- Email: [email protected]
Phylogenetic analysis of Indian rabies virus isolates targeting the complete glycoprotein gene
Infection, Genetics and Evolution 36 (2015) 333–338
Contents lists available at ScienceDirect
Infection, Genetics and Evolution journal homepage: www.elsevier.com/locate/meegid
Phylogenetic analysis of Indian rabies virus isolates targeting the complete glycoprotein gene Susan Cherian a, Rajendra Singh a,⁎, K.P. Singh b, G.B. Manjunatha Reddy c, Anjaneya a, G.V.P.P.S. Ravi Kumar d, T.G. Sumithra e, R.P. Singh f a
Division of Pathology, Indian Veterinary Research Institute, Izatnagar, Bareilly, U.P. 243 122, India CARDRAD, Indian Veterinary Research Institute, Izatnagar, Bareilly, U.P. 243 122, India NIVEDI, Bengaluru, Karnataka 560 064, India d Division of Animal Biotechnology, Indian Veterinary Research Institute, Izatnagar, Bareilly, U.P. 243 122, India e Department of Veterinary Microbiology, College of Veterinary And Animal Sciences, Pookot, Wayanad, Kerala 673 576, India f Division of Biological Products, Indian Veterinary Research Institute, Izatnagar, Bareilly, U.P. 243 122, India b c
a r t i c l e
i n f o
Article history: Received 23 January 2015 Received in revised form 19 August 2015 Accepted 25 September 2015 Available online 30 September 2015 Keywords: Rabies virus Indian isolate G gene Phylogenetic analysis Wildlife species
a b s t r a c t Rabies a fatal viral zoonosis is endemic in India. There is no report on phylogenetic study of Indian rabies virus isolates based on the complete G gene. In the present study, a total of 25 rabies positive brain samples collected during 2001–2014 from North India (UP, MP, Delhi, Rajasthan), South India (Kerala and Karnataka) and Gujarat states belonging to six different host species were subjected to G gene amplification by RT-PCR as three overlapping fragments of 881 bp, 991 bp and 618 bp. Phylogenetic analysis revealed that all Indian rabies virus isolates are genetically closely related with Arctic-like 1a lineage viruses. However, two distinct clusters were identified namely, India South and India North. All the Indian rabies isolates had 95.5–100% homology related to geography, but not to host species. Deduced amino acids on comparison revealed two amino acid changes, aa 356 in ECTO; N → K and aa 458; M → I, which were found to distinguish between the India South and India North isolates. © 2015 Published by Elsevier B.V.
1. Introduction Rabies is a fatal encephalomyelitic viral zoonotic disease of mammals caused by viruses belonging to genus Lyssavirus under Rhabdoviridae family. Out of fourteen different species in Lyssavirus, classical rabies virus is responsible for most rabies cases in terrestrial mammals globally. Rabies occurs in two different epidemiological cycles: urban rabies and sylvatic rabies. In urban rabies, mostly stray dogs and in sylvatic rabies different wildlife species act as reservoirs and/or transmitters of the disease to humans and domestic animals. In India, dogs are the reservoir host which transmits the disease. The human deaths due to dog rabies is estimated to be 70,000 per annum worldwide, a major share of which is reported from South Asian countries (approx. 45%) (Hampson et al., 2011). India is a forerunner among the rabies endemic Asian countries with the largest number of reported human deaths (WHO Expert Consultation on Rabies, 2013). Rabies virus (RABV) is bullet shaped with a length of 180 nm and a diameter of 75 nm (Davies et al., 1963) and has an approximately 12 kb long single-stranded, non-segmented, negative-sense RNA genome encoding five structural proteins, 3′-N–P–M–G–L-5′; N (nucleoprotein), ⁎ Corresponding author. E-mail addresses: [email protected] (S. Cherian), [email protected] (R. Singh).
http://dx.doi.org/10.1016/j.meegid.2015.09.024 1567-1348/© 2015 Published by Elsevier B.V.
P (phosphoprotein), M (matrix protein), G (glycoprotein) and L (RNA-dependent RNA polymerase) (Wunner et al., 1988; Tordo and Kouknetzoff, 1993). The order of relative conservation of these five genes from high to low could be either N N L N M N P N G or N N L N M N G N P (Wu et al., 2007). The precursor RVG is 524 amino acid (aa) in length, consisting of a signal peptide of 19 aa in the N terminal while the mature 505 aa protein comprises a 439 aa ecto-domain (ECTO), a 22 aa trans-membrane domain (TM) and a C-terminal endo-domain (ENDO)/cytoplasmic domain (G-CD) of 44 aa (Anilionis et al., 1981; Yelverton et al., 1983; Conzelmann et al., 1990). RVG plays an essential role in pathogenesis, neurovirulence and production of neutralizing antibodies (Wiktor et al., 1973; Lentz et al., 1982; Tuffereau et al., 1989; Etessami et al., 2000). Continuous monitoring of RABV variants is necessary to see the pattern distribution of the disease and source of infection and to help rabies control strategies. In India, majority of the rabies phylogenetic studies have targeted the N gene, P gene, G-CD, noncoding G–L intergenic region (Psi) and the L region (Psi–L region) and partial G gene of RABV genome (Jayakumar et al., 2004; Nadin-Davis et al., 2007; Nagarajan et al., 2006, 2009;; Reddy et al., 2014). Genetic structuring of RABV variants maintained among dog populations was according to geographic location in India (Jayakumar et al., 2004; Nagarajan et al., 2006). Nagarajan et al. (2009) described that RV isolates in Southern India were similar to one another forming a single major genetic cluster not ordered by geography and dissimilar to RABV isolates in Northern
334
S. Cherian et al. / Infection, Genetics and Evolution 36 (2015) 333–338
India and in other parts of the world based on analysis of partial N gene sequences. Further, RABVs of Indian origin were found to have close homology with Arctic-like lineage (Nadin-Davis et al., 2007; Reddy et al., 2011). G gene can be used as a marker to study genetic diversity and antigenic typing because of having several major antigenic sites and relatedness with pathogenicity (Badrane and Tordo, 2001; Yang et al., 2011). However, the studies targeting G gene are limited especially those giving due importance to isolates from both North and South India. 2. Materials and methods 2.1. Samples Twenty five brain samples of animals that died of rabies like symptoms collected during 2002–2014 from north (1 Rajasthan, 1 Madhya Pradesh, 2 Gujarat, 3 Delhi and 5 Uttar Pradesh) and south (6 Karnataka and 7 Kerala) were utilized in this study. These include 14 dogs, 7 cattles, 1 Himalayan black bear, 1 sambar deer, 1 mongoose and 1 hyena (Table 2). The samples were confirmed positive for rabies by dFAT on impression smears and were stored at −80 °C till further use. 2.2. RNA extraction The total RNA was extracted from the brain samples using RNAeasy lipid tissue minikit (Qiagen) as per manufacturer's instructions. Briefly 100 mg of brain was used and the extracted RNA was quantified using Nanodrop (Thermo Scientific, USA). 2.3. RT-PCR One step RT-PCR (RobusT II RT-PCR kit, Finnzymes) was performed using specifically designed primers (Table 1) which amplified whole 1575 bp G gene as three overlapping fragments of 881 bp, 991 bp and 618 bp respectively. PCR reactions were carried out in a 50 μl volume of reaction mix containing 500 ng of total RNA, 1× PCR reaction buffer, 1.5 mM MgCl2, 250 μM dNTPs, 20 pmol of each primer, 10 U M-MuLV RT RNase H- and 10 U DyNAzyme EXT DNA Polymerase. Briefly the cycling conditions included a reverse transcription at 37 °C for 45 min followed by an initial denaturation at 94 °C for 2 min. This was followed by 29 cycles, each consisting of a denaturation at 94 °C for 30 s, annealing 49 °C (RVG1F and RVG1R), 55 °C (RVG2F and RVG2R) and 45 °C (RVG3F and RVG3R) and annealing at 72 °C for 1 min. The final stage of the reaction included an extension of 10 min at 72 °C. PCR products were resolved by gel electrophoresis on 2% agarose containing 0.5% ethidium bromide and visualized under UV light. 2.4. Sequencing and phylogenetic analysis The amplified PCR products were purified with the QIAquick PCR gel extraction kit (Qiagen) as per manufacturer's instructions. The purified PCR products were sequenced commercially (Europhins Pvt Ltd, India) by Sanger's di-deoxy method using the gene specific primers. The sequences were edited and compiled using Editseq (DNASTAR Inc., USA) to obtain the complete 1575 bp of the G gene which covered whole
Table 1 List of primers used in present study. Sl. no.
Primer ID
Sequence
1. 2. 3. 4. 5. 6.
RVGIF RVGIR RVG2F RVG2R RVG3F RVG3R
5′ TGGGGGCAATATAACAAAAA 3′ 5′ TTCATCTACAAAGCCGCAAGTC 3′ 5′ GAGCCGCGTACAACTGGAAGA 3′ 5′ TCGTGCACATCGGGAAGGT 3′ 5′ TGCAATCATCCCTCCTC 3′ 5′ GAAAGCACCGTTAGTCAC 3′
524 aa. Pair alignments and sequence identity generation were performed using MegAlign (DNASTAR, USA). GenBank accession numbers for the 25 complete G gene sequences newly acquired in this study are designated as KM 492745–KM492765, KM408747 and KM278992–KM278994. The sequences were subjected to BLAST search and complete G gene sequences from neighboring countries (Bangladesh, Nepal, Pakistan and Afghanistan) were selected and included along with representative sequences from different parts of the world in this phylogenetic study (Table 2). The sequences were aligned using ClustalW and a NJ tree was constructed by MEGA version 6.06 (Tamura et al., 2013) using Tamura 3-parameter model. The confidence in the NJ tree was estimated by 1000 bootstrap replicates. Similar analysis was conducted for
Table 2 Description of RABV isolates used in phylogenetic analysis of complete G gene. RABV isolates highlighted in red and green are generated in this study. Sl no 1. 2. 3. 4. 5.
IRV1-RD IRV2-RD IRV3-RC IRV4-RC IRV5-RH
6. 7. 8. 9. 10. 11. 12. 13. 14. 15. 16. 17. 18. 19. 20. 21. 22. 23. 24. 25. 26. 27. 28. 29.
IRV6-RD IRV7-RD IRV8-RC IRV9-RD IRV10-RHB IRV11-RM IRV12-RS IRV13-RC IRV14-RC IRV15-RD IRV16-RD IRV17-RD IRV18-RC IRV19-RD IRV20-RD IRV21-RC IRV22-RD IRV23-RD IRV24-RD IRV25-RD NNV-RAB-H DQ103705 AY956319 RVD
Bareilly, UP Gwalior, MP S.K. Nagar, Gujarat Anand, Gujarat Rathambore, Rajasthan Dog Lucknow, UP Dog Karnataka Cattle Rampur, UP Dog Bareilly, UP Himalayan black bear Delhi Mongoose Delhi Sambar deer Delhi Cattle Karnataka Cattle Karnataka Dog Karnataka Dog Karnataka Dog Kerala Cattle Kerala Dog Kerala Dog Kerala Cattle Kerala Dog Bareilly, UP Dog Karnataka Dog Kerala Dog Kerala Human India Dog India Human Germany-India Dog India
2001 2002 2008 2009 2010
Accession number KM492746 KM492748 KM492747 KM492749 KM408747
2011 2012 2013 2013 2013 2013 2013 2013 2013 2013 2013 2013 2013 2013 2013 2013 2014 2014 2014 2014 2006 2005 2004 1998
KM492750 KM492753 KM492751 KM492745 KM278992 KM278993 KM278994 KM492754 KM492755 KM492756 KM492757 KM492758 KM492759 KM492760 KM492761 KM492762 KM492752 KM492763 KM492764 KM492765 EF437215 DQ103705 AY956319 AY237121
Isolate name
Species
Place
Dog Dog Cattle Cattle Hyena
Year
Lineage Arctic like 1a Arctic like 1a Arctic like 1a Arctic like 1a Arctic like 1a
30. CHAND03
Dog
India
1999
AY987478
31. 32. 33. 34. 35. 36. 37. 38. 39. 40. 41.
BLY/99/EF rv61 04032AFG 04035AFG 02052AFG 11017 3878-78(11008NEP) 3878-09(11009 NEP) 3878-03 4403-16 NEP1-DG
Dog Human Dog Dog Dog Dog Goat Dog Dog Dog
India UK-India Afghanistan Afghanistan Afghanistan Nepal Nepal Nepal Nepal Nepal Nepal
1999 1987 2009 2004 2002 2011 2010 2010 2010 2009 2000
EF151231 JQ685981 JX987723 JX987720 JX987718 JX987727 JX944593 JX944586 JX944580 JX944577 AF325489
42. 43. 44. 45. 46. 47. 48. 49. 50.
9901NEP Pk23 Pk24 Pk56 Pk58 BDR2 BDR5 BDR7 H-08-1320
Dog Cattle Cattle Cattle Cattle Cattle Goat Cattle Human
Nepal Pakistan Pakistan Pakistan Pakistan Bangladesh Bangladesh Bangladesh Sri Lanka
1998 2010 2007 2007 2007 2010 2010 2007 2008
EU086153 HE802675 HE802676 HE801614 HE801616 AB699208 AB699220 AB699213 AB569299
51. 52. 53. 54. 55. 56. 57. 58. 59. 60. 61. 62. 63.
F01 CZJ0811 NeiMeng927B 02035CHI 9913BIR THAI1-HM MAL1-HM 04030PHI 13R13 KRVR0804 SKRBV0403CW SKRRD9903YG 9104USA (CRBIP8.32) 91RABN3899 90RABN9285 96321IRA HUN1-FX 9147FRA PM
Chinese ferret badger Dog Raccoon dog Dog Dog Human Human Human Dog Raccoon dog Cattle Raccoon dog Skunk
China China China China Myanmar Thailand Malaysia Philippines South Korea South Korea South Korea South Korea USA
2008 2008 2007 1997 1999 1983 1985 2004 2013 2008 2004 1999 1991
FJ825133 JN936791 EU284096 EU086136 EU086129 AF325488 AF325487 EU086155 KF437651 GU937026 DQ076095 DQ076099 JX987749
Arctic like 1a Arctic like 1a Arctic like 1a Arctic like 1a Arctic like 1a Arctic like 1a Arctic like 1a Arctic like 1a Arctic like 1a Arctic like 1a Arctic like 1a Arctic like 1a Arctic like 1a Arctic like 1a Arctic like 1a Arctic like 1a Arctic like 1a Arctic like 1a Arctic like 1a Arctic like 1a Arctic like 1a Arctic like 1a Arctic like 1a Indian subcontinent Indian subcontinent Arctic like 1a Arctic like 1a Arctic like 1b Arctic like 1b Arctic like 1b Arctic like 1a Arctic 3 Arctic like 1a Arctic 3 Arctic 3 Indian subcontinent Arctic like 1a Arctic like 1a Arctic like 1b Arctic like 1b Arctic like 1b Arctic like 1a Arctic like 1a Arctic like 1a Indian subcontinent Asian Asian Arctic like 2 Asian Asian Asian Asian Asian Arctic like 2 Arctic like 2 Arctic like 2 Arctic like 2 Arctic 1
Skunk Red fox Jackal Human Fox
Canada Canada Iran Hungary France
1991 1990 1996 1991 1991
U11743 U11756 JX987734 AF325462 EU293115 AJ871962
Arctic 1 Arctic 1 Cosmopolitan Cosmopolitan Cosmopolitan Cosmopolitan
M13215 GQ918139
Cosmopolitan Cosmopolitan
64. 65. 66. 67. 68. 69.
70. PV 71. CVS
S. Cherian et al. / Infection, Genetics and Evolution 36 (2015) 333–338
335
3. Results A total of 25 samples belonging to different species including wildlife from different regions of the country were confirmed positive for rabies by dFAT on impression smears which were used for G gene amplification and sequencing. 3.1. Phylogenetic analysis of complete G gene Twenty five RABV complete G gene sequences were aligned with other RABVs of genotype 1 (Table 2) in this study. The homologies of these 25 isolates were 95.5–100% at nucleotide level. The Indian isolates of the present study clustered together along with the Pakistan [Pk23], Nepal [3878-78(11008)] and other Indian RABVs [RVG, RV serotype 1, NNV-RAB-H, rv61, BLY/99] in Arctic like 1a lineage. Pk23 and 387878(11008) have 96.9–98.8% and 95–98.2% identity to the Indian isolates. All Indian RABVs of Arctic like 1a clade segregated into two genetic clusters India South and India North with bootstrap values 80 and 63 respectively (Fig. 1). India South consists of RABVs from the Southern region of India namely the states of Kerala, Karnataka along with state of Gujarat which is in the Western region of India while India North includes isolates from the Northern region of the country namely Delhi, Rajasthan, Uttar Pradesh and Madhya Pradesh (Fig. 2). In India South, isolates from Kerala, Karnataka and Gujarat formed three separate branches except for IRV14-RC and IRV15-RD two Karnataka isolates grouping among Kerala and IRV20-RD, a Kerala isolate among Karnataka isolates. Similarly in India North, isolates from Delhi grouped together and while isolates from Rajasthan, Uttar Pradesh and Madhya Pradesh formed a separate branch along with Pk23, a Pakistan isolate of cattle origin. Phylogenetic analysis based on partial G gene sequences of 1317 bp revealed similar clustering pattern as in complete G gene (Fig. S1) with an exception of two Indian isolates from Uttar Pradesh; IUP-R197 and IUP-R198 clustering in Arctic like 1b lineage. In addition to IRV14-RC and IRV15-RD, another two isolates from Karnataka namely IKA-R129
Fig. 1. Phylogenetic tree showing the genetic relationship of 25 rabies virus isolate complete G gene sequences. The sequences generated in this study are marked bold and only significant bootstrap values N80 are shown.
partial G gene (1317 bp) using additional 13 published Indian RABV sequences representing wide geographical area of India (Table S1). Deduced aa sequence of glycoprotein (524 aa) of all 25 RABVs along with other representative isolates of Arctic like Ia clade and other clades along with vaccine strain Pasteur virus was analyzed for variations. Partial deduced aa sequences of RABV glycoprotein were also analyzed by including 13 additional published sequences from India.
Fig. 2. Map depicting the distribution of RABV India South and India North clusters of present study in different states of India.
336
S. Cherian et al. / Infection, Genetics and Evolution 36 (2015) 333–338
and IKA-R144 also grouped among Kerala isolates. India North included two isolates from Andhra Pradesh, IAP-R90 and IAP-R91 which is in Southern region (Fig. S1). 3.2. Comparison of amino acids The RABV isolates of the present study exhibited identity of 95.6– 100% at aa level. Pk23 and 3878-78(11008) exhibited 97.3–100% and 97.3–99.6% identity respectively with the Indian RABVs of Arctic like 1a lineage. Analysis of the deduced aa sequences of glycoprotein revealed the conservation of antigenic site I, IIb and III in all 25 Indian isolates. Similarly the two N-glycosylation sites at amino acid positions 37 and 319, Arginine residue at 333 and 14 cysteine residues in the ECTO were present in all 25 RABVs. Antigenic site IIa is conserved in most isolates except IRV6-RD (Uttar Pradesh) at aa 39; S → T. All India North isolates including Pk23, and 3878-78(11008) differed from India South RABVs at aa 356 of ECTO; N → K consistent for all India North except IRV2-RD, a Madhya Pradesh isolate of dog origin and aa 458; M → I in all IG2 isolates in mature glycoprotein of 505 aa (Figs. 3 & 4). Partial aa sequences of glycoprotein revealed aa 356 of ECTO; N → K in all India North isolates including two isolates from Andhra Pradesh, IAP-R90 and IAP-R91 (Fig. S2). 4. Discussion Twenty five rabies positive brain samples were utilized in this study which were collected during 2001–2014 from 7 seven states of India
isolated from 6 different species including dog, cattle, hyena, Himalayan black bear, mongoose and sambar deer. Phylogenetic analysis of the complete G gene revealed that Indian isolates belong to Arctic like 1a clade (Nadin-Davis et al., 2007; Reddy et al., 2011; Reddy et al., 2014) and formed 2 clusters namely India South and India North based on geographical region with a distinct separate clustering of North and South Indian RABV isolates. However partial G gene analysis in addition revealed the evidence of Arctic like 1b lineage in India which is prevalent in Pakistan and Afghanistan (Reddy et al., 2014). This is in agreement to the findings of phylogenetic studies of G gene that RABV isolates cluster on the basis of geographic region and not on host species (Bourhy et al., 1999; Yang et al., 2011; Saito et al., 2013). Research targeting other regions of genome of Indian RABVs is also in agreement regarding the separate region wise clustering (Jayakumar et al., 2004; Nadin-Davis et al., 2007; Nagarajan et al., 2006, 2009; Reddy et al., 2011). Dogs are the reservoir host in India that infect other dead end hosts and therefore lack of clustering based on host species is not significant. Physical barriers like mountain ranges and rivers which can contribute to the evolution RABVs in a region (Bourhy et al., 1999; Biek et al., 2007; Brunker et al., 2012) might have directed to the evolution of genetically distinct isolates in North and South India. The grouping of Pk23, a Pakistan isolate of cattle origin and 3878-78 (11008), a Nepal isolate of goat origin in India North points to the possibility of translocation of infected animals from India across the international borders (Pant et al., 2013). There is clustering of two Indian isolates from Uttar Pradesh, IUP-R197 and IUP-R198 in Arctic like 1b lineage and two Andhra Pradesh isolates, IAP-R90 and IAP-R91 in India North lineage
Fig. 3. Deduced amino acid sequence of G gene of Indian rabies virus isolates after alignment with rabies virus of other parts of the world. The G gene sequence varied at amino acid position at 356 (N → K) in all isolates from India North.
S. Cherian et al. / Infection, Genetics and Evolution 36 (2015) 333–338 Fig. 4. Deduced amino acid sequence of G gene of Indian rabies virus isolates obtained after alignment with rabies virus of other parts of the world. The G gene sequence varied at amino acid position at 458 (M → I) in all isolates from North India.
337
338
S. Cherian et al. / Infection, Genetics and Evolution 36 (2015) 333–338
upon partial G gene analysis hinting to the prospect of similar animal translocation (Reddy et al., 2014). Analysis of the deduced amino acid sequences of glycoprotein revealed two genetic markers within the genome that differentiated North Indian RABV isolates from South Indian and Gujarat RABV isolates [aa 356 of ECTO; N → K] and [aa 458; M → I]. This can complement another gene marker present in the N gene (aa 134; I → V) (Nagarajan et al., 2009). However in India South, there is no definite clustering either based on species or region which is in agreement to the findings of Nagarajan et al. (2009). Two Gujarat RABVs in India South, two Karnataka isolates IRV14-RC and IRV15-RD grouping among Kerala isolates and a Kerala isolate IRV20-RD among Karnataka isolates indicate the probability of similar animal movements across the state borders. Two isolates from Karnataka namely IKA-R129 and IKA-R144 clustered among Kerala isolates upon partial G gene analysis reinforcing the possible animal translocation. Also the genetic marker in G-CD at aa 478; G → E (Nagarajan et al., 2006) was not present in all Kerala isolates but was noticed among two Karnataka isolates. These findings support the human mediated transborder propagation of RABV across state and international borders (Biek et al., 2007; Brunker et al., 2012). In neighboring countries namely Nepal, Pakistan, Afghanistan and Bangladesh there is evident circulation of predominant Arctic like RABV variants (Jamil et al., 2012; Pant et al., 2013). The Indian subcontinent RABV lineage is one of the oldest lineages circulating in domestic dogs in Central Asia, together with those found circulating in domestic dogs in far east countries such as China, Vietnam, Thailand and Philippines, whereas the Arctic-like RABV lineage now widespread in Central Asia (India, Pakistan, Bhutan, Afghanistan, Iraq and Iran), seems to be more recent lineages enzootically established in domestic dogs as well. Sub-continental lineage was last reported from India a decade back from southern region of the country and lack of recent reports from South India may be due to the gradual replacement of this lineage by Arctic like 1 lineage from north to south (Reddy et al., 2014). However there is possibility of the prevalence of Indian subcontinent lineages in North India evidenced from its existence in Nepal (Pant et al., 2013). The presence of Arctic like 1b lineage in India also points out to the requirement of further investigation. There is no substantial difference in rabies control policy and actual efforts on rabies control in different regions. The shift in distribution of RABV lineages needs to be clarified by including more number of archived as well as recent samples. The present study also support that dog RABV variants mainly circulating in India cause species spillover to human and other species including wildlife. This emphasizes the need to control the disease by vaccination of the dog population. 5. Conclusion In conclusion, all the Indian RABV isolates of the present study belong to Arctic like 1a clade with a separate clustering of Indian RABV isolates to India South and India North. This clustering on regional basis can be distinguished by two genetic markers [aa 356 of ECTO; N → K] and [458; M → I]. There is clustering of two RABV isolates from Gujarat along with India South isolates. Further detailed study targeting the same gene with extensive sampling from different species and different geographical regions including the archived samples can generate a clear picture regarding the RABV isolates of the country. This will enable us to understand the various RABV lineages present in India and to clarify the uncertainty regarding the possible presence of Indian subcontinent lineage in other parts of the country other than South India. Acknowledgment The authors are thankful to the Director of the Institute and Joint Director, CADRAD for providing necessary facilities. The first author greatly acknowledges Indian Council of Medical Research for providing fellowship to carry out this work.
Appendix A. Supplementary data Supplementary data to this article can be found online at http://dx. doi.org/10.1016/j.meegid.2015.09.024. References Anilionis, A., Wunner, W.H., Curtis, P.J., 1981. Structure of the glycoprotein gene in rabies virus. Nature 294, 275–278. Badrane, H., Tordo, N., 2001. Host switching in lyssavirus history from the Chiroptera to the Carnivora orders. J. Virol. 75, 8096–8104. Biek, R., Henderson, J.C., Waller, L.A., Rupprecht, C.E., Real, L.A., 2007. A high-resolution genetic signature of demographic and spatial expansion in epizootic rabies virus. Proc. Natl. Acad. Sci. U. S. A. 104, 7993–7998. Bourhy, H., Kissi, B., Audry, L., Smreczak, M., Sadkowska-Todys, M., Kulonen, K., Tordo, N., Zmudzinski, J.F., Holmes, E.C., 1999. Ecology and evolution of rabies virus in Europe. J. Gen. Virol. 80, 2545–2557. Brunker, K., Hampson, K., Horton, D.L., Biek, R., 2012. Integrating the landscape epidemiology and genetics of RNA viruses: rabies in domestic dogs as a model. Parasitology 1–15. Conzelmann, K.K., Cox, J.H., Schneider, L.G., Thiel, H.J., 1990. Molecular cloning and complete nucleotide sequence of the attenuated rabies virus SAD B19. Virology 175, 485–499. Davies, M.C., Englert, M.E., Sharpless, G.R., Cabasso, V.J., 1963. The electron microscopy of rabies virus in cultures of chicken embryo tissues. Virology 21, 4642–4665. Etessami, R., Conzelmann, K.K., Fadai-Ghotbi, B., Natelson, B., Tsiang, H., Ceccaldi, P.E., 2000. Spread and pathogenic characteristics of a G-deficient rabies virus recombinant: an in vitro and in vivo study. J. Gen. Virol. 81, 2147–2153. Hampson, K., Cleaveland, S., Maganga, S., Coudeville, L., Partners for Rabies Prevention Technical Advisory Group, 2011. Reassessment of the socio-economic global burden of rabies: human and animal cost of global rabies. Global Conference on Rabies Control: Towards Sustainable Prevention at Source: Incheon (Republic of Korea): 7–9 September 2011. OIE, Incheon, Korea, p. 26. Jamil, K.M., Ahmed, K., Hossain, M., Matsumoto, T., Ali, M.A., Hossain, S., Shakhawat, H., Islam, A., Nasiruddin, M., Nishizono, A., 2012. Arctic-like rabies virus, Bangladesh. Emerg. Infect. Dis. 18, 2021–2024. Jayakumar, R., Tirumurugaan, K.G., Ganga, G., Kumanan, K., Mahalinga Nainar, A., 2004. Characterization of nucleoprotein gene sequence of an Indian isolate of rabies virus. Acta Virol. 48, 47–50. Lentz, T.L., Burrage, T.G., Smith, A.L., Crick, J., Tignor, G.H., 1982. Is the acetylcholine receptor a rabies virus receptor? Science 215, 182–184. Nadin-Davis, S.A., Turner, G., Paul, J.P., Madhusudana, S.N., Wandeler, A.I., 2007. Emergence of Arctic-like rabies lineage in India. Emerg. Infect. Dis. 13, 111–116. Nagarajan, T., Mohanasubramanian, B., Seshagiri, E.V., Nagendrakumar, S.B., Saseendranath, M.R., Satyanarayana, M.L., Thiagarajan, D., Rangarajan, P.N., Srinivasan, V.A., 2006. Molecular epidemiology of rabies virus isolates in India. J. Clin. Microbiol. 44, 3218–3224. Nagarajan, T., Nagendrakumar, S.B., Mohanasubramanian, B., Rajalakshmi, S., Hanumantha, N.R., Ramya, R., Thiagarajan, D., Srinivasan, V.A., 2009. Phylogenetic analysis of nucleoprotein gene of dog rabies virus isolates from southern India. Infect. Genet. Evol. 9, 976–982. Pant, G.R., Lavenir, R., Wong, F.Y.K., Certoma, A., Larrous, F., Bhatta, D.R., Bourhy, H., Stevens, V., Dacheux, L., 2013. Recent emergence and spread of an arctic-related phylogenetic lineage of rabies virus in Nepal. PLoS Negl. Trop. Dis. 7, e2560. Reddy, G.B., Singh, R., Singh, R.P., Singh, K.P., Gupta, P.K., Desai, A., Shankar, S.K., Ramakrishnan, M.A., Verma, R., 2011. Molecular characterization of Indian rabies virus isolates by partial sequencing of nucleoprotein (N) and phosphoprotein (P) genes. Virus Genes 43, 13–17. Reddy, R.V., Mohana Subramanian, B., Surendra, K.S., Babu, R.P., Rana, S.K., Manjari, K.S., Srinivasan, V.A., 2014. Rabies virus isolates of India — simultaneous existence of two distinct evolutionary lineages. Infect. Genet. Evol. 27, 163–172. Saito, M., Oshitani, H., Orbina, J.R.C., Tohma, K., de Guzman, A.S., Kamigaki, T., Demetria, C.S., Manalo, D.L., Noguchi, A., Inoue, S., Quiambao, B.P., 2013. Genetic Diversity and Geographic Distribution of Genetically Distinct Rabies Viruses in the Philippines. PLoS Negl. Trop. Dis. 7, e2144. Tamura, K., Stecher, G., Peterson, D., Filipski, A., Kumar, S., 2013. MEGA6: molecular evolutionary genetics analysis version 6.0. Mol. Biol. Evol. 30, 2725–2729. Tordo, N., Kouknetzoff, A., 1993. The rabies virus genome: an overview. Onderstepoort J. Vet. Res. 60, 263–269. Tuffereau, C., Leblois, H., Benejean, J., Coulon, P., Lafay, F., Flamand, A., 1989. Arginine or lysine in position 333 of ERA and CVS glycoprotein is necessary for rabies virulence in adult mice. Virology 172, 206–212. WHO Expert Consultation on Rabies, 2013. Second Report, Tech. Rep. Series 982. World Health Organization, Geneva, Switzerland. Wiktor, T.J., Gyorgy, E., Schlumberger, H.D., Sokol, F., Koppowski, H., 1973. Antigenic properties of rabies virus components. J. Immunol. 110, 269–276. Wu, X., Franka, R., Velasco-Villa, A., Rupprecht, C.E., 2007. Are all lyssavirus genes equal for phylogenetic analyses? Virus Res. 129, 91–103. Wunner, W.H., Larson, J.K., Dietzschold, B., Smith, C.L., 1988. The molecular biology of rabies viruses. Rev. Infect. Dis. 10, 771–784. Yang, D.K., Park, Y.N., Hong, G.S., Kang, H.K., Oh, Y.I., Cho, S.D., Song, J.Y., 2011. Molecular characterization of Korean rabies virus isolates. J. Vet. Sci. 12, 57–63. Yelverton, E., Norton, S., Obijeski, J.F., Goeddel, D.V., 1983. Rabies virus glycoprotein analogs: biosynthesis in Escherichia coli. Science 219, 614–620.
Contents lists available at ScienceDirect
Infection, Genetics and Evolution journal homepage: www.elsevier.com/locate/meegid
Phylogenetic analysis of Indian rabies virus isolates targeting the complete glycoprotein gene Susan Cherian a, Rajendra Singh a,⁎, K.P. Singh b, G.B. Manjunatha Reddy c, Anjaneya a, G.V.P.P.S. Ravi Kumar d, T.G. Sumithra e, R.P. Singh f a
Division of Pathology, Indian Veterinary Research Institute, Izatnagar, Bareilly, U.P. 243 122, India CARDRAD, Indian Veterinary Research Institute, Izatnagar, Bareilly, U.P. 243 122, India NIVEDI, Bengaluru, Karnataka 560 064, India d Division of Animal Biotechnology, Indian Veterinary Research Institute, Izatnagar, Bareilly, U.P. 243 122, India e Department of Veterinary Microbiology, College of Veterinary And Animal Sciences, Pookot, Wayanad, Kerala 673 576, India f Division of Biological Products, Indian Veterinary Research Institute, Izatnagar, Bareilly, U.P. 243 122, India b c
a r t i c l e
i n f o
Article history: Received 23 January 2015 Received in revised form 19 August 2015 Accepted 25 September 2015 Available online 30 September 2015 Keywords: Rabies virus Indian isolate G gene Phylogenetic analysis Wildlife species
a b s t r a c t Rabies a fatal viral zoonosis is endemic in India. There is no report on phylogenetic study of Indian rabies virus isolates based on the complete G gene. In the present study, a total of 25 rabies positive brain samples collected during 2001–2014 from North India (UP, MP, Delhi, Rajasthan), South India (Kerala and Karnataka) and Gujarat states belonging to six different host species were subjected to G gene amplification by RT-PCR as three overlapping fragments of 881 bp, 991 bp and 618 bp. Phylogenetic analysis revealed that all Indian rabies virus isolates are genetically closely related with Arctic-like 1a lineage viruses. However, two distinct clusters were identified namely, India South and India North. All the Indian rabies isolates had 95.5–100% homology related to geography, but not to host species. Deduced amino acids on comparison revealed two amino acid changes, aa 356 in ECTO; N → K and aa 458; M → I, which were found to distinguish between the India South and India North isolates. © 2015 Published by Elsevier B.V.
1. Introduction Rabies is a fatal encephalomyelitic viral zoonotic disease of mammals caused by viruses belonging to genus Lyssavirus under Rhabdoviridae family. Out of fourteen different species in Lyssavirus, classical rabies virus is responsible for most rabies cases in terrestrial mammals globally. Rabies occurs in two different epidemiological cycles: urban rabies and sylvatic rabies. In urban rabies, mostly stray dogs and in sylvatic rabies different wildlife species act as reservoirs and/or transmitters of the disease to humans and domestic animals. In India, dogs are the reservoir host which transmits the disease. The human deaths due to dog rabies is estimated to be 70,000 per annum worldwide, a major share of which is reported from South Asian countries (approx. 45%) (Hampson et al., 2011). India is a forerunner among the rabies endemic Asian countries with the largest number of reported human deaths (WHO Expert Consultation on Rabies, 2013). Rabies virus (RABV) is bullet shaped with a length of 180 nm and a diameter of 75 nm (Davies et al., 1963) and has an approximately 12 kb long single-stranded, non-segmented, negative-sense RNA genome encoding five structural proteins, 3′-N–P–M–G–L-5′; N (nucleoprotein), ⁎ Corresponding author. E-mail addresses: [email protected] (S. Cherian), [email protected] (R. Singh).
http://dx.doi.org/10.1016/j.meegid.2015.09.024 1567-1348/© 2015 Published by Elsevier B.V.
P (phosphoprotein), M (matrix protein), G (glycoprotein) and L (RNA-dependent RNA polymerase) (Wunner et al., 1988; Tordo and Kouknetzoff, 1993). The order of relative conservation of these five genes from high to low could be either N N L N M N P N G or N N L N M N G N P (Wu et al., 2007). The precursor RVG is 524 amino acid (aa) in length, consisting of a signal peptide of 19 aa in the N terminal while the mature 505 aa protein comprises a 439 aa ecto-domain (ECTO), a 22 aa trans-membrane domain (TM) and a C-terminal endo-domain (ENDO)/cytoplasmic domain (G-CD) of 44 aa (Anilionis et al., 1981; Yelverton et al., 1983; Conzelmann et al., 1990). RVG plays an essential role in pathogenesis, neurovirulence and production of neutralizing antibodies (Wiktor et al., 1973; Lentz et al., 1982; Tuffereau et al., 1989; Etessami et al., 2000). Continuous monitoring of RABV variants is necessary to see the pattern distribution of the disease and source of infection and to help rabies control strategies. In India, majority of the rabies phylogenetic studies have targeted the N gene, P gene, G-CD, noncoding G–L intergenic region (Psi) and the L region (Psi–L region) and partial G gene of RABV genome (Jayakumar et al., 2004; Nadin-Davis et al., 2007; Nagarajan et al., 2006, 2009;; Reddy et al., 2014). Genetic structuring of RABV variants maintained among dog populations was according to geographic location in India (Jayakumar et al., 2004; Nagarajan et al., 2006). Nagarajan et al. (2009) described that RV isolates in Southern India were similar to one another forming a single major genetic cluster not ordered by geography and dissimilar to RABV isolates in Northern
334
S. Cherian et al. / Infection, Genetics and Evolution 36 (2015) 333–338
India and in other parts of the world based on analysis of partial N gene sequences. Further, RABVs of Indian origin were found to have close homology with Arctic-like lineage (Nadin-Davis et al., 2007; Reddy et al., 2011). G gene can be used as a marker to study genetic diversity and antigenic typing because of having several major antigenic sites and relatedness with pathogenicity (Badrane and Tordo, 2001; Yang et al., 2011). However, the studies targeting G gene are limited especially those giving due importance to isolates from both North and South India. 2. Materials and methods 2.1. Samples Twenty five brain samples of animals that died of rabies like symptoms collected during 2002–2014 from north (1 Rajasthan, 1 Madhya Pradesh, 2 Gujarat, 3 Delhi and 5 Uttar Pradesh) and south (6 Karnataka and 7 Kerala) were utilized in this study. These include 14 dogs, 7 cattles, 1 Himalayan black bear, 1 sambar deer, 1 mongoose and 1 hyena (Table 2). The samples were confirmed positive for rabies by dFAT on impression smears and were stored at −80 °C till further use. 2.2. RNA extraction The total RNA was extracted from the brain samples using RNAeasy lipid tissue minikit (Qiagen) as per manufacturer's instructions. Briefly 100 mg of brain was used and the extracted RNA was quantified using Nanodrop (Thermo Scientific, USA). 2.3. RT-PCR One step RT-PCR (RobusT II RT-PCR kit, Finnzymes) was performed using specifically designed primers (Table 1) which amplified whole 1575 bp G gene as three overlapping fragments of 881 bp, 991 bp and 618 bp respectively. PCR reactions were carried out in a 50 μl volume of reaction mix containing 500 ng of total RNA, 1× PCR reaction buffer, 1.5 mM MgCl2, 250 μM dNTPs, 20 pmol of each primer, 10 U M-MuLV RT RNase H- and 10 U DyNAzyme EXT DNA Polymerase. Briefly the cycling conditions included a reverse transcription at 37 °C for 45 min followed by an initial denaturation at 94 °C for 2 min. This was followed by 29 cycles, each consisting of a denaturation at 94 °C for 30 s, annealing 49 °C (RVG1F and RVG1R), 55 °C (RVG2F and RVG2R) and 45 °C (RVG3F and RVG3R) and annealing at 72 °C for 1 min. The final stage of the reaction included an extension of 10 min at 72 °C. PCR products were resolved by gel electrophoresis on 2% agarose containing 0.5% ethidium bromide and visualized under UV light. 2.4. Sequencing and phylogenetic analysis The amplified PCR products were purified with the QIAquick PCR gel extraction kit (Qiagen) as per manufacturer's instructions. The purified PCR products were sequenced commercially (Europhins Pvt Ltd, India) by Sanger's di-deoxy method using the gene specific primers. The sequences were edited and compiled using Editseq (DNASTAR Inc., USA) to obtain the complete 1575 bp of the G gene which covered whole
Table 1 List of primers used in present study. Sl. no.
Primer ID
Sequence
1. 2. 3. 4. 5. 6.
RVGIF RVGIR RVG2F RVG2R RVG3F RVG3R
5′ TGGGGGCAATATAACAAAAA 3′ 5′ TTCATCTACAAAGCCGCAAGTC 3′ 5′ GAGCCGCGTACAACTGGAAGA 3′ 5′ TCGTGCACATCGGGAAGGT 3′ 5′ TGCAATCATCCCTCCTC 3′ 5′ GAAAGCACCGTTAGTCAC 3′
524 aa. Pair alignments and sequence identity generation were performed using MegAlign (DNASTAR, USA). GenBank accession numbers for the 25 complete G gene sequences newly acquired in this study are designated as KM 492745–KM492765, KM408747 and KM278992–KM278994. The sequences were subjected to BLAST search and complete G gene sequences from neighboring countries (Bangladesh, Nepal, Pakistan and Afghanistan) were selected and included along with representative sequences from different parts of the world in this phylogenetic study (Table 2). The sequences were aligned using ClustalW and a NJ tree was constructed by MEGA version 6.06 (Tamura et al., 2013) using Tamura 3-parameter model. The confidence in the NJ tree was estimated by 1000 bootstrap replicates. Similar analysis was conducted for
Table 2 Description of RABV isolates used in phylogenetic analysis of complete G gene. RABV isolates highlighted in red and green are generated in this study. Sl no 1. 2. 3. 4. 5.
IRV1-RD IRV2-RD IRV3-RC IRV4-RC IRV5-RH
6. 7. 8. 9. 10. 11. 12. 13. 14. 15. 16. 17. 18. 19. 20. 21. 22. 23. 24. 25. 26. 27. 28. 29.
IRV6-RD IRV7-RD IRV8-RC IRV9-RD IRV10-RHB IRV11-RM IRV12-RS IRV13-RC IRV14-RC IRV15-RD IRV16-RD IRV17-RD IRV18-RC IRV19-RD IRV20-RD IRV21-RC IRV22-RD IRV23-RD IRV24-RD IRV25-RD NNV-RAB-H DQ103705 AY956319 RVD
Bareilly, UP Gwalior, MP S.K. Nagar, Gujarat Anand, Gujarat Rathambore, Rajasthan Dog Lucknow, UP Dog Karnataka Cattle Rampur, UP Dog Bareilly, UP Himalayan black bear Delhi Mongoose Delhi Sambar deer Delhi Cattle Karnataka Cattle Karnataka Dog Karnataka Dog Karnataka Dog Kerala Cattle Kerala Dog Kerala Dog Kerala Cattle Kerala Dog Bareilly, UP Dog Karnataka Dog Kerala Dog Kerala Human India Dog India Human Germany-India Dog India
2001 2002 2008 2009 2010
Accession number KM492746 KM492748 KM492747 KM492749 KM408747
2011 2012 2013 2013 2013 2013 2013 2013 2013 2013 2013 2013 2013 2013 2013 2013 2014 2014 2014 2014 2006 2005 2004 1998
KM492750 KM492753 KM492751 KM492745 KM278992 KM278993 KM278994 KM492754 KM492755 KM492756 KM492757 KM492758 KM492759 KM492760 KM492761 KM492762 KM492752 KM492763 KM492764 KM492765 EF437215 DQ103705 AY956319 AY237121
Isolate name
Species
Place
Dog Dog Cattle Cattle Hyena
Year
Lineage Arctic like 1a Arctic like 1a Arctic like 1a Arctic like 1a Arctic like 1a
30. CHAND03
Dog
India
1999
AY987478
31. 32. 33. 34. 35. 36. 37. 38. 39. 40. 41.
BLY/99/EF rv61 04032AFG 04035AFG 02052AFG 11017 3878-78(11008NEP) 3878-09(11009 NEP) 3878-03 4403-16 NEP1-DG
Dog Human Dog Dog Dog Dog Goat Dog Dog Dog
India UK-India Afghanistan Afghanistan Afghanistan Nepal Nepal Nepal Nepal Nepal Nepal
1999 1987 2009 2004 2002 2011 2010 2010 2010 2009 2000
EF151231 JQ685981 JX987723 JX987720 JX987718 JX987727 JX944593 JX944586 JX944580 JX944577 AF325489
42. 43. 44. 45. 46. 47. 48. 49. 50.
9901NEP Pk23 Pk24 Pk56 Pk58 BDR2 BDR5 BDR7 H-08-1320
Dog Cattle Cattle Cattle Cattle Cattle Goat Cattle Human
Nepal Pakistan Pakistan Pakistan Pakistan Bangladesh Bangladesh Bangladesh Sri Lanka
1998 2010 2007 2007 2007 2010 2010 2007 2008
EU086153 HE802675 HE802676 HE801614 HE801616 AB699208 AB699220 AB699213 AB569299
51. 52. 53. 54. 55. 56. 57. 58. 59. 60. 61. 62. 63.
F01 CZJ0811 NeiMeng927B 02035CHI 9913BIR THAI1-HM MAL1-HM 04030PHI 13R13 KRVR0804 SKRBV0403CW SKRRD9903YG 9104USA (CRBIP8.32) 91RABN3899 90RABN9285 96321IRA HUN1-FX 9147FRA PM
Chinese ferret badger Dog Raccoon dog Dog Dog Human Human Human Dog Raccoon dog Cattle Raccoon dog Skunk
China China China China Myanmar Thailand Malaysia Philippines South Korea South Korea South Korea South Korea USA
2008 2008 2007 1997 1999 1983 1985 2004 2013 2008 2004 1999 1991
FJ825133 JN936791 EU284096 EU086136 EU086129 AF325488 AF325487 EU086155 KF437651 GU937026 DQ076095 DQ076099 JX987749
Arctic like 1a Arctic like 1a Arctic like 1a Arctic like 1a Arctic like 1a Arctic like 1a Arctic like 1a Arctic like 1a Arctic like 1a Arctic like 1a Arctic like 1a Arctic like 1a Arctic like 1a Arctic like 1a Arctic like 1a Arctic like 1a Arctic like 1a Arctic like 1a Arctic like 1a Arctic like 1a Arctic like 1a Arctic like 1a Arctic like 1a Indian subcontinent Indian subcontinent Arctic like 1a Arctic like 1a Arctic like 1b Arctic like 1b Arctic like 1b Arctic like 1a Arctic 3 Arctic like 1a Arctic 3 Arctic 3 Indian subcontinent Arctic like 1a Arctic like 1a Arctic like 1b Arctic like 1b Arctic like 1b Arctic like 1a Arctic like 1a Arctic like 1a Indian subcontinent Asian Asian Arctic like 2 Asian Asian Asian Asian Asian Arctic like 2 Arctic like 2 Arctic like 2 Arctic like 2 Arctic 1
Skunk Red fox Jackal Human Fox
Canada Canada Iran Hungary France
1991 1990 1996 1991 1991
U11743 U11756 JX987734 AF325462 EU293115 AJ871962
Arctic 1 Arctic 1 Cosmopolitan Cosmopolitan Cosmopolitan Cosmopolitan
M13215 GQ918139
Cosmopolitan Cosmopolitan
64. 65. 66. 67. 68. 69.
70. PV 71. CVS
S. Cherian et al. / Infection, Genetics and Evolution 36 (2015) 333–338
335
3. Results A total of 25 samples belonging to different species including wildlife from different regions of the country were confirmed positive for rabies by dFAT on impression smears which were used for G gene amplification and sequencing. 3.1. Phylogenetic analysis of complete G gene Twenty five RABV complete G gene sequences were aligned with other RABVs of genotype 1 (Table 2) in this study. The homologies of these 25 isolates were 95.5–100% at nucleotide level. The Indian isolates of the present study clustered together along with the Pakistan [Pk23], Nepal [3878-78(11008)] and other Indian RABVs [RVG, RV serotype 1, NNV-RAB-H, rv61, BLY/99] in Arctic like 1a lineage. Pk23 and 387878(11008) have 96.9–98.8% and 95–98.2% identity to the Indian isolates. All Indian RABVs of Arctic like 1a clade segregated into two genetic clusters India South and India North with bootstrap values 80 and 63 respectively (Fig. 1). India South consists of RABVs from the Southern region of India namely the states of Kerala, Karnataka along with state of Gujarat which is in the Western region of India while India North includes isolates from the Northern region of the country namely Delhi, Rajasthan, Uttar Pradesh and Madhya Pradesh (Fig. 2). In India South, isolates from Kerala, Karnataka and Gujarat formed three separate branches except for IRV14-RC and IRV15-RD two Karnataka isolates grouping among Kerala and IRV20-RD, a Kerala isolate among Karnataka isolates. Similarly in India North, isolates from Delhi grouped together and while isolates from Rajasthan, Uttar Pradesh and Madhya Pradesh formed a separate branch along with Pk23, a Pakistan isolate of cattle origin. Phylogenetic analysis based on partial G gene sequences of 1317 bp revealed similar clustering pattern as in complete G gene (Fig. S1) with an exception of two Indian isolates from Uttar Pradesh; IUP-R197 and IUP-R198 clustering in Arctic like 1b lineage. In addition to IRV14-RC and IRV15-RD, another two isolates from Karnataka namely IKA-R129
Fig. 1. Phylogenetic tree showing the genetic relationship of 25 rabies virus isolate complete G gene sequences. The sequences generated in this study are marked bold and only significant bootstrap values N80 are shown.
partial G gene (1317 bp) using additional 13 published Indian RABV sequences representing wide geographical area of India (Table S1). Deduced aa sequence of glycoprotein (524 aa) of all 25 RABVs along with other representative isolates of Arctic like Ia clade and other clades along with vaccine strain Pasteur virus was analyzed for variations. Partial deduced aa sequences of RABV glycoprotein were also analyzed by including 13 additional published sequences from India.
Fig. 2. Map depicting the distribution of RABV India South and India North clusters of present study in different states of India.
336
S. Cherian et al. / Infection, Genetics and Evolution 36 (2015) 333–338
and IKA-R144 also grouped among Kerala isolates. India North included two isolates from Andhra Pradesh, IAP-R90 and IAP-R91 which is in Southern region (Fig. S1). 3.2. Comparison of amino acids The RABV isolates of the present study exhibited identity of 95.6– 100% at aa level. Pk23 and 3878-78(11008) exhibited 97.3–100% and 97.3–99.6% identity respectively with the Indian RABVs of Arctic like 1a lineage. Analysis of the deduced aa sequences of glycoprotein revealed the conservation of antigenic site I, IIb and III in all 25 Indian isolates. Similarly the two N-glycosylation sites at amino acid positions 37 and 319, Arginine residue at 333 and 14 cysteine residues in the ECTO were present in all 25 RABVs. Antigenic site IIa is conserved in most isolates except IRV6-RD (Uttar Pradesh) at aa 39; S → T. All India North isolates including Pk23, and 3878-78(11008) differed from India South RABVs at aa 356 of ECTO; N → K consistent for all India North except IRV2-RD, a Madhya Pradesh isolate of dog origin and aa 458; M → I in all IG2 isolates in mature glycoprotein of 505 aa (Figs. 3 & 4). Partial aa sequences of glycoprotein revealed aa 356 of ECTO; N → K in all India North isolates including two isolates from Andhra Pradesh, IAP-R90 and IAP-R91 (Fig. S2). 4. Discussion Twenty five rabies positive brain samples were utilized in this study which were collected during 2001–2014 from 7 seven states of India
isolated from 6 different species including dog, cattle, hyena, Himalayan black bear, mongoose and sambar deer. Phylogenetic analysis of the complete G gene revealed that Indian isolates belong to Arctic like 1a clade (Nadin-Davis et al., 2007; Reddy et al., 2011; Reddy et al., 2014) and formed 2 clusters namely India South and India North based on geographical region with a distinct separate clustering of North and South Indian RABV isolates. However partial G gene analysis in addition revealed the evidence of Arctic like 1b lineage in India which is prevalent in Pakistan and Afghanistan (Reddy et al., 2014). This is in agreement to the findings of phylogenetic studies of G gene that RABV isolates cluster on the basis of geographic region and not on host species (Bourhy et al., 1999; Yang et al., 2011; Saito et al., 2013). Research targeting other regions of genome of Indian RABVs is also in agreement regarding the separate region wise clustering (Jayakumar et al., 2004; Nadin-Davis et al., 2007; Nagarajan et al., 2006, 2009; Reddy et al., 2011). Dogs are the reservoir host in India that infect other dead end hosts and therefore lack of clustering based on host species is not significant. Physical barriers like mountain ranges and rivers which can contribute to the evolution RABVs in a region (Bourhy et al., 1999; Biek et al., 2007; Brunker et al., 2012) might have directed to the evolution of genetically distinct isolates in North and South India. The grouping of Pk23, a Pakistan isolate of cattle origin and 3878-78 (11008), a Nepal isolate of goat origin in India North points to the possibility of translocation of infected animals from India across the international borders (Pant et al., 2013). There is clustering of two Indian isolates from Uttar Pradesh, IUP-R197 and IUP-R198 in Arctic like 1b lineage and two Andhra Pradesh isolates, IAP-R90 and IAP-R91 in India North lineage
Fig. 3. Deduced amino acid sequence of G gene of Indian rabies virus isolates after alignment with rabies virus of other parts of the world. The G gene sequence varied at amino acid position at 356 (N → K) in all isolates from India North.
S. Cherian et al. / Infection, Genetics and Evolution 36 (2015) 333–338 Fig. 4. Deduced amino acid sequence of G gene of Indian rabies virus isolates obtained after alignment with rabies virus of other parts of the world. The G gene sequence varied at amino acid position at 458 (M → I) in all isolates from North India.
337
338
S. Cherian et al. / Infection, Genetics and Evolution 36 (2015) 333–338
upon partial G gene analysis hinting to the prospect of similar animal translocation (Reddy et al., 2014). Analysis of the deduced amino acid sequences of glycoprotein revealed two genetic markers within the genome that differentiated North Indian RABV isolates from South Indian and Gujarat RABV isolates [aa 356 of ECTO; N → K] and [aa 458; M → I]. This can complement another gene marker present in the N gene (aa 134; I → V) (Nagarajan et al., 2009). However in India South, there is no definite clustering either based on species or region which is in agreement to the findings of Nagarajan et al. (2009). Two Gujarat RABVs in India South, two Karnataka isolates IRV14-RC and IRV15-RD grouping among Kerala isolates and a Kerala isolate IRV20-RD among Karnataka isolates indicate the probability of similar animal movements across the state borders. Two isolates from Karnataka namely IKA-R129 and IKA-R144 clustered among Kerala isolates upon partial G gene analysis reinforcing the possible animal translocation. Also the genetic marker in G-CD at aa 478; G → E (Nagarajan et al., 2006) was not present in all Kerala isolates but was noticed among two Karnataka isolates. These findings support the human mediated transborder propagation of RABV across state and international borders (Biek et al., 2007; Brunker et al., 2012). In neighboring countries namely Nepal, Pakistan, Afghanistan and Bangladesh there is evident circulation of predominant Arctic like RABV variants (Jamil et al., 2012; Pant et al., 2013). The Indian subcontinent RABV lineage is one of the oldest lineages circulating in domestic dogs in Central Asia, together with those found circulating in domestic dogs in far east countries such as China, Vietnam, Thailand and Philippines, whereas the Arctic-like RABV lineage now widespread in Central Asia (India, Pakistan, Bhutan, Afghanistan, Iraq and Iran), seems to be more recent lineages enzootically established in domestic dogs as well. Sub-continental lineage was last reported from India a decade back from southern region of the country and lack of recent reports from South India may be due to the gradual replacement of this lineage by Arctic like 1 lineage from north to south (Reddy et al., 2014). However there is possibility of the prevalence of Indian subcontinent lineages in North India evidenced from its existence in Nepal (Pant et al., 2013). The presence of Arctic like 1b lineage in India also points out to the requirement of further investigation. There is no substantial difference in rabies control policy and actual efforts on rabies control in different regions. The shift in distribution of RABV lineages needs to be clarified by including more number of archived as well as recent samples. The present study also support that dog RABV variants mainly circulating in India cause species spillover to human and other species including wildlife. This emphasizes the need to control the disease by vaccination of the dog population. 5. Conclusion In conclusion, all the Indian RABV isolates of the present study belong to Arctic like 1a clade with a separate clustering of Indian RABV isolates to India South and India North. This clustering on regional basis can be distinguished by two genetic markers [aa 356 of ECTO; N → K] and [458; M → I]. There is clustering of two RABV isolates from Gujarat along with India South isolates. Further detailed study targeting the same gene with extensive sampling from different species and different geographical regions including the archived samples can generate a clear picture regarding the RABV isolates of the country. This will enable us to understand the various RABV lineages present in India and to clarify the uncertainty regarding the possible presence of Indian subcontinent lineage in other parts of the country other than South India. Acknowledgment The authors are thankful to the Director of the Institute and Joint Director, CADRAD for providing necessary facilities. The first author greatly acknowledges Indian Council of Medical Research for providing fellowship to carry out this work.
Appendix A. Supplementary data Supplementary data to this article can be found online at http://dx. doi.org/10.1016/j.meegid.2015.09.024. References Anilionis, A., Wunner, W.H., Curtis, P.J., 1981. Structure of the glycoprotein gene in rabies virus. Nature 294, 275–278. Badrane, H., Tordo, N., 2001. Host switching in lyssavirus history from the Chiroptera to the Carnivora orders. J. Virol. 75, 8096–8104. Biek, R., Henderson, J.C., Waller, L.A., Rupprecht, C.E., Real, L.A., 2007. A high-resolution genetic signature of demographic and spatial expansion in epizootic rabies virus. Proc. Natl. Acad. Sci. U. S. A. 104, 7993–7998. Bourhy, H., Kissi, B., Audry, L., Smreczak, M., Sadkowska-Todys, M., Kulonen, K., Tordo, N., Zmudzinski, J.F., Holmes, E.C., 1999. Ecology and evolution of rabies virus in Europe. J. Gen. Virol. 80, 2545–2557. Brunker, K., Hampson, K., Horton, D.L., Biek, R., 2012. Integrating the landscape epidemiology and genetics of RNA viruses: rabies in domestic dogs as a model. Parasitology 1–15. Conzelmann, K.K., Cox, J.H., Schneider, L.G., Thiel, H.J., 1990. Molecular cloning and complete nucleotide sequence of the attenuated rabies virus SAD B19. Virology 175, 485–499. Davies, M.C., Englert, M.E., Sharpless, G.R., Cabasso, V.J., 1963. The electron microscopy of rabies virus in cultures of chicken embryo tissues. Virology 21, 4642–4665. Etessami, R., Conzelmann, K.K., Fadai-Ghotbi, B., Natelson, B., Tsiang, H., Ceccaldi, P.E., 2000. Spread and pathogenic characteristics of a G-deficient rabies virus recombinant: an in vitro and in vivo study. J. Gen. Virol. 81, 2147–2153. Hampson, K., Cleaveland, S., Maganga, S., Coudeville, L., Partners for Rabies Prevention Technical Advisory Group, 2011. Reassessment of the socio-economic global burden of rabies: human and animal cost of global rabies. Global Conference on Rabies Control: Towards Sustainable Prevention at Source: Incheon (Republic of Korea): 7–9 September 2011. OIE, Incheon, Korea, p. 26. Jamil, K.M., Ahmed, K., Hossain, M., Matsumoto, T., Ali, M.A., Hossain, S., Shakhawat, H., Islam, A., Nasiruddin, M., Nishizono, A., 2012. Arctic-like rabies virus, Bangladesh. Emerg. Infect. Dis. 18, 2021–2024. Jayakumar, R., Tirumurugaan, K.G., Ganga, G., Kumanan, K., Mahalinga Nainar, A., 2004. Characterization of nucleoprotein gene sequence of an Indian isolate of rabies virus. Acta Virol. 48, 47–50. Lentz, T.L., Burrage, T.G., Smith, A.L., Crick, J., Tignor, G.H., 1982. Is the acetylcholine receptor a rabies virus receptor? Science 215, 182–184. Nadin-Davis, S.A., Turner, G., Paul, J.P., Madhusudana, S.N., Wandeler, A.I., 2007. Emergence of Arctic-like rabies lineage in India. Emerg. Infect. Dis. 13, 111–116. Nagarajan, T., Mohanasubramanian, B., Seshagiri, E.V., Nagendrakumar, S.B., Saseendranath, M.R., Satyanarayana, M.L., Thiagarajan, D., Rangarajan, P.N., Srinivasan, V.A., 2006. Molecular epidemiology of rabies virus isolates in India. J. Clin. Microbiol. 44, 3218–3224. Nagarajan, T., Nagendrakumar, S.B., Mohanasubramanian, B., Rajalakshmi, S., Hanumantha, N.R., Ramya, R., Thiagarajan, D., Srinivasan, V.A., 2009. Phylogenetic analysis of nucleoprotein gene of dog rabies virus isolates from southern India. Infect. Genet. Evol. 9, 976–982. Pant, G.R., Lavenir, R., Wong, F.Y.K., Certoma, A., Larrous, F., Bhatta, D.R., Bourhy, H., Stevens, V., Dacheux, L., 2013. Recent emergence and spread of an arctic-related phylogenetic lineage of rabies virus in Nepal. PLoS Negl. Trop. Dis. 7, e2560. Reddy, G.B., Singh, R., Singh, R.P., Singh, K.P., Gupta, P.K., Desai, A., Shankar, S.K., Ramakrishnan, M.A., Verma, R., 2011. Molecular characterization of Indian rabies virus isolates by partial sequencing of nucleoprotein (N) and phosphoprotein (P) genes. Virus Genes 43, 13–17. Reddy, R.V., Mohana Subramanian, B., Surendra, K.S., Babu, R.P., Rana, S.K., Manjari, K.S., Srinivasan, V.A., 2014. Rabies virus isolates of India — simultaneous existence of two distinct evolutionary lineages. Infect. Genet. Evol. 27, 163–172. Saito, M., Oshitani, H., Orbina, J.R.C., Tohma, K., de Guzman, A.S., Kamigaki, T., Demetria, C.S., Manalo, D.L., Noguchi, A., Inoue, S., Quiambao, B.P., 2013. Genetic Diversity and Geographic Distribution of Genetically Distinct Rabies Viruses in the Philippines. PLoS Negl. Trop. Dis. 7, e2144. Tamura, K., Stecher, G., Peterson, D., Filipski, A., Kumar, S., 2013. MEGA6: molecular evolutionary genetics analysis version 6.0. Mol. Biol. Evol. 30, 2725–2729. Tordo, N., Kouknetzoff, A., 1993. The rabies virus genome: an overview. Onderstepoort J. Vet. Res. 60, 263–269. Tuffereau, C., Leblois, H., Benejean, J., Coulon, P., Lafay, F., Flamand, A., 1989. Arginine or lysine in position 333 of ERA and CVS glycoprotein is necessary for rabies virulence in adult mice. Virology 172, 206–212. WHO Expert Consultation on Rabies, 2013. Second Report, Tech. Rep. Series 982. World Health Organization, Geneva, Switzerland. Wiktor, T.J., Gyorgy, E., Schlumberger, H.D., Sokol, F., Koppowski, H., 1973. Antigenic properties of rabies virus components. J. Immunol. 110, 269–276. Wu, X., Franka, R., Velasco-Villa, A., Rupprecht, C.E., 2007. Are all lyssavirus genes equal for phylogenetic analyses? Virus Res. 129, 91–103. Wunner, W.H., Larson, J.K., Dietzschold, B., Smith, C.L., 1988. The molecular biology of rabies viruses. Rev. Infect. Dis. 10, 771–784. Yang, D.K., Park, Y.N., Hong, G.S., Kang, H.K., Oh, Y.I., Cho, S.D., Song, J.Y., 2011. Molecular characterization of Korean rabies virus isolates. J. Vet. Sci. 12, 57–63. Yelverton, E., Norton, S., Obijeski, J.F., Goeddel, D.V., 1983. Rabies virus glycoprotein analogs: biosynthesis in Escherichia coli. Science 219, 614–620.