Photosynthesis and chloroplast genes are involved in water-use efficiency in common bean

Plant Physiology and Biochemistry 86 (2015) 166e173

Contents lists available at ScienceDirect

Plant Physiology and Biochemistry journal homepage: www.elsevier.com/locate/plaphy

Research article

Photosynthesis and chloroplast genes are involved in water-use efficiency in common bean
sar L. Aguirre-Mancilla a, Jorge A. Acosta-Gallegos b, Jorge E. Ruiz-Nieto a, Ce
zquez-Medrano c,
rez a, Elías Piedra-Ibarra c, Josefina Va Juan C. Raya-Pe b, * Victor Montero-Tavera a b c


n de Estudios de Posgrado e Investigacio
n, Instituto Tecnolo
gico de Roque, Celaya C.P. 38110, Guanajuato, Mexico Divisio Campo Experimental Bajío, Instituto Nacional de Investigaciones Forestales, Agrícolas y Pecuarias, Celaya C.P. 38110, Guanajuato, Mexico
noma de M
Facultad de Estudios Superiores Iztacala, Universidad Nacional Auto exico, Iztacala C.P. 54090, Estado de M
exico, Mexico

a r t i c l e i n f o

a b s t r a c t

Article history: Received 18 August 2014 Accepted 29 November 2014 Available online 4 December 2014

A recent proposal to mitigate the effects of climatic change and reduce water consumption in agriculture is to develop cultivars with high water-use efficiency. The aims of this study were to characterize this trait as a differential response mechanism to water-limitation in two bean cultivars contrasting in their water stress tolerance, to isolate and identify gene fragments related to this response in a model cultivar, as well as to evaluate transcription levels of genes previously identified. Keeping CO2 assimilation through a high photosynthesis rate under limited conditions was the physiological response which allowed the cultivar model to maintain its growth and seed production with less water. Chloroplast genes stood out among identified genetic elements, which confirmed the importance of photosynthesis in such response. ndhK, rpoC2, rps19, rrn16, ycf1 and ycf2 genes were expressed only in response to limited water availability. © 2014 Elsevier Masson SAS. All rights reserved.

Index terms: Phaseolus vulgaris Transcription levels Transcriptome Suppressive subtractive hybridization Water regimens

1. Introduction One of the main components of climatic change is the alteration in the distribution of water by shorter and erratic rainy seasons, forcing many plant species to complete their life cycles under water stress conditions, restricting plant growth, development, survival and yield (Ahuja et al., 2010). Water is a limited resource and agriculture consumes about 78% of it (de Fraiture and Wichelns, 2010), hence a recent proposal to mitigate the effects of climate change and to reduce agricultural water consumption is generating cultivars which use water efficiently (Boutraa, 2010), mainly in species of agronomic and alimentary interest such as common bean, which is mostly grown under rainfall, condition under which 60% of agricultural crops are

Abbreviations: WUE, Water-use efficiency; PS, Pinto Saltillo; BM, Bayo Madero; TB, Total Biomass; A, Photosynthetic Rate; gs, Stomatal Conductance; PRO, Yield of Seeds; WC, Water Consumed; ssDNA, Single Strand DNA; 20%, Limited Water Regimen; 60%, Optimal Water Regimen; dsDNA, Double Stranded DNA; pDNA, Plasmid DNA; cDNA, Complementary DNA; ROS, Reactive Oxygen Species. * Corresponding author. E-mail address: [email protected] (V. Montero-Tavera). http://dx.doi.org/10.1016/j.plaphy.2014.11.020 0981-9428/© 2014 Elsevier Masson SAS. All rights reserved.

produced (Molden et al., 2010). A crucial step in the colonization of terrestrial environments by plants was the evolution of genetic and physiological mechanisms which allowed them to control water loss while still fixing CO2. This disjunctive and its implications in the plant water balance, its hydraulic and stomatal functionality are evident in the vascular plants evolution (Pittermann, 2010). The water-use efficiency (WUE) at physiological level is defined as the ratio between biomass and/or seed produced over water consumed (Xing et al., 2011). WUE in plants can be improved by increasing carbon assimilation while keeping the transpiration rate, or by reducing the transpiration rate while the carbon assimilation is kept (Yoo et al., 2009). Mittler and Blumwald (Mittler and Blumwald, 2010) mention that there is a genetic basis for WUE and is possible to perform breeding for this trait. Although WUE variation has been observed in plants, only recently its molecular characterization and dissection has started in the model specie Arabidopsis thaliana. So far, the engineering of major field crops for improved WUE with single genes has not yet been achieved (Karaba et al., 2007). Among the genes involved in the regulation of this phenomenon, ascorbate peroxidase (apx2), erecta, hardy and the transcription factor GT-2 LIKE (gtl1) stand out. The A. thaliana mutant alx8 has a high housekeeping expression of the apx2 gene,

J.E. Ruiz-Nieto et al. / Plant Physiology and Biochemistry 86 (2015) 166e173

conferring water stress tolerance and a higher WUE (Wilson et al., 2009). The housekeeping (35S) overexpression of the erecta gene in an A. thaliana transgenic line increased its WUE by improving its photosynthetic rate, reducing its transpiration and stomatal density (Xing et al., 2011). The expression of A. thaliana gene hardy in rice improved its WUE by increasing the CO2 assimilation through a high photosynthetic rate and a reduction in transpiration (Karaba et al., 2007). A. thaliana mutants with function loss of gtl1 increased their water deficit tolerance and have a higher WUE by reducing the daily transpiration without a reduction in their biomass accumulation (Yoo et al., 2010). The aims of this study were to characterize the efficient use of water as a differential mechanism in response to water limitation in two bean cultivars contrasting in their water stress tolerance, isolate and identify fragments of genes associated to this response in a model cultivar and to evaluate transcription levels of genes previously identified. 2. Materials and methods

167

to 1000 mmol m2 s1 for 30 min, photosynthesis was subsequently calibrated to 1000 mmol m2 s1 with a CO2 concentration of 400 mmol mol1, leaf temperature was kept at 25
C and vapor pressure between 1 and 1.3 kPa. Measurements began between 12:00 and 13:00 h with a 70% average relative humidity. These variables were evaluated in three phenological stages: vegetative, reproductive and maturity, considering them when 50% of the plants had three composed leaves, when they were flowering and when pigmentation changed in mature pods, respectively. Seeds produced by plants (PRO) were weighted and water consumed (WC) was measured during the whole biological cycle. Integral WUE was evaluated considering the ratio between yield of seed and water consumed (PRO/WC), also the ratio between total biomass and water consumed (TB/WC). Instant WUE was measured as the ratio between photosynthesis and stomatal conductance (A/gs). Results were subjected to analysis of variance (ANOVA) in a completely randomized design with eight replications and means separation tests of Tukey (p < 0.05) were performed, using SAS System for Windows 9.1. statistical software.

2.1. Plant material and treatments 2.3. Housekeeping control genes evaluation Two bean cultivars contrasting in their water stress tolerance were selected, due to their differential ability to produce seeds under limited irrigation conditions. It has been reported (Rosales et al., 2012) that the Pinto Saltillo (PS) cultivar under drought reduced its pod biomass only by 17.0% with respect to irrigation, while for Bayo Madero (BM) cultivar the reduction was of 42.0%, considering the first one cultivar as tolerant and the second as susceptible. Both cultivars show prostrate growth habit type III, short photoperiod and belong to Durango race. In 2011 two experiments in SpringeSummer and AutumneWinter cycles were established, at the Instituto Nacional de Investigaciones Forestales, Agrícolas y Pecuarias (INIFAP) Campo Experimental Bajío (CEBAJ), located at 20
310 north latitude and 100
450 west longitude to 1765 m above sea level. Experiments were established in a greenhouse using pots (16 cm height X 18 cm greatest diameter) with peat moss type substrate (Sunshine® mix No. 3) of which field capacity was determined as 1.89 g of retained water per gram of soil. Seeds were germinated in humidity chamber at 30
C and five days later these were transplanted into pots containing the previously established treatments. In the spring-summer and autumnewinter cycles, four water regimens were established: 20%, 40%, 60% and 80% with respect to field capacity. To avoid water loss by evaporation and percolation, pots were covered with foil and drain holes were sealed with silicone, so that the only losses were by evapotranspiration. Water regimens were kept assuming that weight loss corresponded to consumed water and it was replenished through controlled daily irrigations. The only nutrients resource available was the previously contained in the substrate. For each water regimen, eight replicates were kept for 75 days, at that time plants reached full maturity and drastically reduced their water consumption. The average maximum and minimum temperatures in the spring-summer and autumnewinter cycles were 38
C/14
C and 31
C/12
C respectively, with average maximum and minimum relative humidities of 60%/36% and 86%/54%. The photoperiod was 14 and 12 light hours, according to the weather station located at CEBAJ. 2.2. Evaluated variables In both agricultural cycles total biomass (TB) was evaluated, drying plants at 80
C overnight. In the autumnewinter cycle the photosynthetic rate (A) and stomatal conductance (gs) were evaluated with an infrared gas analyzer (LI-6400, LICOR) using the leaves which better represented the plants state. Radiation was set

To identify the best reference housekeeping gene, expression profiles were generated by semiquantitative RT-PCR for actin, btubulin, cyclophilin, the elongation factor 1-b (fe1b), and ribosomals 26S and 28S genes. Primers pairs for each gene were designed using the Primer 3 Plus software based on their sequences housed in GenBank [GenBank accessions: KF033476.1, KF569615.1, X74403.1, KF033738.1, KF033619.1 and L36638.1]. Total RNA was extracted (Logemann et al., 1987) from leaf tissue of eight plants of both cultivars in the four water regimens in the vegetative and reproductive stages. Maturity stage was not considered, by the reduction in the physiological activity due to the aging of plants. RNA integrity was analyzed by electrophoresis, using 1.5% agarose denaturing gels with 12.3 M folmaldehyde and 10 X MOPS (Sambrook et al., 1989). Gels were visualized with ethidium bromide (0.5 mg mL1, EtBr) and UV light in a Chemidoc™ (BIO-RAD) photodocumenter. Concentration and purity of total RNA were determined by measuring the absorption of UV light using a Nanodrop 800™ (Thermo Fisher Scientific). Single strand DNA (ssDNA) was synthesized by reverse transcription with the enzyme SuperScript™ II (Invitrogen) from eight RNA's extracted of each treatment. Housekeeping genes were amplified by RT-PCR in a total volume of 20 mL containing 12 mL sterile water, 1 mM dNTP's, 1 X PCR buffer, 2 mM MgCl2, 1 mM corresponding primers, 1 U taq polymerase and 300 ng of ssDNA. Reaction conditions were: 1 cycle at 95
C for 5 min, 30 cycles at 95
C for 1 min, corresponding melting temperature of each primer pair for 2 min, 72
C for 2 min and a final cycle at 72
C for 2 min. Products were analyzed by horizontal electrophoresis in 1.5% agarose with 1 X TBE buffer (1 mM pH 8 EDTA, 40 mM boric acid, 40 mM Tris), results were released and documented as described above. The densitometry analyses of images were performed using the TotalLab Quant TL120 1D v2009 software. Finally, variation among expression levels in quantitative terms was analyzed and compared. 2.4. Identification of water-use efficiency-related genes The Pinto Saltillo cultivar was selected as study model. The instant and integral WUE increased under limited water and optimal conditions respectively, therefore based on the results of these evaluations, two contrasting water regimens were identified, one limiting (20%) and another optimal (60%) (Medrano et al., 2007). Ten plants were kept under these regimens until vegetative stage, considered as the most suitable to identify the genes of

168

J.E. Ruiz-Nieto et al. / Plant Physiology and Biochemistry 86 (2015) 166e173

interest, due to an evident trend to increase instant WUE and a greater physiological activity were observed. Leaves tissue from the ten plants were used to extract total RNA due to its sampling and handling ease, which turns it suitable on an assisted selection system. RNA integrity was assayed by denaturing electrophoresis, while its concentration and purity were determined at 260 nm by UV light spectrophotometry. From the RNA bulks of each treatment, double stranded DNA (dsDNA) was synthesized by LD-PCR with the Super Smart (Clontech) synthesis kit. Subsequently, EST (Expressed Sequence Tag) fragments were generated by Suppressive Subtractive Hybridization of the genes expressed under 20% water regimen using the PCR-Select™ cDNA Subtraction kit (Clontech). EST fragments were ligated to the pGEM®-T Easy (Promega) vector to transform the strain E. coli DH5a-Select 96® (Invitrogen) competent cells by heat shock. In this way a bank of 100 recombinant clones was generated, in which the presence of inserts was tested by restriction with Eco RI enzyme (Invitrogen) and nested PCR. The subtractive bank was sequenced with the T7 primer using the BigDye® Terminator v3.1 (Applied Biosystems) kit and the ABI 3730xl (Applied Biosystems) sequencing platform. From the obtained sequences, genes were identified in the GenBank database using the BLAST algorithm, considering the E 1  105 values as significant homology index (Recchia et al., 2013). To evaluate the EST's deferential character and to select those related to WUE, Dot Blot hybridizations in macroarrays were performed for the 20% and 60% water regimens, in vegetative and reproductive stages of both cultivars. For this purpose, the transformed cells were grown in LB medium for 24 h and from these cultures, plasmid DNA (pDNA) was obtained from recombinant clones (Birnboim and Doly, 1979). The integrity of the pDNA thus obtained was evaluated and its concentration was standardized to 500 ng mL1. Plasmids were denatured in boiling water for 10 min and 1 mL of each pDNA was blotted by duplicate on a Hybond-Nþ (GE Healthcare) nylon membrane and fixed with UV light. The blotted membrane was pre conditioned in 30 mL of hybridization solution containing 1.93 mL of sterile distilled water, 1.07 mL of 14% SDS, 3 mL of 100 X Denhardt's solution, 9 mL of 20 X SSC pH 7.0 and 15 mL of formamide, this solution was prepared in the dark and the membrane was incubated at 46
C for 4 h with stirring (60 rpm). Meanwhile, dsDNA was synthesized from a bulk of eight RNA's from each experimental condition and it was purified with the QIAquick™ (Qiagen) kit. Double stranded DNA was labeled with the Biotin Decalabel™ (Fermentas) kit following the manufacturer instructions to use it as a probe. Each probe was denatured in boiling water for 5 min. It was poured in the dark into 30 mL of freshly prepared hybridization solution, where the membrane was pre conditioned at 46
C for 18 h. Hybridized membrane was washed twice with 50 mL of 2 X SSC and 0.1% SDS, at room temperature for 10 min. Two astringent washes of 0.1 X SSC and 0.1% SDS were consequently applied at 60
C for 20 min. Detection was performed with the Biotin Chromogenic #K066™ (Fermentas) kit. With the obtain images, densitometric analysis were performed to evaluate expression levels using as reference the expression level of the ribosomal 26S housekeeping gene. Alignments were carried out from each fragment sequences with the Clustal X 1.8 software (Jeannmougin et al., 1998) to identify fragments corresponding to one same gene. 2.5. Homologous genes related to water-use efficiency mRNA sequences for different plant species of apx2 (Wilson et al., 2009), erecta (Xing et al., 2011), hardy (Karaba et al., 2007) and gtl1 (Yoo et al., 2010) genes (Previously related to WUE) were obtained from the GenBank database. Meanwhile, their respective homologous were identified in the annotated bean genome (obtained by the Genoma-CYTED project and available at

mazorka.langebio.cinvestav.mx/phaseolus) and their corresponding sequences obtained. From these elements, multiple alignments as well as similarity dendrograms with 1000 bootstrap iterations were performed. EST fragments which had higher similarity to the mRNA's for each gene were respectively selected.

Table 1 Designed primers for EST's identified by suppressive subtractive hybridization and homologous genes related to water-use efficiency. Origin

Description

P. vulgaris chloroplast P. vulgaris chloroplast P. vulgaris chloroplast P. vulgaris chloroplast P. vulgaris chloroplast P. vulgaris chloroplast P. vulgaris chloroplast P. vulgaris chloroplast

accD

Forward and reverses primers

F: CTTTGGTTCGGCAATAATGA R: GAGCTTGATGCAAATGGCTA clpP F: TGGAATCCTAATCAATCGACTTT R: ACCGCCCGGAGAGTTTAT ndhK F: CAGGCTCCCATAGCAATAACA R: AGGCGGACCTCATTTTAACC petB F: CGGGGTTTTGAGCATAAAGA R: CTTGGCTTGGACAGGACATT psaB F: CTGTGACCAATCCCGAAGTT R: CTCAAGGAGCAGGAACTGCTAT rp12 F: CGCACGAGTGGGTATATAGGA R: CCATGTGGAAGTAGCGACGTA atpA F: AGGCATTGCTTTGAATTTGG R: TGGTTTAGCCAGGGCATTTA rpoC2 F: ACACCAATTAGTAGGTATGAGAGGA R: GCAGTATCTACAACCCCTTTACG P. vulgaris rps19 F: TTGGTCCAGAGCATCTACCA chloroplast R: CGCATGTCCTCGGAAGTTTA P. vulgaris rrn16 F: CCCCAGGCGGGATACTTAACGC chloroplast R: GGGAATTTCCGGTGGAGCGGT P. vulgaris rrn23 F: GGACGGAGGAGGCTAGGTTA chloroplast R: GGCTCGAGGCATTTTCTCTA P. vulgaris ycf1 F: chloroplast TCCAGAACATGAACAAGTAAAAATG R: GTGTTATTTCGATTTCCTTTTGTTT P. vulgaris ycf2 F: TTTTGTGAAACAGCCCTTCC chloroplast R: GCACTTAACAATGAGGCCCTA P. vulgaris cp2 F: CCAGACGTTCGTCACTGTGA R: CAGCTTCGCACACAAACGAA V. unguiculata 5s F: CGGAGTTCTGATGGGATCCG R: AGTTATCGCGTTCGAGGTCC G. max LOC100795789 F: AACGCAGAATCAGCTGGTCA R: CTCCCGTACGCACCTATTCC P. coccineus g564 F: GCGGTTTTCCACTCATCACC R: GGCGCATGTGTTGTGATTGT P. vulgaris Clone T2-3 F: TTAAACCCATTTCGCTCCAC R: GGAGGAGGTTGGTGATTCAA P. vulgaris Clone T3-11 F: GCAATCTTGGTGTTGGTGTG R: CAGAACCCTGAGGAAATCCA P. vulgaris Clone T2-12 F: ACGAAATGTCGGATTTCAGC R: TCAGAGGAAATTTGGCAAGG P. vulgaris Clone T2-34 F: ACGGCATCACCCTATAGCAA R: CAAATGTCGTGCTGGTGAAG P. vulgaris Clone T3-6 F: TGTTGAAGAGCGCTGAGAGA R: CAAACCCCTCATCCATCACT Homologous genes P. vulgaris apx2 00009 F: CATACTGGCACAAGGTGCTG R: CGCATTATGACGTTGCTGTC P. vulgaris apx2 00361 F: TGGACCTGAGAAGCTCCTTG R: TCGAGTGGAGGATACGGAAC P. vulgaris erecta 00711 F: CCACTCCAAACTCCAGTGGT R: CTGAATGGCAAGTCAGTGGA P. vulgaris gtl1 00184 F: TTTCCTCTTGGATGCCTCTG R: TCTGCATTGCTCCAGTCAAC P. vulgaris gtl1 00279 F: GCTACATCCGGATTTGCTGT R: CCAGGCATTTCTGTTGAACC P. vulgaris hardy 00098 F: CCCAGTAAGCCATTTTCCAG R: GGTGTTGGAGATGGAAAGACA

Product Tm (bp) (
C) 154

59

156

59

112

60

152

60

160

60

150

61

163

60

150

58

154

60

218

59

103

60

126

59

173

60

133

60

131

60

250

60

178

60

114

60

123

60

247

60

258

60

190

60

289

60

103

60

139

60

129

60

129

60

123

60

J.E. Ruiz-Nieto et al. / Plant Physiology and Biochemistry 86 (2015) 166e173

2.6. Expression profiles of genes related to water-use efficiency and drought We evaluated through PCR amplification whether the WUE differences between cultivars were only due to the presence or absence of some identified genes in the genome of both cultivars. Primer pairs were designed using the Primer 3 Plus software (Table 1). Genomic DNA of eight plants of each cultivar was extracted (Doyle and Doyle, 1990) testing their integrity and purity by electrophoresis and UV light spectrophotometry respectively. The EST's were amplified by PCR under the conditions described above using 1 mL of genomic DNA (30 ng mL1) as template, and the products were subjected to electrophoresis. Meanwhile, the relation between expression levels and WUE of 28 genes identified through the subtractive library and through homology were studied. For this purpose expression profiles were generated by RT-PCR. Additionally, the similarity between responses to the experimental conditions where plants increased their WUE and drought was tested at transcriptome level evaluating the expression of 22 genes previously associated to drought and corresponding to the accessions housed at GenBank [GenBank accessions: AF350505, AY052627, DQ196430, DQ117557, AF402773, AY220096, CX129914, CX129903, CX129891, CX129794, CX129726, CX129713, CX129643, CK901535, CA913352, CA909576, CA847645, BU791113, BU791091, AF190462, U72764, and U76687]. Based on these sequences primers were designed. For expression profiles leaf tissue of both cultivars under water regimens of 20% and 60%, in the vegetative and reproductive phenological stages was used. ssDNA for each treatment was synthesized from a total RNA bulk of eight plants and its basal expression normalized based on the housekeeping expression of the ribosomal 26S gene. EST's were amplified by PCR and the products were analyzed by electrophoresis. Densitometric analyses were performed from the images, to quantitatively evaluate the expression levels. Of the 50 EST's evaluated (28 genes related to WUE and 22 drought genes), genes which expressed in response to limited water conditions (20%) were identified where plants increased their WUE based on their higher expression level with respect to optimal water regimen (60%). With these EST's, expression profiles under drought conditions were generated. Eight plants of both cultivars grown in greenhouse in the same substrate were kept under irrigation until the vegetative stage, when watering was suspended until plants presented the drought typical symptoms, such as sagging and wilt. On a second group of plants, under same number of repetitions, the irrigation was suspended in the reproductive stage. In each case the collect of leaf tissue was done under drought and irrigation. Expression profiles under drought were generated and evaluated as described earlier. 2.7. Evaluation of expression levels by qPCR To confirm the validity of the differential expressions observed in the profiles generated by RT-PCR and the complementary DNA (cDNA) arrays, expression levels of the ndhK, ycf1, erecta 00711, apx2 00009 genes and the T2-12 fragment were evaluated by qPCR. In such profiles, both cultivars were evaluated under contrasting water regimens (20% and 60%) in the vegetative and reproductive stages. These genes were selected because their primers fulfilled the technical requirements for their evaluation by qPCR, besides of represent 35.7% of the genes which turned out to be related to WUE. The assays were performed using SYBR Green (Thermo Scientific), the Step One Real-time PCR system platform (Applied Biosystems), ssDNA came from eight RNA's bulks from each experimental condition and the corresponding primer pairs. Their concentrations were selected from their evaluation in a range from 50 nM to 900 nM. Level of basal expression was normalized using

169

the 26S gene as a reference. 25 mL reactions were used by triplicate containing 12.5 mL of 2 X Maxima SYBR Green/ROX qPCR Master Mix, 1.5 mL at 300 nM of the corresponding primer pairs, 1 mL of 50 ng mL1 cDNA and 10 mL nuclease-free water. The reaction conditions were: 1 cycle at 95
C for 10 min, 30 cycles at 95
C for 15 s, 60
C for 30 s and 72
C during 30 s. To identify products melting curves were generated with the following conditions: 95
C for 15 s, 50
C during 1 min and 95
C for 15 s. PCR efficiency for each gene was evaluated using calibration curves from five serial dilutions (1:10) of cDNA with three repeats. Results were analyzed by the CT (threshold cycle) comparative method through the mathematical model proposed by Pfaffl (2001) and the REST 2009 v2.0.13 software using 2000 bootstrap iterations. 3. Results and discussion 3.1. Evaluation of water-use efficiency Plant development variables showed that water regimen of 20% was the most limited for plant growth, while 60% allowed them an optimal growth and better plant structure in both cycles (Supplemental Table 1). In the spring-summer cycle the combination or synergy between high temperatures (daily average maximum 38
C) and photoperiod (14 h light) limited seed production. In both cultivars biomass decreased as water availability was reduced. However, at water regimen of 20% the reduction in the accumulated biomass in PS and BM was 43.1% and 47.2% on average with respect to regimen of 60% where most biomass accumulation in each cultivar took place. An inflection curve in consumed water (WC) was observed, finding the maximum consumption at water regimen of 60% in both cultivars. Nonetheless PS consumed more water due to a limited seed production, leading photosynthates to the development of foliage which increased water requirements to maintain it. Therefore, in this cycle the best way to evaluate the WUE was by the ratio between total biomass and consumed water (TB/WC), where PS was more efficient mainly at water regimens of 20% and 40% in which water was less available (Table 2). In the autumnewinter cycle, with daily average maximum temperature of 31
C and photoperiod of 12 h light, as the plants longevity increased, reduction in the stomatal conductance and photosynthesis was observed, so the phenological stage of grater activity was the vegetative one. Both cultivars reduced their stomatal conductance (gs) as water availability was reduced. In PS, between water regimens of 20% and 40% in the vegetative stage, the reductions was of 0.08 mol H2O m2 s1, turning out this difference highly significant, while in the same comparison in BM the reduction only was of 0.03 mol H2O m2 s1. The trend to reduce stomatal conductance was expected since avoiding water loss is one of the main responses to water limitation (Rosales et al., 2012). However, increase of water restriction caused different response between cultivars. The most important response was observed in the trend to increase photosynthesis (A) as water availability decreased, however PS had higher photosynthetic rate, being this ability to assimilate CO2 under limited conditions directly correlated with WUE as well as biomass and seed production. Seed production decreased as water availability was reduced; PS under 20% water regimen produced 1.9 g of seed per plant which represented a reduction of 70.8% with respect to the production of 60% water regimen, being this treatment where PS produced more seed (6.5 g). In the case of BM, between the water regimens of 20% and 80%, the production was of 0.7 g and 5.0 g respectively, with a reduction of 86%. Differences in seed production turned out highly significant (p < 0.01) and showed that limitation in water availability had a higher effect in BM production. In this cycle BM consumed more water, mainly under water regimens of 60% and

170

J.E. Ruiz-Nieto et al. / Plant Physiology and Biochemistry 86 (2015) 166e173

Table 2 Water-use efficiency variable components evaluated in both cycles. Variable

Stage

PS20%

PS40%

PS60%

PS80%

BM20%

BM40%

BM60%

BM80%

CV

2

A

2

gs

V** R** M** V** R** M** I** I** I** I** V** R* M** V** R** M* V** R** M**

13.3a 8.8a 1.6c 0.10d 0.08b 0.01d 8.0e 1.8e 1.9e 1.10abc 9.5a 4.1ab 1.6a 9.2ab 7.8a 3.2a 133.9a 115.4abc 130.7a

13.0a 7.9a 2.4bc 0.18bc 0.06c 0.02c 12.6c 4.1cd 4.7bc 1.14ab 6.9bc 4.5a 1.0bc 5.9c 6.3ab 1.4b 74.7c 145.4a 113.6abc

11.1abc 6.0bc 4.9a 0.19b 0.03e 0.05a 16.2a 5.1bc 6.5a 1.32a 5.6cd 4.0ab 1.1bc 5.5c 5.8ab 1.6b 58.2cde 140.6ab 96.6bc

12.3ab 5.2c 4.3a 0.23a 0.04de 0.04b 14.4b 5.3ab 6.3a 1.19a 4.7cd 3.7ab 0.9c 6.4bc 5.2b 1.5b 53.2de 132.5ab 114.3abc

11.0abc 5.0c 2.2c 0.11d 0.04cd 0.02cd 7.2e 1.8e 0.7f 0.38e 8.5ab 3.7ab 1.3ab 10.9a 7.6a 3.5a 96.4b 112.3abc 90.6c

10.1bc 7.6ab 3.3b 0.14cd 0.07b 0.03b 9.7d 3.9d 3.0d 0.80cd 6.4bc 2.7b 1.0bc 7.1bc 5.3b 2.0b 73.5cd 105.3bc 105.3abc

10.0bc 5.8c 2.5bc 0.20ab 0.08b 0.02c 12.8bc 6.2a 4.1c 0.66de 6.3bc 3.5ab 1.3ab 6.7bc 4.6b 1.9b 50.0e 76.6cd 106.7abc

9.2c 5.3c 2.6c 0.18bc 0.10a 0.02c 12.2c 6.3a 5.0b 0.81cd 3.8d 2.7b 1.1bc 6.7bc 4.8b 1.8b 52.6de 56.1d 121.0ab

10.2 11.8 14.6 11.9 11.2 13.8 10.0 12.1 9.9 11.6 12.6 15.9 12.7 9.9 14.1 16.5 13.9 9.6 12.3

1

WC WC 2 PRO 2 PRO/WC 1 TB/WC 2

2

TB/WC

2

A/gs

Spring-Summer cycle (1), AutumneWinter cycle (2), Pinto Saltillo (PS), Bayo Madero (BM), water regimen (20%, 40%, 60%, 80%), vegetative stage (V), reproductive stage (R), maturity stage (M), integral evaluation (I), photosynthetic rate (A, mmol CO2 m2 s1), stomatal conductance (gs, mol H2O m2 s1), water consumed (WC, L), production per plant (PRO, g), integral WUE (PRO/WC, g L1), integral WUE (TB/WC, g L1), intrinsic WUE (A/gs, mmol CO2 mol H2O1). Coefficient of variation (CV). Values with the same letter inside average rows are statistically equal Tukey (p < 0.05), significant differences p < 0.05 (*), highly significant differences p < 0.01 (**).

80%, while under 20% and 40% regimens, water consumed was statistically similar between the two cultivars. Therefore, PS produced more grain than BM under these regimens without the need of increasing its water requirements, highlighting at the regimen of 20% where water was always less available, suggesting a more efficient use. In this cycle where conditions did not limit production PS kept less biomass at the end of its cycle but produced more seeds, while BM produced less seed but kept more biomass at the end of its cycle, suggesting that under water limited conditions PS is
llar-Ortiz et al., 2008). In able to produce more photosynthates (Cue the ratio of instant character (A/gs), a tendency to increase WUE as water availability in both cultivars was previously observed (Rosales et al., 2012). However, PS showed a higher WUE mainly because its ability to keep a high photosynthetic rate under limited conditions, considering that the A/gs ratio is less influenced by the environment when it is compared with other variables used to evaluate WUE (Medrano et al., 2007). With respect to the integral evaluation of WUE, in the PRO/WC ratio, highly significant differences (p < 0.01) were identified, where PS was more efficient in

Fig. 1. Variation in the levels expression of housekeeping genes.

each water regimen, particularly at 20% producing 1.10 g L1 while BM produced only 0.38 g L1 (Table 2). This data suggests that under limited water conditions production is not only reduced, it would also have a higher water cost to maintain a productive level. 3.2. Identification and expression profiles of EST fragments related to water-use efficiency Among evaluated housekeeping genes in order to use them as an expression reference, cyclophilin and 26S ribosomal gene had less variation in their expression levels among treatments, with variation coefficients of 24.7 and 22.8 respectively. However, the ribosomal origin of 26S allows obtaining enough PCR product with fewer cycles, thus avoiding variations in expression levels due to the over-cycling of the products. Therefore, this gene was selected as reference (Fig. 1). Ribosomal genes are a valuable alternative to quantify genes of interest (Nicot et al., 2005). From the generated EST's, 13 chloroplast genes from Phaseolus vulgaris were identified (Table 3). This turns out to be meaningful, due to chloroplasts are the main source of Reactive Oxygen Species (ROS) as a collateral damage under stress conditions. The expression of sod, apx and dar genes in chloroplast of mutant plants of N. tabacum allowed them to maintain a high photosynthetic rate under the applied experimental conditions (Lee et al., 2007). The expression of ndhK in Nicotiana tabacum has an antioxidant function in response to high temperatures (Wang et al., 2006). The expression of ycf1 in A. thaliana confers tolerance to stress by salinity and xenobiotic compounds (Koh et al., 2006), while in Brassica juncea, it improved heavy metal tolerance through oxidative stress management (Bhuiyan et al., 2011). Similarly, the transcript A6B3-b homologous to ycf2 was expressed in response to salinity stress in Gossypium arboreum (Shahid et al., 2012), suggesting that avoiding ROS accumulation is part of the response to the experimental conditions proposed here. In Table 3 we can observe that the cp2 gene from the nucleus of P. vulgaris, 5S of Vigna unguiculata, g564 of Phaseolus coccineus and the LOC100795789 fragment of Glycine max, were also identified. The five EST's T2-3, T2-12, T2-34, T3-6 and T3-11 [GenBank accession assigned: JZ715508, JZ715510, JZ715511, JZ715512 and JZ715509] whose function and identity are unknown were selected because they were expressed under limited

J.E. Ruiz-Nieto et al. / Plant Physiology and Biochemistry 86 (2015) 166e173 Table 3 Identified genes in GenBank database. Clone Length Element (bp) T2269 30

T2-6 274

T2210 10

T2-8 340

T5-4 209

T6217 12 T2214 20

T6207 23

T2219 31 T1-9 231

T6-5 207

T6219 16 T6202 19 T2-4 207

T5201 20

T2-1 497

T6276 14

accD

Description

Acetyl-CoA carboxylase beta subunit (P. vulgaris chloroplast). clpP ATP-dependent Clp protease proteolytic subunit (P. vulgaris chloroplast). ndhK NADH dehydrogenase subunit K (P. vulgaris chloroplast). petB Cytochrome b6 (P. vulgaris chloroplast). psaB Photosystem I P700 chlorophyll apoprotein A2 (P. vulgaris chloroplast). rpl2 Ribosomal protein L2 (P. vulgaris chloroplast). atpA ATP synthase CF1 alpha subunit (P. vulgaris chloroplast). rpoC2 Subunits of the PEP RNA polymerase catalytic core (P. vulgaris chloroplast). rps19 Ribosomal protein 19s (P. vulgaris chloroplast). rrn16 Ribosomal protein 16s (P. vulgaris chloroplast). rrn23 Ribosomal protein 23s (P. vulgaris chloroplast). ycf1 Hypothetic protein RF1 (P. vulgaris chloroplast). ycf2 Hypothetic protein RF2 (P. vulgaris chloroplast). cp2 Similar to cysteine proteinase (P. vulgaris) 5S 5S ribosomal protein (V. unguiculata chloroplast) LOC100795789 Probable LRR receptor-like serine/ threonine-protein kinase At4g08850like (G. max). g564 Similar to Suspensor-specific protein (P. coccineus).

E Max GenBank value ident accession 1e140

100% 1JZ715496

2e141

99% 1JZ715497

9e108

100% 1JZ715498

4e178

100% 1JZ715499

4e107

100% 1JZ715500

1e111

100%

171

two for gtl1 transcription factor in scaffolds 00184 and 00279, and one for hardy gen in scaffold 00098. PCR analysis of the 28 EST's showed that they are present in the genome of both cultivars; therefore, differences in WUE between cultivars are due to the transcription and translation regulation. In expression profiles generated by RT-PCR under limited water conditions where plants increased their WUE, the ndhK, ycf2, rps19 genes and T2-2 EST had expression patterns related to WUE in both cultivars, suggesting they are essential to efficient water management. According to our evaluations rpoC2, rrn16, ycf1, cp2, g564 genes and T2-12, T2-34 and T3-6 EST's resulted to be related to WUE in PS at least in one of the phenological stages; while petB, atpA, 5s, LOC100795789 genes and T3-11 EST were related to WUE in BM. The homologous to erecta and apx2 genes from scaffolds 00711 and 00009 were associated to WUE in PS in the reproductive stage, while hardy gene of scaffold 00098 was expressed differentially in the vegetative stage. In BM, only the apx2 gene from scaffold 00009 was expressed in response to water limitation in this stage. 3.3. Drought genes and expression profiles

2a

EU196765.1

3e108

99% 1JZ715501

4e106

100% 1JZ715502

5e106

98%

2b

2e119

100%

2c

1e85

100%

2d

1e112

100% 1JZ715503

EU196765.1

EU196765.1

EU196765.1

1

3e103

100% JZ715504

6e70

90% 1JZ715505

1e33

99% 2M18861.1

1e47

82% 1JZ715506

1e124

96% 1JZ715507

(1) Accession assigned by GenBank, (2) like an accession previously housed at GenBank. Complements: (a) 80302e81450, (b) 80705e80486, (c) 97773e98003, (d) 102505e102636.

conditions in the vegetative and/or reproductive stage. With respect to the homologous genes identified in the bean genome, two EST fragments for apx2 gene located in scaffolds 00009 and 00361 were selected. One of them for erecta gene in scaffold 00711,

Of the 22 genes of drought response, LR0064 EST [GenBank accession: CK901535] presented higher expression level in PS in the vegetative stage under water regimen of 20%. The b-zip transcription factor [GenBank accession: AF350505] was expressed differentially in PS and BM in the reproductive and vegetative stages respectively. The expression of b-zip improved the photosynthetic ability and increased WUE in A. thaliana mutants subjected to water stress (Zhang et al., 2008). Six more genes had a higher expression level at water regimen of 60%, while the remaining 14 genes were not expressed (Table 4). The ndhK, rpoC2, rps19, rrn16, ycf1, ycf2, bzip, apx2 00009, erecta 00711, hardy 00098, T2-3, T2-12, T3-6 and LR0064 genes were evaluated in plants subjected to drought. These genes were selected since they showed evident expression related to WUE in PS. The apx2 (scaffold 00009) gene was expressed in response to drought in the vegetative and reproductive stages, while in BM was only expressed in the first stage. It is known that Table 4 Densitometric analyzes (ng) of expression profiles generated under conditions related to water-use efficiency. Element

a

b

c

d

e

f

g

h

bzip Clone LR0064 ndhK petB atpA rpoC2 rps19 rrn16 ycf1 ycf2 cp2 5s LOC100795789 g564 Clone T2-3 Clone T3-11 Clone T2-12 Clone T2-34 Clone T3-6 apx2 00009 erecta 00711 hardy 00098

e 175 135 147 182 199 221 367 172 169 163 746 170 849 183 787 321 259 977 207 95 205

320 88 112 179 239 177 189 211 159 228 197 767 186 681 143 1088 187 350 1119 191 96 163

180 68 182 161 282 294 264 92 197 203 218 724 e 685 190 166 e 292 701 174 88 187

48 72 131 170 281 216 194 220 106 173 100 721 60 505 158 503 e 177 548 130 14 187

77 132 216 254 363 301 369 81 110 240 130 668 116 581 224 1103 e 318 960 181 79 97

34 129 164 214 375 309 334 135 113 210 128 619 e 684 167 756 e 310 951 132 68 99

97 117 154 184 417 243 372 75 128 229 113 593 e 721 206 208 e 317 1028 15 70 206

237 201 147 211 308 274 352 79 126 246 110 484 e 720 183 468 e 337 1029 213 74 204

(a) PS20%V, (b) PS60%V, (c) PS20%R, (d) PS60%R, (e) BM20%V, (f) BM60%V, (g) BM20% R, (9) BM60%R, (PS) Pinto Saltillo, (BM) Bayo Madero. Limited water regimen (20%), optimal water regimen (60%), vegetative stage (V), reproductive stage (R), without expression ().

172

J.E. Ruiz-Nieto et al. / Plant Physiology and Biochemistry 86 (2015) 166e173

Table 5 Densitometric analyzes (ng) of expression profiles under drought conditions. Element

a

b

c

d

e

f

g

h

ndhK rpoC2 rps19 rrn16 ycf1 ycf2 apx2 00009 erecta 00711 hardy 00098 Clone T2-3 Clone T2-12 Clone T3-6 bBzip Clone LR0064

242 214 268 239 199 167 259 e e e e 262 159 214

278 274 284 282 234 247 135 e e 136 e 263 160 114

244 e 180 205 201 197 195 e e 132 e 239 161 316

305 e 224 215 256 228 94 22 130 154 e 335 195 336

325 373 285 211 344 247 341 e 117 196 e 195 165 358

297 371 260 245 320 276 279 e 102 137 e 277 155 305

143 e 100 201 96 243 208 e e 134 e 253 172 195

167 e 35 185 75 237 212 e e 132 e 290 159 289

(a) PS under drought in vegetative stage, (b) PS under irrigation in vegetative stage, (c) PS under drought in reproductive stage, (d) PS under irrigation in reproductive stage, (e) BM under drought in vegetative stage, (f) BM under irrigation in vegetative stage, (g) BM under drought in reproductive stage, (h) BM under irrigation in reproductive stage, () without expression.

apx2 plays an essential role in the ROS detoxification (Navrot et al., 2011). Results showed that apx2 expression is related to both WUE increase and drought. Similarly, LR0064 EST was expressed in response to drought in both cultivars, although only in the vegetative stage. In PS the remaining 12 EST's either had higher expression levels under irrigation or it did not express at all. Therefore such EST's were differentially expressed only in response to the limited water conditions (20%), where plants increased their WUE (Table 5).

respect to its optimal condition (60%) was confirmed, and also the absence of its product in all other experimental conditions was corroborated, exactly as it was observed by RT-PCR. The above indicates that although the identity of this EST is unknown, it plays an important biological function in increasing the WUE under water regimen of 20%. Similarly, differential expression of ndhK, ycf1, erecta 00711 and apx2 00009 genes in PS at reproductive stage was confirmed. Whereas in BM, corresponding expressions of ndhk and apx2 00009 in the same stage were confirmed (Fig. 2). Results of the described experiments indicated that the best expression marker for WUE were ndhK, rpoC2, rps19, rrn16, ycf1, ycf2, cp2, g564, erecta 00711, hardy 00098, b-zip, T2-3, T2-12 and LR0064 genes. 4. Conclusions We conclude that the Pinto Saltillo cultivar makes a more efficient use of water both instantly and integrally than Bayo Madero, due to its ability to keep a high photosynthesis rate and CO2 assimilation. This explains its ability to produce more seeds with less water under limited conditions. The suppressive subtractive isolation of EST's from chloroplast genes, as well as their differential expression, and the experimental physiological observations confirm this asseveration. Differential expression and biological function of genes related to water-use efficiency suggests that avoiding ROS accumulation, the ability to translocate nutrients, the morphological and physiological plasticity were essential to improve water-use efficiency. The lack expression of drought genes under water regimen of 20% indicates that a different genetic base exists at a transcriptome level between response to drought and water-use efficiency.

3.4. Validation of expression profiles by qPCR Contributions Results of real time PCR confirmed the observed differential expressions using other techniques. For example, the expression induced of T2-12 EST in PS in the vegetative stage under 20% with

Jorge E. Ruiz Nieto: he is student of the Ph.D. program on Agroalimentary Production who participated in the purpose of this

Fig. 2. Expression profiles by real-time PCR of ndhK, ycf1, erecta, apx2 genes and clone T2-12.

J.E. Ruiz-Nieto et al. / Plant Physiology and Biochemistry 86 (2015) 166e173

project and executed it as his thesis; also he is the main writer of this researching article.
sar L. Aguirre Mancilla: He is the internal thesis director who Ce assisted on the molecular techniques based on his experience, also worked as one of the main editor of the present article and provided institute resources for the develop of this study. Jorge A. Acosta-Gallegos: He is the specialist bean breeder who provided the plant material and coordinated the project base on their previously knowledge on the used cultivars, also worked as editor this article.
rez: He is an internal thesis assessor who also Juan C. Raya Pe assisted in the implementation of molecular techniques used to develop this work.
zquez Medrano: They are Elías Piedra Ibarra and Josefina Va specialized researcher on plants physiology who purposed the variables to evaluate the instant water-use efficiency; also they provided the required equipment to measure such physiological variables. Both participated revising this article before its submission. Victor Montero Tavera: He is the leader of this water-use efficiency project and also the external thesis director, he has provided most of the needed resources for the executing of such project, purposed the experimental conditions and assisted on the molecular approach of the aims established, base on his experience in the area. He is also one of the main reviewers of this manuscript. Acknowledgments This research was supported by INIFAP-SAGARPA 1225619346 project. Appendix A. Supplementary data Supplementary data related to this article can be found at http:// dx.doi.org/10.1016/j.plaphy.2014.11.020. References Ahuja, I., De Vos, R.C., Bones, A.M., Hall, R.D., 2010. Plant molecular stress responses face climate change. Trends Plant Sci. 15, 664e674. Bhuiyan, M.S.U., Min, S.R., Jeong, W.J., Sultana, S., Choi, K.S., Song, W.Y., Lee, Y., Lim, Y.P., Liu, J.R., 2011. Overexpression of a yeast cadmium factor 1 (YCF1) enhances heavy metal tolerance and accumulation in Brassica juncea. Plant Cell Tissue Organ Cult. 105, 85e91. Birnboim, H.C., Doly, J., 1979. A rapid alkaline extraction procedure for screening recombinant plasmid DNA. Nucleic Acids Res. 7, 1513e1523. Boutraa, T., 2010. Improvement of water use efficiency in irrigated agriculture: a Review. J. Agron. 9, 1e8.
llar-Ortiz, S.M., Arrieta-Montiel, M.P., Acosta-Gallegos, J., Covarrubias, A.A., Cue 2008. Relationship between carbohydrate partioning and drought resistance in common bean. Plant Cell Environ. 31, 1399e1409. de Fraiture, C., Wichelns, D., 2010. Satisfying future water demands for agriculture. Agric. Water Manag. 97, 502e511.

173

Doyle, J.J., Doyle, J.L., 1990. A rapid total DNA preparation procedure for fresh plant tissue. Focus 12, 13e15. Jeannmougin, F., Thompson, J.D., Gouy, M., Higgins, D.G., Gibson, T.J., 1998. Multiple sequence alignment with Clustal X. Trends Biochem. Sci. 23, 403e405. Karaba, A., Dixit, S., Greco, R., Aharoni, A., Trijatmiko, K., Marsch, N., Krishnan, A., Nataraja, K., Udayakumar, M., Pereira, A., 2007. Improvement of water use efficiency in rice by expression of HARDY, an Arabidopsis drought and salt tolerance gene. PNAS 104, 15270e15275. Koh, E.J., Song, W.Y., Lee, Y., Kim, K.H., Kim, K., Chung, N., Lee, K.W., Hong, S.W., Lee, H., 2006. Expression of yeast cadmium factor 1 (YCF1) confers salt tolerance to Arabidopsis thaliana. Plant Sci. 170, 534e541. Lee, Y.P., Kim, S.H., Bang, J.W., Lee, H.S., Kwak, S.S., Kwon, S.Y., 2007. Enhanced tolerance to oxidative stress in transgenic tobacco plants expressing three antioxidant enzymes in chloroplasts. Plant Cell Rep. 26, 591e598. Logemann, J., Schell, J., Willmitzer, L., 1987. Improved method for the isolation of RNA from plant tissues. Anal. Biochem. 163, 16e20.
, M., Gulías, J., 2007. Eficiencia en Medrano, H., Bota, J., Cifre, J., Flexas, J., Ribas-Carbo el uso del agua por las plantas. Investig. Geogr. 43, 63e84. Mittler, R., Blumwald, E., 2010. Genetic engineering for modern agriculture: challenges and perspectives. Annu. Rev. Plant Biol. 61, 443e462. Molden, D., Oweis, T., Steduto, P., Bindraban, P., Hanjra, M.A., Kijne, J., 2010. Improving agricultural water productivity: between optimism and caution. Agric. Water Manag. 97, 528e535. €gglund, P., 2011. Plant redox proteomics. Navrot, N., Finnie, C., Svensson, B., Ha J. Proteomics 74, 1450e1462. Nicot, N., Hausman, J.F., Hoffmann, L., Evers, D., 2005. Housekeeping gene selection for real-time RT-PCR normalization in potato during biotic and abiotic stress. J. Exp. Bot. 56, 2907e2914. Pfaffl, M.W., 2001. A new mathematical model for relative quantification in realtime RT-PCR. Nucleic Acids Res. 29, 45. Pittermann, J., 2010. The evolution of water transport in plants: an integrated approach. Geobiology 8, 112e139. Recchia, G.H., Caldas, D.G.G., Beraldo, A.L.A., da Silva, M.J., Tsai, S.M., 2013. Transcriptional analysis of drought-induced genes in the roots of a tolerant genotype of the common bean (Phaseolus vulgaris L.). Int. J. Mol. Sci. 14, 7155e7179. Rosales, M.A., Ocampo, E., Rodríguez-Valentín, R., Olvera-Carrillo, Y., AcostaGallegos, J., Covarrubias, A.A., 2012. Physiological analysis of common bean (Phaseolus vulgaris L.) cultivars uncovers characteristics related to terminal drought resistance. Plant Physiol. Biochem. 56, 24e34. Sambrook, J., Fritsch, E.F., Maniatis, T., 1989. Molecular Cloning. Cold Spring Harbor Laboratory Press, New York, pp. 14e19. Shahid, M.N., Jamal, A., Rashid, B., Aftab, B., Husnain, T., 2012. Identification and isolation of salt-stress-responsive transcripts from Gossypium arboreum L. Turk. J. Biol. 36, 746e756. Wang, P., Duan, W., Takabayashi, A., Endo, T., Shikanai, T., Ye, J.Y., Mi, H., 2006. Chloroplastic NAD(P)H dehydrogenase in tobacco leaves functions in alleviation of oxidative damage caused by temperature stress. Plant Physiol. 141, 465e474. Wilson, P.B., Estavillo, G.M., Field, K.J., Pornsiriwong, W., Carroll, A.J., Howell, K.A., Woo, N.S., Lake, J.A., Smith, S.M., Millar, A.H., Caemmerer, S.V., Pogson, B.J., 2009. The nucleotidase/phosphatase SAL1 is a negative regulator of drought tolerance in Arabidopsis. Plant J. 58, 299e317. Xing, H.T., Guo, P., Xia, X.L., Yin, W.L., 2011. PdERECTA, a leucine-rich repeat receptor-like kinase of poplar, confers enhanced water use efficiency in Arabidopsis. Planta 234, 229e241. Yoo, C.Y., Pence, H.E., Hasegawa, P.M., Mickelbart, M.V., 2009. Regulation of transpiration to improve crop water use. Crit. Rev. Plant Sci. 28, 410e431. Yoo, C., Pence, H., Jin, J., Miura, K., Gosney, M., Hasegawa, P., Mickelbart, M., 2010. The Arabidobsis GTL1 transcription factor regulates water use efficiency and drought tolerante by modulating stomatal density via transrepression of SDD1. Plant Cell 22, 4128e4141. Zhang, X., Wollenweber, B., Jiang, D., Liu, F., Zhao, J., 2008. Water deficits and heat shock effects on photosynthesis of a transgenic Arabidopsis thaliana constitutively expressing ABP9, a bZIP transcription factor. J. Exp. Bot. 59, 839e848.