- Email: [email protected]
Phylogenetic analysis of hepatitis E virus in domestic swine and wild boar in Germany
Veterinary Microbiology 174 (2014) 233–238
Contents lists available at ScienceDirect
Veterinary Microbiology journal homepage: www.elsevier.com/locate/vetmic
Short Communication
Phylogenetic analysis of hepatitis E virus in domestic swine and wild boar in Germany Edmilson F. Oliveira-Filho *, Barbara R. Bank-Wolf, Heinz-Ju¨rgen Thiel, Matthias Ko¨nig Institut fu¨r Virologie, Fachbereich Veterina¨rmedizin, Justus-Liebig-Universita¨t Giessen, Giessen, Germany
A R T I C L E I N F O
A B S T R A C T
Article history: Received 19 July 2014 Received in revised form 11 September 2014 Accepted 15 September 2014
Hepatitis E virus (HEV) is an emerging non-enveloped positive strand RNA virus with worldwide distribution that can cause acute liver disease in humans. The virus has also been detected in both domestic and wild animals. In this study we investigated the presence of HEV in free-living wild boar as well as in domestic swine. A total of 105 domestic swine fecal samples and 124 wild boar sera were tested for the presence of HEV RNA by RT-PCR. A 241 nucleotide (nt) fragment from the capsid gene of HEV from one domestic swine and from 18 wild boars were amplified and sequenced. In addition, the complete capsid of three HEV sequences found in wild boar and the complete genomic sequence of the domestic swine HEV were obtained. Phylogenetic analyses based on both the 241 nt fragments as well as four complete capsid gene sequences demonstrated that all sequences belong to genotype HEV-3. ß 2014 Elsevier B.V. All rights reserved.
Keywords: HEV Domestic swine Wild boar Zoonosis RT-PCR Phylogenetic analyses
1. Introduction Hepatitis E is an emerging acute liver disease observed in humans. Originally considered to be limited to developing countries, hepatitis E has recently been shown to be widespread also in industrialized countries (Lewis et al., 2010; Pavio et al., 2010; Wichmann et al., 2008). In humans hepatitis E shows a high attack rate in adults but the disease appears to be usually self-limiting. Most infections with HEV take a subclinical or mild course and fulminant hepatic failure is a rare outcome (Lewis et al., 2010; Pavio et al., 2010). Infection in pregnant women is
* Corresponding author. Present address: Veterinary Virology and Animal Viral Diseases, Department of Infectious and Parasitic Diseases, FARAH, Faculty of Veterinary Medicine, University of Lie`ge, Lie`ge, Belgium. Tel.: +32 43664251. E-mail addresses: [email protected], [email protected] (E.F. Oliveira-Filho). http://dx.doi.org/10.1016/j.vetmic.2014.09.011 0378-1135/ß 2014 Elsevier B.V. All rights reserved.
generally more severe with remarkably high morbidity and case-fatality rates; the latter can reach 25% after infection during the third trimester. Vertical transmission associated with a high neonatal mortality rate has also been reported (Khuroo and Kamili, 2009). The causative agent hepatitis E virus (HEV) is a nonenveloped positive strand RNA virus with a diameter of 27–32 nm. The HEV genome has a size of approximately 7.2 kb and contains three open reading frames (ORF). The virus belongs to the family Hepeviridae, genus Orthohepevirus A, which is subdivided into seven genotypes (Smith et al., 2014). Classification of HEV subtypes or subgenotypes is under discussion. Subdivision into 24 subtypes has been proposed (Lu et al., 2006), however inconsistencies concerning this subtype classification were demonstrated by two recent publications using different methodologies (Oliveira-Filho et al., 2013; Smith et al., 2013). Epidemiological data suggests that genotype distribution as well as prevalence rates vary considerably between
234
E.F. Oliveira-Filho et al. / Veterinary Microbiology 174 (2014) 233–238
continents and countries. Genotype HEV-1 has mainly been detected in Asia and the north of Africa and genotype HEV-2 was originally isolated from a single outbreak in Mexico, but is now also found in Africa (Van der Poel, 2014). First detected in domestic swine in the USA, genotype HEV-3 is now found on all continents (Oliveira-Filho et al., 2013). Members of genotype HEV-4 have been detected in Asia and more recently in both animal and humans in Europe (Van der Poel, 2014; Wichmann et al., 2008). Genotype HEV-5 and HEV-6 have been found only in Japanese wild boar, while genotype HEV-7 has been isolated in dromedary camels from Dubai (Smith et al., 2014). HEV is present in both domestic and wild animals such as swine, wild boar, roe deer, rabbits and rats (Johne et al., 2010; Pavio et al., 2010). Natural infection of domestic pigs with HEV was first seen in 1997 in the United States (Meng et al., 1997), genotypes HEV-3 and 4 are now known to circulate in animals in many countries such as China, India and parts of Europe (Van der Poel, 2014). To date clinical disease has not been associated with HEV in animals. Sequences from human and animal HEVs are closely related and zoonotic transmission has been demonstrated (Pavio et al., 2010). In Germany infection with HEV genotypes 3 and 4 has been reported in humans, including recent autochthonous cases which were correlated with consumption of undercooked meat products, e.g. from wild boar (Wichmann et al., 2008). Furthermore studies in Germany showed the presence of HEV in the swine and wild boar population (Adlhoch et al., 2009; Kaci et al., 2008; Schielke et al., 2009; Wenzel et al., 2011). In order to assess the risk of HEV transmission between animals and humans an extensive epidemiological and phylogenetic study is required. Here we report the detection of HEV in German domestic swine and free-living wild boar together with phylogenetic analyses using different parts of the HEV genome. 2. Materials and methods 2.1. Samples A total of 105 domestic swine fecal samples were collected between 2003 and 2006 during a survey throughout Germany. In addition 124 blood samples from free living wild boar collected in conjunction with Classical Swine Fever Virus surveillance. These samples were from the state of Hessen, collected in 2008 and kindly provided by the ‘‘Landesbetrieb Hessisches Landeslabor, Giessen’’. Age and sex of the majority of animals are unknown. 2.2. RNA extraction and molecular detection of HEV Fecal samples were suspended in phosphate buffered saline (PBS) at a dilution of 1:10. RNA was extracted from 140 ml fecal suspension or serum using the QIAamp Viral RNA Mini KitTM (Qiagen) according to the manufacturer’s instructions. RT-PCR was performed as described previously using primers F1 (AGCTCCTGTACCTGATGTTGACTC), R1 (CTACAGAGCGCCAGCCTTGATTGC), F2 (GCTCACGTCATCTGTCGCTGCTGG) and R2 (GGGCTGAACCAAAATCCT-
GACATC) which amplify fragments of 404 nt and 241 nt, respectively, from the ORF2 region of the HEV genome (Lee et al., 2007). To allow cloning and sequencing of the complete sequence of HEV isolate from domestic swine, the nonstructural polyprotein (ORF1) was divided in seven regions and the entire capsid protein (ORF2) was divided in four regions. For each region, one pair of primers was designed using the Primer Express1 software and are included in supplementary Table S1. RT-PCR was performed using the OneStep RT-PCR KitTM (Qiagen) as per manufacturer’s instructions. 2.3. Cloning and phylogenetic analyses PCR products of the expected size (241 nt) were further analyzed. After gel extraction using the QIAquick Gel Extraction KitTM (Qiagen) and cloning using the TOPO TA cloning kitTM (Invitrogen) plasmid DNA was transferred to sequencing by Qiagen (Hilden, Germany) or Seqlab (Go¨ttingen, Germany). Sequences were compared to Genbank entries and phylogenetic analyses performed using the HUSAR package (DKFZ, Heidelberg). Phylogenetic distances were calculated by the Kimura-2-parameter method (Kimura, 1980) and unrooted trees generated based on the neighbor-joining method (Saitou and Nei, 1987). A bootstrap analysis with 1000 replicates was included. Branch lengths are proportional to genetic distances. The sequences were submitted to GenBank and accession numbers are given on Table 1. 3. Results and discussion 3.1. Detection of HEV in swine and wild boar samples A fragment of 241 nucleotides (nt) from the capsid gene region of the HEV genome was amplified in one out of 105 fecal samples from domestic swine. The animal, a fourmonth-old female Pietrain breed, was clinically healthy and originated from Giessen (Hesse state). Wild boar sera were obtained from the national classical swine fever surveillance program. HEV could be detected in 18 out of the 124 sera with positive animals being distributed over the sampling area (Fig. 1 and Table 1). No information about sex and age of the animals was available. The results of the current study imply that HEV is endemic in the wild boar population of western Hesse. Domestic swine and wild boar have been reported as the major animal reservoir of HEV. Indeed, retrospective studies suggest that HEV circulated in both domestic swine and wild boar for decades (Casas et al., 2009; Kaci et al., 2008). The high prevalence rate observed in wild boar in the current study is comparable to those previously found in other parts of Germany (Adlhoch et al., 2009; Schielke et al., 2009) and other European countries such as Spain and Italy (de Deus et al., 2008; Martelli et al., 2008). Lower prevalence rates were reported in France, the Netherlands and in a retrospective study for Germany (Kaba et al., 2009; Kaci et al., 2008; Rutjes et al., 2009). In contrast to the widespread occurrence of HEV in wild boar only one sample from domestic swine was found
E.F. Oliveira-Filho et al. / Veterinary Microbiology 174 (2014) 233–238
235
Table 1 Regions where positive wild boar samples were found; subtyping and subgenotyping according to 241 b and 1983 b; accession numbers. Region
N. pos
Sample identification
Subtype
Subgenotype
Accession numbers
241b
Capsid
Rheingau-Taunus-Kreis
2
WB 1, WB 121
3i, 3h 3a, 3b, 3j
3i
3.1 3.1
KF303501 KF303496
Wiesbaden
2
WB 22 WB 24
3i 3i, 3h
3.1 3.1
KF303486 KF303485
Lahn-Dill-Kreis/Wetzlar
7
WB WB WB WB WB WB WB
3i 3i 3i 3i 3i 3a, 3b, 3j 3a, 3b, 3j
3.1 3.1 3.1 3.1 3.1 3.1 3.1
KF303494 KF303489 KF303490 KF303493 KF303491 KF303484 KF303498
Marburg-Biedenkopf/Lahn
3
WB 34 WB 91 WB 122
3i, 3h 3i 3a
3a
3.1 3.1 3.1
KF303487 KF303488 KF303499
Waldeck-Frankenberg Hochtaunuskreis
1 1
WB 52 WB 69
3i 3a, 3b, 3j
3a
3.1 3.1
KF303492 KF303500
Limburg
2
WB 118 WB 120
3i 3a, 3b, 3j
3.1 3.1
KF303495 KF303497
Total
18
25 75 76 104 119 117 124
Fig. 1. Geographical distribution of wild boar samples. Grid (blue) indicates where positive samples were found and diagonal lines (red) shows regions where negative samples were collected. (For interpretation of the references to color in figure legend, the reader is referred to the web version of the article.) Map build with Quantum GIS –QGIS Development Team, 2012. QGIS Geographic Information System. Open Source Geospatial Foundation Project. http:// qgis.osgeo.org.
236
E.F. Oliveira-Filho et al. / Veterinary Microbiology 174 (2014) 233–238
positive in our study. Prevalence rates in domestic swine vary considerably between countries and studies. Low prevalence was previously reported from China, Japan, India and Korea (Geng et al., 2010; Lee et al., 2009; Sakano et al., 2009; Vivek and Kang, 2011). In contrast significantly higher HEV positive rates were observed in studies from Brazil, China, Japan, United States and European countries including France and the Netherlands (dos Santos et al., 2009; Geng et al., 2011; Huang et al., 2002; Kaba et al., 2009; van der Poel et al., 2001). Reasons for the remarkable discrepancies are not clear but technical differences between studies may play a role. In the current study serum samples from wild boar and fecal samples from domestic swine were investigated. This difference in the source of samples may have biased our results. After experimental infection in domestic swine, HEV has been shown to be detected more frequently and for longer periods in feces in comparison to blood samples (Bouwknegt et al., 2009). Thus, a prolonged presence of HEV in the blood stream in comparison to virus excretion via feces is unlikely. Another factor to be taken into account for fecal samples is the presence of RT-PCR inhibitors. We used a standard purification protocol validated for fecal samples. However we did neither test for inhibitors nor quantify the amount of HEV RNA. According to both field and experimental studies detection rates are correlated with the age of animals. HEV RNA appears to be more easily detectable in domestic pigs up to six months of age in comparison to older animals (dos Santos et al., 2009; Geng et al., 2011; Huang et al., 2002). For animals in our study we have limited information about age. Social, behavioral and environmental differences between domestic swine and wild boar play a role in viral transmission. Wild boars, as free-living opportunistic omnivores, are probably more exposed to constant re-infection. For domestic swine the kind of husbandry, hygiene conditions and the restriction of animal contacts probably influence the prevalence rates. 3.2. Phylogenetic analyses HEV is currently divided into seven genotypes, HEV-1– 7. The subtype classification is controversial. Currently, the mostly accepted classification of 24 HEV subtypes has been proposed by Lu and colleagues (Lu et al., 2006). They divided HEV-3 into 10 subtypes (a–j). However, recent studies have shown inconsistencies within this classification. The separation of genotypes into subtypes does not actually reflect neither the distribution of amino acid or nucleotide pairwise distances values (Smith et al., 2013). As such, there is a low accuracy defining subtypes (Oliveira-Filho et al., 2013). The nucleotide pairwise corrected distances variation for the 241 nt PCR fragments from the capsid region of the HEV genome ranged between 11.57 and 21.45% when sequences from domestic pig and wild boar were compared. Within wild boar sequences nucleotide variation from 0 to 21.61% was observed. Phylogenetic analyses placed the sequences determined in the present study in different branches within
genotype HEV-3. Accordingly four separate groups were identified (Supplement Fig. S1). However this clustering was not supported by significant bootstrap values. In order to establish a more robust phylogeny, analyses were extended to the entire capsid gene. Due to limited amounts and quality of samples, capsid encoding sequences were obtained only from three wild boar samples (WB1, WB69 and WB122) and the positive domestic swine (GiSw). Phylogenetic analysis based on complete capsid gene sequences was supported by high bootstraps values and allowed a convincing separation of our sequences (Fig. 2). The WB1 sequence clustered in one branch together with two previously reported viruses from wild boar from Germany classified as subtype 3i (FJ705359 and FJ998008) (Adlhoch et al., 2009; Schielke et al., 2009) with genetic differences between 10.66 and 13.54%. The other two wild boar capsid sequences WB122 and WB69 grouped together with virus from the domestic swine (GiSw) and published HEV sequences classified as subtype 3a according to Lu and co-workers (Lu et al., 2006). Using the recently proposed classification all complete capsid gene sequences clustered into subgenotype 3.1 (Oliveira-Filho et al., 2013). The heterogeneity of HEV detected in wild boar in Germany is remarkable and the overall degree of genetic heterogeneity was up to 16.3% (Supplement Table S3). No developing lineage or geographic clustering was observed. These findings together with the high prevalence observed here and by previous studies (Adlhoch et al., 2009; Schielke et al., 2009) imply that HEV is widespread and likely to be endemic in the wild boar population of Germany. The prolonged persistence may have driven evolution of the virus leading to such heterogeneity. This also could be explained by the fact that the virus is more widespread in the wild boar population and the viral circulation in the domestic swineherds is slower. Previously in Germany an epidemiological study with hepatitis E patients pointed to the consumption of wild boar meat products as probable origin (Wichmann et al., 2008). In the current study sequences from wild boar intermingled with HEV from domestic swine and human cases which indicates the possibility of transmission of virus between wild boar and domestic swine as well as to man. 3.3. Complete sequence of HEV isolate from domestic swine The genome of GiSw HEV consists of three ORFs with a size of 1708 aa (ORF1), 660 aa (ORF2) and 123 aa (ORF3) flanked by 50 and 30 non-coding regions that were not sequenced. Like other HEV complete sequences GiSw ORF1 encoded conserved sequence motifs that allow putative designation of proteins: methyltransferase 34–355 aa, papain-like cysteine protease 432–592 aa, helicase 980–1199 aa and RNA-dependent RNA polymerase 1412–1594 aa. Phylogenetic analysis demonstrated a close relationship between complete sequence of GiSw and other genotype HEV-3 sequences. Pairwise genetic distances ranged from 9.88 to 26.35% (Supplement Table S4). GiSw clustered in a branch together with porcine HEV found in
E.F. Oliveira-Filho et al. / Veterinary Microbiology 174 (2014) 233–238
237
Fig. 2. Phylogenetic analysis based on complete capsid gene sequences. Sequences identification in bold and underlined represent sequences found in this study. Phylogenetic distances were calculated using the Kimura-2 parameter method. Tree was calculated by the neighbor-joining method. The branch lengths are proportional to the genetic distances. A bootstrap analysis of 1000 replicates was included; numbers indicate bootstrap values. Additional sequences were obtained from GenBank together with accession numbers indicated.
Korea (FJ426404 and FJ426403) and the US (AF082843) as well as HEV from human patients from the US (AF060669 and AF060668) and AB591734 detected in Mongoose in Japan (supplement Fig. S2). 4. Conclusions The results of this study confirm that HEV is circulating between both wild boar and domestic swine populations in Germany. HEV isolates from animals analyzed here are closely related to human isolates indicating zoonotic risk in case of undercooked meat products from swine or wild boar are consumed. Further studies are necessary to understand the mode of HEV transmission between animal populations (and humans) as well as the pathogenesis of the disease. Acknowledgments Wild boar serum samples were kindly provided by the ‘‘Landesbetrieb Hessisches Landeslabor’’ in Giessen, Germany. We thank Damien Thiry for assistance with the map and Annette Dougall for the English correction of the manuscript. Appendix A. Supplementary data Supplementary data associated with this article can be found, in the online version, at http://dx.doi.org/10.1016/ j.vetmic.2014.09.011.
References Adlhoch, C., Wolf, A., Meisel, H., Kaiser, M., Ellerbrok, H., Pauli, G., 2009. High HEV presence in four different wild boar populations in East and West Germany. Vet. Microbiol. 139, 270–278. Bouwknegt, M., Rutjes, S.A., Reusken, C.B., Stockhofe-Zurwieden, N., Frankena, K., de Jong, M.C., de Roda Husman, A.M., Poel, W.H., 2009. The course of hepatitis E virus infection in pigs after contactinfection and intravenous inoculation. BMC Vet. Res. 5, 7. Casas, M., Pujols, J., Rosell, R., de Deus, N., Peralta, B., Pina, S., Casal, J., Martı´n, M., 2009. Retrospective serological study on hepatitis E infection in pigs from 1985 to 1997 in Spain. Vet. Microbiol. 135, 248–252. de Deus, N., Peralta, B., Pina, S., Allepuz, A., Mateu, E., Vidal, D., Ruiz-Fons, F., Martı´n, M., Gorta´zar, C., Segale´s, J., 2008. Epidemiological study of hepatitis E virus infection in European wild boars (Sus scrofa) in Spain. Vet. Microbiol. 129, 163–170. dos Santos, D.R., Vitral, C.L., de Paula, V.S., Marchevsky, R.S., Lopes, J.F., Gaspar, A.M., Saddi, T.M., Ju´ nior, N.C., Guimara˜ es, F.e.R., Ju´nior, J.G., Ximenes, L.L., Souto, F.J., Pinto, M.A., 2009. Serological and molecular evidence of hepatitis E virus in swine in Brazil. Vet. J. 182, 474–480. Geng, J., Wang, L., Wang, X., Fu, H., Bu, Q., Liu, P., Zhu, Y., Wang, M., Sui, Y., Zhuang, H., 2011. Potential risk of zoonotic transmission from young swine to human: seroepidemiological and genetic characterization of hepatitis E virus in human and various animals in Beijing, China. J. Viral Hepat. 18, e583–e590. Geng, Y., Wang, C., Zhao, C., Yu, X., Harrison, T.J., Tian, K., Wang, Y., 2010. Serological prevalence of hepatitis E virus in domestic animals and diversity of genotype 4 hepatitis E virus in China. Vector Borne Zoonotic Dis 10, 765–770. Huang, F.F., Haqshenas, G., Guenette, D.K., Halbur, P.G., Schommer, S.K., Pierson, F.W., Toth, T.E., Meng, X.J., 2002. Detection by reverse transcription-PCR and genetic characterization of field isolates of swine hepatitis E virus from pigs in different geographic regions of the United States. J. Clin. Microbiol. 40, 1326–1332. Johne, R., Heckel, G., Plenge-Bo¨nig, A., Kindler, E., Maresch, C., Reetz, J., Schielke, A., Ulrich, R.G., 2010. Novel hepatitis E virus genotype in Norway rats, Germany. Emerg. Infect. Dis. 16, 1452–1455.
238
E.F. Oliveira-Filho et al. / Veterinary Microbiology 174 (2014) 233–238
Kaba, M., Davoust, B., Marie´, J.L., Barthet, M., Henry, M., Tamalet, C., Raoult, D., Colson, P., 2009. Frequent transmission of hepatitis E virus among piglets in farms in Southern France. J. Med. Virol. 81, 1750–1759. Kaci, S., No¨ckler, K., Johne, R., 2008. Detection of hepatitis E virus in archived German wild boar serum samples. Vet. Microbiol. 128, 380–385. Khuroo, M.S., Kamili, S., 2009. Clinical course and duration of viremia in vertically transmitted hepatitis E virus (HEV) infection in babies born to HEV-infected mothers. J. Viral Hepat. 16, 519–523. Kimura, M., 1980. A simple method for estimating evolutionary rates of base substitutions through comparative studies of nucleotide sequences. J. Mol. Evol. 16, 111–120. Lee, S.H., Kang, S.C., Kim, D.Y., Bae, J.H., Kim, J.H., 2007. Detection of swine hepatitis E virus in the porcine hepatic lesion in Jeju Island. J. Vet. Sci. 8, 51–55. Lee, W.J., Kang, M.L., Cha, S.B., Park, B.K., Choi, I.S., Yoo, H.S., 2009. Analysis of the helicase gene of Korean swine hepatitis E virus isolates and trends in viral infection. Arch. Virol. 154, 1361–1364. Lewis, H.C., Wichmann, O., Duizer, E., 2010. Transmission routes and risk factors for autochthonous hepatitis E virus infection in Europe: a systematic review. Epidemiol. Infect. 138, 145–166. Lu, L., Li, C., Hagedorn, C.H., 2006. Phylogenetic analysis of global hepatitis E virus sequences: genetic diversity, subtypes and zoonosis. Rev. Med. Virol. 16, 5–36. Martelli, F., Caprioli, A., Zengarini, M., Marata, A., Fiegna, C., Di Bartolo, I., Ruggeri, F.M., Delogu, M., Ostanello, F., 2008. Detection of hepatitis E virus (HEV) in a demographic managed wild boar (Sus scrofa scrofa) population in Italy. Vet. Microbiol. 126, 74–81. Meng, X.J., Purcell, R.H., Halbur, P.G., Lehman, J.R., Webb, D.M., Tsareva, T.S., Haynes, J.S., Thacker, B.J., Emerson, S.U., 1997. A novel virus in swine is closely related to the human hepatitis E virus. Proc. Natl. Acad. Sci. U. S. A. 94, 9860–9865. Oliveira-Filho, E.F., Ko¨nig, M., Thiel, H.J., 2013. Genetic variability of HEV isolates: inconsistencies of current classification. Vet. Microbiol. 165, 148–154. Pavio, N., Meng, X.J., Renou, C., 2010. Zoonotic hepatitis E: animal reservoirs and emerging risks. Vet. Res. 41, 46.
Rutjes, S.A., Lodder, W.J., Lodder-Verschoor, F., van den Berg, H.H., Vennema, H., Duizer, E., Koopmans, M., de Roda Husman, A.M., 2009. Sources of hepatitis E virus genotype 3 in The Netherlands. Emerg. Infect. Dis. 15, 381–387. Saitou, N., Nei, M., 1987. The neighbor-joining method: a new method for reconstructing phylogenetic trees. Mol. Biol. Evol. 4, 406–425. Sakano, C., Morita, Y., Shiono, M., Yokota, Y., Mokudai, T., Sato-Motoi, Y., Noda, A., Nobusawa, T., Sakaniwa, H., Nagai, A., Kabeya, H., Maruyama, S., Yamamoto, S., Sato, H., Kimura, H., 2009. Prevalence of hepatitis E virus (HEV) infection in wild boars (Sus scrofa leucomystax) and pigs in Gunma Prefecture, Japan. J. Vet. Med. Sci. 71, 21–25. Schielke, A., Sachs, K., Lierz, M., Appel, B., Jansen, A., Johne, R., 2009. Detection of hepatitis E virus in wild boars of rural and urban regions in Germany and whole genome characterization of an endemic strain. Virol. J. 6, 58. Smith, D.B., Purdy, M.A., Simmonds, P., 2013. Genetic variability and the classification of hepatitis E virus. J. Virol. 87, 4161–4169. Smith, D.B., Simmonds, P., Jameel, S., Emerson, S.U., Harrison, T.J., Meng, X.J., Okamoto, H., Van der Poel, W.H., Purdy, M.A., 2014. Consensus proposals for classification of the family hepeviridae. J. Gen. Virol. 95, 2223–2232. Van der Poel, W.H., 2014. Food and environmental routes of hepatitis E virus transmission. Curr. Opin. Virol. 4, 91–96. van der Poel, W.H., Verschoor, F., van der Heide, R., Herrera, M.I., Vivo, A., Kooreman, M., de Roda Husman, A.M., 2001. Hepatitis E virus sequences in swine related to sequences in humans, The Netherlands. Emerg. Infect. Dis. 7, 970–976. Vivek, R., Kang, G., 2011. Hepatitis E virus infections in swine and swine handlers in Vellore, Southern India. Am. J. Trop. Med. Hyg. 84, 647–649. Wenzel, J.J., Preiss, J., Schemmerer, M., Huber, B., Plentz, A., Jilg, W., 2011. Detection of hepatitis E virus (HEV) from porcine livers in Southeastern Germany and high sequence homology to human HEV isolates. J. Clin. Virol. 52, 50–54. Wichmann, O., Schimanski, S., Koch, J., Kohler, M., Rothe, C., Plentz, A., Jilg, W., Stark, K., 2008. Phylogenetic and case–control study on hepatitis E virus infection in Germany. J. Infect. Dis. 198, 1732–1741.
Contents lists available at ScienceDirect
Veterinary Microbiology journal homepage: www.elsevier.com/locate/vetmic
Short Communication
Phylogenetic analysis of hepatitis E virus in domestic swine and wild boar in Germany Edmilson F. Oliveira-Filho *, Barbara R. Bank-Wolf, Heinz-Ju¨rgen Thiel, Matthias Ko¨nig Institut fu¨r Virologie, Fachbereich Veterina¨rmedizin, Justus-Liebig-Universita¨t Giessen, Giessen, Germany
A R T I C L E I N F O
A B S T R A C T
Article history: Received 19 July 2014 Received in revised form 11 September 2014 Accepted 15 September 2014
Hepatitis E virus (HEV) is an emerging non-enveloped positive strand RNA virus with worldwide distribution that can cause acute liver disease in humans. The virus has also been detected in both domestic and wild animals. In this study we investigated the presence of HEV in free-living wild boar as well as in domestic swine. A total of 105 domestic swine fecal samples and 124 wild boar sera were tested for the presence of HEV RNA by RT-PCR. A 241 nucleotide (nt) fragment from the capsid gene of HEV from one domestic swine and from 18 wild boars were amplified and sequenced. In addition, the complete capsid of three HEV sequences found in wild boar and the complete genomic sequence of the domestic swine HEV were obtained. Phylogenetic analyses based on both the 241 nt fragments as well as four complete capsid gene sequences demonstrated that all sequences belong to genotype HEV-3. ß 2014 Elsevier B.V. All rights reserved.
Keywords: HEV Domestic swine Wild boar Zoonosis RT-PCR Phylogenetic analyses
1. Introduction Hepatitis E is an emerging acute liver disease observed in humans. Originally considered to be limited to developing countries, hepatitis E has recently been shown to be widespread also in industrialized countries (Lewis et al., 2010; Pavio et al., 2010; Wichmann et al., 2008). In humans hepatitis E shows a high attack rate in adults but the disease appears to be usually self-limiting. Most infections with HEV take a subclinical or mild course and fulminant hepatic failure is a rare outcome (Lewis et al., 2010; Pavio et al., 2010). Infection in pregnant women is
* Corresponding author. Present address: Veterinary Virology and Animal Viral Diseases, Department of Infectious and Parasitic Diseases, FARAH, Faculty of Veterinary Medicine, University of Lie`ge, Lie`ge, Belgium. Tel.: +32 43664251. E-mail addresses: [email protected], [email protected] (E.F. Oliveira-Filho). http://dx.doi.org/10.1016/j.vetmic.2014.09.011 0378-1135/ß 2014 Elsevier B.V. All rights reserved.
generally more severe with remarkably high morbidity and case-fatality rates; the latter can reach 25% after infection during the third trimester. Vertical transmission associated with a high neonatal mortality rate has also been reported (Khuroo and Kamili, 2009). The causative agent hepatitis E virus (HEV) is a nonenveloped positive strand RNA virus with a diameter of 27–32 nm. The HEV genome has a size of approximately 7.2 kb and contains three open reading frames (ORF). The virus belongs to the family Hepeviridae, genus Orthohepevirus A, which is subdivided into seven genotypes (Smith et al., 2014). Classification of HEV subtypes or subgenotypes is under discussion. Subdivision into 24 subtypes has been proposed (Lu et al., 2006), however inconsistencies concerning this subtype classification were demonstrated by two recent publications using different methodologies (Oliveira-Filho et al., 2013; Smith et al., 2013). Epidemiological data suggests that genotype distribution as well as prevalence rates vary considerably between
234
E.F. Oliveira-Filho et al. / Veterinary Microbiology 174 (2014) 233–238
continents and countries. Genotype HEV-1 has mainly been detected in Asia and the north of Africa and genotype HEV-2 was originally isolated from a single outbreak in Mexico, but is now also found in Africa (Van der Poel, 2014). First detected in domestic swine in the USA, genotype HEV-3 is now found on all continents (Oliveira-Filho et al., 2013). Members of genotype HEV-4 have been detected in Asia and more recently in both animal and humans in Europe (Van der Poel, 2014; Wichmann et al., 2008). Genotype HEV-5 and HEV-6 have been found only in Japanese wild boar, while genotype HEV-7 has been isolated in dromedary camels from Dubai (Smith et al., 2014). HEV is present in both domestic and wild animals such as swine, wild boar, roe deer, rabbits and rats (Johne et al., 2010; Pavio et al., 2010). Natural infection of domestic pigs with HEV was first seen in 1997 in the United States (Meng et al., 1997), genotypes HEV-3 and 4 are now known to circulate in animals in many countries such as China, India and parts of Europe (Van der Poel, 2014). To date clinical disease has not been associated with HEV in animals. Sequences from human and animal HEVs are closely related and zoonotic transmission has been demonstrated (Pavio et al., 2010). In Germany infection with HEV genotypes 3 and 4 has been reported in humans, including recent autochthonous cases which were correlated with consumption of undercooked meat products, e.g. from wild boar (Wichmann et al., 2008). Furthermore studies in Germany showed the presence of HEV in the swine and wild boar population (Adlhoch et al., 2009; Kaci et al., 2008; Schielke et al., 2009; Wenzel et al., 2011). In order to assess the risk of HEV transmission between animals and humans an extensive epidemiological and phylogenetic study is required. Here we report the detection of HEV in German domestic swine and free-living wild boar together with phylogenetic analyses using different parts of the HEV genome. 2. Materials and methods 2.1. Samples A total of 105 domestic swine fecal samples were collected between 2003 and 2006 during a survey throughout Germany. In addition 124 blood samples from free living wild boar collected in conjunction with Classical Swine Fever Virus surveillance. These samples were from the state of Hessen, collected in 2008 and kindly provided by the ‘‘Landesbetrieb Hessisches Landeslabor, Giessen’’. Age and sex of the majority of animals are unknown. 2.2. RNA extraction and molecular detection of HEV Fecal samples were suspended in phosphate buffered saline (PBS) at a dilution of 1:10. RNA was extracted from 140 ml fecal suspension or serum using the QIAamp Viral RNA Mini KitTM (Qiagen) according to the manufacturer’s instructions. RT-PCR was performed as described previously using primers F1 (AGCTCCTGTACCTGATGTTGACTC), R1 (CTACAGAGCGCCAGCCTTGATTGC), F2 (GCTCACGTCATCTGTCGCTGCTGG) and R2 (GGGCTGAACCAAAATCCT-
GACATC) which amplify fragments of 404 nt and 241 nt, respectively, from the ORF2 region of the HEV genome (Lee et al., 2007). To allow cloning and sequencing of the complete sequence of HEV isolate from domestic swine, the nonstructural polyprotein (ORF1) was divided in seven regions and the entire capsid protein (ORF2) was divided in four regions. For each region, one pair of primers was designed using the Primer Express1 software and are included in supplementary Table S1. RT-PCR was performed using the OneStep RT-PCR KitTM (Qiagen) as per manufacturer’s instructions. 2.3. Cloning and phylogenetic analyses PCR products of the expected size (241 nt) were further analyzed. After gel extraction using the QIAquick Gel Extraction KitTM (Qiagen) and cloning using the TOPO TA cloning kitTM (Invitrogen) plasmid DNA was transferred to sequencing by Qiagen (Hilden, Germany) or Seqlab (Go¨ttingen, Germany). Sequences were compared to Genbank entries and phylogenetic analyses performed using the HUSAR package (DKFZ, Heidelberg). Phylogenetic distances were calculated by the Kimura-2-parameter method (Kimura, 1980) and unrooted trees generated based on the neighbor-joining method (Saitou and Nei, 1987). A bootstrap analysis with 1000 replicates was included. Branch lengths are proportional to genetic distances. The sequences were submitted to GenBank and accession numbers are given on Table 1. 3. Results and discussion 3.1. Detection of HEV in swine and wild boar samples A fragment of 241 nucleotides (nt) from the capsid gene region of the HEV genome was amplified in one out of 105 fecal samples from domestic swine. The animal, a fourmonth-old female Pietrain breed, was clinically healthy and originated from Giessen (Hesse state). Wild boar sera were obtained from the national classical swine fever surveillance program. HEV could be detected in 18 out of the 124 sera with positive animals being distributed over the sampling area (Fig. 1 and Table 1). No information about sex and age of the animals was available. The results of the current study imply that HEV is endemic in the wild boar population of western Hesse. Domestic swine and wild boar have been reported as the major animal reservoir of HEV. Indeed, retrospective studies suggest that HEV circulated in both domestic swine and wild boar for decades (Casas et al., 2009; Kaci et al., 2008). The high prevalence rate observed in wild boar in the current study is comparable to those previously found in other parts of Germany (Adlhoch et al., 2009; Schielke et al., 2009) and other European countries such as Spain and Italy (de Deus et al., 2008; Martelli et al., 2008). Lower prevalence rates were reported in France, the Netherlands and in a retrospective study for Germany (Kaba et al., 2009; Kaci et al., 2008; Rutjes et al., 2009). In contrast to the widespread occurrence of HEV in wild boar only one sample from domestic swine was found
E.F. Oliveira-Filho et al. / Veterinary Microbiology 174 (2014) 233–238
235
Table 1 Regions where positive wild boar samples were found; subtyping and subgenotyping according to 241 b and 1983 b; accession numbers. Region
N. pos
Sample identification
Subtype
Subgenotype
Accession numbers
241b
Capsid
Rheingau-Taunus-Kreis
2
WB 1, WB 121
3i, 3h 3a, 3b, 3j
3i
3.1 3.1
KF303501 KF303496
Wiesbaden
2
WB 22 WB 24
3i 3i, 3h
3.1 3.1
KF303486 KF303485
Lahn-Dill-Kreis/Wetzlar
7
WB WB WB WB WB WB WB
3i 3i 3i 3i 3i 3a, 3b, 3j 3a, 3b, 3j
3.1 3.1 3.1 3.1 3.1 3.1 3.1
KF303494 KF303489 KF303490 KF303493 KF303491 KF303484 KF303498
Marburg-Biedenkopf/Lahn
3
WB 34 WB 91 WB 122
3i, 3h 3i 3a
3a
3.1 3.1 3.1
KF303487 KF303488 KF303499
Waldeck-Frankenberg Hochtaunuskreis
1 1
WB 52 WB 69
3i 3a, 3b, 3j
3a
3.1 3.1
KF303492 KF303500
Limburg
2
WB 118 WB 120
3i 3a, 3b, 3j
3.1 3.1
KF303495 KF303497
Total
18
25 75 76 104 119 117 124
Fig. 1. Geographical distribution of wild boar samples. Grid (blue) indicates where positive samples were found and diagonal lines (red) shows regions where negative samples were collected. (For interpretation of the references to color in figure legend, the reader is referred to the web version of the article.) Map build with Quantum GIS –QGIS Development Team, 2012. QGIS Geographic Information System. Open Source Geospatial Foundation Project. http:// qgis.osgeo.org.
236
E.F. Oliveira-Filho et al. / Veterinary Microbiology 174 (2014) 233–238
positive in our study. Prevalence rates in domestic swine vary considerably between countries and studies. Low prevalence was previously reported from China, Japan, India and Korea (Geng et al., 2010; Lee et al., 2009; Sakano et al., 2009; Vivek and Kang, 2011). In contrast significantly higher HEV positive rates were observed in studies from Brazil, China, Japan, United States and European countries including France and the Netherlands (dos Santos et al., 2009; Geng et al., 2011; Huang et al., 2002; Kaba et al., 2009; van der Poel et al., 2001). Reasons for the remarkable discrepancies are not clear but technical differences between studies may play a role. In the current study serum samples from wild boar and fecal samples from domestic swine were investigated. This difference in the source of samples may have biased our results. After experimental infection in domestic swine, HEV has been shown to be detected more frequently and for longer periods in feces in comparison to blood samples (Bouwknegt et al., 2009). Thus, a prolonged presence of HEV in the blood stream in comparison to virus excretion via feces is unlikely. Another factor to be taken into account for fecal samples is the presence of RT-PCR inhibitors. We used a standard purification protocol validated for fecal samples. However we did neither test for inhibitors nor quantify the amount of HEV RNA. According to both field and experimental studies detection rates are correlated with the age of animals. HEV RNA appears to be more easily detectable in domestic pigs up to six months of age in comparison to older animals (dos Santos et al., 2009; Geng et al., 2011; Huang et al., 2002). For animals in our study we have limited information about age. Social, behavioral and environmental differences between domestic swine and wild boar play a role in viral transmission. Wild boars, as free-living opportunistic omnivores, are probably more exposed to constant re-infection. For domestic swine the kind of husbandry, hygiene conditions and the restriction of animal contacts probably influence the prevalence rates. 3.2. Phylogenetic analyses HEV is currently divided into seven genotypes, HEV-1– 7. The subtype classification is controversial. Currently, the mostly accepted classification of 24 HEV subtypes has been proposed by Lu and colleagues (Lu et al., 2006). They divided HEV-3 into 10 subtypes (a–j). However, recent studies have shown inconsistencies within this classification. The separation of genotypes into subtypes does not actually reflect neither the distribution of amino acid or nucleotide pairwise distances values (Smith et al., 2013). As such, there is a low accuracy defining subtypes (Oliveira-Filho et al., 2013). The nucleotide pairwise corrected distances variation for the 241 nt PCR fragments from the capsid region of the HEV genome ranged between 11.57 and 21.45% when sequences from domestic pig and wild boar were compared. Within wild boar sequences nucleotide variation from 0 to 21.61% was observed. Phylogenetic analyses placed the sequences determined in the present study in different branches within
genotype HEV-3. Accordingly four separate groups were identified (Supplement Fig. S1). However this clustering was not supported by significant bootstrap values. In order to establish a more robust phylogeny, analyses were extended to the entire capsid gene. Due to limited amounts and quality of samples, capsid encoding sequences were obtained only from three wild boar samples (WB1, WB69 and WB122) and the positive domestic swine (GiSw). Phylogenetic analysis based on complete capsid gene sequences was supported by high bootstraps values and allowed a convincing separation of our sequences (Fig. 2). The WB1 sequence clustered in one branch together with two previously reported viruses from wild boar from Germany classified as subtype 3i (FJ705359 and FJ998008) (Adlhoch et al., 2009; Schielke et al., 2009) with genetic differences between 10.66 and 13.54%. The other two wild boar capsid sequences WB122 and WB69 grouped together with virus from the domestic swine (GiSw) and published HEV sequences classified as subtype 3a according to Lu and co-workers (Lu et al., 2006). Using the recently proposed classification all complete capsid gene sequences clustered into subgenotype 3.1 (Oliveira-Filho et al., 2013). The heterogeneity of HEV detected in wild boar in Germany is remarkable and the overall degree of genetic heterogeneity was up to 16.3% (Supplement Table S3). No developing lineage or geographic clustering was observed. These findings together with the high prevalence observed here and by previous studies (Adlhoch et al., 2009; Schielke et al., 2009) imply that HEV is widespread and likely to be endemic in the wild boar population of Germany. The prolonged persistence may have driven evolution of the virus leading to such heterogeneity. This also could be explained by the fact that the virus is more widespread in the wild boar population and the viral circulation in the domestic swineherds is slower. Previously in Germany an epidemiological study with hepatitis E patients pointed to the consumption of wild boar meat products as probable origin (Wichmann et al., 2008). In the current study sequences from wild boar intermingled with HEV from domestic swine and human cases which indicates the possibility of transmission of virus between wild boar and domestic swine as well as to man. 3.3. Complete sequence of HEV isolate from domestic swine The genome of GiSw HEV consists of three ORFs with a size of 1708 aa (ORF1), 660 aa (ORF2) and 123 aa (ORF3) flanked by 50 and 30 non-coding regions that were not sequenced. Like other HEV complete sequences GiSw ORF1 encoded conserved sequence motifs that allow putative designation of proteins: methyltransferase 34–355 aa, papain-like cysteine protease 432–592 aa, helicase 980–1199 aa and RNA-dependent RNA polymerase 1412–1594 aa. Phylogenetic analysis demonstrated a close relationship between complete sequence of GiSw and other genotype HEV-3 sequences. Pairwise genetic distances ranged from 9.88 to 26.35% (Supplement Table S4). GiSw clustered in a branch together with porcine HEV found in
E.F. Oliveira-Filho et al. / Veterinary Microbiology 174 (2014) 233–238
237
Fig. 2. Phylogenetic analysis based on complete capsid gene sequences. Sequences identification in bold and underlined represent sequences found in this study. Phylogenetic distances were calculated using the Kimura-2 parameter method. Tree was calculated by the neighbor-joining method. The branch lengths are proportional to the genetic distances. A bootstrap analysis of 1000 replicates was included; numbers indicate bootstrap values. Additional sequences were obtained from GenBank together with accession numbers indicated.
Korea (FJ426404 and FJ426403) and the US (AF082843) as well as HEV from human patients from the US (AF060669 and AF060668) and AB591734 detected in Mongoose in Japan (supplement Fig. S2). 4. Conclusions The results of this study confirm that HEV is circulating between both wild boar and domestic swine populations in Germany. HEV isolates from animals analyzed here are closely related to human isolates indicating zoonotic risk in case of undercooked meat products from swine or wild boar are consumed. Further studies are necessary to understand the mode of HEV transmission between animal populations (and humans) as well as the pathogenesis of the disease. Acknowledgments Wild boar serum samples were kindly provided by the ‘‘Landesbetrieb Hessisches Landeslabor’’ in Giessen, Germany. We thank Damien Thiry for assistance with the map and Annette Dougall for the English correction of the manuscript. Appendix A. Supplementary data Supplementary data associated with this article can be found, in the online version, at http://dx.doi.org/10.1016/ j.vetmic.2014.09.011.
References Adlhoch, C., Wolf, A., Meisel, H., Kaiser, M., Ellerbrok, H., Pauli, G., 2009. High HEV presence in four different wild boar populations in East and West Germany. Vet. Microbiol. 139, 270–278. Bouwknegt, M., Rutjes, S.A., Reusken, C.B., Stockhofe-Zurwieden, N., Frankena, K., de Jong, M.C., de Roda Husman, A.M., Poel, W.H., 2009. The course of hepatitis E virus infection in pigs after contactinfection and intravenous inoculation. BMC Vet. Res. 5, 7. Casas, M., Pujols, J., Rosell, R., de Deus, N., Peralta, B., Pina, S., Casal, J., Martı´n, M., 2009. Retrospective serological study on hepatitis E infection in pigs from 1985 to 1997 in Spain. Vet. Microbiol. 135, 248–252. de Deus, N., Peralta, B., Pina, S., Allepuz, A., Mateu, E., Vidal, D., Ruiz-Fons, F., Martı´n, M., Gorta´zar, C., Segale´s, J., 2008. Epidemiological study of hepatitis E virus infection in European wild boars (Sus scrofa) in Spain. Vet. Microbiol. 129, 163–170. dos Santos, D.R., Vitral, C.L., de Paula, V.S., Marchevsky, R.S., Lopes, J.F., Gaspar, A.M., Saddi, T.M., Ju´ nior, N.C., Guimara˜ es, F.e.R., Ju´nior, J.G., Ximenes, L.L., Souto, F.J., Pinto, M.A., 2009. Serological and molecular evidence of hepatitis E virus in swine in Brazil. Vet. J. 182, 474–480. Geng, J., Wang, L., Wang, X., Fu, H., Bu, Q., Liu, P., Zhu, Y., Wang, M., Sui, Y., Zhuang, H., 2011. Potential risk of zoonotic transmission from young swine to human: seroepidemiological and genetic characterization of hepatitis E virus in human and various animals in Beijing, China. J. Viral Hepat. 18, e583–e590. Geng, Y., Wang, C., Zhao, C., Yu, X., Harrison, T.J., Tian, K., Wang, Y., 2010. Serological prevalence of hepatitis E virus in domestic animals and diversity of genotype 4 hepatitis E virus in China. Vector Borne Zoonotic Dis 10, 765–770. Huang, F.F., Haqshenas, G., Guenette, D.K., Halbur, P.G., Schommer, S.K., Pierson, F.W., Toth, T.E., Meng, X.J., 2002. Detection by reverse transcription-PCR and genetic characterization of field isolates of swine hepatitis E virus from pigs in different geographic regions of the United States. J. Clin. Microbiol. 40, 1326–1332. Johne, R., Heckel, G., Plenge-Bo¨nig, A., Kindler, E., Maresch, C., Reetz, J., Schielke, A., Ulrich, R.G., 2010. Novel hepatitis E virus genotype in Norway rats, Germany. Emerg. Infect. Dis. 16, 1452–1455.
238
E.F. Oliveira-Filho et al. / Veterinary Microbiology 174 (2014) 233–238
Kaba, M., Davoust, B., Marie´, J.L., Barthet, M., Henry, M., Tamalet, C., Raoult, D., Colson, P., 2009. Frequent transmission of hepatitis E virus among piglets in farms in Southern France. J. Med. Virol. 81, 1750–1759. Kaci, S., No¨ckler, K., Johne, R., 2008. Detection of hepatitis E virus in archived German wild boar serum samples. Vet. Microbiol. 128, 380–385. Khuroo, M.S., Kamili, S., 2009. Clinical course and duration of viremia in vertically transmitted hepatitis E virus (HEV) infection in babies born to HEV-infected mothers. J. Viral Hepat. 16, 519–523. Kimura, M., 1980. A simple method for estimating evolutionary rates of base substitutions through comparative studies of nucleotide sequences. J. Mol. Evol. 16, 111–120. Lee, S.H., Kang, S.C., Kim, D.Y., Bae, J.H., Kim, J.H., 2007. Detection of swine hepatitis E virus in the porcine hepatic lesion in Jeju Island. J. Vet. Sci. 8, 51–55. Lee, W.J., Kang, M.L., Cha, S.B., Park, B.K., Choi, I.S., Yoo, H.S., 2009. Analysis of the helicase gene of Korean swine hepatitis E virus isolates and trends in viral infection. Arch. Virol. 154, 1361–1364. Lewis, H.C., Wichmann, O., Duizer, E., 2010. Transmission routes and risk factors for autochthonous hepatitis E virus infection in Europe: a systematic review. Epidemiol. Infect. 138, 145–166. Lu, L., Li, C., Hagedorn, C.H., 2006. Phylogenetic analysis of global hepatitis E virus sequences: genetic diversity, subtypes and zoonosis. Rev. Med. Virol. 16, 5–36. Martelli, F., Caprioli, A., Zengarini, M., Marata, A., Fiegna, C., Di Bartolo, I., Ruggeri, F.M., Delogu, M., Ostanello, F., 2008. Detection of hepatitis E virus (HEV) in a demographic managed wild boar (Sus scrofa scrofa) population in Italy. Vet. Microbiol. 126, 74–81. Meng, X.J., Purcell, R.H., Halbur, P.G., Lehman, J.R., Webb, D.M., Tsareva, T.S., Haynes, J.S., Thacker, B.J., Emerson, S.U., 1997. A novel virus in swine is closely related to the human hepatitis E virus. Proc. Natl. Acad. Sci. U. S. A. 94, 9860–9865. Oliveira-Filho, E.F., Ko¨nig, M., Thiel, H.J., 2013. Genetic variability of HEV isolates: inconsistencies of current classification. Vet. Microbiol. 165, 148–154. Pavio, N., Meng, X.J., Renou, C., 2010. Zoonotic hepatitis E: animal reservoirs and emerging risks. Vet. Res. 41, 46.
Rutjes, S.A., Lodder, W.J., Lodder-Verschoor, F., van den Berg, H.H., Vennema, H., Duizer, E., Koopmans, M., de Roda Husman, A.M., 2009. Sources of hepatitis E virus genotype 3 in The Netherlands. Emerg. Infect. Dis. 15, 381–387. Saitou, N., Nei, M., 1987. The neighbor-joining method: a new method for reconstructing phylogenetic trees. Mol. Biol. Evol. 4, 406–425. Sakano, C., Morita, Y., Shiono, M., Yokota, Y., Mokudai, T., Sato-Motoi, Y., Noda, A., Nobusawa, T., Sakaniwa, H., Nagai, A., Kabeya, H., Maruyama, S., Yamamoto, S., Sato, H., Kimura, H., 2009. Prevalence of hepatitis E virus (HEV) infection in wild boars (Sus scrofa leucomystax) and pigs in Gunma Prefecture, Japan. J. Vet. Med. Sci. 71, 21–25. Schielke, A., Sachs, K., Lierz, M., Appel, B., Jansen, A., Johne, R., 2009. Detection of hepatitis E virus in wild boars of rural and urban regions in Germany and whole genome characterization of an endemic strain. Virol. J. 6, 58. Smith, D.B., Purdy, M.A., Simmonds, P., 2013. Genetic variability and the classification of hepatitis E virus. J. Virol. 87, 4161–4169. Smith, D.B., Simmonds, P., Jameel, S., Emerson, S.U., Harrison, T.J., Meng, X.J., Okamoto, H., Van der Poel, W.H., Purdy, M.A., 2014. Consensus proposals for classification of the family hepeviridae. J. Gen. Virol. 95, 2223–2232. Van der Poel, W.H., 2014. Food and environmental routes of hepatitis E virus transmission. Curr. Opin. Virol. 4, 91–96. van der Poel, W.H., Verschoor, F., van der Heide, R., Herrera, M.I., Vivo, A., Kooreman, M., de Roda Husman, A.M., 2001. Hepatitis E virus sequences in swine related to sequences in humans, The Netherlands. Emerg. Infect. Dis. 7, 970–976. Vivek, R., Kang, G., 2011. Hepatitis E virus infections in swine and swine handlers in Vellore, Southern India. Am. J. Trop. Med. Hyg. 84, 647–649. Wenzel, J.J., Preiss, J., Schemmerer, M., Huber, B., Plentz, A., Jilg, W., 2011. Detection of hepatitis E virus (HEV) from porcine livers in Southeastern Germany and high sequence homology to human HEV isolates. J. Clin. Virol. 52, 50–54. Wichmann, O., Schimanski, S., Koch, J., Kohler, M., Rothe, C., Plentz, A., Jilg, W., Stark, K., 2008. Phylogenetic and case–control study on hepatitis E virus infection in Germany. J. Infect. Dis. 198, 1732–1741.