Phosphorylation of Srp1p, the yeast nuclear localization signal receptor, in vitro and in vivo

Biochimie (1997) 79, 247-259 © Soci6t6 franqaise de biochhnie e! bkflogie mol6culaire / Elsevier, Paris

Phosphorylafion of Srplp, the yeast nuclear localization signal receptor, vitro and in vivo Y Azuma"', K Takio b, MM Tabb", L Vu ~, M Nomura ~* aDepartments of Biologi.cai Chemistry amt Microbiology and Molecular Genetics, University of California, h'vine, CA 92697-1700. USA: The instttut~ o,] Physwai and Chemical Research (RIKEN), Wako. Sattama 351-01, Japan •

t

[)

,

f

,

.

~

.

.

. . ,

.

(Received 31 March 1997: accepted 16 April 1997) Summary ~ Srplp, the protein encoded by SRPI of the yeast Saccharomyces cerevisiae, is a yeast nuclear localization signal (NLS) receptor

protein, We have previously reported isolation of a protein kinase from yeast extracts that phosphorylates Srplp complexed with NLS peptides/proteins. From partial amino acid sequences of the four subunits of the purified kinase, we have now identified this protein kinase to be identical to yeast casein kinase II (CKII). It was previously thought that autophosphorylation of the 36 kDa subunit of the yeast enzyme was stimulated by the substrate, GST-Srp I p. ttowever, with the use of a more refined system, no stimulation of autophosphorylation of the 36 kDa subunit of yeast CKll wa:; observed. Biochemical and mutational analyses localized the in vitro phosphorylation site of Srplp by CKll to serine 67. It was shown that, in the absence of NLS peptides/proteins, phosphorylation of the intact Srplp protein is very weak, but deletion of the C-terminal end causes great stimulation of phosphorylation without NLS peptides/proteins. Thus, the CKll phosphorylation site is apparently masked in the intact protein structure by the presence of a C-terminal region, probably between amino acids 403 and 5 i 6. Binding of NLS peptides/proteins most likely causes a ch,'mge in protein conformation, exposing the CKil phosphorylation site. Mutational alterations of serine 67, the CKil phosphorylation site, to valine ($67V) and aspartic acid ($67D) were not found to cause any significant deleterious effects on cell growth. Analysis of in vivo phosphorylation showed that at least 30% of the wild type Srpip molecules a~e phosphorylated in growing cells, and that the phosphorylation is mostly at the serine 67 CKll site. The ability of Srplp purified from E coli and treated with calf intestinal phosphatase to bind a SV40 T-antigen NLS peptide was compared with that of Srp i p which was almost fully phosphorylated by CKll. No significant difference was observed. It appears that NLS binding does not require any phosphorylation of Srp Ip. either by CKll or by some other protein kinase. casein kinase II / NLS receptor / Srplp / hnportin ~ Introduction

Transport of proteins through the nuclear pore complex has been extensively studied (for recent reviews, see [I-51). The first step of nuclear import involves recognition of a nuclear localization signal (NLS) within the proteins by specific 'receptor' proteins (NLS receptors). Clear identification of the NLS receptor proteins was achieved first for metazoans by protein fractionation using an in vitro nuclear protein uptake assay that employed digitonin-permeabilized cells [6l. The gene for the Xenopus NLS receptor, called importin 0t ([7]; also called karyopherin a, [8]), was cloned and sequenced and was found to be homologous to SRPI

*Correspondence and reprints Abbreviations: NLS, nuclear localization signal; CKII, casein kinase I1; PMSE phenylmethylsulfonyl fluoride; SDS-PAGE, SDSpolyacrylamide gel electrophoresis; GSF, glutathione S-transferase; T-NLS, SV40 large-T-antigen NLS.

lTI, which was originally identified as a suppressor of cero lain temperature*sensitive mutations of RNA polymerase 1 ill Sat'chatotnyces cerevisiae 191. Genes tbr ~imilar NLS receptors wcr• also identified for lmman cells (at least t~vo subtypes: one called RCH1 [101 or hSRPla [!ll and the other called NPI. 1 [! 21 or hSRP 1 1131: for mouse (at least two subtypes: one called m*pendulin 114, 151, or m-imporo tin ~ [16] and the other called mSRP! [13, 15]); and for Drosophila (called d-pendulin [17] or Oho*31 [18]). Sequences of all proteins encoded by these genes were found to be similar to yeast Srp ! p with approximately 50% mnino acid identity. Indeed, the NLS receptor function of yeast Srplp has been directly demonstrated (llg, 20], see also [211). Another protein called importin [~ (also called p97. or karyopherin ~ 18, 22-251), which functions in nuclear protein transport in conjunction with the NLS receptor, was subsequently identified. The protein forms a complex with the NLS receptor and stimulates the binding of NLS con* taining proteins to the NLS receptor [26]. Translocation ot" the complex consisting of the NLS receptor, importin ~ and an NLS containing protein through the nuclear pore is complex and involves, in addition to nuclear porin proteins,

248 some 'cytosolic factors.' such as RAN/TC4 127, 281, a RAN-interacting protein called p 10 (also called NTF2 12931]) and H ~ 7 0 I32-M1. How these factors interact with each other and/or nucleoporins and other nuclear or cytotransport systems, which do not involve the "classical' NLS receptor and which may be connected with mRNA export, have recently been discovered [35, 361. We have previously reported the presence of a protein k~ {called Sip l p kinas¢) in yeast extracts that phosphorylates the yeast NLS receptor, Srplp, complexed with NLS ~ d e , q p r o t e i n s I20]. With purified kinase preparations, phosp~rylation of Srpl p was strongly dependent on the presence of NLS peptide~proteins, suggesting a functional significance of this phosphorylation in relation to nuclear protein transport and/or nuclear activities. Since there is s o ~ evidence suggesting modulation of transport activity by phosphorylation of the transport machinery itself 137401, we have studied this phosphorylation further. Here we show that the Sip I p kinase we have purified is identical to yeast casein kinase II (CKII) characterized by Glover and his coworkers [41-451. We have also identified the site.of CKll pb~phorylation of Srpl p in vitro and demonstrated that phosphorylation at this site accounts tbr most of the phosphorylation of Srplp hi vivo. We describe the results of the~ and other experiments designed to study the nature of stimulation of Srp!p phosphorylation by NLS peptide~proIeins and possible s' , igntfieance ' ' of this phospl~oryhttion reaction i~ vivo,

M~iid~ls and methods lti~ist sti~10tsacid plasmids Yeast ~trli~s and plasmids are list~ in table !, Strains NOY766, NOY767 a ~ NOY768 carry the wild type SIP/, 'the CKII site mutant gene (s~l,,~?V)and another CKI! site mutant gene {srpl~TD), res~tively, on a plasmid with the chromosomal SRPI dismpled, The~ t h ~ strains were constructed by transformation of NOY48! with pNOYI62, pNOY362 and pNOY363, res~tively, i b l l o ~ by ~ n t e r - ~ l ~ t i o n of the resident pNOY 138 by growth on g l u ¢ ~ minimal medium containing 5°-fluoroorotic acid' Media Synthetic 81uco~ and galacto~ m~ia were described previously 1471, Th~ low phosphate YEPD medium was prepar~ using a Iweth~gln~il'ied from that described by Warner I481, YEP medium I1% yeast extxact (Dif¢o, ~troit, MI), 2% peptone {Difco)) containiag 10raM MgSOa was mix~ with concentrated NHaOH (Ir~ v/v) and kept for l o b at 4°C, Alter filtration of the mixture through a Oi4,~m Millrace filter, t ~ pH of the filtet~l medium was adjusted to 5:5 wi~ ~.xag'entrated HCI, Aut~laved 4 ( ~ gluco~ solution was then ~ to a final concentration of 2%,

Pi,ri/h'ation of Siplp kimlse f CKH) amt protein seqm,m'e determinathm Frozen cells from strain NOY388 (400 g wet weightl, cultured by Grain Processors of Iowa (Muscatine, lowa), were disrupted with glass beads and extracts were prepared in 600 taiL of buffer B 120 mM Het~s. pH 7.4, I mM EDTA, ! mM DTT, 5% glycerol, ! mM phenyimethylsulfonyl fluoride (PMSF)) containing a O.i % volume of a protease inhibitor mixture (chymostatin (100 pg/mLk aprotinin ( 100 lag/mL), pepstatin ( 100 ~tg/mL), leupeptin ( 100 Ilg/mL), antipain (100 pg/mL), bepstatin (20 IlglmL), aminobenzamidine (2 mgtmL)). The kinase (lbrm li) was then purified essentially as described previously 1201including Q-Sepharose, Mono-Q, SP-Sepharose and HiLoad 16/60 column chromatographic steps. Approximately 12 lag purified enzyme preparation was obtained. For protein sequence determination, approximately I0 ~tg of Srplp kinase II (form 11, see 1201}were subjecled to SDS~polyacrylamide gel electrophoresis (SDS-PAGE~ to separate four snbuniis, and electmblotted onto a PVDF membrane 1491. The p38 and p32.5 subunits were sequenced directly from N-terminal anaino acids by Edman degradation using a protein sequencer {model 477A, Perkin Elmer, Foster City, CA). The p36 and p31 subunits were digested with Achtomobacter protcase I !a lysine specific protease, a girl from Dr T Masaki, lbaraki University, Japan; 1501t/n situ at 37°C for 15 h. Peptide fragments were then separated by reverse phase HPLC on a column of Aquapore RP-300 (Perkin Ehner} at a flow rate of 0.2 mL/min with a linear gradient of acetonitrile (0 to 60% in 40 rain) in O.I% trifluoroacetic acid. N-terminal amino acid sequences of purified peptides were deterlnined as described above. Ptt7!aralion of ghitathione S.trau.~'f,,rase ( GSTF SqJ l p and it.i it!titatll det'ii,alJi,es

GST-Srp I p and other mutant proteins were expressed in E colt from plasmids carrying ~rtinent fusion genes (listed in table !) as de~ ,~¢ribed previously 1201. Purification of the proteins was done using glulathioiieoagarosc'~ aMnily purific:~lion fiilh;wcd by QoSepharose ¢ltliitiili dironlalOgrliphy 120! e~cepi Ihiil the Q-St~pliarose step was oniilled tor lilt: pi"f.'l~tiil'alioia!if the Iblhi~.ving iiitillilll proteins: GSTSrplp M 151:117), fiS1;Srplp M (51-72) il!lil GST-Srplp M (151). It should ~ noted tha_tsome of the deletion nluiant proi¢ii~s carry extra alnhlo acids at their C-lenllinal ends which are not present in the native Srpl p protehl, but were created by fusion of respective SIP/c(gling regions to some downstreanl DNA. Thus. GST-Srplp M ( I-516) encoded by pNOY3207 consists of the GST ~gment t'o!lowed by the Srplp segment from amino acids ! to 516 and additional amino acids ATCRHASLA. The presence of such e×tra amino acids in mutant fusion proteins is indicated in lhe description of pertinent plasmids listed in table I. Recombimint GST-free Srplp was prepared h'om purified GSTSrplp, One mL of GS1:Srplp solution (0.4 nlghnL) was first dialyzed against column buffer (50 mM Tris-HCl, pH 8.0, ! m M dithiothreitol, I mM EDTA, 5% (vol/vol) glycerol, 50 mM {NH4hSO~) containing 50 mM ammonium sulfate and no protease inhibiiors for I h at 4°C. Two mL of the dialyzed GST-SrpI p solution was treated with 12 NIH units of thrombin (Sigma, St Louis, MO)at 30°C for 30 rain to cleave off GST. Glutathione agarose beads (0.2 mL) and 20 IlL of 100 mM PMSF were then added, and the suspension was rotated lbr I h at 4°C. The beads that bound GST were removed by filtration using a 0.2 Ilm centrifuge filter (Costar. Cmnbridge, MAt. The Srplp was purified by MonoQ HR515 (Pharmatin) column chromatography using a linear gradient of 50 to 400

24t~ Tab|e 1. Yeast strains a~d pl~sRmds used. Strah~s amt phasmMx Strain,~ NOY388 NOY481 NOY766 NOY767 NOY768 Piasmids pNOY 138 pRS314 pNOY ! 62 pNOY362

pNOY363 pNOY3198 pNOY3199 pNOY3204 pNOY3207 pNOY3208

pNOY321 I pNOY324t)

pNOY3252 pNOY3253 pNOY3254 pNOY3255 pNOY3257 pNOY3258

pNOY3259

l)es~'ripti~ ms

Mcml ade2-1 Mata ade2-1 Mata ade2-1 Mata ade2- I Mata ade2- I

urud- i ura3-1 re'a3-1 .p'a3- l re'a3- I

his 3-11 . p i - 1 ieu2.3-112 can 1-100 his3-1 i o p l - i ieu2-3,112 canl-lO0 AstpI::LEU2, his3-11 o p l - ! !eu2-3,112 cani-lO0 Asrpl::LEU2. his3- I I t q d i leu2-3,112 cai~1-100 Aslpl ::LEU2, his3- l i opl- ! leu2-3.112 can 1-100 AsrpI::LEU2,

pNOY ! 38 pNOY162 pNOY362 pNOY 363

A derivative of pRS316 carrying SRPI which is under GAL7 promoter control 1471. A yeast E coil shuttle vector 1461 with TRPI, CEN6, ARS4, amp. A derivative of pRS314 carrying the SRPI gene on a 2.4 kb fi'agment inserted between Kpnl and Sail sites 1471. A derivative of pNOY 162 carrying the sspI.S67V mutation; the 1).3 kb Pstl-Xbal fragment (in SRPI~ of pNOY 162 was replaced with the corresponding 0.3 kb PstI-Xbai fragment of pNOY3257. A derivative of pNOY 162 carrying the sq~l-S67D mutation: the I).3 kb Psd-Xbal fiagment of pNOY 162 was replaced with the corresponding 0.3 kb PstI-Xbal fragment of pNOY3258. A derivative of pGEX-2T (Pharmacia) carrying a GST-SRPI fusion gene 1201. A derivative of pNOY3198 carrying GST-sq~! (218-542): the 6.3 kb Ncol fragment of pNOY3198 was isolated and self-ligated 1201. A derivative of pNOY3198 carrying GST-srpl t 1-375, 463-542); the region of SRPI encoding the 7th and 8th repeats of Srp I p (amino acids 376 to 462: [471) were deleted by oligonucleotide mutagenesis. A derivative of pNOY3198 carrying GST-sq~I (1-516); a 0.4 kb of Accl fragment was removed from the pNOY3198, blunt ended by Klenow fragment and seifoliga|ed. The encoded tusmn protein (GST-Srplp M(1-516)) has ATCRHASLA following the amino acid 516 of Srplp. A derivative of pNOY3198 carryit,g GST-srpl (i-403); after digestion of pNOY3198 with Hindlll, which produces three fiagments, the 5. ! kb and i. 1 kb fragments were isolated and ligated together in a correct orientation, leading to the lormation of GST-Srplp (I-403) mutant gene. The encoded fusion protein (GST-Srplp M( 1-403)~ has extra C-terminal amino acids, WRNHGHSCFGNSS. A derivative of pNOY3198 carrying GST-srpl (1-299); a !. ! kb EcoR! fi'agment was removed from the pNOY3198 and self-ligated. The encoded fusion protein (GST-Srplp M(1-299)) has extra C-terminal amino acids, HRD. A derivative of pNOY3198 carrying an amp gene without a Pstl site; the !.4 kb AatlI-AIwNl fragment of pNOY3198 containing amp r with a Pstl site was replaced with the corresponding !.4 kb Astll-AIwNI fragment from ptlC I 9 plasmid. A derivative of pNOY3198 carrying GST-sq~I t51~299); after digestion of pNOY321 I with BamHI and Hmdlll. both ends of the 5.7 kb fragment were filled in, lollowed by isolation and selfdigation of the fl'a~QIle111, The encoded fiosion protein (GST-Srpl p M(51-2q9))has extra Cqerminal amino acids. IIRI). A derivative of pNOY3198 carrying GSl'o,~rpl t51 117); after digestion of pNOY3252 with l:'~.oRI and Xh, l, both ends of the 5.2 kb fi'agment wel~ filled in, lbllowed by isolation and selfoligation of the fragment, The encoded fllsion prolein (GST-Srpl p M(5 I=117)) has extra C-terminal antino acids, IHDR, A derivative of pNOY3 I,)8 carrying GST.stpl (51=72); after digestion of pNOY3252 with EcoRl and Sad, both ends of the 5.0 kb fi'agment were filled in, Ibilowed by isolation and self-ligation of the fragment, The encoded l'usion protein (GST-Srplp M(51-72)) has extra C-terminal amino acids, HRD, A derivative of pNOY3198 carrying GSTsrpl (1-51); after digestion of pNOY3198 with Hindill, the 5. i kb fragment was isnlated and self-ligated. The encoded fusion protein (GST-Srpip M(l-51)) has extra Cqerminal amino acid~, WRNHGHSCFGNSS. A derivative of pNOY3198 carrying GST-srpi-S67V; site-direct mutagenesis of SRPI was carried out to change serine 67 to valine using an oligonucleotide, 5'CCAACTGATGGCGCTGATGTCGACGAAGAAGATGAGAGCTCCGTrY, A derivative of pNOY3249 carrying GST.sq~l-S67D; PCR reaction was carried out to change serine 67 to aspartic acid; two primers, 5'GTCCGCAGAAACGAAGCTCTCATCTTCTTCATCATCA TCAGCGCCATCAGTI~GGy and 5'TrGGATCCATGGATAATGGTACAY, were used and the {}.I kb PstioSacl fi'agment obtained from the PCR product was cloned into the same sites of pNOY3249. A derivative of pGEX-3T (Pharmacia) carrying the yeast CKA2 as a GST.CKA2 fusion gene; the yeast CKli catalytic subunit gene, CKA2, was isolated fronl NOY388 genomic DNA by PCR using two primers. 5'TTTGGATTCCATATGCCATTACCTCCGTCAACY and 5'TTTGAATTCTTATTCAAACTTCGTTI'TGA3'. and a 1.0 kb fragment obtained after digestion of the PCR product with EcoR! was cloned between Sinai and EcoRI sites of pGEX-3T.

2~

¸

mM ammomunt"s.ulfat¢" .... in column buffer. Srp i p was eluted at alxmt 1 ~ mM amen(urn sulfate.

Phosphor3,1aiion ¢~"Srl, l p lation ofSrp ip. GST-Srp ! p and other mutant derivatives was carried out using [~3~PiATP (DuPont NEN. Boston. MA) es~ i a l l y as described previously [20f Briefly. GST-Srp lp (or other mulam protein) was incubated with [¥--~-'PIATPand a kinase with tw without an NLS peptide in a 40 ~tL reaction mixture at room terapemmr¢ for ~ rain. The reaction mixtures were analyzed by SD$~.PAGE followed by autoradiography as also described previously 1201. Specific conditions, such as substrate concentrations which were different from the standard conditions, are described in the legends to figures. A SV40 large T-antigen NLS ('T-NLS') peptide and a control peptide with a reverse sequence were the same as those used previously 1201; they were: GYGP.KK:KRK_yED and GYGDEVKRKKK_K~(reversed sequences underlined),

0.2 mL of SDS sample buffer (50 mM Tris-HCi, pH 6.8. 100 mM dithiothreitol, 2% SDS, 0.1% bromophenol blue and 10% glycerol). Aliquots (70 t.tL) fi'om each sample were subjected to SDSPAGE followed by Western immunoblot analysis and autoradiography.

Other materials Human casein kinase I[ (human CKII). which is an ot~.13.,tetramer, was obtained from New England BioLabs (Beverly, MA). It was isolated from a strain of E col( expressing both human ~t and 13 CKII subunits. Calf intestinal phosphatase was also obtained from New England BioLabs (Beverly. MAL Endoproteinase Giu-C (Staphylococcus aureus V8 protease) and trypsin were obtained ITem Sigma (St Louis, MO).

Results

NL~ peptide binding assay

Amino acid sequence analysis of Srplp kinase subunits

A~mys for the e x ~ r i ~ n t s shown in figure 2 were carried out as described previously 120. 51 l. Briefly. GST-Srp I p was incubated with t:qdaMled T-NLS peptide at room temperature tbr 20 rain followed by chemical cross-linking with disuccinimidyl suberate (Pierce, Rockford, ILL The t:q-labeled peptide cross-linked to GST-S~Ip or its mutant derivatives was analyzed by SDS-PAGE followed by autoradiography. In the experiments shown in figure 6, ~:P-labeled 'T-NLS kemptide' (GYGPKKKRKVEDL_RRASbG; the kempti~ portion underlined; obtained from Bio-synthesis, Lewisville. TX) instead of the !~lolabeled T-NLS peptide was used. The NLS kemptide was phosphorylated at the mr(he in the kemptide portion by cAMPodependcnt protein kinase (Sigma, St Louis, MO) and ty~:~:PIATP,The phospho~l~tion was terminated by healing at 8(I~C for 10 rain.

The previous study showed that purified Srp I p kinase (form II) contained four protein components with approximate molecular masses of 38, 36, 32.5 and 31 kDa [20]. These protein components were separated by SDS polyacrylamide gel electrophoresis and analyzed for amino acid sequences of their N-termini. The N-termini of the 36 kDa and 31 kDa subunits were blocked and two internal peptides from each were analyzed, As shown in table !1, the amino acid sequences of the four components corresponded to the sequences of the four subunits of S cemvisiae casein kinase I1 (called 'yeast CK!I' in this paper), Ix 1421, I~ 1451. Ix' 1431 and [V 1441, respectively. Thus, although the apparent mo!eca!ar masses of the four subunits of yeast CK!I reported previously (42, 38, 35 and 32 kDa; !521) are somewhat larger than the values for the four suhunits (38.36. 32.5 and 3! kDa; 12011 estimated by us (see table IlL we conclude that the Srplp kinase complex (form 11) we purified previously is identical to yeast CKII. It should ~ noted that the ~x and 0f subunits represent two re!ated catalytic subunits, and the 1~ and ~' subunits represent regulatory subunits of yeast CKII [521. Although we have not analyzed Srplp kinase form I, which is missing the 32.5 kDa subunit 1201, this enzyme complex must be another form of yeast CKII that is missing the Ix' subunit. This conclusion is consistent with the previous observations that deletion of the Ix subunit gene (CKAI) alone or the ~x' subunit gene (CKA2) alone does not give any phenotype, but deletion of both genes is lethal 142, 431. The significance of the presence of two forms of CKll in S cet~,visiae is not known.

h, vi~,o ~--'Pohtbelit,g¢~fSffdp Y¢itst cells (NAY766, NAY767 and NOY768) we~ grown in 4 mL of t ~ low phosphate YEPD n ~ i u m at 30~C to an absor~nce at 600 am of app~simately 0,5, Cells we~ centrifuged and resusaded in I.~ mLof the low ~osphate YEPD ng~lium and carrier [ ~ P l o n h ~ s ~ a t e was added (I,2 MBqlmL: DuPont NEN, Boston. MA), After further incubation at 30°C for 2.5 h, the cells were Mrvested and ~sus~nded in 0,4 mL of disruption buffer (20 mM Tris.HCI, pH 7.6, 1 ram EDTA, I mM DTT, 2 mM MgCI~, 1% ~ t o n X~,I00, 0,!% SDS, 50 mM ammonium sulfate, I mM PMSE 0,5 mg/mL BSA) containing 0, I% volume of pretense inhibitor mixtu~ d e ~ r i ~ above and i% volume of phosphata~/kina~ inhibitor mixture (100 mM NaF. I(X) mM NAN,. 40 mM orthovanadat¢, 100 mM phosphate, 100 mM Na~HPO~). The cells we~ disnapted by ~aking with 0.2 mL of glass ~ads tbr 10 rain at 4°C using a vortex mixer. Cell extracts were obtained after centrifus~!ion at 15 000 g for 10 rain at 4°C, The extracts were first ~incubated with ,SOI~Lof protein A Sepharose ~ads for 30 rain at 4~'Cwi~rotation After centrifugation, sul~matants were mixed with 2 pL of rabbit anti,Srplp antibody 191 and incubated for 30 mitt m 4~'C, Protein A Sephamse beads (20 IIL) were then added ~incubation was continued for an additional 30 rain at 4°C with rtgatkm, ~ beads were recove~ and washed five times with disru~ion bu0~r, Proteins h-~undto the beads were then eluted with

Ph~ sphor)latton of Stplp by luunan CKil and a recombinant Ix" catalytic subunit of yeast CKll in order to confirm the identification of Srp I p kinase as the yeast CKli, phosphorylation reactions were carried out using a commercially available reconstituted human CKII,

25I Table I1, Amino acid sequence analysis of Srpl p kinase subunits, Srplp kinase subunils a

P~7~lides amdyzed b

Seqtwm'es ,t'~m~d

Corresptmding ,~eqt~em'e ,ftmnd in CEll stdnmit~

CEll stchtmit.~ lapp(trent m,d,,'~'tchtr ma.~,~f!

38 kDa

N-terminal

MKXRVWSEARVYTNINKQ

a (1-18): X = C

ct (42 kDa)

36 kDa

Internal a Internal b

VFGFRINDEAVSXPYrMK wI,XOYPSTEEDX 'EEFAK

[3 (237-253); X = G [3 (254-270); X = X: = w

~3(38 kDa)

32.5 kDa

N-terminal

PLPPStLNQKsNRVYsVar e

ct' (1-19)

of (35 kDal

31 kDa

Internal a Internal b

IFGFELHK GHEYFXDVDPEYItDX 'FNLMNLQK

13' (217-224) 13' (47-70); X = C, X' = R

13' (32 kDa)

a Subunits described in our previous paper 1201. b Internal peptides were obtained after digestion with Achromobacter pro(ease I follow'ed by ~urification using reverse phase HPLC. c Single letter-code was used. X, X'; unidentified. Lower case letters: identified with some uncertainity, d Apparent molecular masses of S cerevisiae CKI! subunits are from 152]. Molecular masses calculated from cloned genes are: 0t, 44 673 1421; [3, 32 475 1451; tz', 34 408 1431; [~', 29 990 1441. e This sequence was obtained as a mixture with another sequence which corresponded to the N-terminal sequence of the ~-subunit of pyruvate dehydrogenase EI complex. Evidently the latter was present a~ ~ contaminant in this preparation of Srplp kinase.

A

B yeast CKII

NLS

+

-

+

h u m a n CKII -

+

-

+

GST-Cka2p -

NLS

RV

t

GST.SrplpSrplp-

Srplp-

• Ct

C

m

1

2

3

4

5

6

7

8

1

2

Fig 1. Phosphorylation of Srplp by yeast and human CKII. A. GST-,~rplp (0.08 gM; lanes i. 2, 5 and 6) or Srplp (0.08 l,tM; lanes 3.4. 7 and 8) was incubated with 4 laL of yeast CEll purified as the Srplp kmase I! ([201; lanes I to 4) or human CKIi (0.25 unit/~tL: lane~ 5 to 8) in the presence or absence of the T-NLS peptide (40 ~M) as indicated, and in the presence of Iy-32PIATP (8 nM; !.9 MBq/mL). B. Srpip (0.04 laM) was incubated with a GST fusion of the yeast CKII catalytic subunit cx' (GST-Cka2p) (2.5 nM) in the presence of 25 laM of the T-NLS peptide ('NLS'; lane 1~or the control peptide with the reverse sequence ('RV'; lane 2). Reaction products were analyzed by SDS,PAGE followed by autoradiography. Autoradiograms are shown. Locations of GST-Srplp and Srplp are shown. C is the 36 kDa protein contami° nating the GST-Srplp preparation (see text).

25~ a ~ comparem with them using the yeast CKil purified as Srplp kinase. Phosphorylation reactions were carried out using GST-Srp!p substrate as was done in the previous work 1201 tfig I A. lanes i, 2, 5 and 6) and using Srplp, which was prepared from GST-Srpl p by thrombin cleavage by a chromatographic purification as described in ~wrials ~ m e t t u M s (fig IA, lanes 3, 4, 7 and 8). Effects of N ~ were also examined by carrying out the reactions in ~ n c e of an SV40 T-antigen NLS peptide ('T-NLS ~ i d e Inn I. 3. 5 and 7) and in its absence (lanes 9 4, 6 and 8). When GST-Srplp was used as substrate we observed ~ p h o q t l a t i o n of GSToSrpi p, which migrated on an SDSgel as a 90 kD a protein, with both yeast CKII and human ' CKII. Stimulation of phosphorylation by the T-NLS peptide was also obmrved using both yeast and human CKII (lanes I~ 2, 5 and 6). in addition, another radioactive protein band (band C in fig I) was observed at the position corresponding to the 36 kDa 13 subunit of yeast CKII. in previous work 1201. we thought that this protein represented the 36 kDa subuait of the enzyme and concluded that GST-Srplp, the substeate, stimulated autophosphorylation of this regulatory subunit of the enzyme. (it was previously reported that during autophosphorylation of yeast CKII, the 13 subunit is phosphorylated strongly and the lY subunit is phosphory. luted weakly 1521 and this is consistent with our previous ob~rvatian of autophosphorylation of the 36 kDa subunit of the Srplp kina~ (ie yeast CKII) 1201.) However, s~uchphosphorylation was not observed when Srpip, rather than the GST-Srplp fusion protein, was used as substrate (lanes 3, 4, 7 and 8), It wa~ Grand that the phosphorylated 36 kDa protein was not the 36 kDa (I]) subunit of the kinase, and was a &agment of GST--Srplp present in it small amount in the GST~S~I p preparations, By ana!y~ing large amounts of GSToSrplp preparations by SDS gel electrophoresis fi~lo lowed by staining with Ctmmassi¢ blue, the contaminant

~ r , the phosphorylation site of GST-S~Ip is masked in t:~ intact GST~S~/p (or Srplp) and deletion of the C-terminus unmasks the phosphorylation site. The contaminating ~ t e i n a p ~ to be a derivative of GST-Srplp that c~purifi~ with the intact GST-Srplp, containing a small N~terminal region of S ~ I p fund to GST, prtxluc~ in E ¢oli either by p~mature termination of translation of the GS~SRPI fusion gene or proteolytic degradation of GSTS~lp, ~ i s Nqe~inal region apparently canies the phosphorylation site for C KII, which is well exposed in this fragment (see below). This would explain why a small a ~ n t of the- contaminating 36 kDa protein was phosphorylat~ strongly relative to the intact GST..Srplp and inde~ n ~ n t l y of the p ~ n c e of NLS peptide.',¢proteins. Stimulation of phosphorylation of Srplp (and GSTS~Ip) by T~NLS ~ptid¢ is apparently not related to the ~~x of the regulatory subunits (the 15and I]' subunits) of CKIi, The Ix" catalytic subunit, which was expressed in

E coti as the GST-tx' (GST-Cka2p) fusion, was used instead of the CKII holoenzyme. It was found that the catalytic subunit alone phosphorylates Srplp weakly, and its phosphorylation is greatly stimulated by the T-NLS peptide, but not by a control peptide with the reverse amino acid sequence (fig 1B, and other experiments not shown). Maskbzg of the phospho~'lation sitets) of Srp ip requires an intact inotein stnwture In the course of analysis of various derivatives of GSTSrplp for their ability to serve as substrates for CKI! (and for their ability to serve as receptors of the T-NLS peptide), we found that deletions from the C-terminal end of the fusion protein caused an increase in the degree of phosphorylation by CKll in the absence of NLS peptides (and decrease in the ability to bind the T-NLS peptide). The results of such an experiment are shown in figure 2. For example, the GSTSrplp derivative constructed fi'om the fusion gene with the deletion up to the C-terminus Hindlll site (M( 1--403): lane 3 in A and B, and lanes 5 and 6 in C) or up to the EcoRl site (M(I-299); lane 4 in A and B, and lanes 7 and 8 in C) showed very weak or almost no binding of the T-NLS peptide. in agreement with this result, no or only a weak stimulation of CKll phosphorylation by this NLS peptide was observed With these mutant proteins. However, the degree of phosphorylation in the absence of NLS was significantly greater in these cases than the intact GST-Srp I p (lanes 6 and 8 compared with lane 2 in fig 2C). Another construct with an internal deletion, M(1~375,463-542), retained an ability to bind the T-NLS peptide weakly (fig 2B), but the phosphorylation in the absence of NLS was also significantly greater than the intact GST-Srp!p (lane l0 compared with lane 2 in fig 2CL From the resnlts obtained l'or the various derivatives (shown ill fig 2),-ne can conchide that the presence of a C-terminal region, perhaps between amino acids 403 and 516, is responsible, at least in pan, for inhibition of the phosphorylmion in the absence of the 'lZNLS. We have also observed tllat prior heating of GST-Srplp at 42"C for 30 rain causes a significant stimulation of CKI! phosphory!ation with or without the T-NLS peptide (data not shown). Thus, we conclude that the phosphorylation site(s) is masked in the intact Srplp protein structure, and that binding of NLS l~ptides/proteins causes a change in protein conformation and exposes the phosphorylation site(sL Similarly, truncation of the C-terminal region or heat-denaturation of the protein also exposes the CKII phosphorylation site(s).

Identification of the CKIi phosphoo, httion site The minimum consensus sequence for CKii is S/TXXE/D, where E/D is an acidic residue, E, D or phosphoserine, and X is any amino acid [53]. Srplp contains six sequences that agree with this consensus sequence; 28 SADE, 67 SDEE, 273 TLVD, 328 TGND, 352 SPKE and 399 TKKE. in order

253 to determine the CKIi phosphory~ation site(s~ of Srplp. we constructed various deletion derivatives of a plasmid encoding the GST-Srplp fusion protein, expressed in E coti. purified the encoded fusion proteins and tested them for their ability to be phosphorylated by the kinase in the presence of a T-NLS peptide. The results are summarized in figure 3A. Since both the M(51-117) and M(51-72)derivatives were efficiently phosphorylated and the M ( l - 5 1 ) and M(217-542) derivatives were not pbosphorylated, at least one phosphorylation site must exist between amino acids 51 and 72, and possibly another might be between 72 and 217.

A ga r~

N

U

A

F L J

r~

GST GST-Srpl M(1.299) M(51.299) M(51.117) M(51-72) M(I-51) M(217-542)

B 1

2

3

4

Srpl 2

4"

K////////~~

+

~ s l ~ n 7

++

~sl~z

++

V_/_//////_~Jsl 21"11

1542

-

5 CKII

B GST-Srplp

C NLS

+ - + - - + - ÷ . - ÷ -

NLS

4"

m

4"

m

W

i

.......O ¸ ~ ~ ~ O ~

~ 1

Fig 2, Effects o1' C-terminal deletions (A) on 'BNLS peptide binding (B) and on l~hosphorylation by CKII in the presence and absence of the T-NLS peptide (C). A. Structures of the mutant derivatives. From the left, the wild type (WT) and four deletion mutants. Amino acid residues of Srp I p retained in the mutant constructs are indicated. In addition, M(1-516), M(!--403) and M(!299) have a few extra amino acids at the C-terminus, which are absent: in the wild type Srpl p but were created during construction of the mutants (see Materials and methods and table I). The region corresponding to GST is hatched and eight armadillo repeats (defined according to 19, 47 I) are shown as stippled boxes. B. GSTSrplp or each of the mutant derivatives (0.1 I.tM) wa:; incubated with a 1251-1abeled T-NLS peptide (20 laM) followed by chemical cross-linking and SDS-PAGE. An autoradiogram of the gel is shown. C, GST-Srplp or each of the mutant derivatives (0. ! taM) was incubated with yeast CKll and IT-32PIATP (8 nM: 1.9 MBq/mL) in the presence or absence of the T-Ni_,S peptide (40 laM) as indicated and phosphorylated proteins were analyzed by SDSPAGE. An autoradiogram of the gel is shown.

2

3

4

Fig 3. ldentil'ication of the site o1" phosphorylation of Srplp by CKI! in vim~. A. Summary o1' phosphorylation of various mutant constructs as analyzed using yeast CKI! in the presence of the T-NLS peptide. The degree of phosphorylation was compalvd by visual inspection of atttoradiograms, phosphorylation of M(51~ 117) and M (5 i-72) was qualitatively much stronger than that of the wild type, and hence, is indicated as ++. The segment of fusion proteins corresponding to GST is shown us a 4latched box. The segments corresponding to Srpl p are shown as either filled boxes. when phosphorylation was observed, or open boxes, when phosphorylation was not observed. Amino acid residues of Srplp re° tained in x,arious constructs are indicated. Several mutant cunstrucls have extra anlino acid residues, which are not present in the wild type Srplp but were created during construction of mutants (see Materials amt methods). B. GS'l;Srplp t0. I li.M" lanes i and 2) or GST-Srplp $67V tnutanl protein (0. I ~tM; lanes 3 and 4) was incubated with IT-3:'PIATP(0.02 laM: 4.9 MBq/mL) and yeast CKll in the presence or absence of the T-NI, S peptide t50 pM) us indicated. Phosphorylaled proteins were analyzed by SDS-PAGE. An autoradiogram of the gel is shown.

254 However, there is no CKII consensus sequence between 72 and 217, whereas the consensus site serine at 67 (SDEE) may correspond to the site found between 51 and 72. We have a l ~ studied the site(s) of phosphorylation by analyzing the intact GST-Srplp phosphorylated by CKII wad I[~"P] in the p~sence of the T-NLS peptide. Phoslated Srplp was partially digested with proby autotadiography. Both phosphorylated and unphosphoryl d e s tlmt , were separated from others were isolated ~¢ir amino-terminal sequences were determined. In addition, from the approximate sizes of these peptides as well as the specificity of the V8 pretense (cleavage adjacent to Glu) or trypsin (cleavage adjacent to Lys or Arg), the C-termini of the~ peptides were inferred (data not shown). The results of these analyses showed that the site(s) of phosphorylation is between amino acids 51 and 198. These resuit~ are consistent with the conclusion obtained above, and support serine 67 as the most likely phosphorylation site. We then constructed a mutant of GST-Srplp in which ~rine 67 was altered to valine ($67V), expressed the mutant gene in E colt and the mutant fusion protein was purified+ As shown in figure 313, the mutant protein was not phosphorylated by CKII (lanes 3 and 4). As described below, the mutant ($67V) protein was shown to be fully active in binding the T-NLS peptide, and therefore, appears to be structurally intact. We conclude that serine 67 is the site phosphorylated by CKII ht vitn~.

Srplp ph+t~pho~,latiotl in rive In p~liminary experiments, we labeled yeast cells with +~P and showed that Srplp is phosphory!ated in rive. The p~sence of phosphosorine, but not phosphothreonine or phosphoty~sine, was demonstrated (data not shown). We then examined whether the site of phosphorylation in vivo is identical to the site (serine 67) phosphorylated by CKII invi¢m, and:ifso, whether this phosphorylation is im~Mant for cell growth. We fi~t constructed two plasmids carrying a mutant s ~ i , one s ~ l tS67V) and another srpl tS67D), as derivatives of plasmid (pNOYI38) carrying the wild type SRPI, and examin~ whether these mutant genes complement ~ s ~ l deletion mutation. As shown in figure 4, these two mutants, srpl (S67VJ and srpl ($67D), were both able ' to ~ m p l e ~ n t the srpl deletton. We comp~ed growth of the two mutant strains, carrying the $67V or $67D mutation, with the wild type SRPI strain under a variety of growth conditions, including low and high temperatures. No significant differences were ob~rved between the wild t y ~ and the mutants. We then grew the three strains, the wild type, the $67V mutant ~ t h e $67D mutant, in low phosphate medium in the p r e s e ~ of [3".P]orthophosphat¢ and examined phos~ l a t i o n of S ~ l p after immunop~ipitation of the protein from cell extracts using anti-Srplp antibodies. As shown in figure 5, the precipitated tractions conta;ned ap-

Fig 4, Growth of srpl-S67V and srpl-S67D mutants. Strain NOY481. which carries a chromosomal srpl deletion and pNOY138 with SRP! underthe GAL7promoter control, was grown on galactose, transformed w~,th pNOY162 (carrying SRPI). pNOY362 (carrying srp!-S67VL pNOY363 (carrying srp!-S67D) or pRS314 ('Vector'). Transformants were isolated on a synthetic galactose medium without tryptophan, and then restreaked on a synthetic glucose medium containing 5'-fluoroorotic acid to eliminate the original pNOYI38 plasmid. Incubation was at 25°C for 3 days. Two independent transformants are shown for the srpl+S67V and srp!.S67D mutants.

proximately the same amounts of Srp!p as analyzed by Western immunoblot (lanes I to 3). In contrast, the amounts of ~P in the mutant Srplp proteins were greatly reduced (l~nes 5 and 6) compared with the amount of 32p in the wild type protein (lane 4). Quantification of 32p showed that the residual amounts of 32p in the $67V and $67D mutant proteins were less than !0% of the amount tbund in the wild type protein. We conclude that Srplp in growing yeast cells is phosphorylated, and that more than 90% of phosphory!ation takes place at the serine 67 CKII site. Although it is not proven, the phosphory!ation at this site in rive is most likely by CKIi as was demonstrated in vitro. We have also estimated the degree of phosphorylation of Srplp in the wild type under these conditions assuming a complete equilibration of phosphate in Srpl p with [32p]orthophosphate in the medium at the end of labeling period (2.5 h at 30°C). The calculation showed approximately 0.3 reel of phosphorus per mol of Srplp and this value represents almost certainly a minimum estimate because of the

255

........ ~!~ii!~ ~ ~i!!~iiii,lii!i

Srplp--

123

4

6

Fig 5. Phosphorylation of Srplp at the serine 67 CKII site ?~ vi~,o. Three strains (NOY766, NOY767 and NOY768) catr¢~,in~ SRPI, sqd-S67V and srp !-$67D, respectively, were grown in ~a~t~wphtas. phate YEPD medium, and labeling of cells was done by i~cubati on with 132P]orthophosphate (!.2 MBq/mL) in the same metli um [or 2.5 h at 30°C. Srpi proteins were immunoprecipitat~etlfr-o~-~crt~de cell extracts and immunoprecipitates were subjected ~o SDS-PAGE followed by Western immunobiot analysis using rabbit ~unti.Srp,I p antibodies (lanes ! to 3). The same membrane wt:~s~e~13o.~edto X-ray film to detect Y~P-labeled Srpip (lanes 4 to 6L

tathione-agarose column to remove GST. GST-free Srplp was then purified by MonoQ column chromatography, and the ability of this tunphosphorylated) SrpIp to bind the TNLS peptide was compared with that of phosphorylated Srplp, which was obtained after a near complete { ~ 8 5 ~ phosphorylation of this Srplp by the o( subunit of yeast CKII. As shown in figure 6, no significant difference was observed between the phosphorylated and non-phosphorylated forms of Srplp in the degree of binding of the NLS peptide. In other experiments, GST-Srplp and the two mutant forms of GST-Srplp, $67V and $67D, parified from E coli were compared for their ability to bind the T-NLS peptide. No difference was observed (data not shown). In addition, direct assay of nuclear transport of Green fluorescence protein fused to histone H2B after induction from the GALI-IO prornoter did not show a~y significant difference between the $67V mutant strain and the control strain tour unpublished experiments). From these experiments combined with the absence of deleterious effects of the $67V and $67D mutations (see above), it appears that although a significant fraction of Srplp is phosphorylated in yeast cells at the $67 CKII site, this phosphorylation apparently does not

Srplp

assumption mentioned above. We conclude that a maj~or fraction of Srp! p is phosphorylated in growing yeast eel is.

Effects ol'tdu~sphorylation of Stp Ip on T-NLS p~Tei¢~e bimting GST-Srplp expressed in E coil and purified is pr~hahly not phosphorylated, and therefore, NLS binding to ~rp lp ~ppears to take place without any phosphorylatioll ~f Srp|p. However, as described in the previous section, at I~a.sl 3(3% of Srplp in growing yeast cells is phosphory!at~0,, ~ld thi~ phosphorylation is mostly (90% or more) at th¢~ serine 67 CKII site. In addition, there is a report of isollttiol~ of an NLS-binding protein that requires phosphoryhlti~J~ I'or NLS binding [541. Therefore, the following experill~,~ats were carried out to examine the role o1' phosphorylatio~ of Srpl p in NLS binding. GST-Srplp, which was expressed in E coli ao~l purified, was first treated with calf intestinal phosphata.s¢ t~ re,hove any possible phospate on proteins. A parallel re,a~fion ttsing 32p-labeled GST-Srpl p (phosphorylated by CKII)jtlcJi carted that the condition used was sufficient to remove tills 32p. phosphate at the CKII site completely. The ph~splaatase treated GST-Srplp was recovered by binding 19 gl~tathione beads followed by elution and MonoQ chrot,~tltography. The resultant GST-Srp l p was compared with co111trol GSTSrplp (without phosphatase treatment) for NLS&imd ing ,activity. No significant difference was observed ~data lint shown). The phosphatase treated GST-Srp i i~ w~.~ then treated with thrombin, followed by passage thr~o gl~ u glu-

+P

-P

Competitor

1 2 3 4 5 6 Fig 6. Binding of a 32p-labeled T-NLS peptide to Srplp with and without CKII phosphorylation. Srplp prepared fronl a phosphatase.treated GST-Srpl p preparation (see text) was phosphoryhtted by GST-Cka2p (CKII ¢x' subunit) in the presence of nonoradioactive ATP (1.5 raM) or in its absence. A parallel reaction with 13:PIATP showed that approximately 85% of Srplp was phosphorylated. After removal of GST-Cka2p with glutathione beads, phosphorylated ('+P'; hines ! to 3) and non-phosphorylated ('-P': lanes 4 to 6) Srpi p were incubated with I a.M of a 32p-labeled T-NLS kemptide in the presence of 50 [aM of non-radioactive competitor ToNLS peptide (lanes 2 and 5) or mutant (reverse NLS) peptide {lanes 3 and 6) or in the absence of competitor (lanes 1 and 4). An auto° radiogram of an SDS-PAGE gel is shown. The position of Srplp carrying cross-linked 32p-labeled T-NLS is shown by an arrow.

L~6 play any significant ro|e in bindi~lg of NLS pept?es/proreins in vitro and in ~i~o, nor does it play any significant role in nuclear protein transport in general in vivo. In addition, since the phosphatase treatment that removed phosat the $67 CKII site completely did not affect NLS Ifiadiag activity, as described above, it appears that NLS binding does not require any phosphorylation, either by CKIi or by some other protein kinase.

We have previously purified a protein kinase. Srplp kinase. which phosphorylates Srplp with ATP in the presence of NLS peptides/proteins 1201. We have now established that the Stglp kinase is identical to the yeast CKII. and identitied the site of phosphorylation as serine 67 both in vitro and in vivo. The sequence containing this site. DSDEEDE, is consistent with the known CKII consensus sequence (S/TXXE/D). In fact, the presence of one acidic amino acid ~tbre and five acidic amino acids after serine appears to make this ,~quence an excellent CKII substrate sequence 1531. The CKII phosphorylation site (serine 67) in yeast Srplp is h~ated just distal to the N-terminal 42 amino acids domain (importin I~ binding domain or IBB domain covering amino acids 17 to 58: see 155. 561), that is required for binding of impor!in 13and is highly conserved among Srp ! p homologs from different organisms, It is interesting to note that, in human and mouse, there are at least two Srpl p homologs which are no more similar to each other than they are to yeast Srplp (¢g see 1151), and that one of the homologs from these organisms (hSRPI and mSRPI ) has a CKI! site in a position roughly corresponding to the yeast CKII site, but the other homologs (Rehl and mPendulin~ do not h~ve such a CKII site (table liD, The homologs wilhout a CKII site carry a consensus ~ u e n c e for ode2 kinase as noted previously 1171, The libations of all of these phosphocylation sites are distal to the IBB domains and are separated from it by 6-8 amino acids (table I!i). Thus, phosphorylation of the yeast Srplp at the $67.CKI1 site appears to have counte~arls in other distantly related or-

ganisms, one type tbr phosphorylation at the corresponding CKII site presumably by CKI! and other type(s) for phosphorylation by some other protein kinase, such as cdc2 kinose, suoo,~ting=,~_, a potential s i g n i f i c a n c e of such phosphorylation in relation to the functions of Srp ! p/importin ~ a r y o p h e r i n o~, In addition, the requirement of NLS peptides/proteins tbr Srplp phosphorylation demonstrated in the yeast system implies that only Srpl p complexed with karyophilic proteins carrying an NLS is the in vivo substrate for CKII, suggesting a possible functional role of this phosphorylation in nuclear protein import. However, mutations of serine 67 to valine or aspartic acid in Srplp that abolish phosphorylation by CKII both in vim~ and in vivo did not cause any apparent deleterious effects on cell growth, and hence, did not presumably affect nuclear protein import in vivo in any significant way, The in viro nuclear import assays mentioned above (unpublished experiments) also failed to show effects of the $67V mutation on nuclear protein import. Thus, the functional significance of phosphorylation at the CKil site in the yeast system is unknown. It sl.,t.d be noted that a search in the genome sequence data base suggests the absence of any other Srplp homolog in S cerevisiae. It is possible that phosphorylation might be connected to the presence of multiple NLS receptor homologs in an organism. Thus. it might be worthwhile to carry out mutagenesis studies of phosphorylation sites using other systems where different Srplp homoiogs carry different tepes of potential phosphorylation sites in the analogous krcations, as mentioned above. Efficient phosohorylation of Srplp by CKI! requires the prtsence of peptones or proteins t:~m~ia~ a fuh~:tkma! NLS 120[, The results ~,~.rlb~d ia d~i,, i,,qJc, .d:~.,:: ~.!~.::'~:eri~',,:,67 is masked in tl~e intact Srplp protein structure, and that inleractions of NLS peptides/proteins with Srplp nlusl cause a contiwmational change of Srp I p, exposing serine 67 for CKII phosphorylation (see fig 7). Stimulation of CK!! phosphorylation of Srplp by deletion of a C-terminal domain or by heating at moderate temperatures support this conclusion (fig 7). We have noted that the degree of CKII phosphorylation of Srplp in the absence of NLS varied to some extent depending on preparations and experiments. Perhaps, a small fraction of Srplp molecules might have

Tall~ III. Com~fison of the amino acid ~quence of the CKII site of yeast Srplp with potential phosphorylation sites of Srplp homologs l~m o~herorganisms, N~m¢

S~ Ip hSRPl n~SRPI Rchl mPeadulin dPendulin iml~t~in ot

Seq~lolt'c

Kinase"

Distain'eft'ore IBB

Organisms

Reference

166} DSDEEDE ~.~6~F~EEE (56) EIEEE (62) SPLQ (62) SPLQ (56) SPLK (59~ SPEK

CK|! (CKII) (CKIi) (cdc2) (cdc2) (cdc2) ~cdc2)

8 6 6 8 8 7 8

Yeast Human Mouse Human Mouse

9 13 13 I0 14 17. 18

~CKll) a potential CKll phosphorylatitm site: (cdc2) a pqtential cdc2 kinase site I171.

Drosophih~ Xem~lmS

7

257

C

$67

( NLS-Prot. ) N

uncation

C

NI_

$67 ~l

i::::ii:~1:',~:1 I~C

Casein Kinase i!

Fig 7. A model for unmasking the serine 67 CKil site by NLS binding to Srplp. Unmasking caused by a C-terminal truncation is also shown. Eight armadillo repeats (defined according to 19, 471) are indicated by stippled boxes. The location of NLS peptides/proteins binding sites varies depending on peptides/proteins. The region important for the T-NLS binding roughly defined by our unpublished experiments ~an example is shown in fig 2B) is used here. No other information on protein structures is available and the shape change in Srplp shown is for illustration only.

'partially denatured' conformations with the exposed $67, and the amount of this fraction may vary depending on Srp I p preparations. Yoneda and his coworkers r¢cent!y reported the presence of a protein kinase (called 'NLS kinase') in HeLa cell ex° tracts which is stimulated by NLS peptides and phosphorylates an uncharacterized protein ('p34') with an apparent molecular mass of 34 kDa 1571. The protein components tbund in the purified preparation of this enzyme are different from those of mammalian CKII. In addition, as explained in the results section, NLS stimulation of the yeast CKII has been observed only for Srplp as substrate, and other substrates including C-terminal deletion derivatives of GST-Srplp are efficiently phosphorylated with no or only a slight stimulation by NLS, It is clear that NLS-dependent phosphorylation of Srplp by CKII as described in this and previous papers 1201 is different from the NLS-dependent phosphorylation of p34 by NLS-kinase described by Yoneda and coworkers 1571. Stochaj and coworkers previously purified a yeast protein of an apparent molecular mass of 70 kDa (NBP70), which binds NLS and NLS-bearing proteins specifically 1581, and reported that this protein is phosphorylated and phosphatase treatment apparently abolished its NLS-bind-

ing ability 1541. Because of the specific NLS binding property of this protein and evidence of participation of an anligenicaily related Dro.Wldtila prolein in nuclear protein transport, there is a possibility that this 70 kDa yeast protein might be Srplp. Since the gene l'or this 70 kDa protein has not been cloned, this possibility cannot be directly examined. Its apparent molecular mass (70 kDa) is close to that of Srplp (calculated molecular mass, 60.4 kDa; apparent molecular mass, 67 kDa; see [91). However, as described in this paper, GST-Srplp (and Srplp) expressed in E coli and purified has the ability to bind NLS efficiently and its phos~ phorylation by CKII or dephosphorylation of phosphate at the CKII site (and other hypothetical phosphates) by calf intestinal phosphatase did not alter the NLS binding activity of GST-Srplp in any significant way. Further studies are required to establish the idetttity of NBP70 with respect to Srplp and the significance of phosphorylation of NBP70 for NLS binding. Although we have found that phosphorylation of Srpl p at the serine 67 CKII site is dispensable for normal cellular growth, a significant fraction of Srplp, which plays a crucial role in nuclear protein import and is essential for cell growth, is phosphorylated at this site in growing yeast cells. Thus, it is still possible that this phosphorylation has some

258 ,lgmhcant a l e for yeast cells. Perhaps we have not yet f o u ~ conditions where the phosphorylmion at this site is important. It is also possible that there might be some other cellular re~tions with overlapping functions leading to the nt dis~nsability of phosphorylation of Srp I p at this in addition+ that there is a small amount S ~'

~': ~ ~1,~

i~e~ ~ main CKtl site, and this residual+phosphoryl a t i ~ e i ~ by CKH or by some other protein kinase(s) might ~ import~t for regulation of S ~ l p functions. These possibilities ~ under current investigation.

Acknowledgments We thank Dr J Keener lbr critical t~ading of the manuscript, and Dr M l a k e s algl D Semanko for help in preparation of the manuscript. This work was supported by US Public Health Grant R37GM35949 from the National Institutes of Health.

Rel'eRn¢~ I Davis LI 11~51 The nuclear ~)re complex. Atom Rev Biochem 64. 8~S~8~ 2 Sines G, Hurt, BC 11995) Nudeocytoplasmic transport: factors and mech~isms, FEllS I~,tt 369, 107-112 3 Mclehkw F, Gerace L (1995) Mechanisms of nuclear protein impnrt. C~+rrOpin Cell Biol 7, 311~-318 4 Gotlieh D, MaII:~ IW (1~6) Nucl¢ocytoplasmi¢ transl~Jrt. Sciem.e 271, 1713+1518 5 K~I)P DM, Silver PA t I~X)) A GTPa~ ¢ol~tn)tl!ng nu~|e,;ff Iraffiekin$: runnin~ the right way or walking RANdumly? {:W! 87+ I ~ 6 Adam SA, Ger~¢¢ L t 10911Cylo~oli¢pa, tein~ that ~'tfi¢~tl!~,' hind nuclear h~qatton signals at+ receptors fur nuclear iml~+rl. (~+!l (~0, 837=847 7 Gtwllch D, ~ h n S, Laskey RA, Hartmann 1~,119~}4| Isulatiun of a p[otcin th+tt is e~scutiul fi,r tile first step uf nuclear protein impure, Cell79, 76%~78 8 R~I~ A, B k ~ l G. Mtx~ MS ~1~5) Id~atifi~ation of a protein corn+ pt¢~ that is ~ i ~ i+~ n~lear protein impola and mediates docking of ilnl~>~sub~tra|e to dls+th~tm~leop~+rins+Pt+w +Vat/Ac.d&'i USA 9~+ 17~9=1773 9 Y~+R, lakes M, Yam~ishi M, D~ld JA, Nomura M ( 1~21 Cloning ~nd eharacledtation of SRPi, a suppressor of temperature-sensitive RNA ~ y m ~ r a ~ I mutations, in ~r'ch~m~nyces ce+rvisi,w, Mol Cell #6-# 12, 5~S67iI I0 Um++~CA, Kimh SA, Gyuris J, Brant R, Oettinger MA (19t)4)Rcb l, l ~ t n that s~ifically interacts with the RAG+I recmnbinationo ~tivating l ~ e i n , Pt~w Nell Acad S(,i USA 91,6!56,--6160 I1 Wets K, Maltaj IW; t.amo~ AI (1~5) Identification tffhSRPl alpha ms a ihmtional r~epl(+ lhr nuclear iocalitation ~uences, Science 2~:, 1049+1053 12 O+Ndll RF:, i~le~ P (19951 NPI-l, the human homolog of SRP-I, interacts wilh influenza vires nuclcoprotein. VTndogy206, 1167125 t3 Co~¢s P, Ye ZS, Baltim~ D t l ~ } RAG-I interacts with the t,e, I~al~ amir~-~~id motif of t ~ human homologue tff the yeast protein SRPI+ Pn~- Naa Ac~&,i USA 91, 7633~7637 t4 K ~ t P, F r ~ h M (19951 Yeaa Srpl, a nuclear plx~tein~lat~:dto Drt+. .W~i/r + l a m a p~'ndulin+is n.s4uilxxltka"atonal migration,divisim~, integrity of nuclei dudng mitosis, M,d Gen Genet 248, 351~.~3 15 ~ e ~ MG, Guttdd~ KL, Munguia JE, Waterman ML ( 19961 The nuclear Iocali~atkm signal of lymphoid enhancer factor, I is recug-

nized by two differentially txpressed Srpl.nuclear localization stquence receptor proteins. J Bhd Chem 271, 7654-7658 16 hmuuoto N, Shimamoto T, l~tkao T, Tachibana T, Kose S, Matsul>ae M. Sekimoto T, Shimonishi Y, Yoneda Y ~19951 In rive tvidence for involvement of a 58 kDa component of nuclear pore-targeting complex in nuclear protein import. EMBO J 14, 3617-3626 17 Kussel P, Frasch M 119951 Pendulin, a Drosophila protein whh eel| cyclt~-dependentnuclear localization, is required lbr normal cell proiiferation, d ¢.~,ll Bill 129, 1491-1507 18 Torok I, Strand D, Schmitt R, Tick G, Torok T, Kiss I, Mechler BM (1995) Tht overgrown hematopoietic organs-31 tumor suppressor gene of Drosophila encodes an importin-like protein accumulating in the nucleus at the onset of mitosis, d Cell Bill 129, 1473-1489 19 Enenkel C, Blobel G, Rexach M (1995} Identification of a yeast karyopherin heterodimer that targets import substrate to mammalian nuclear pore complexes. J Bin! Chem 270, 16499-16502 20 Azuma Y, Tabb MM, Vu L, Nomura M (1995) Isolation of a yeast protein kinase that is activated by the protein encoded by SRP! (Srp Ip) and phosphory!ates Srp I p complexed with nuclear Iocali~.ation signal peptides, l:b~r: NatOAcad So+ USA 92, 5 ! 59-5163 21 Lt~ebJDJ, Schlenstedt G, Pelilnal~D, Kornitl.er D, Silver PA, Fink GR (1~51 The yeast nuclear import receptor is required lbr mitosis. Pay Natl Acad Sci USA 92, 7ffl7-765 I 22 Adam EJH, Adam SA 119941 Identification of cytosolic fiwtors required for nuclear k~:ation sequence-nlediated binding to the nuclear envelope, d Cell Bill 125, 547-555 23 Chi NC, Adam E,IH, AdmnSA ( 19951Sequence and characterizationof cytoplaslnic nuclear prutein import factor p97. J Cell Bill 130, 265-274 24 Gorlich D. Kostka S, Kraft R, Dingwall C, Laskey RA, Hartlnann E, Prehn S ( 19951 Two different subunits of importin cooperate to recognize nuclear h~alization signals and bind them to the nuclear envelope, On" Bill 5, 383-392 25 MoruianuJ, Hijikata M, B!obel G, Radu A ~19951Mmnmalian karyopherin alpha I beta and alpha 2 beta heterodimers: alpha i or alpha 2 suhunit binds nuclear localization signal and beta subunit interacts with peptide relent-containing nuclcoporins. Pro+.Nat/Acad S<.iUSA 92, 6532-6536 26 Rexach M. B!obel G i 19951 Prutein intport into nuclei: assta:iation and dissociation reactions involving tnmsport substnlte, transport factars, and nucleuporhls. ~,!1 83, 6ls3~692 27 Melchior E Paschal B. Evans ]. Gerace L t 19931 Inhibition of nuclear pnnem iml~ul b)/ttotdlytlroly~ablc analogues of GTP and identifica+ lion of tile small GTPase RanO'C4 its an essential transport fil¢lOr (ptlhlished en+alunlapl~ars iu ,I (~ql Iliol ( 19941 Jan; 124 1172):217). d Celt Bill 123, 1049+1059 28 M ~ MS, Bk~¢l G (1993) The GTP+bindingprotein R~nfI'C4'is re, qui1~,dfro' protein import into lhe nucleus. Natut~ (l~m+O365, 6617663 29 Moon MS, BIo~l G 119941Purification of a Ran-interacting protein that is required for protein import into the nucleus. Pmc Natl Acad &~i USA 91, 10212-10216 30 Nehrbass U, Blobel G (1996) Role of the nuclear transport factor p 10 in nuclear import, Scie,ce 272, I,.071 ++ 31 Pa~hal BM+ Gerace L 119951 Identification of NTF2, a cytoaolic factor fur nuclear import that interacts with nuclear pore complex protein p62, J Cell Bill 129. 925+937 32 Imamoto N, Matsuoka Y, Kurihara T, Kohno K, Miyagi M. Sakiyama IF,Okada Y, "l,~unasawaS, Yoneda Y ( 19921 Antibodies against 70-kD heat shock cognate protein inhibit mediated nuclear import of karyophilic proteins. J Cell Bill 119, 1047-1061 ,13 Shi Y, Tholnas JO( i~21 The transport of proteins into the nucleus requires the 70-kikMalton heat shock protein or its cytosolic cognate. Mol Cell Biol 12, 2186-2192 34 Shulga N. Roi~erts P, Gu Z, Spitz L, Tahb MM, Nomura M, Goldfarb D, ( 1 ~ ) In vh,o nuclear transport kinetics in Sacchmomyees cerevishte: a rule fiw heat sll~ck protein 70 during targeting and translocadon. J Cell Biol 135, 329-339 35 PollalxlVW, Michael WM, Nakielny S, Siomi MC, Wang E Dreyfuss G (1996) A novel receptor-mediated nuclear protein import pathway. Cell 86, 985-994

259 36 Aitchison JD, Blobel G, Rout MP (1996) Kaplt~4p: a karyopherin involved in the nuclear transport of messenger RNA binding proteins. Science 274, 624-627 37 Feldherr C, Akin D (1995~ Stimu|adon of nuclear import by simian virus 40-transformed cell extracts is dependent on protein kmase activity. Mol Celt Blot 15, 7043-7049 38 Gauthier-Rouviere C, Vandromme M, Lautredou N, Cai QQ, Girard F, Fernandez A, Lamb N (1995) The serum response factor nuclear localization signal: general implications for cyclic AMP-dependent protein kinase activity in control of nuclear translocation. Mol Cell Biol 15, 433-444 39 *Mishra K, Pamaik VK (1995) Essential role of protein phosphorylalion in nuclear transport. Exp Cell Res 216, 124--I 34 40 Vandromme M, Gauthier-Rouviere C, Lamb N, Fernandez A (1996) Regulation of transcription factor localization: fine-tuning of gene expression. TIBS 21, 59-64 41 Bidwai AP, Reed JC, Glover CVC (1994) Casein kinase 11of Sacchammyces ¢ewvisiae contains two distinct regulatory subunits, beta and held. Arch Biochem Biophys 309, 348-355 42 ChewWu .!L, Padmanabha R, Giover CVC (1988) Isolation, sequencing, and disruption of the CKAI gene encoding the alpha subunit of yeast casein kinase !!. Mol Cell Biol 8, 4981-4990 43 Padmanabha R, Chen-Wu JLP, Hanna DE, Glover CVC (1990) Isolation, sequencing, and disruption of the yeast CKA2 gene: Casein kinase II is essential for viability in Saccharomyces cereviaise. Mol Cell Biol 10, 4089-4099 44 Reed JC, Bidwai AP, Glover CVC (1994) Cloning and disruption of CKB2, the gene encoding the 32-kDa regulatory beta'-subunit of Saccharomyces cerevisiae casein kinase I!. ,I Biol Chem 269, 18192! 82OO 45 Bidwai AP, Reed JC, Glover CVC (1995) Cloning and disruption of CKBI, the gene encoding the 38-kDa beta subunit of Sacchammyces cewvisiae casein kinase 11(CKll). Deletion of CKll regulatory subunits elicits a salt,sensitive phenotype, d Biol Chem 270, 10395-10404 46 Sikorski RS, Heiter P (1989) A system of shuttle vectors and yeast host strains designed for efficient manipulation of DNA in Saccharomyces cewvisiae. Genetics 122, 19-27

47 Yano R, Oakes M|.. Tabb MM, Nomura M ~1994~ Yeast Srplp has homology to armadillolplakoglobin/beta-catenfl~ and participates in apparently multiple nuclear functions including the maintenance of the nucleolar structure. Proc Natl Acad Sci USA 91, 6880-6884 48 Warner JR ( 1991 ) Methods Enzymoi 194. Guide to Yeast Genetic~ and Molecular Biology (Guthrie C, Fink GR, eds) 423-428 49 Aebcrsold RH, Leavitt J. Saavedra RA. Hood LE. Kent. SBH (1987) Internal amino acid sequence analysis of proteins separated by oneor two-dimensional gel electrophoresis after in situ 9mte~'~e digestion on nitrocellulose. Proc Natl Acad Sci USA. 84. 6970 6974 50 Masaki T, Tanabe M, Nakamam K, Soejima M ( 1981 ;~Studies on a new proteolytic enzyme from A chromobacter lyticus M47, -!. I. Purification and some enzymatic properties. Biochim Biophys A c , ~ 0 , 44--50 51 Adam SA, Lobl TJ, Mitchell MA, Gerace L (1989) Identification of specific binding proteins for a nuclear location sequence. Nature 337. 276-279 52 Padmanabha R, Gio~'er CVC (1987) Casein kinase !i of yeast contains two distinct alpha polypeptides and an unusually large beta subunit. J Biol Owm 262, ! 829- ! 835 53 Pinna LA (1990) Casein kinase 2: an 'eminence grise' in cellular regulation'? Biochim Biophys Acta 1054, 267-284 54 Stochaj U, Silver P (1992) A conserved phosphoprotem that specifically binds nuclear localization sequences is involved in nuclear import (published erratum appears in J Cell Biol (1992) Jul;l 18 (!):2 ! 5L J Cell Bi,d 117,473--482 55 Gorlich D. Henklein P, l,askey RA, Hartmann, E (|996) A 41 amino acid motif in import(n-alpha confers binding to import(n-beta and hence transit into the nucleus. EMBO J 15, 1810-1817 56 Weis K, Ryder U, Lamond AI (1996) The conserved amino-terminal domain of hSRPI alpha is essential for nuclear protein import. EMBO J !5, 1818-1825 57 Kurihara T, Hori M, Taked,: H, lnoue M, Yoneda Y (1996) Partial purification and characterization of a protein kinase that is activated by nuclear localization signal peptides. FEBS Lett 380. 241--245 58 Stochaj U, Osborne M, Kurihara T. Silver P (1991) A yeast protein that binds nuclear localization signals: Purification localization, and antibody inhibition of binding activity, d Cell Biol I 13. 1243- ! 254