PHYL Acts to Down-Regulate TTK88, a Transcriptional Repressor of Neuronal Cell Fates, by a SINA-Dependent Mechanism

Cell, Vol. 90, 459–467, August 8, 1997, Copyright 1997 by Cell Press

PHYL Acts to Down-Regulate TTK88, a Transcriptional Repressor of Neuronal Cell Fates, by a SINA-Dependent Mechanism Amy H. Tang, Thomas P. Neufeld,* Elaine Kwan, and Gerald M. Rubin Howard Hughes Medical Institute Department of Molecular and Cell Biology University of California, Berkeley Berkeley, California 94720-3200

Summary We show that Tramtrack (TTK88) expression represses neuronal fate determination in the developing Drosophila eye. Phyllopod (PHYL) acts to antagonize this repression by a mechanism that requires Seven In Absentia (SINA) and is associated with decreased TTK88 protein levels, but not reduced ttk88 gene transcription or mRNA stability. We present evidence that SINA, PHYL, and TTK88 physically interact and that SINA interacts genetically and physically with UBCD1, a component of the ubiquitin-dependent protein degradation pathway. Our results suggest a model in which activation of the Sevenless receptor tyrosine kinase induces PHYL expression, which then acts with SINA to target the transcriptional repressor TTK88 for degradation, thereby promoting R7 cell fate specification. Introduction Many receptor tyrosine kinases (RTKs) employ the RAS/ MAPK signaling cascade to execute specific developmental programs required for cell differentiation and proliferation (for reviews, see van der Geer et al., 1994; Marshall, 1995). It is not well understood how the output of such a general signaling cascade is interpreted to elicit highly specific developmental effects in different cell types. Gaining this understanding will require the identification of downstream components in a number of cell types and the determination of how their expression and activity are modified in response to RTK signaling. The response to activation of the Sevenless RTK during development of the Drosophila eye has been studied extensively in an attempt to identify such downstream components (reviewed in Dickson and Hafen, 1993; Zipursky and Rubin, 1994; Wassarman et al., 1995). The adult eye is an array of 800 ommatidia, each comprised of eight photoreceptor cells designated R1–R8, four lens-secreting cone cells, and eight accessory cells. During the third larval instar the photoreceptor cells are recruited sequentially through a series of local inductive events (reviewed in Wolff and Ready, 1993). The Sevenless RTK, acting through the RAS1/MAPK signaling cascade, mediates one of these inductive events by triggering neuronal development in the R7 precursor (reviewed in Zipursky and Rubin, 1994). In the absence *Present Address: Fred Hutchinson Cancer Research Center, Division of Basic Sciences B2-152, 1124 Columbia Street, Seattle, Washington 98104.

of this signal, the presumptive R7 cell differentiates instead as a nonneuronal cone cell. Neuronal differentiation of the other photoreceptors also requires the RAS1/ MAPK signaling cascade, although the precise sequence of events has been less extensively characterized then for the R7 cell. Several nuclear components that act downstream of MAPK in the presumptive R7 cell have been identified (reviewed in Dickson, 1995). Two transcriptional activators, POINTED and JUN, and one repressor, YAN, are known to have their activities modified by direct MAPK phosphorylation (O’Neill et al., 1994; Rebay and Rubin, 1995; Treier et al., 1995). Three other nuclear components of the pathway have been identified—PHYL, SINA, and TTK88 (Carthew and Rubin, 1990; Xiong and Montell, 1993; Chang et al., 1995; Dickson et al., 1995). The phyl gene encodes a nuclear protein (PHYL) that is required for R1, R6, and R7 cell fate determination, as well as for proper development of the embryonic PNS (Chang et al., 1995; Dickson et al., 1995). Ectopic expression of PHYL during eye development can recruit the cone cell precursors to an R7-cell fate and induce expression of a neuronal marker in the pigment cells. Transcription of the phyl gene is up-regulated by RAS1/ MAPK signaling during photoreceptor determination, suggesting that phyl is one of the earliest trancriptional targets of this signaling pathway (Chang et al., 1995; Dickson et al., 1995). PHYL contains no protein domains of known function and its biochemical mechanism of action remains unknown. The sina gene encodes a ring finger–containing nuclear protein (SINA) that is required for R7 cell fate specification, as well as for the proper development of other sensory structures (Carthew and Rubin, 1990). While ring-finger domains are thought to mediate protein– protein interactions (Saurin et al., 1996), the biochemical function of SINA is unknown. SINA has mammalian counterparts that are greater than 80% identical in amino acid sequence, and both human and mouse sina genes have been shown to be induced during apoptosis (Della et al., 1993; Amson et al., 1996; Nemani et al., 1996). The tramtrack (ttk) gene encodes two alternatively spliced zinc-finger transcription factors first identified by their ability to repress transcription of segmentation genes during embryogenesis (Harrison and Travers, 1990; Brown et al., 1991; Read and Manley, 1992; Read et al., 1992; Brown and Wu, 1993). The role of the ttk gene in cell fate determination has been most closely examined in the developing eye and PNS. In both cases, TTK acts to repress specific neuronal fates (Xiong and Montell, 1993; Guo et al., 1995, 1996; Lai et al., 1996). In the eye, loss of function of the 88 kDa gene product (TTK88) results in supernumerary R7 cell formation (Xiong and Montell, 1993). However, the mechanisms by which TTK expression and activity are regulated remain unknown. Genetic experiments indicate that PHYL, SINA, and TTK88 are the most downstream-known components of the signaling pathway that specifies the R7 cell fate.

Cell 460

Mutation of sina blocks the ability of activated RAS1 (Fortini et al., 1992), activated MAPK (Brunner et al., 1994), ectopically expressed PHYL (Chang et al., 1995; Dickson et al., 1995), or loss of the repressor YAN (Lai and Rubin, 1992) to induce R7 cell formation. Indeed, the only known case where R7 cells can be formed in a sina mutant background is when TTK88 has also been mutationally inactivated (Lai et al., 1996; Yamamoto et al., 1996), indicating that TTK acts downstream of SINA or in a parallel pathway. In this report, we investigate the functional relationship among the SINA, PHYL, and TTK88 proteins. We show that induction of PHYL expression leads to downregulation of TTK88 by a mechanism that requires SINA. We present evidence that these three proteins physically interact with each other and that SINA genetically and physically interacts with UBCD1, a component of the ubiquitin-dependent protein degradation pathway. Our data reveal biochemical functions for the SINA and PHYL proteins and support a model for a novel mechanism of signaling by the RAS1/MAPK cascade—transcriptional induction of a protein that then targets a specific transcriptional repressor for degradation. Results Expression of TTK88 Blocks Photoreceptor Determination During eye development, TTK88 is expressed only in undifferentiated and nonneuronal cells (Lai et al., 1996). To determine if the presence of TTK88 is sufficient to repress neuronal development, we expressed TTK88 under the control of the Sevenless enhancer (sev-ttk88) that drives high level expression in the R3, R4, and R7 photoreceptor precursors and the four cone cell precursors (Basler et al., 1989; Bowtell et al., 1989; Dickson et al., 1992). The resultant transgenic flies have moderately rough eyes (Figure 1B) with approximately three missing photoreceptor cells per ommatidium (Figure 1D). Staining of third instar eye imaginal discs for the ELAV protein, a marker of neuronal differentiation, revealed that photoreceptors R3 and R4 fail to stain in the five-cell precluster (Figure 1F), indicating that ectopic TTK88 expression blocks the neuronal differentiation of these cells. To determine if TTK88 expression is sufficient to repress all photoreceptor cell fates, we expressed TTK88 under the control of multimerized glass response elements, the Glass Multimer Reporter (GMR), which drives expression in all cells in and posterior to the morphogenetic furrow in the developing eye (Hay et al., 1994). Flies carrying the GMR-ttk88 transgene had rough eyes; the strength of the phenotype varied between different transgenic lines, but was uniform within an individual line (Figure 2A and data not shown). Sections of adult retinae revealed that even the moderately rough GMRttk88 transgenic lines were devoid of photoreceptors (Figure 2K). Third instar eye imaginal discs from strong lines exhibited reduced ELAV staining and increased cell death (data not shown). Expression of PHYL Counteracts the Effects of TTK88 Expression The observation that TTK88 is present in both undifferentiated precursor cells and differentiating nonneuronal

Figure 1. Ectopic Expression of TTK88 Blocks Neuronal Development Scanning electron micrographs (A and B) of adult eyes, apical sections through adult retinae (C and D), and third instar eye imaginal discs stained for the neuronal marker ELAV (E and F) are shown: (A), (C), and (E), wild type; (B), (D), and (F), sev-ttk88/sev-ttk88 flies. The sev-ttk88 transgene causes a mild rough eye phenotype with ommatidia missing approximately three photoreceptors. Insets in (E) and (F) show enlargements of single developing ommatidia at the five-cell precluster stage. Numbers identify photoreceptors. In wild type ([E] and inset), the nuclei of R8, R2, R5, R3, and R4 are stained, as indicated. In (F) and inset, expression of TTK88 in the developing R3 and R4 cells from the sev-ttk88 transgene blocks their neural development and they remain ELAV-negative.

cells but is absent from the presumptive photoreceptors (Lai et al., 1996) suggests that TTK88 is down-regulated in cells upon their commitment to a neuronal fate, perhaps as a primary response to the activation of the RAS1/MAPK pathway. Activation of the RAS1/MAPK pathway has been shown to induce the rapid transcription of phyl (Chang et al., 1995; Dickson et al., 1995), prompting us to ask if PHYL plays a direct role in TTK88 down-regulation. If so, then ectopic expression of PHYL might be able to suppress the effects of ectopic TTK88 expression. Indeed, we found that while flies carrying either the GMR-ttk88 (Figure 2A) or GMR-phyl transgene (Figure 2C; Chang et al., 1995) alone had rough eyes, flies carrying both transgenes had nearly wild-type eyes (Figure 2B). Within the retina of these transheterozygous flies, most of the ommatidia had a close to normal complement of photoreceptors, in contrast to the severe

PHYL and SINA Down-Regulate TTK88 461

Figure 2. Mutual Suppression of the GMR-ttk88 and GMR-phyl Rough Eye Phenotypes (A)–(J) show scanning electron micrographs of adult eyes. Each genotype is shown at two magnifications. (K)–(O) show sections of adult retinae. (A), (F), and (K), GMR-ttk88 /1; (B), (G), and (L), GMR-ttk88/GMR-phyl; (C), (H), and (M), GMR-phyl/1; (D), (I), and (N), GMR-ttk88, sina3/ GMR-phyl, sina2 ; (E), (J), and (O), GMR-phyl, sina3/GMR-phyl, sina2.

defects observed in either parental line (compare Figure 2L with Figures 2K and 2M). Similar results were obtained with the sev-ttk88 and sev-phyl transgenes, where flies carrying both transgenes had phenotypically wild-type eyes as compared to those carrying either transgene alone (data not shown). These results show that PHYL and TTK88 act antagonistically. The results of decreasing the level of endogenous ttk or phyl expression on the phenotypes produced by the transgenes support this conclusion. The phyl mutation dominantly enhances the sev-ttk88 phenotype; likewise, in a ttk 1/1 genetic background the sev-phyl phenotype is weakly enhanced (data not shown). PHYL Requires SINA to Suppress the Effects of TTK88 Expression The ability of ectopic expression of PHYL from the sevphyl transgene to recruit the cone cell precursors to an R7-cell fate requires the presence of SINA (Chang et al., 1995; Dickson et al., 1995). Likewise, the multiple eye defects observed in GMR-phyl transgenic flies are completely suppressed in a sina2 /sina3 mutant background; the eyes are normal, except that the R7 cells are missing due to the absence of SINA function (Figures 2E and 2O). To test if SINA was also required for PHYL to counteract the effects of TTK88 expression, we generated GMR-ttk88/GMR-phyl transheterozygotes in a sina2 / sina3 background. The adult eyes of these transheterozygotes are highly disrupted (Figures 2D and 2N), similar to those of flies carrying the GMR-ttk88 transgene alone,

indicating that PHYL requires SINA to suppress the effects of TTK88 expression. TTK88 Protein Level Is Down-Regulated Posttranscriptionally by SINA and PHYL Two distinct molecular mechanisms could account for the suppression of the TTK88 overexpression phenotype by SINA and PHYL. SINA and PHYL might block the synthesis or decrease the stability of the TTK88 protein. Alternatively, SINA and PHYL might block the action of TTK88 protein or that of a downstream component whose expression is induced by TTK88. To distinguish between these alternatives, we examined TTK88 protein expression in third instar eye imaginal discs of different genotypes. We also monitored neuronal differentiation using an antibody against the neuron-specific protein ELAV. In the sev-ttk88 imaginal discs, strong TTK88 expression was observed in the nuclei of the presumptive R3 and R4 cells at the five-cell precluster stage (Figures 3A and 3B); we conducted our analysis at this early stage, since the disruption caused by ectopic TTK88 expression limits our ability to identify individual cell types at later stages of retinal development. In wildtype imaginal discs at this stage, ELAV is detected in R8, R2, R5, R3, and R4 (Figure 1E); however, in sevttk88 imaginal discs, the nuclei of R3 and R4 showed no ELAV staining (Figures 1F, 3A, and 3B), indicating an early block in their neuronal differentiation. In sev-ttk88/ sev-phyl discs, TTK88 staining is no longer observed in R3 and R4, and ELAV is restored in all cells of the fivecell precluster (Figure 3C). This result suggests that

Cell 462

Figure 3. SINA-Dependent and PHYL-Mediated TTK88 Degradation (A–C) Discs double-labeled with anti-ELAV (Texas red–conjugated secondary, red) and anti-TTK88 (FITC-conjugated secondary, green). (A) and (B) show portions of a disc from a third instar larva that carries the sevttk88 transgene. (A) shows two developing ommatidia at the five-cell precluster stage. ELAV staining is absent in the developing R3 and R4 cells that express TTK88. (C) shows a portion of a disc from a sev-ttk88/sev-phyl larva. Note the disappearance of TTK88 staining and the reappearance of ELAV staining. (D–F) Regions posterior to the morphogenic furrow of discs stained for TTK88 are shown: (D), GMR-ttk88/1; (E), GMR-ttk88/GMR-phyl; (F), GMR-ttk88, sina3 /GMR-phyl, sina2. (G–I) (G) and (H) show discs labeled by in situ hybridization with a ttk88 C-terminal specific cDNA probe: (G), GMR-ttk88/1; (H), GMRttk88/GMR-phyl. (I) shows a GMR-ttk88/GMRphyl disc labeled by in situ hybridization with a phyl cDNA probe, as a control for the experiment shown in (H). The anterior of all the discs is down and posterior is up. The arrows in (G)–(I) indicate the position of the morphogenetic furrow.

PHYL acts by down-regulating TTK88 protein levels, rather than by counteracting the action of TTK88. This observation was confirmed using the GMR-ttk88 lines. In GMR-ttk88 imaginal discs, TTK88 staining was observed in the nuclei of most cells posterior to the morphogenetic furrow (Figure 3D), and ELAV was decreased in TTK88-expressing cells (data not shown). However, in discs from GMR-ttk88/GMR-phyl transheterozygotes, TTK88 staining was reduced to background levels (Figure 3E), and the ELAV staining pattern appeared wildtype (data not shown). Consistent with the analysis of adult phenotypes, SINA was required for this downregulation of TTK88 levels. In GMR-ttk88, sina2/GMRphyl, sina3 discs, TTK88 was expressed at high levels (Figure 3F). Several lines of evidence indicate that the observed down-regulation of TTK88 protein levels occurs by decreasing the half-life of TTK88 protein. First, in contrast to the TTK88 protein levels, the steady-state level of ttk transcripts in lines carrying the GMR-ttk88 transgene is unaffected by the presence of SINA and PHYL (Figures 3G and 3H), indicating that the decrease in TTK88 protein levels is not caused by decreasing ttk mRNA stability. Second, the expression of b-gal pattern from an enhancer-trap insertion in the ttk gene (Lai et al. 1996) remains unchanged in the sev-phyl background, suggesting that the decrease in TTK88 protein levels is not caused by decreasing ttk transcription (data not shown). Finally, we were also able to reproduce the effects of SINA and PHYL on TTK88 protein levels in Drosophila S2 cells that were transiently transfected with constructs expressing epitope-tagged versions of these three proteins from an inducible metallothionein promoter (Bunch et al., 1988). The subcellular localization of PHYL and TTK88 was exclusively nuclear, while SINA had a predominant nuclear localization with some cytoplasmic

staining (data not shown). We compared TTK88 protein levels in cells that had been transfected with constructs expressing TTK88 in combination with PHYL, SINA or both proteins at 3 hr and 22 hr after induction (Figure 4). In cells expressing TTK88 and PHYL or TTK88 and SINA, there was an approximately 2-fold reduction in TTK88 staining cells when the 3 hr and 22 hr time points were compared. In contrast to these modest decreases, cells expressing TTK88 together with both SINA and PHYL showed a 15-fold reduction in the number of TTK88-expressing cells. SINA, PHYL, and TTK88 Physically Interact The data we have presented show that coexpression of SINA and PHYL can lead to the down-regulation of TTK88 without obvious effects on ttk gene transcription or mRNA stability. These observations suggest that TTK88 down-regulation occurs at the level of protein stability and led us to ask whether SINA, PHYL, and TTK88 physically interact. Using yeast two-hybrid assays, we found that SINA and PHYL interact strongly, as has been reported previously by Kauffmann et al. (1996) (Figures 5A and 5B). In addition, we found that PHYL interacts strongly with the TTK88, but not with TTK69. SINA and TTK88 showed a weak interaction. In vitro protein binding assays using immobilized GSTfusion and 35S-labeled in vitro-translated proteins confirmed that 35S-labeled PHYL binds strongly to both the full-length SINA and TTK88 (data not shown). Using stably transfected S2 cell lines, we then asked whether physical association between native full-length PHYL and TTK88 could be detected in cultured Drosophila cells. S2 cells stably expressing either Polyomatagged PHYL or Myc-tagged TTK88, or coexpressing PHYL and TTK88 were lysed, proteins were immunoprecipitated with either a-Myc MAb or a-Polyoma MAb,

PHYL and SINA Down-Regulate TTK88 463

Figure 5. SINA, PHYL, and TTK88 Physically Interact

Figure 4. The Level of TTK88 in Transfected S2 Cells Is Decreased by the Combined Presence of PHYL and SINA S2 cells were transiently cotransfected with the various combinations of pRmHa3 constructs capable of expressing the epitopetagged PHYL, SINA, and TTK88 proteins upon copper induction. A plasmid expressing b-gal was included as an internal control in all transfections. After protein expression was induced, the cells were stained for TTK88 and b-gal, and for either SINA or PHYL (see Experimental Procedures). Flow-cytometric analyses were used to monitor protein expression levels at 3 hr (left panels) and 24 hr (right panels) after induction of expression. In all panels, TTK88 expression levels are shown on the horizontal axis. In the top panels, cells were transfected with constructs expressing PHYL and TTK88, and PHYL expression levels are shown on the vertical axis. In the middle panels, cells were transfected with constructs expressing SINA and TTK88, and SINA expression levels are shown on the vertical axis. In the bottom panels, cells were transfected with constructs expressing SINA, PHYL, and TTK88, and SINA expression levels are shown on the vertical axis. Numbers in the quadrants indicate relative percentages of positive cells from a representative experiment.

and then immunoprecipitates were examined for the presence of PHYL and TTK88 by immunoblot analyses. As shown in Figure 5C, the results indicated that TTK88 and PHYL were coimmunoprecipitated. Taken together, our data suggest that SINA, PHYL, and TTK88 can form a protein complex that may play a role in targeting TTK88 for degradation. SINA Interacts with Component(s) of the Ubiquitin-Dependent Protein Degradation Pathway In an attempt to discern the role of SINA during R7 development, we have carried out genetic modifier

(A and B) Yeast two-hybrid assays were performed as described in Experimental Procedures. Plasmids expressing the indicated fusion proteins were cotransformed into yeast cells. Three individual colonies from each transformation were patched to minimal selection plates containing either galactose plus raffinose (A and B) or glucose (data not shown). (A) Interactions between fusion proteins were revealed by their ability to induce b-galactosidase expression (blue stain). (B) Interactions between fusion proteins were revealed by the leucine-independent growth of transformed yeast cells that indicates the activation of the LEU2 reporter. The pictures were taken 72 hr after the cells were patched; all interactions were galactose dependent. The following interactions were consistently observed in both assays. SINA and PHYL interact with themselves and each other. PHYL and TTK88 show a strong interaction. Finally, the ubiquitin conjugating enzyme UBCD1 and SINA interact. (C) TTK88 and PHYL can be coimmunoprecipitated. S2 cells were stably transfected with constructs expressing either Myc-tagged TTK88 (TTK88) or Polyoma-tagged PHYL (PHYL) alone, or both tagged proteins (TTK88 1 PHYL) in combination as indicated (see Experimental Procedures). After induction of protein expression, the cells were lysed, and then PHYL was immunoprecipitated (IP) using an antibody to the Polyoma epitope tag (lanes labeled [IP PHYL]) and TTK88 was immunoprecipitated using an antibody to the Myc epitope tag (lanes labeled [IP TTK88]). The immunoprecipitates and total cell lysates (Lysate) were resolved by 10% SDS–PAGE and immunoblots were performed. An a-Myc MAb was used to detect TTK88 (top panel), and an a-Polyoma MAb was used to detect PHYL (lower panel). The positions of the PHYL, TTK88 proteins and the immunoglobulin heavy chain (IgG) are indicated. Note that PHYL and TTK88 can be coimmunoprecipitated from an extract of cells expressing both proteins using an antibody against either protein. Neither PHYL nor TTK88 is precipitated by beads alone (lane labeled [Beads]) or by beads plus secondary antibodies (lane labeled [(2) Control]).

screens for dominant modifiers of a partial loss-of-function sina allele (Carthew et al., 1994) and of the rough eye phenotype caused by ectopically expressed SINA (T. P. N., A. H. T., and G. M. R., submitted). In these screens, we identified a small deletion uncovering the fat facets gene, which encodes a deubiquitinating enzyme

Cell 464

Figure 6. Model Summarizing the Proposed Pathway Leading to TTK88 Degradation Activation of RAS1/MAPK signaling leads to the transcriptional induction of PHYL expression. PHYL forms a complex with SINA, and this complex binds to TTK88, targeting it for degradation. See text for details.

(Huang and Fischer-Vize, 1996), as a dominant enhancer of reduced sina activity (Carthew et al., 1994) and mutations in a gene encoding a ubiquitin conjugating enzyme, ubcD1 (Treier et al., 1992), as a dominant suppressor of the effects of SINA overexpression (T. P. N., A. H. T., and G. M. R., submitted). Moreover, yeast two-hybrid assays, shown in Figures 5A and 5B, indicate that SINA and UBCD1 can physically interact. These results raise the possibility that SINA may provide a biochemical link between a SINA/ PHYL/TTK88 complex and the ubiquitin-dependent proteolytic pathway. Discussion Cell fate determination is a complex process, governed by the combinatorial effects of positive and negative signaling events. Ultimately, downstream transcription factors—whose abundance and activities are modulated by these signals—mediate the specific patterns of gene expression that lead to a particular cell fate. In this paper, we have investigated the regulation of the transcription factor TTK88 during Drosophila eye development. We show that TTK88 is a repressor of photoreceptor cell fate determination. We provide evidence that PHYL, whose transcription is induced in response to RAS1 activation (Chang et al. 1995; Dickson et al. 1995), acts in concert with SINA to target TTK88 for degradation, thereby creating a permissive environment for photoreceptor differentiation (see Figure 6). The genetic and physical interactions detected between SINA and UBCD1 raise the possibility that SINA may target TTK88 to the ubiquitin-dependent proteolytic pathway. This protein degradation pathway plays a role in many regulated developmental processes, and protein–protein interactions appear to be important in selecting proteins for degradation (for reviews, see Ciechanover, 1994; Hochstrasser, 1995, 1996). For example, it has been shown that human papilloma virus (HPV) E6 oncoproteins target p53 for degradation (Scheffner et al., 1990, 1993; Ciechanover, 1994) and the anaphase-promoting complex targets cyclin B for degradation (King et al., 1995). Our observation that development of all photoreceptors can be blocked by TTK88 expression indicates that TTK88 acts as a repressor of neuronal development. TTK88 does not block the formation of nonneuronal cell

types, however, in contrast to the transcription factor YAN, which acts as a general repressor of differentiation in the developing eye (Rebay and Rubin, 1995). Thus, while YAN can be thought of as controlling the general decision to differentiate, TTK88 appears to act at a later decision point to block neuronal differentiation. The repressing effects of both TTK88 and YAN are alleviated by down-regulating the levels of these proteins in response to RAS/MAPK signaling. However, unlike the mechanism we have proposed here for TTK88, the regulation of YAN involves its direct phosphorylation by MAPK (Rebay and Rubin, 1995). Likewise, the stability of c-JUN in mammalian cells appears to be regulated by MAPK phosphorylation. However, in this case, c-JUN phosphorylation by MAPK results in a reduction in c-JUN ubiquitination and increased protein stability (Musti et al., 1997). TTK functions as a transcriptional repressor in several tissues and cell types during Drosophila development (Brown et al., 1991; Read et al., 1992; Brown and Wu, 1993). Guo et al. (1996) have shown that TTK acts downstream of NOTCH in the determination of the fates of sensory cells in the PNS. As in the developing eye, TTK is expressed in nonneuronal support cells, but not in neurons, and in ttk mutants support cells are transformed into neurons (reviewed in Campos-Ortega, 1996). Constitutive activation of NOTCH leads to ectopic expression of TTK in neuronal precursors and causes them to be transformed into nonneuronal support cells. NOTCH function is required in many tissues, including the eye where it can antagonize RAS1 signaling (for a review, see Artavanis-Tsakonas et al., 1995). This raises the possibility that the regulation of TTK protein stability by PHYL, which is also required for normal PNS development (Chang et al., 1995), may represent a point of downstream integration of signals from the RAS1/MAPK and NOTCH signaling pathways. Experimental Procedures Genetics Fly cultures and crosses were carried out according to standard procedures. Multiple transgenic lines for each construct were established using P element–mediated transformation (Spradling and Rubin, 1982). Molecular Biology Full-length and fragments of phyl and sina cDNAs, with or without 59- or 39-Polyoma epitope tags, were generated by PCR using the following primers: for full-length phyl, 59-GGCGGATCCAACATGTCT ACCAATCAGCAGCAGCAGGCG-39 and 59-GGCCTCGAGTTAGACG AGGCTAATGCTAAGGCCCATTGG-39; for full-length phyl with a 39-Polyoma epitope tag, 59-GGCGGATCCAACATGTCTACCAATCA GCAGCAGCAGGCG-39 and 59-GGCCTCGAGTTACATATGTTCCAT TGGCATATATTCCATTTCCATTGGCATATATTCCATGACGAGGCTA ATGCTAAGGCCCATTGGTAATCGC-39; for full-length sina, 59-GGC GAATTCAACATGTCCAATAAAATCAACCCGAAGCG-39 and 59-GGC CTCGAGTTAGACCAGAGATATGGTCACGTTAATGCC-39; and for full-length sina with a 59-Polyoma epitope tag, 59-GGCGAATTC AACATGGAATATATGCCAATGGAAATGGAATATATGCCAATGGAA CATATGTCCAATAAAATCAACCCGAAGCGC-39 and 59-GGCCTCG AGTTAGACCAGAGATATGGTCACGTTAATGCC-39. This created BamHI and XhoI sites at the 59 and 39 ends of the phyl coding regions, and EcoRI and XhoI sites at the 59 and 39 ends of the sina coding regions, respectively. Full-length ttk88 coding sequence with a Myc tag was generated using the primers: 59-GGATTC TAGATTCAACATGGCATCTCAACGCTTCTGC-39 and 59-GAATTC

PHYL and SINA Down-Regulate TTK88 465

AGATCTAGTTCAGGTCCTCCTCGGAGATAAGCTTCTGCTCCGTTG CGGTTTGTGCGGTAGAGGC-39. This created EcoRI sites at the 59 and 39 ends of the TTK88 coding region. ttk88 and ttk69 unique regions were generated by PCR on ttk88 and ttk69 full-length cDNAs with the primers: 59-CAGCGAATTCGTTACTCCTACTAAGGCCACT-39 and 59-CCTTCACTCGAGTTACGTTGCCGTTTGTGCGGT-39 for ttk 88, and 59-CAGCGAATTCGACGGAAACGACAGCGATGGC-39 and 59-GGTGCCTCGAGATTACTGCGCCGCAGCTGCTGG-39 for ttk69. This created EcoRI and XhoI sites at the 59 and 39 ends of these coding regions. The authenticity of each PCR fragment was confirmed by DNA sequencing before subcloning into an appropriate expression vector. The following expression vectors were used: the yeast two-hybrid vectors, pEG202 and pJG4-5 (Gyuris et al., 1993; Golemis et al., 1994); the in vitro-translation vector pGEM (Promega); the GST-fusion protein vector pGEX (Pharmacia); the S2 cell transfection vector pRmHa3 (Bunch et al., 1988); pCaSper-HS vector (Thummel et al., 1988); and the P element–mediated transformation vectors pSEV (Dickson et al., 1992) and pGMR (Hay et al., 1994). An EcoRI fragment derived from the pRmHa3-ttk88-Myc construct (gift of S. Harrison) that contains the full-length ttk88 coding region with a C-terminal Myc epitope tag was ligated into the pGEM, pGEX, pSEV, and pGMR vectors. Histology Scanning electron microscopy was as described by Kimmel et al. (1990). Fixation, embedding, and sectioning of adult eyes and antibody staining of eye imaginal discs were performed as described by Wolff and Ready (1991). In situ hybridization to eye discs was carried out essentially as described by Tautz and Pfeifle (1989). Immunohistochemical staining of imaginal discs was performed as described in Xu and Rubin (1993). Polyclonal guinea pig a-TTK88 antibodies were generously provided by D. Read and used at a 1:1000 dilution. Rat-a-ELAV MAb (7E8A10) was used at a 1:5 dilution. Polyclonal rabbit a-b-galactosidase antibodies were purchased from Cappel and used at a 1:4000 dilution. Mouse-a-Myc (9E10) MAb ascites were used at a 1:1000 dilution. Mouse-a-Polyoma MAb and mouse-a-HA MAb (12CA5) were used at 1:10 dilution. Cy5-, Texas red–, Cy3- and FITC-conjugated secondary IgGs from Jackson Immunological Laboratories were used at a 1:1000 dilution. Microscopy Confocal microscopy was carried out using a Bio-Rad MRC1024 LSCM. Images were processed using Adobe Photoshop 4.0 and Aldus Pagemaker software. Standard photomicrographs were prepared with a Zeiss Axiophot Microscope. Yeast Two-Hybrid Assay The ttk gene encodes two alternatively spliced transcripts, ttk69 and ttk88, which translate into two proteins that share a common N-terminal half and diverge in their zinc finger–containing C-terminal halves (Harrison and Travers, 1990; Read and Manley, 1992). The untagged full-length and fragments of SINA and PHYL, TTK88 (corresponding to amino acid residues 287–811), and TTK69 (corresponding to amino acid residues 287–641) unique C-terminal regions were synthesized by PCR and subcloned in-frame into the pEG202 and pJG4-5 vectors. Yeast two-hybrid assays were performed as described (Chien et al., 1991; Gyuris et al., 1993; Golemis et al., 1994). Bait and prey constructs were cotransformed by the lithium acetate method (Schiestl and Gietz, 1989) into yeast strain EGY48 (Estojak et al., 1995) carrying the pSH18-34 reporter plasmid (Golemis et al., 1994). The transformants were selected on SD medium lacking histidine, tryptophan, and uracil to select for the presence of all plasmids. Activation of the lacZ reporter was determined on SD medium lacking tryptophan, uracil, and histidine in the presence of 5-bromo-4-chloro-3-indolyl-b-D-galactopyranoside (X-gal) and in the presence of either glucose or galactose plus raffinose. Activation of the LEU2 reporter was determined by the growth rate of transformed yeast cells patched on SD medium lacking tryptophan, uracil, histidine, and leucine in the presence of either glucose or galactose plus raffinose. Three independent transformants were analyzed for each pair of constructs. The following LexA-fusion proteins were used as baits and showed no significant interaction with SINA or

PHYL: YAN, RAS1DCAAX, RAF, DSOR, Bicoid, Dm Cdc2, FTZ homeodomain, Dm Cyclin D, and hMAX (Figure 5A and data not shown). Since the TTK88 C-terminal region, the TTK69 C-terminal region, and the PNTP1 and PNTP2 bait constructs self-activate, we could only perform the assay with these proteins in one direction. The following AD-fusion proteins were used as preys and showed no significant interaction with SINA or PHYL: YAN, TTK69, PNTP1, PNTP2, and DERK-A. TTK88 showed no interaction with the Dm Cyclin D bait, and weak interaction with YAN, UBC D1, FTZ homeodomain, Dm Cdc2, and hMAX baits in the b-gal assay; this weak interaction was of a similar strength to interaction with Bicoid as shown in Figure 5A. However, no significant interactions between these constructs were observed in the growth assay. TTK88 showed strong interaction with PHYL. YAN, PNTP1, PNTP2 bait, and YAN prey constructs were obtained from I. Rebay (Rebay and Rubin, unpublished data). RAS1DCAAX, RAF, DSOR, and DERK-A bait and prey constructs were obtained from M. Therrien (Therrien and Rubin, unpublished data). Bicoid, Dm Cdc2, FTZ homeodomain, Dm Cyclin D, and hMAX bait constructs were obtained from R. L. Finley (Zervos et al., 1993; Finley and Brent, 1994; Finley et al., 1996). Drosophila S2 Transfection, FACS Analysis, and Coimmunoprecipitation Assays Transient transfection of pRmHa3-SINA, -PHYL, -TTK88, -RAS1 v12, and pPAC-lacZ constructs into Drosophila S2 cells were performed using Lipofectin (GIBCO-BRL) following a protocol provided by R. Diederich. pPAC-lacZ was used as an internal control (Krasnow et al., 1989). The pRmHa3-RAS1 v12 construct was obtained from I. Rebay (Rebay and Rubin, 1995). SINA was 59 Polyoma–tagged, PHYL was either 39 Polyoma–tagged or 59 HA–tagged, and TTK88 was 39 Myc–tagged. In all transfections, the total amount of transfected DNA was adjusted to constant levels with the pRmHa3 vector. S2 cells in log phase growth were separately transfected. Six hours after transfection, the cells were incubated with Schneider’s Drosophila medium (GIBCO-BRL) supplemented with 10% fetal calf serum overnight for recovery. Protein expression from the metallothionein promoter was induced by the addition of 0.7 mM copper sulfate. Each experiment was repeated at least three times. For FACS analysis and immunofluorescent staining, the transient transfected S2 cells were fixed at the indicated time points after induction with 2% paraformaldehyde and permeabilized in PBS with 0.1% Triton X-100. When performing immunohistochemistry staining with three antibodies, cells were first stained using primary antibodies against TTK88 (1:1000), b-gal (1:4000), and Polyoma (1:10), and subsequently with anti-guinea pig-FITC, anti-mouse-Cy3, and anti-rabbit-Cy5 secondary antibodies (Jackson Immunological Laboratories). These cells were analyzed on an Elite IV FACScan (Coulter Electronics Inc., Hialeah, FL). At least 500,000 events were collected using narrow forward and side scatter to gate on the viable cells. Graphics were generated using the WindMdI software (John Trotter, Salk Institute). Anti-mouse-Cy3 secondary antibodies were used for flow-cytometric analyses, whereas anti-mouse-Texas red secondary antibodies were used for confocal microscopy analysis. For coimmunoprecipitation assays, S2 cells were stably transfected with constructs expressing either Myc-tagged TTK88 (pRmHa3-TTK88-Myc) or Polyoma-tagged PHYL (pRmHa3-PHYLPolyoma) alone, or both tagged proteins (pCaSper-hs-TTK88-Myc 1 pRmHa3-PHYL-Polyoma) in combination. The stably transfected S2 cell lines were established according to a protocol provided by H. Kra¨mer (personal communication). After copper and heat-shock induction of protein expression, the S2 cells were lysed in NP-40 hypotonic lysis buffer (10 mM KCl, 20 mM Tris–HCl [pH 7.4], 0.1% b-mercaptoethanol, 1 mM EDTA, 1% NP-40, 1 mM PMSF, 20 mM leupeptin and aprotinin, and 1 mM sodium vanadate) following a protocol provided by D. Morrison (personal communication). Cell lysates were equalized for protein expression by immunoblot analysis. Lysates were divided equally and immunoprecipitated by incubating lysates (from 1 3 10 7 cells) with the corresponding MAb for 4–6 hr at 48C as previously described (Therrien et al., 1996). The antigen–antibody complexes were collected with GammaBind Plus Sepharose beads (Pharmacia Biotech. Inc.). The immunoprecipitates were then washed five times in cold 0.1 M KCl HEMG buffer before analyses by SDS–PAGE and immunoblotting as previously

Cell 466

described (Ruppert and Tjian, 1995). Blots were developed with enhanced chemiluminescence (Amersham).

two-hybrid system: a method to identify and clone genes for proteins that interact with a protein of interest. Proc. Natl. Acad. Sci. USA 88, 9578–9582.

Acknowledgments

Ciechanover, A. (1994). The ubiquitin-proteasome proteolytic pathway. Cell 79, 13–21.

Correspondence should be addressed to G. M. R. We thank B. Dickson for fly stocks, S. Harrison for the pRmHa3-TTK88-Myc construct, E. O’Neill for the GST-PNT P2 construct, and D. Read for a-TTK88 antibodies. R. Brent and R. Finley generously provided many two-hybrid constructs and yeast strains used in the twohybrid experiments, and I. Rebay and M. Therrien provided several unpublished two-hybrid constructs. The authors thank Duncan Stuart for assistance with confocal microscopy, M. Jeans and B. Ho for assistance with P element–mediated transformation, C. Suh and N. Solomon for assistance with DNA sequencing, P. Sicurello for assistance with scanning electron microscopy, and P. Schow for assistance with cell flow cytometry. We are grateful to R. Tjian, M. Levine, M. Therrien, I. Rebay, B. A. Hay, and S. D. Harrison for critical reading of this manuscript; to D. K. Morrison and S. Hansen for helpful advice on the protein–protein interaction assays; and to our colleagues in the Rubin lab for helpful discussions throughout the course of this work. A. H. T is supported by a National Institutes of Health postdoctoral fellowship. G. M. R. is a Howard Hughes Medical Institute Investigator.

Della, N.G., Senior, P.V., and Bowtell, D.D.L. (1993). Isolation and characterization of murine homologues of the Drosophila seven in absentia gene (sina). Development 117, 1333–1343.

Received May 6, 1997; revised June 16, 1997. References Amson, R.B., Nemani, M., Roperch, J.P., Israeli, D., Bougueleret, L., Le Gall, I., Medhioub, M., Linares-Cruz, G., Lethrosne, F., Pasturaud, P., et al. (1996). Isolation of 10 differentially expressed cDNAs in p53-induced apoptosis: activation of the vertebrate homologue of the Drosophila seven in absentia gene. Proc. Natl. Acad. Sci. USA 93, 3953–3957. Artavanis-Tsakonas, S., Matsuno, K., and Fortini, M.E. (1995). Notch signaling. Science 268, 225–232. Basler, K., Siegrist, P., and Hafen, E. (1989). The spatial and temporal expression pattern of sevenless is exclusively controlled by geneinternal elements. EMBO J. 8, 2381–2386. Bowtell, D.D.L., Kimmel, B.E., Simon, M.A., and Rubin, G.M. (1989). Regulation of the complex pattern of sevenless expression in the developing Drosophila eye. Proc. Natl. Acad. Sci. USA 86, 6245– 6249. Brunner, D., Oellers, N., Szabad, J., Biggs, W.H., III, Zipursky, S.L., and Hafen, E. (1994). A gain-of-function mutation in Drosophila MAP kinase activates multiple receptor tyrosine kinase signaling pathways. Cell 76, 875–888. Brown, J.L., Sonoda, S., Ueda, H., Scott, M.P., and Wu, C. (1991). Repression of the Drosophila fushi tarazu (ftz) segmentation gene. EMBO J. 10, 665–674. Brown, J.L., and Wu, C. (1993). Repression of Drosophila pair-rule segmentation genes by ectopic expression of tramtrack. Development 117, 45–58. Bunch, T.A., Grinblat, Y., and Goldstein, L.S. (1988). Characterization and use of the Drosophila metallothionein promoter in cultured Drosophila melanogaster cells. Nucleic Acids Res. 16, 1043–1061. Campos-Ortega, J.A. (1996). Numb diverts Notch pathway off the Tramtrack. Neuron 17, 1–4. Carthew, R.W., and Rubin, G.M. (1990). seven in absentia, a gene required for specification of R7 cell fate in the Drosophila eye. Cell 63, 561–577. Carthew, R.W., Neufeld, T.P., and Rubin, G.M. (1994). Identification of genes that interact with the sina gene in Drosophila eye development. Proc. Natl. Acad. Sci. USA 91, 11689–11693. Chang, H.C., Solomon, N.M., Wassarman, D.A., Karim, F.D., Therrien, M., Rubin, G.M., and Wolff, T. (1995). phyllopod functions in the fate determination of a subset of photoreceptors in Drosophila. Cell 80, 463–472. Chien, C.T., Bartel, P.L., Sternglanz, R., and Fields, S. (1991). The

Dickson B. (1995). Nuclear factors in Sevenless signaling. Trends Genet. 11, 106–111. Dickson, B., Dominguez, M., van der Straten, A., and Hafen, E. (1995). Control of Drosophila photoreceptor cell fates by Phyllopod, a novel nuclear protein acting downstream of the Raf kinase. Cell 80, 453–462. Dickson, B., and Hafen, E. (1993). Genetic dissection of eye development in Drosophila. In The Development of Drosophila melanogaster, M. Bate and A. Martinez-Arias, eds. (Cold Spring Harbor, New York: Cold Spring Harbor Laboratory Press), pp. 1327–1362. Dickson, B., Sprenger, F., Morrison, D., and Hafen, E. (1992). Raf functions downstream of Ras1 in the Sevenless signal transduction pathway. Nature 360, 600–603. Estojak J., Brent R., and Golemis, E.A. (1995). Correlation of twohybrid affinity data with in vitro measurements. Mol. Cell. Biol. 15, 5820–5829. Finley, R.L., Jr., and Brent, R. (1994). Interaction mating reveals binary and ternary connections between Drosophila cell cycle regulators. Proc. Natl. Acad. Sci. USA 91, 12980–12984. Finley, R.L., Jr., Thomas, B.J., Zipursky, S.L., and Brent, R. (1996). Isolation of Drosophila cyclin D, a protein expressed in the morphogenetic furrow before entry into S phase. Proc. Natl. Acad. Sci. USA 93, 3011–3015. Fortini, M.E., Simon, M.A., and Rubin, G.M. (1992). Signaling by the sevenless protein tyrosine kinase is mimicked by Ras1 activation. Nature 355, 559–561. Golemis, E.A., Gyuris, J., and Brent, R. (1994). Two hybrid systems/ interaction traps. In Current Protocols in Molecular Biology, F.M. Ausubel, R. Brent, R. Kingston, D. Moore, J. Seidman, J.A. Smith, and K. Struhl, eds. (New York: John Wiley & Sons), pp. 13.14.1– 13.14.17. Guo, M., Bier, E., Jan, L.Y., and Jan, Y.N. (1995). tramtrack acts downstream of numb to specify distinct daughter cell fates during asymmetric cell divisions in the Drosophila PNS. Neuron 14, 913–925. Guo, M., Jan, L.Y., and Jan, Y.N. (1996). Control of daughter cell fates during asymmetric division: interaction of Numb and Notch. Neuron 17, 27–41. Gyuris, J., Golemis, E., Chertkov, H., and Brent, R. (1993). Cdi1, a human G1 and S phase protein phosphatase that associates with Cdk2. Cell 75, 791–803. Harrison, S.D., and Travers, A.A. (1990). The tramtrack gene encodes a Drosophila finger protein that interacts with the ftz transcriptional regulatory region and shows a novel embryonic expression pattern. EMBO J. 9, 207–216. Hay, B.A., Wolff, T., and Rubin, G.M. (1994). Expression of baculovirus P35 prevents cell death in Drosophila. Development 120, 2121– 2129. Hochstrasser, M. (1995). Ubiquitin, proteasomes, and the regulation of intracellular protein degradation. Curr. Opin. Cell Biol. 7, 215–223. Hochstrasser, M. (1996). Ubiquitin-dependent protein degradation. Annu. Rev. Genet. 30, 405–439 Huang, Y., and Fischer-Vize, J.A. (1996). Undifferentiated cells in the developing Drosophila eye influence facet assembly and require the Fat facets ubiquitin-specific protease. Development 122, 3207– 3216. Kauffmann, R.C., Li, S., Gallagher, P.A., Zhang, J., and Carthew, R.W. (1996). Ras1 signaling and transcriptional competence in the R7 cell of Drosophila. Genes Dev. 10, 2167–2178. Kimmel, B.E., Heberlein, U., and Rubin, G.M. (1990). The homeo domain protein rough is expressed in a subset of cells in the developing Drosophila eye where it can specify photoreceptor cell subtype. Genes Dev. 4, 712–727.

PHYL and SINA Down-Regulate TTK88 467

King, R.W., Peters, J.M., Tugendreich, S., Rolfe, M., Hieter, P., and Kirschner, M.W. (1995). A 20S complex containing CDC27 and CDC16 catalyzes the mitosis-specific conjugation of ubiquitin to cyclin B. Cell 81, 279–288. Krasnow, M.A., Saffman, E.E., Kornfeld, K., and Hogness, D.S. (1989). Transcriptional activation and repression by Ultrabithorax proteins in cultured Drosophila cells. Cell 16, 1031–1043. Lai, Z.-C., and Rubin, G.M. (1992). Negative control of photoreceptor development in Drosophila by the product of the yan gene, an ETS domain protein. Cell 70, 609–620. Lai, Z.-C., Harrison, S.D., Karim, F., Li, Y., and Rubin, G.M. (1996). Loss of tramtrack gene activity results in ectopic R7 cell formation, even in a sina mutant background. Proc. Natl. Acad. Sci. USA 93, 5025–5030. Marshall, C.J. (1995). Specificity of receptor tyrosine kinase signaling: transient versus sustained extracellular signal–regulated kinase activation. Cell 80, 179–185. Musti, A.M., Treier, M., and Bohmann, D. (1997). Reduced ubiquitindependent degradation of c-Jun after phosphorylation by MAP kinases. Science 275, 400–402. Nemani, M., Linares-Cruz, G., Bruzzoni-Giovanelli, H., Roperch, J.P., Tuynder, M., Bougueleret, L., Cherif, D., Medhioub, M., Pasturaud, P., Alvaro, V., et al. (1996). Activation of the human homologue of the Drosophila sina gene in apoptosis and tumor suppression. Proc. Natl. Acad. Sci. USA 93, 9039–9042. O’Neill, E.M., Rebay, I., Tjian, R., and Rubin, G.M. (1994). The activities of two Ets-related transcription factors required for Drosophila eye development are modulated by the Ras/MAPK pathway. Cell 78, 137–147. Read, D., Levine, M., and Manley, J.L. (1992). Ectopic expression of the Drosophila tramtrack gene results in multiple embryonic defects, including repression of even-skipped and fushi tarazu. Mech. Dev. 38, 183–195. Read, D., and Manley, J.L. (1992). Alternatively spliced transcripts of the Drosophila tramtrack gene encode zinc finger proteins with distinct DNA binding specificities. EMBO J. 11, 1035–1044. Rebay, I., and Rubin, G.M. (1995). Yan functions as a general inhibitor of differentiation and is negatively regulated by activation of the Ras1/MAPK pathway. Cell 81, 857–866. Ruppert, S., and Tjian, R. (1995). Human TAFII250 interacts with RAP74: implications for RNA polymerase II initiation. Genes Dev. 9, 2747–2755. Saurin, A.J., Borden, K.L.B., Boddy, M.N., and Freemont, P.S. (1996). Does this have a familiar ring? Trends Biochem. Sci. 21, 208–214. Scheffner, M., Huibregtse, J.M., Vierstra, R.D., and Howley, P.M. (1993). The HPV-16 E6 and E6-AP complex functions as a ubiquitin– protein ligase in the ubiquitination of p53. Cell 75, 495–505. Scheffner, M., Werness, B.A., Huibregtse, J.M., Levine, A.J., and Howley, P.M. (1990). The E6 oncoprotein encoded by human papillomavirus types 16 and 18 promotes the degradation of p53. Cell 63, 1129–1136. Schiestl, R.H., and Gietz, R.D. (1989). High efficiency transformation of intact yeast cells using single stranded nucleic acids as a carrier. Curr. Genet. 16, 339–346. Spradling, A.C., and Rubin, G.M. (1982). Transposition of cloned P elements into Drosophila germ line chromosomes. Science 218, 341–347. Tautz, D., and Pfeifle, C. (1989). A non-radioactive in situ hybridization method for the localization of specific RNAs in Drosophila embryos reveals translational control of the segmentation gene hunchback. Chromosoma 98, 81–85. Therrien, M., Michaud, N.R., Rubin, G.M., and Morrison, D.K. (1996). KSR modulates signal propagation within the MAPK cascade. Genes Dev. 10, 2684–2695. Thummel, C.S., Boulet, A.M., and Lipshitz, H.D. (1988). Vectors for Drosophila P-element-mediated transformation and tissue culture transfection. Gene 74, 445–456. Treier, M., Bohmann, D., and Mlodzik, M. (1995). JUN cooperates with the ETS domain protein pointed to induce photoreceptor R7 fate in the Drosophila eye. Cell 83, 753–760.

Treier, M., Seufert, W., and Jentsch, S. (1992). Drosophila UbcD1 encodes a highly conserved ubiquitin-conjugating enzyme involved in selective protein degradation. EMBO J. 11, 367–372. van der Geer, P., Hunter, T., and Lindberg, R.A. (1994). Receptor protein-tyrosine kinases and their signal transduction pathways. Annu. Rev. Cell Biol. 10, 251–337. Wassarman, D.A., Therrien, M., and Rubin, G.M. (1995). The Ras signaling pathway in Drosophila. Curr. Opin. Genet. Dev. 5, 44–50. Wolff, T., and Ready, D.F. (1991). Cell death in normal and rough eye mutants of Drosophila. Development 113, 825–839. Wolff, T., and Ready, D.F. (1993). Pattern formation in the Drosophila retina. In Developmental Biology of Drosophila, M. Bate and A. Martins-Arias, eds. (Cold Spring Harbor, NY: Cold Spring Harbor Press), pp. 1277–1325. Xiong, W.C., and Montell, C. (1993). Tramtrack is a transcriptional repressor required for cell fate determination in the Drosophila eye. Genes Dev. 7, 1085–1096. Xu, T., and Rubin, G.M. (1993). Analysis of genetic mosaics in developing and adult Drosophila tissues. Development 117, 1223–1237. Yamamoto, D., Nihonmatsu, I., Matsuo, T., Miyamoto, H., Kondo, S., Hirata, K., and Ikegami, Y. (1996). Genetic interactions of pokkuri with seven in absentia, tramtrack and downstream components of the sevenless pathway in R7 photoreceptor induction in Drosophila melanogaster. Roux’s Arch. Dev. Biol. 205, 215–224. Zervos, A.S., Gyuris, J., and Brent, R. (1993). Mxi1, a protein that specifically interacts with Max to bind Myc–Max recognition sites. Cell 72, 223–232. Zipursky, S.L., and Rubin, G.M. (1994). Determination of neuronal cell fate: lessons from the R7 neuron of Drosophila. Annu. Rev. Neurosci. 17, 373–397.