDCK cells, and a non-phosphorylated mutant form of claudin-16, in which serine217 is substituted to alanine, accumulates in lysosomes [45]. The precise localization of claudins requires the expression of ZO proteins [8]. From these observations, we consider TJ formation to be regulated through the subcellular localization of claudins, and/or a physical interaction

3338

EX PE R IM E NTAL CE L L RE S E ARCH 314 ( 2 0 0 8 ) 332 6 –333 9

between claudins and ZO proteins, in a phosphorylation-dependent manner. While we demonstrated that the claudin-4 in which the serine194 was phosphorylated was co-localized with ZO-1 at TJ, Morin's group demonstrated that the phosphorylation of threonine189 and serine194 of human claudin-4 disrupts the barrier function of TJ with an affect on the subcellular localization of claudin-4 [50]. One of the reasonable interpretations for these different aspects of phosphorylated claudin-4 is that the phosphorylation of serine194 of claudin-4 is required for TJ formation and the phosphorylation of threonine189 of claudin-4 is associated with the disruption of TJ. To investigate these hypotheses, it is worth examining whether the phosphorylation of claudin-4 affects its interaction with ZO-1. We also expect that an understanding of the working mechanism of the S195A mutant molecule would result in an understanding of how TJ formation is regulated through claudin phosphorylation. Once a TJ had formed in HaCaT cells during culture in SPCDMEM, this TJ was maintained even after these cells were subsequently cultured in the original DMEM (data not shown). These observations suggest that the cells in which the TJ formed had differentiated during culture in SPC-DMEM, as in a previous study demonstrating that HaCaT cells were induced to differentiate by increasing the calcium concentration in the culture medium [53]. SP600125 is a well known JNK inhibitor. However, the target of SP600125 in TJ formation is still unclear, because 40 μM of SP600125 suppresses not only the activity of JNK, but also that of other kinases [54]. Indeed, the results from the study using JNK knockout mice, which demonstrated that JNK activity is indispensable for epidermal proliferation and differentiation [37], is inconsistent with our results, which suggest that the target of SP600125 suppresses the epidermal differentiation in HaCaT. For a complete understanding of the TJ formation in HaCaT demonstrated in this study, it will be necessary to identify the target of SP600125. In conclusion, it is demonstrated that serine194 of human claudin-4 is phosphorylated during TJ formation in keratinocytes. The phosphorylated claudin-4 preferentially co-localized with ZO-1 at TJ. Claudin-4 is phosphorylated by aPKC in vitro. The phosphorylation of claudin-4 during TJ formation depends on functional aPKC activity. These findings establish that TJ formation is regulated by aPKC through the phosphorylation of claudin4 in keratinocytes.

Acknowledgments We thank Dr. Motomu Manabe for HaCaT cells, Dr. Mikio Furuse for claudin-4 cDNA, Dr. Atsushi Suzuki for advice on the kinase assay and helpful discussions, Dr. Shigeo Ohno for adenovirus AxCApkcλwt and Yumiko Okuda for administrative support. This work was supported by an endowment from Sumitomo Electric Industries (Y.H.). The authors declare no competing financial interests. Pacific Edit reviewed the manuscript prior to submission.

REFERENCES

[1] S. Tsukita, M. Furuse, Claudin-based barrier in simple and stratified cellular sheets, Curr. Opin. Cell Biol. 14 (2002) 531–536.

[2] M. Furuse, S. Tsukita, Claudins in occluding junctions of humans and flies, Trends in Cell Biol. 16 (2006) 181–188. [3] K. Matter, S. Aijaz, A. Tsapara, M.S. Balda, Mammalian tight junctions in the regulation of epithelial differentiation and proliferation, Curr. Opin. Cell Biol. 17 (2005) 453–458. [4] M. Furuse, M. Hata, K. Furuse, Y. Yoshida, A. Haratake, Y. Sugitani, T. Noda, A. Kubo, S. Tsukita, Claudin-based tight junctions are crucial for the mammalian epidermal barrier: a lesson from claudin-1 deficient mice, J. Cell. Biol. 156 (2002) 1099–1111. [5] T. Nitta, M. Hata, S. Gotoh, Y. Seo, H. Sasaki, N. Hashimoto, M. Furuse, S. Tsukita, Size-selective loosening of the blood-brain barrier in claudin-5 deficient mice, J. Cell. Biol. 161 (2003) 653–660. [6] S. Kitajiri, T. Miyamoto, A. Mineharu, N. Sonoda, K. Furuse, M. Hata, H. Sasaki, Y. Mori, T. Kubota, J. Ito, M. Furuse, S. Tsukita, Compartmentalization established by claudin-11-based tight junctions in stria vascularis is required for hearing through generation of endocochlear potential, J. Cell Sci. 117 (2004) 5087–5096. [7] T. Miyamoto, K. Morita, D. Takemoto, K. Takeuchi, Y. Kitano, T. Miyakawa, K. Nakayama, Y. Okamura, H. Sasaki, Y. Miyachi, M. Furuse, S. Tsukita, Tight junctions in Schwann cells of peripheral myelinated axons: a lesson from claudin-19-deficient mice, J. Cell. Biol. 169 (2005) 527–538. [8] K. Umeda, J. Ikenouchi, S. Katahira-Tayama, K. Furuse, H. Sasaki, M. Nakayama, T. Matsui, S. Tsukita, M. Furuse, S. Tsukita, ZO-1 and ZO-2 independently determine where claudins are polymerized in tight-junction strand formation, Cell 126 (2006) 741–754. [9] J. Hou, Q. Shan, T. Wang, A.S. Gomes, Q. Yan, D.L. Paul, M. Bleich, D.A. Goodenough, Transgenic RNAi depletion of claudin-16 and the renal handling of magnesium, J. Biol. Chem. 282 (2007) 17114–17122. [10] F.M. Watt, Stem cell fate and patterning in mammalian epidermis, Curr. Opin. Genet. Dev. 11 (2001) 410–417. [11] E. Fuchs, S. Raghavan, Getting under the skin of epidermal morphogenesis, Nat. Rev. Genet. 3 (2002) 199–209. [12] M. Perez-Moreno, C. Jamora, E. Fuchs, Sticky business: orchestrating cellular signals at adherens junctions, Cell 112 (2003) 535–548. [13] J.M. Brandner, S. Kief, C. Grund, M. Rendl, P. Houdek, C. Kuhn, E. Tschachler, W.W. Franke, I. Moll, Organization and formation of the tight junction system in human epidermis and cultured keratinocytes, Euro. J. Cell. Biol. 81 (2002) 253–263. [14] J.A. Tunggal, I. Helfrich, A. Schmitz, H. Schwarz, D. Gunzel, M. Fromm, R. Kemler, T. Krieg, C.M. Niessen, E-cadherin is essential for in vivo epidermal barrier function by regulating tight junctions, EMBO J. 24 (2005) 1146–1156. [15] S. Ohno, Intercellular junctions and cellular polarity: the PAR– aPKC complex, a conserved core cassette playing fundamental roles in cell polarity, Curr. Opin. Cell Biol. 13 (2001) 641–648. [16] W.J. Nelson, Adaptation of core mechanisms to generate cell polarity, Nature 422 (2003) 766–774. [17] I.G. Macara, Parsing the polarity code, Nat. Rev. Mol. Cell Biol. 5 (2004) 220–231. [18] A. Suzuki, S. Ohno, The PAR–aPKC system: lessons in polarity, J. Cell Sci. 119 (2006) 979–987. [19] H. Hug, T.F. Sarre, Protein kinase C isoenzymes: divergence in signal transduction? Biochem. J. 291 (1993) 329–343. [20] J. Moscat, M.T. Diaz-Meco, The atypical protein kinase Cs. Functional specificity mediated by specific protein adapters, EMBO Rep. 1 (2000) 399–403. [21] A. Suzuki, T. Yamanaka, T. Hirose, N. Manabe, K. Mizuno, M. Shimizu, K. Akimoto, Y. Izumi, T. Ohnishi, S. Ohno, Atypical protein kinase C is involved in the evolutionarily conserved par protein complex and plays a critical role in establishing epithelia-specific junctional structures, J. Cell Biol. 152 (2001) 1183–1196. [22] A. Suzuki, C. Ishiyama, K. Hashiba, M. Shimizu, K. Ebnet, S. Ohno, aPKC kinase activity is required for the asymmetric differentiation

EX PE R IM E NTAL CE LL RE S E ARCH 314 ( 2 0 0 8 ) 332 6 –333 9

[23]

[24]

[25]

[26]

[27]

[28]

[29]

[30]

[31]

[32]

[33]

[34]

[35]

[36]

[37]

[38]

of the premature junctional complex during epithelial cell polarization, J. Cell Sci. 115 (2002) 3565–3573. P.J. Plant, J.P. Fawcett, D.C. Lin, A.D. Holdorf, K. Binns, S. Kulkarni, T. Pawson, A polarity complex of mPar-6 and atypical PKC binds, phosphorylates and regulates mammalian Lgl, Nat. Cell Biol. 5 (2003) 301–308. T. Yamanaka, Y. Horikoshi, Y. Sugiyama, C. Ishiyama, A. Suzuki, T. Hirose, A. Iwamatsu, A. Shinohara, S. Ohno, Mammalian Lgl forms a protein complex with PAR-6 and aPKC independently of PAR-3 to regulate epithelial cell polarity, Curr. Biol. 13 (2003) 734–743. A. Suzuki, M. Hirata, K. Kamimura, R. Maniwa, T. Yamanaka, K. Mizuno, M. Kishikawa, H. Hirose, Y. Amano, N. Izumi, Y. Miwa, S. Ohno, aPKC acts upstream of PAR-1b in both the establishment and maintenance of mammalian epithelial polarity, Curr. Biol. 14 (2004) 1425–1435. X. Chen, I.G. Macara, Par-3 controls tight junction assembly through the Rac exchange factor Tiam1, Nat. Cell Biol. 7 (2005) 262–269. T.W. Hurd, L. Gao, M.H. Roh, I.G. Macara, B. Margolis, Direct interaction of two polarity complexes implicated in epithelial tight junction assembly, Nat. Cell Biol. 5 (2003) 137–142. A.E.E. Mertens, T.P. Rygiel, C. Olivo, R.v.d. Kammen, J.G. Collard, The Rac activator Tiam1 controls tight junction biogenesis in keratinocytes through binding to and activation of the Par polarity complex, J. Cell Biol. 170 (2005) 1029–1037. P. Boukamp, R.T. Petrussevska, D. Breitkreutz, J. Hornung, A. Markham, N.E. Fusenig, Normal keratinization in a spontaneously immortalized aneuploid human keratinocyte cell line, J. Cell Biol. 106 (1988) 761–771. I. Helfrich, A. Schmitz, P. Zigrino, C. Michels, I. Haase, A.l. Bivic, M. Leitges, C.M. Niessen, Role of aPKC isoforms and their binding partners par3 and par6 in epidermal barrier formation, J. Invest. Dermat. 127 (2007) 782–791. M.S. Balda, J.A. Whitney, C. Flores, S. Gonzalez, M. Cereijido, K. Matter, Functional dissociation of paracellular permeability and transepithelial electrical resistance and disruption of the apical–basolateral intramembrane diffusion barrier by expression of a mutant tight junction membrane protein, J. Cell Biol. 134 (1996) 1031–1049. H.J. Stark, A. Szabowski, N.E. Fusenig, N. Maas-Szabowski, Organotypic cocultures as skin equivalents: a complex and sophisticated in vitro system, Biol. Proced. 6 (2004) 55–60. U. Ohnemus, K. Kohrmeyer, P. Houdek, H. Rohde, E. Wladykowski, S. Vidal, M.A. Horstkotte, M. Aepfelbacher, N. Kirschner, M.J. Behne, I. Moll, J.M. Brandner, Regulation of epidermal tightjunctions (TJ) during infection with exfoliative toxin-negative Staphylococcus strains, J. Invest. Dermat. 128 (2008) 906–916. S. Yonemura, M. Itoh, A. Nagafuchi, S. Tsukita, Cell-to-cell adherens junction formation and actin filament organization: similarities and differences between non-polarized fibroblasts and polarized epithelial cells, J. Cell. Sci. 108 (1995) 127–142. V. Vasioukhin, C. Bauer, M. Yin, E. Fuchs, Directed actin polymerization is the driving force for epithelial cell–cell adhesion, Cell 100 (2000) 209–219. A. Vaezi, C. Bauer, V. Vasioukhin, E. Fuchs, Actin cable dynamics and Rho/Rock orchestrate a polarized cytoskeletal architecture in the early steps of assembling a stratified epithelium, Dev. Cell. 3 (2002) 367–381. C.R. Weston, A. Wong, J.P. Hall, M.E.P. Goad, R.A. Flavell, R.J. Davis, The c-Jun NH2-terminal kinase is essential for epidermal growth factor expression during epidermal morphogenesis, Proc. Natl. Acad. Sci. 101 (2004) 14114–14119. B. Tebbe, J. Mankertz, C. Schwarz, S. Amasheh, M. Fromm, C. Assaf, U. Schults-Ehrenburg, H. Sanchez-Ruderish, J.D. Schulzke, C.E.

[39] [40]

[41]

[42]

[43]

[44]

[45]

[46]

[47]

[48] [49]

[50]

[51]

[52]

[53]

[54]

3339

Orfanos, Tight junction proteins: a novel class of integral membrane proteins. Expression in human epidermis and in HaCaT keratinocytes, Arch. Dermatol. Res. 294 (2002) 14–18. Y. Hao, L. Boyd, G. Seydoux, Stabilization of cell polarity by the C. elegans RING protein PAR-2, Dev. Cell. 10 (2006) 199–208. V. Nunbhakdi-Craig, T. Machleidt, E. Ogris, D. Bellotto, C.L. White III, E. Sontag, Protein phosphatase 2A associates with and regulates atypical PKC and the epithelial tight junction complex, J. Cell. Biol. 158 (2002) 967–978. P.J. Morin, Claudin proteins in human cancer: promising new target for diagnosis and therapy, Cancer Res. 65 (2005) 9603–9606. A. Banan, L.J. Zhang, M. Shaikh, J.Z. Fields, S. Choudhary, C.B. Forsyth, A. Farhadi, A. Keshavarzian, Theta-isoform of protein kinase C alters barrier function in intestinal epithelium through modulation of distinct claudin isotypes: a novel mechanism for regulation of permeability, J. Pharmacol. Exp. Ther. 313 (2005) 962–982. T. D'Souza, R. Agarwal, P.J. Morin, Phosphorylation of claudin-3 at Threonine 192 by cAMP-dependent protein kinase regulates tight junction barrier function in ovarian cancer cells, J. Biol. Chem. 280 (2005) 26233–26240. M. Tanaka, R. Kamata, R. Sakai, EphA2 phosphorylates the cytoplasmic tail of claudin-4 and mediates paracellular permeability, J. Biol. Chem. 280 (2005) 42375–42382. A. Ikari, S. Matsumoto, H. Harada, K. Takagi, H. Hayashi, Y. Suzuki, M. Degawa, M. Miwa, Phosphorylation of paracellin-1 at Ser217 by protein kinase A is essential for localization in tight junctions, J. Cell Sci. 119 (2006) 1781–1789. K. Yamauchi, T. Rai, K. Kobayashi, E. Sohara, T. Suzuki, T. Itoh, S. Suda, A. Hayama, S. Sasaki, S. Uchida, Disease-causing mutant WNK4 increases paracellular chloride permeability and phosphorylates claudins, Proc. Natl. Acad. Sci. 101 (2004) 4690–4694. C. Le Moellic, S. Boulkroun, D. Gonzalez-Nunez, I. Dublineau, F. Cluzeaud, M. Fay, M. Blot-Chabaud, N. Farman, Aldosterone and tight junctions: modulation of claudin-4 phosphorylation in renal collecting duct cells, Am. J. Physiol. Cell Physiol. 289 (2005) C1513–C1521. R.O. Stuart, S.K. Nigam, Regulated assembly of tight junctions by protein kinase C, Proc. Natl. Acad. Sci. 92 (1995) 6072–6076. A.Y. Andreeva, E. Krause, E.C. Muller, I.E. Blasig, D.I. Utepbergenov, Protein kinase C regulates the phosphorylation and cellular localization of occludin, J. Biol. Chem. 276 (2001) 38480–38486. T. D'Souza, F.E. Indig, P.J. Morin, Phosphorylation of claudin-4 by PKCɛ regulates tight junction barrier function in ovarian cancer cells, Exp. Cell Res. 313 (2007) 3364–3375. A. Seth, P. Sheth, B.C. Elias, B.R. Rao, Protein phosphatase 2A and 1 interact with occludin and negatively regulate the assembly of tight junction in the Caco-2 cell monolayer, J. Biol. Chem. 282 (2007) 11487–11498. T. Yuki, A. Haratake, H. Koishikawa, K. Morita, Y. Miyachi, S. Inoue, Tight junction proteins in keratinocytes: localization and contribution to barrier function, Exp. Dermatol. 16 (2007) 324–330. E.Y. Seo, Y.J. Piao, J.S. Kim, K.B. Suhr, J.K. Park, J.H. Lee, Identification of calcium-induced genes in HaCaT keratinocytes by polymerase chain reaction-based subtractive hybridization, Arch. Dermatol. Res. 294 (2002) 411–418. B.L. Bennett, D.T. Sasaki, B.W. Murray, E.C. O'Leary, S.T. Sakata, W. Xu, J.C. Leisten, A. Motiwala, S. Pierce, Y. Satoh, S.S. Bhagwat, A.M. Manning, D.W. Anderson, SP600125, an anthrapyrazolone inhibitor of Jun N-terminal kinase, Proc. Natl. Acad. Sci. 98 (2001) 13681–13686.