Phylogenetic analysis of rabies viruses from Sudan provides evidence of a viral clade with a unique molecular signature

Virus Research 145 (2009) 244–250

Contents lists available at ScienceDirect

Virus Research journal homepage: www.elsevier.com/locate/virusres

Phylogenetic analysis of rabies viruses from Sudan provides evidence of a viral clade with a unique molecular signature夽夽,夽 D.A. Marston a , L.M. McElhinney a , Y.H. Ali b , K.S. Intisar b , S.M. Ho a,1 , C. Freuling c , T. Müller c , A.R. Fooks a,∗ a Rabies and Wildlife Zoonoses Group, WHO Collaborating Centre of Rabies and Rabies-Related Viruses, Veterinary Laboratories Agency, Woodham Lane, Addlestone, Surrey KT15 3NB, UK b Central Veterinary Research Laboratory (CVRL), Virology Department, P.O. Box 8067, Khartoum, Sudan c Institute of Epidemiology, Friedrich-Loeffler-Institut, Federal Research Institute for Animal Health, WHO Collaborating Centre for Rabies Surveillance and Research, Seestrasse 55, 16868 Wusterhausen, Germany

a r t i c l e

i n f o

Article history: Received 24 April 2009 Received in revised form 11 July 2009 Accepted 13 July 2009 Available online 21 July 2009 Keywords: Sudan Rabies Virus Nucleoprotein Phylogeny

a b s t r a c t Rabies is endemic in Sudan and remains a continual threat to public health as transmission to humans is principally dog-mediated. Additionally, large-scale losses of livestock occur each year causing economic and social dilemmas. In this study, we analysed a cohort of 143 rabies viruses circulating in Sudan collected from 10 different animal species between 1992 and 2006. Partial nucleoprotein sequence data (400 bp) were obtained and compared to available sequence data of African classical rabies virus (RABV) isolates. The Sudanese sequences formed a discrete cluster within the Africa 1a group, including a small number of sequences that clustered with sequences from Ethiopian RABV. These latter sequences share an Aspartic Acid at position 106 (Asp106 ) with all other Africa 1a group members, in contrast to the remaining Sudanese strains, which encode Glutamic Acid at this position (Glu106 ). Furthermore, when representatives of other African and European lineages were aligned, Glu106 is unique to Sudan, which supports the concept of a single distinct virus strain circulating in Sudan. The high sequence identity in all Sudanese isolates studied, demonstrates the presence of a single rabies virus biotype for which the principal reservoir is the domestic dog. Crown Copyright © 2009 Published by Elsevier B.V. All rights reserved.

1. Introduction Sudan is the largest country in Africa, having borders with Egypt to the north, Eritrea and Ethiopia to the east, Kenya and Uganda to the southeast, Democratic Republic of the Congo and Central African Republic (CAR) to the southwest, Chad to the west and Libya to the northwest (Fig. 1A). The River Nile and its tributaries dominate Sudan, where well-irrigated farms are commonplace. Sudan has abundant wildlife ecosystems although some mammals are threatened with extinction due to habitat decline and poaching. Rabies was first reported in Sudan in 1904 (Harbi, 1976). It is assumed that rabies was introduced into Sudan from the East (Eritrea and Abyssinia) and from West Africa into Darfur and sub-

夽夽 Disclaimer: The findings and conclusions in this report are those of the authors and do not necessarily represent the views of the host institutions or funding agency. 夽 These data have been presented at the 9th Southern and Eastern African Rabies Group Meeting (SEARG) held in Botswana in August 2008. ∗ Corresponding author. Tel.: +44 1932 357840; fax: +44 1932 357239. E-mail address: [email protected] (A.R. Fooks). 1 New address: St Georges Hospital Medical School, London, UK.

sequently into other regions of the country (El Nasri, 1962; Hameid, 1989, 1991). During the period between 1992 and 2002, 2656 cases of rabies in animals were reported (1401 were in Khartoum). Animals testing positive were comprised mostly of dogs but also goats and equids, mainly donkeys. In addition, during this time period, 180,957 human rabies post-exposure prophylaxis (PEP) regimes were administered and 253 deaths of the disease had been reported (Ali et al., 2006). In neighbouring Ethiopia, the reported mortality rate from rabies is 18 per 100,000; one of the highest figures in the world (Haupt, 1999). Human rabies in Sudan is diagnosed on clinical findings alone due to religious and cultural reasons. Between 2003 and 2007, 31 human rabies cases were diagnosed and an additional 54,634 patients received rabies PEP (Anon., 2003–2007). Anti-rabies vaccine is rarely available in the remote regions of Sudan resulting in Khartoum State recording the highest number of administered human rabies post-exposures (Ibrahim et al., 1985; Ali and Zeidan, 1999; Ali et al., 2006). The central states of Sudan still record the highest number of human deaths, possibly due to ineffective primary healthcare and the lack of available vaccine. Inconsistencies in rabies surveillance and control programmes in Sudan are evident due to in-adequate veterinary and healthcare

0168-1702/$ – see front matter. Crown Copyright © 2009 Published by Elsevier B.V. All rights reserved. doi:10.1016/j.virusres.2009.07.010

D.A. Marston et al. / Virus Research 145 (2009) 244–250

245

Fig. 1. (A) Map of Africa with Sudan highlighted. (B) Approximate geographical origin of Sudanese RABV (1a Sud 1 and 1a Sud 2).

systems, financial constrains, political instability as well as limited vaccine availability for both animals and humans. Moreover, animal rabies vaccination coverage in Sudan is poor, which may explain the continuous circulation of the virus in animals in different provinces (Ali, 2002). Control strategies still rely on killing the domestic dog, especially during periods when human rabies cases have been widely reported. Based on sequence analysis, RABV in Africa were delineated into four clades Africa 1, 2, 3, 4 (Kissi et al., 1995; David et al., 2007). While Africa 3 is common in Southern Africa and adapted to the mongoose (David et al., 2007), the Africa 2 clade has a wide distribution in western and central Africa, with minimal overlap with the Africa 1 clade in CAR and Nigeria (Talbi et al., 2009). The Africa 1 clade is distributed in North, Central and South Africa and was further differentiated into 1a and 1b (Kissi et al., 1995). Recent analysis of N-gene sequences, grouped the Africa 1 along with Africa 4 into a larger ‘Cosmopolitan’ clade, and it was speculated they represent secondary introductions from Eurasia (Bourhy et al., 2008). The complex situation of rabies epidemiology in Africa, affecting many host species seems a result of historical introductions, translocations, emergence in free roaming and feral dogs and adaptations to wildlife species (Rupprecht et al., 2008). In a previous report, analysing a limited panel of canine Sudanese RABV, we demonstrated the phylogenetic association of Sudanese and Ethiopian strains suggesting a common canid origin of rabies in both countries (Johnson et al., 2004). The panel used in this previous study, provided an understanding of RABV circulating in dogs but did not investigate the lineages found in domestic livestock, nor did it rule out the possibility of other RABV lineages circulating in Sudan. In this study, we analysed a cohort of rabies viruses collected in Sudan from a range of host species between 1992 and 2006, by the CVRL in Khartoum. Our principal objective was to determine the RABV lineages and reservoir hosts circulating in Sudan and undertake a phylodynamic assessment to investigate the genetic differences of rabies viruses circulating in Sudan.

2. Materials and methods 2.1. Panel of Sudanese RABV The VLA received four cohorts of positive brain specimens submitted to the CVRL in Sudan over a 15-year period (n = 275). 2.2. RNA extraction and RT-PCR RNA was extracted directly from the brain material using TRIzol (Invitrogen). The precipitated RNA was reconstituted in water, quantified using a nanodrop spectrophotometer (Thermo Scientific) and diluted to 1 ␮g/␮l. Reverse transcription and hemi-nested RT-PCR was performed, to amplify a 606 bp product from the nucleoprotein gene, as described previously (Heaton et al., 1997). Any samples negative using the diluted RNA were retested using undiluted RNA. Products were visualised on 2% agarose gel with ethidium bromide. 2.3. Sequencing of PCR products All PCR products were purified using QIAquick PCR purification kit (Qiagen) and approximately 50–150 ng of product was used in a sequencing reaction with either the Big Dye sequencing kit (Applied Biosystems) or the Quickstart sequencing kit (BeckmanCoulter) using JW12 (5 ATGTAACACCYCTACAATG 3 ) for all products and either JW6UNI (5 CARTTVGCRCACATYTTRTG 3 ) for first round PCR products or JW10P (5 GTCATTAGAGTATGGTGTTC 3 ) for second round PCR products. The sequences were obtained by a commercial source (Lark Technologies Inc., Essex, UK) or at the VLA on a CEQ8000 machine (Beckman-Coulter). 2.4. Sequence analysis and phylogenetics Forward and reverse sequences for each isolate were aligned using Seqman (Lasergene, DNAStar) and 400 nucleotide consensus sequences obtained (position 71–470 based on Pasteur Virus genome sequence NC 001542). Identical sequences were

246

D.A. Marston et al. / Virus Research 145 (2009) 244–250

Table 1 RABV sequences analysed in this study. Isolate ID

Original ID

Country

Area

Year

Host species

Source

Accession No.

Identical groupa

Genetic Variant

RV1346 RV1349 RV1350 RV1360 RV1548 RV1552 RV1584 RV1591 RV1607 RV1608 RV1609 RV1621 RV1640 RV1641 RV1642 RV1648 RV1672 RV1680 RV1684 RV1710 RV1718 RV1737 RV1754 RV1763 RV1770 RV1771 RV2332 RV2335 RV520 RV521 Eth94 Eth8 Eth25 ALG83 TUNdog 9247 MAD 9246GAB 9107MAR 9324ZIM 9365NAM 9224TAN 8807ETH 8670NGA 9221TAN 9228CAF 9229CAF 94212KEN RV749 9012NIG 9218TCH 9302SOM 9024GUI RV629 1500AFS 8692EGY Kelev S2 S3

409 413 414 426 55 64 115 127 152 155 156 177 214 216 217 224 285 294 299 330 341 363 383 393 464 466 491 494 F5 F7 13477 13488 13496 13119 13116

Sudan Sudan Sudan Sudan Sudan Sudan Sudan Sudan Sudan Sudan Sudan Sudan Sudan Sudan Sudan Sudan Sudan Sudan Sudan Sudan Sudan Sudan Sudan Sudan Sudan Sudan Sudan Sudan Ethiopia Ethiopia Ethiopia Ethiopia Ethiopia Algeria Tunisia Madagascar Gabon Morocco Zimbabwae Namibia Tanzania Ethiopia Nigeria Tanzania CAF CAF Kenya Kenya Niger Tchad Somaliland Guinea UK ex-Nigeria S Africa Egypt Israel Egypt Egypt

Khartoum State C. Khartoum C. Khartoum Khartoum State C. Khartoum C. Khartoum S. Khartoum S. Khartoum C. Khartoum Northern State S. Khartoum C. Khartoum Central State Eastern State C. Khartoum C. Khartoum E. Khartoum C. Khartoum E. Khartoum E. Khartoum S. Khartoum Northern State E. Khartoum S. Khartoum Central State Eastern State E. Khartoum North Darfur Bale Bale

2001 2001 2001 2001 1992 1992 1994 1995 1996 1996 1996 1996 1997 1997 1997 1998 1999 1999 1999 2000 2000 2000 2000 2001 2004 2004 2006 2006

Dog Goat Goat Dog Goat Goat Goat Goat Dog Cattle Goat Goat Cattle Cattle Cattle Cat Dog Donkey Cattle Dog Cattle Sheep Dog Dog Cattle Camel Dog Horse Jackal Jackal Dog

Johnson et al. (2004) This study This study Johnson et al. (2004) This study This study This study This study This study This study This study This study This study This study This study This study This study This study This study This study This study This study This study This study This study This study This study This study Johnson et al. (2004) Johnson et al. (2004) This study (FLI) This study (FLI) This study (FLI) This study (FLI) This study (FLI) Kissi et al. (1995) Kissi et al. (1995) Kissi et al. (1995) Kissi et al. (1995) Kissi et al. (1995) Kissi et al. (1995) Kissi et al. (1995) Kissi et al. (1995) Kissi et al. (1995) Kissi et al. (1995) Kissi et al. (1995) Kissi et al. (1995) Johnson et al. (2004) Kissi et al. (1995) Kissi et al. (1995) Kissi et al. (1995) Kissi et al. (1995) Johnson et al. (2004) Kissi et al. (1995) Kissi et al. (1995) David et al. (2007) David et al. (2007) David et al. (2007)

AY502125 FJ947004 FJ947005 AY502129 FJ947006 FJ947007 FJ947008 FJ947009 FJ947010 FJ947011 FJ947012 FJ947013 FJ947014 FJ947015 FJ947016 FJ947017 FJ947018 FJ947019 FJ947020 FJ947021 FJ947022 FJ947023 FJ947024 FJ947025 FJ947026 FJ947027 FJ947028 FJ947029 AY103013 AY502132 FJ947030 FJ947032 FJ947033 FJ947031 FJ947034 U22854 U22853 U22852 U22856 U22859 U22648 U22637 U22488 U22645 U22650 U22651 U22858 AY502137 U22640 U22644 U22914 U22641 AY103008 U22628 U22627 DQ837431 DQ837462 DQ837463

I II III IV V VI

1a Sud 1 1a Sud 1 1a Sud 1 1a Sud 1 1a Sud 1 1a Sud 2 1a Sud 1 1a Sud 1 1a Sud 1 1a Sud 1 1a Sud 1 1a Sud 1 1a Sud 1 1a Sud 1 1a Sud 1 1a Sud 1 1a Sud 1 1a Sud 1 1a Sud 1 1a Sud 1 1a Sud 1 1a Sud 1 1a Sud 1 1a Sud 1 1a Sud 1 1a Sud 2 1a Sud 1 1a Sud 1 1a 1a 1a 1a 1a 1a 1a 1a 1a 1a 1a 1a 1a 1a 1b 1b 1b 1b 1b 1b 2 2 2 2 2 3 4 4 4 4

Nairobi

Faium Cairo

1990 1992 1990 1992 1983 1992 1987 1983 1992 1992 1992 1993 1995 1990 1992 1993 1990 1996 1987 1979 1950 1998 1999

Dog Dog Dog Dog Human Dog Human Wild dog Hyena Human Dog Dog Dog Dog equine Dog Dog Dog Dog Human Mongoose Human Dog Dog Dog

VII VIII IX X XI XII

a The isolates representing more than one other isolate because they are identical over 400 bp of the nucleoprotein gene have been assigned Group identities. See Table 2 for a summary of these identical sequences.

removed (see Table 2 for list of identical sequences) and the remaining sequences (n = 28) were assigned Genbank accession numbers and compared to other previously published African sequences (Table 1). Multiple sequence alignments were performed in ClustalX using a multiple sequence format file (msf) created in Megalign (Lasergene, DNAStar). Phylograms were generated using the maximum likelihood method with bootstrapping resampling of 1000 replicates as described previously (Johnson et al., 2002). Amino acid sequence alignments were analysed in Genedoc (Nicholas and Nicholas, 1997) using an msf file created in Megalign (Lasergene, DNAStar).

3. Results A large cohort of FAT positive brain samples held at the CVRL in Sudan comprising 10 different animal species (dog, cat, cattle, camel, goat, donkey, horse, sheep, monkey and bat) collected over a 15-year period (1992–2006) has been studied (Tables 1 and 2). An additional 26 RABV from Sudan and other African countries collected between 1982 and 1992 were supplied by the FriedrichLoeffler-Institute, Germany of which five unique sequences were included in the phylogenetic analysis (Table 1; Fig. 2). The single sample submitted in 2003 was negative by hnRT-PCR and no

D.A. Marston et al. / Virus Research 145 (2009) 244–250

247

Table 2 Summarized list of sequences that are identical over 400 bp of the nucleoprotein gene to the representative sequence in Table 1 (total number for each group includes the representative). Group

Number of isolates in group

Area

Year

Host species

I II III

3 16 82

Khartoum region Khartoum region Khartoum region, Kordofan State, Central & Eastern State Khartoum region Kordofan State Khartoum region

1999, 2001 1994–2004 1992–2005

Dog, goat Goat, dog, donkey, cattle, cat Dog, donkey cattle, goat, camel, sheep, cat

2001, 2002, 2006 1992 1992, 1994 1994–1996 1993–2000 1996–1997 1997, 2000 1997–1998 1998

Camel, cat, goat Goat, dog Dog Goat, dog Dog, goat, cattle Goat Cattle Dog, cattle Camel, cat

IV V VI VII VIII IX X XI XII

3 3 3 4 5 2 2 2 2

Khartoum region, Northern state Khartoum region Central State Khartoum region, Eastern State Kordofan State Khartoum region

samples were submitted in 2002. Of the 275 samples sent to the VLA, 151 were positive by hnRT-PCR (4 camels, 9 cats, 22 cattle, 46 dogs, 18 donkeys, 49 goats, 1 horse, 2 sheep) and 143 of these yielded sequences of sufficient quality for further analysis. The bat and monkey samples which had been FAT positive at CVRL, were negative by hnRT-PCR. Of the 143 sequences, only 28 were unique (Table 1), while a total of 12 groups contained identical sequences, representing between 2 and 82 per group (Tables 1 and 2). Phylogenetic analysis shows that the African RABV sequences group into the previously described lineages: Africa 1 (a and b), 2, 3 and 4 (Kissi et al., 1995; David et al., 2007). All sequences from Sudan were of the Africa 1a sub-lineage. The largest number of sequences in this cohort cluster together forming a clade we have denoted as Sudan 1 (Figs. 1B and 2). When the amino acid sequences are aligned (Fig. 3A), it is apparent that in the majority of sequences position 106 is a Glutamic Acid (E) (Glu106 ). The only exceptions are the seven Sudanese RABV sequences: RV1771, Group IV = RV1360, RV1380, RV2333 and Group VI = RV1552, RV1547 and RV1570 (Tables 1 and 2, Fig. 2) that stand phylogenetically closer to the Ethiopian RABV (RV520, RV521, Eth8, Eth25, Eth94 and 8807ETH). All those isolates have Aspartic Acid (D) (Asp106 ) and those from Sudan were denoted Sudan 2 (Figs. 1B and 2). This association with Ethiopian RABV supports previously published data (Johnson et al., 2004). Interestingly, there is a group of sequences; represented by RV1360 (Group IV) which has the molecular signature of the Sudan 1 sequences (Glu106 ) yet synonymous (silent) changes in the sequence indicate phylogenetically it lies between the two groups. When a similar alignment is undertaken with other representative Africa 1a amino acid sequences, they all have Asp106 revealing the uniqueness of the Sudan 1 lineage (Fig. 3B). When representatives for all African RABV lineages were aligned with a representative European isolate and Pasteur Virus (PV), five different amino acids were observed at position 106, none of which were Glu106 (Fig. 3C). Three representatives of Africa 2 are included in the alignment as they all have different amino acids at position 106 (D, G and A) (Fig. 3C). 4. Discussion Sequence analysis and subsequent phylodynamics can contribute greatly to the understanding of the epidemiology of rabies in endemic countries. In this study, we analysed a cohort of 143 rabies viruses circulating in Sudan collected from a range of animal species between 1992 and 2006. This panel of rabies viruses facilitated the largest study of rabies molecular epidemiology in Sudan. Our phylogenetic analysis confirmed that Sudanese RABV cluster within the Africa 1a group (Fig. 2) and supports previous reports that Africa 1a is a highly dispersed group of viruses detected throughout the African continent (Johnson et al., 2004;

Bourhy et al., 2008). In addition, our observations further support the association with Ethiopian RABVs shown with a discrete panel of canine RABV (Johnson et al., 2004). The Ethiopian RABV sequences that group with the Sudanese cluster reflect the close relationship of these viruses within the same lineage and relate to the geographical proximity of the origin of these viruses (Fig. 1). Indeed, all the viruses originate from the Eastern parts of the Sudan, and were isolated from both reservoir and livestock species over a 12-year period, suggesting Ethiopian RABV have either spread continuously into Eastern Sudan or have been established there for over a decade. It is possible that cross-border spread of RABV may be facilitated by traditional livestock trading between Sudan and Ethiopia. In contrast to assumptions that the currently circulating Sudanese RABV might have an origin in Ethiopia (Johnson et al., 2004), data reported in this analysis, using a larger cohort of isolates, suggests that two sub-lineages of Africa 1a are circulating, the first being unique to Sudan only (Sudan 1) and the second, detected both in Sudan and Ethiopia (Sudan 2). This observation supports historical assumptions that rabies was introduced into Sudan from the East (Eritrea and Abyssinia) and from West Africa into Darfur region (El Nasri, 1962). It is notable that in our panel of Sudanese isolates only Africa 1a was identified. This observation is surprising considering the presence of Africa 2 and Africa 4 in bordering countries (Talbi et al., 2009; David et al., 2007). In CAR, both Africa 1 and 2 circulate and the latter seems to have a westward spread (Talbi et al., 2009). The samples investigated in our study however, are not distributed evenly across Sudan and instead originate in the central or eastern provinces in close proximity to the capital, Khartoum, where the central veterinary laboratory is located. This reflects a common problem for most phylogenetic analyses in developing countries and was recently highlighted for West Africa (Talbi et al., 2009). This sample biasing is often due to the fact that due to financial constraints, capabilities to appropriately collect, store and ship samples are lacking in most parts of these countries. When testing the submitted samples, a significant proportion of the previously FAT-positive samples tested negative by hnRT-PCR. Although the possibility of false positive FAT results cannot be ruled out, we propose that generally the poor correlation of FAT and RT-PCR for archived material is not reflective of the relative sensitivities of the two diagnostic tests, rather the storage conditions of the samples. Furthermore, political instabilities prevent systematic surveillance efforts in some areas of Sudan. Therefore, we cannot rule out the possibility that other lineages also circulate in Sudan, particularly in border regions to neighbouring countries. Future surveillance would need to be extended to the outer regions of Sudan to achieve a greater understanding of the cross-border translocation of RABV.

248

D.A. Marston et al. / Virus Research 145 (2009) 244–250

Fig. 2. Radial phylogenetic analysis of RABV isolates from Africa using 400 bp of the nucleoprotein gene. Inset is a phylogram of the Africa 1a sequences in more detail. Significant bootstraps are included—1000 replicates.

It appears there has been only one dominant circulating RABV strain in Sudan during the past 15 years, with the principal reservoir being the domestic dog. The panel does lack representative wildlife species that could also act as reservoirs (such as jackals)

as a result of limited surveillance. The potential of African wildlife species to act as maintenance hosts has been previously discussed (Bingham, 2005). However, if specific wildlife RABV strains circulated in Sudan, we would expect them to be identified in the

D.A. Marston et al. / Virus Research 145 (2009) 244–250

249

Fig. 3. Nucleoprotein amino acid alignment of (A): the unique sequences from Sudan with arrows indicating the variable position 106. (B) Other 1a members all from Kissi et al. (1995). (C) Representatives for each Africa group, 1a: 8807ETH, 1b: 9221TAN, 2: 9012NIG, 9024GUI, 9218TCH, 3: 1500AFS, 4: DQ837412, Europe: 8665FRA (U42605) and PV: (NC 001542).

non-reservoir species that were included in this study. Further research focusing on wildlife rabies is needed to elucidate its true role in the maintenance and epidemiology of the disease in Sudan. The identity between the Sudanese RABV sequences was surprisingly high. For example, the largest group of identical sequences (III, n = 82) contained RABVs from different host species and during the whole period of 13 years of collection suggesting that RABV circulating in this part of Sudan remain highly genetically stable. Indeed, when all 28 unique sequences were compared to other African rabies virus sequences, to further investigate the relationship of our sequences with those in neighbouring countries and circulating in the remaining continent, the high sequence identity between the Sudanese RABV became more apparent (Fig. 2). This finding corroborates studies on canine RABV in Western and Central African countries indicating strong geographical clustering of canine RABV sequences (Talbi et al., 2009). Holistically, the phylogeographic structure of canine RABV revealed only limited viral movement among larger geographical localities (Bourhy et

al., 2008), which seems a common characteristic supported by our observations. Interestingly, using amino acid alignments the delineation between the Sudan 1 and Sudan 2 lineage became more apparent, particularly at amino acid position 106 (Fig. 3). All of the Africa 1a sequences analysed including those from Ethiopia and Sudan 2 share Asp106 contrasting to the majority of Sudanese sequences (Sudan 1) that have Glu106 . Furthermore, when representatives of other African and European lineages are aligned, Glu106 is a unique genetic signature to Sudan 1 RABV. This observation suggests that this variant was acquired and maintained within Sudan and that the spread of RABV from Sudan to other countries is minimal, as the variant has not been detected in Africa 1a isolates from other regions in Africa. This unique genetic signature would offer the possibility to apply this feature as a tracing tool to monitor the spread of this specific RABV lineage in Africa, thereby providing information for risk assessments and viral movement across borders.

250

D.A. Marston et al. / Virus Research 145 (2009) 244–250

Our data suggests that despite the size of Sudan and the variety of both habitats and species identified within, the analysed strains of RABV were similar, with one dominant reservoir species—the domestic dog. It is possible that wildlife species such as jackals play a role in the epidemiology of RABV in Sudan, but there is insufficient evidence to suggest they act as reservoir species. Furthermore, despite the numerous borders and cross-border trading that occurs, new or extraneous RABV strains, even if they have been introduced; appear not to have become established. Although vaccination campaigns have previously been implemented, none have been successfully sustained (Ali et al., 2006). If the vaccination of domestic dogs could be accompanied by vaccination of livestock, financial burdens from losses would be minimised. Future vaccination campaigns must take into account the recently identified cyclical nature of canine rabies in Sudan (Hampson et al., 2007). Rabies epidemics are reported to cycle at 3–6 year intervals and as such vaccination campaigns need to be well co-ordinated and sustained if they are to achieve the goal of rabies elimination from dogs in Sudan (Rupprecht et al., 2008; Hampson et al., 2009). A sustained vaccination campaign targeting the domestic dog will undoubtedly reduce the number of animal and more importantly human rabies cases in Sudan (Cleaveland et al., 2006). In conclusion, the Sudanese RABV analysed contain a unique molecular signature—Glutamic Acid at position 106 (Glu106 ), which supports the concept of a unique virus biotype circulating in Sudan for which the principal reservoir is the domestic dog. Acknowledgments The authors would like to thank Colin Black, Hooman Goharriz and Alison Dicker for their excellent technical assistance. We also express our sincere gratitude to members of the Khartoum Veterinary Clinic, Epizootic Disease Control Department of Ministry of Animal Resources, Animal Resources Departments within the different provinces of Sudan and The Department of Biostatistics of Federal Ministry of Health for data collection. This study was funded by the UK Department for Environment, Food and Rural Affairs (Defra project SE0420 and SE0423). References Anon., 2003–2007. Annual reports of Ministry of Animal Resources and Fisheries, Sudan.

Ali, Y.H., 2002. Outbreak of rabies in South Darfur, Sudan. Vet. Rec. 150, 610–612. Ali, Y.H., Zeidan, M.I., 1999. Rabies in Sudan, 1992–1998. Sud. J. Vet. Sci. Anim. Husb. 38, 162–167. Ali, Y.H., Intisar, K.S., Wegdan, H.A., Ali, E.B., 2006. Epidemiology of rabies in Sudan. J. Anim. Vet. Adv. 5 (3), 266–270. Bingham, J., 2005. Canine rabies ecology in southern Africa. Emerg. Infect. Dis. 11 (9), 1337–1342. Bourhy, H., Reynes, J.M., Dunham, E.J., Dacheux, L., Larrous, F., Huong, V.T., Xu, G., Yan, J., Miranda, M.E., Holmes, E.C., 2008. The origin and phylogeography of dog rabies virus. J. Gen. Virol. 89 (Pt 11), 2673–2681. Cleaveland, S., Kaare, M., Knobel, D., Laurenson, M.K., 2006. Canine vaccination—providing broader benefits for disease control. Vet. Microbiol. 117 (1), 43–50. David, D., Hughes, G.J., Yakobson, B.A., Davidson, I., Un, H., Aylan, O., Kuzmin, I.V., Rupprecht, C.E., 2007. Identification of novel canine rabies virus clades in the Middle East and North Africa. J. Gen. Virol. 88 (Pt 3), 967–980. El Nasri, M., 1962. A review of animal rabies in the Sudan. Sud. J. Vet. Sci. Anim. Husb. 3, 20–24. Hameid, O.A., 1989. Rabies situation in Khartoum province, Sudan 1977–1987. Sud. J. Vet. Sci. Anim. Husb. 28, 83–88. Hameid, O.A., 1991. Rabies in Sudan: an epidemiological review. Vet. Rec. 128, 61–62. Hampson, K., Dushoff, J., Bingham, J., Brückner, G., Ali, Y.H., Dobson, A., 2007. Synchronous cycles of domestic dog rabies in sub-Saharan Africa and the impact of control efforts. Proc. Natl. Acad. Sci. U.S.A. 104 (18), 7717–7722. Hampson, K., Dushoff, J., Cleaveland, S., Haydon, D.T., Kaare, M., Packer, C., Dobson, A., 2009. Transmission dynamics and prospects for the elimination of canine rabies. PLoS Biol. 7 (3), e53. Harbi, M.S., 1976. The incidence of rabies in animals in the Sudan. Bull. Anim. Hlth. Prod. Afric. 42, 43–46. Haupt, W., 1999. Rabies—risk of exposure and current trends in prevention of human cases. Vaccine 17 (13–14), 1742–1749. Heaton, P.R., Johnstone, P., McElhinney, L.M, Cowley,.R., O’Sullivan, E., Whitby, J.E., 1997. Heminested PCR assay for detection of six genotypes of rabies and rabiesrelated viruses. J. Clin. Microbiol. 35 (11), 2762–2766. Ibrahim, A.E., El Tigani, A., Ali, A.A., 1985. Epidemiology of rabies in Sudan. In: Kuwert, E., Merieux, C., Koprowski, H., Bogel, K. (Eds.), Rabies In The Tropics. SpringerVerlag, Berlin Heidelberg, pp. 497–515. Johnson, N., McElhinney, L.M., Smith, J., Lowings, P., Fooks, A.R., 2002. Phylogenetic comparison of the genus Lyssavirus using distal coding sequences of the glycoprotein and nucleoprotein genes. Arch. Virol. 147, 2111–2123. Johnson, N., McElhinney, L.M., Ali, Y.H., Saeed, I.K., Fooks, A.R., 2004. Molecular epidemiology of canid rabies in Sudan: evidence for a common origin of rabies with Ethiopia. Virus Res. 104, 201–205. Kissi, B., Tordo, N., Bourhy, H., 1995. Genetic polymorphism in the rabies virus nucleoprotein gene. Virology 209, 526–537. Nicholas, K.B., Nicholas, H.B Jr., 1997. GeneDoc: a tool for editing and annotating multiple sequence alignments. http://www.psc.edu/biomed/genedoc. Rupprecht, C.E., Barrett, J., Briggs, D., Cliquet, F., Fooks, A.R., Lumlertdacha, F., Meslin, F.X., Muller, T., Nel, L., Schneider, C., Tordo, N., Wanderler, 2008. Can rabies be eradicated? Dev. Biol. 131, 95–122. Talbi, C., Holmes, E.C., de Benedictis, P., Faye, O., Nakoune, E., Gamatie, D., Diarra, A., Elmamy, B.O., Sow, A., Adjogoua, E.V., Sangare, O., Dundon, W.G., Capua, I., Sall, A.A., Bourhy, H., 2009. Evolutionary history and dynamics of dog rabies virus in western and central Africa. J. Gen. Viol. 90, 783–791.