Phylogenetic relationships among families of Gadiformes (Teleostei, Paracanthopterygii) based on nuclear and mitochondrial data

Molecular Phylogenetics and Evolution 52 (2009) 688–704

Contents lists available at ScienceDirect

Molecular Phylogenetics and Evolution journal homepage: www.elsevier.com/locate/ympev

Phylogenetic relationships among families of Gadiformes (Teleostei, Paracanthopterygii) based on nuclear and mitochondrial data Adela Roa-Varón a,*, Guillermo Ortí b a b

Center for Marine Science, University of North Carolina, Wilmington, 5600 Marvin K. Moss Ln, NC 28409, USA School of Biological Sciences, University of Nebraska, Lincoln, USA

a r t i c l e

i n f o

Article history: Received 8 October 2008 Revised 18 March 2009 Accepted 23 March 2009 Available online 2 April 2009 Keywords: Gadiformes RAG1 16S 12S Phylogeny

a b s t r a c t Phylogenetic hypotheses among Gadiformes fishes at the suborder, family, and subfamily levels are controversial. To address this problem, we analyze nuclear and mitochondrial DNA (mtDNA) sequences for the most extensive taxonomic sampling compiled to date, representing all of the recognized families and subfamilies in the order (except the monotypic family Lyconidae). Our study sampled 117 species from 46 genera, comprising around 20% of the species described for the order (more than 60% of all genera in the order) and produced 2740 bp of DNA sequence data for each species. Our analysis was successful in confirming the monophyly of Gadiformes and most of the proposed families for the order, but alternative hypotheses of sister-group relationships among families were poorly resolved. Our results are consistent with dividing Gadiformes into 12 families in three suborders, Muraenolepidoidei, Macrouroidei, and Gadoidei. Muraenolepidoidei contains the single family Muraenolepididae. The suborder Macrouroidei includes at least three families: Macrouridae, Macruronidae and Steindachneriidae. Macrouridae is deeply divided into two well-supported subfamilies: Macrourinae and Bathygadinae, suggesting that Bathygadinae may be ranked at the family level. The suborder Gadoidei includes the families: Merlucciidae, Melanonidae, Euclichthyidae, Gadidae, Ranicipitidae, and Bregmacerotidae. Additionally, Trachyrincinae could be ranked at family level including two subfamilies: Trachyrincinae and Macrouroidinae within Gadoidei. Further taxonomic sampling and sequencing efforts are needed in order to corroborate these relationships. Published by Elsevier Inc.

1. Introduction Gadiform fishes inhabit cool waters in every ocean of the world. They occur throughout the water column in high latitudes, from deep-sea benthic habitats to coastal waters, but mainly in deeper layers in tropical seas. Only two species are known from freshwater habitats (Nelson, 2006). The order Gadiformes includes some of the most important commercial fishes in the world. Considering only cod, hake, and haddock, gadiform fishes account for approximately 18% of the World’s total marine fish catch (FAO, 2004). Despite the great commercial and ecological importance and a long history of taxonomic study, our knowledge of the systematics of Gadiformes still is far from clear. Most of the information available comes from commercially important species and is based on morphological data. Currently, different authors recognize anywhere from 11 to 14 families, about 75 genera, and more than 500 species within the group (Table 1). For this study, we follow the classification of Gadiformes proposed by Endo (2002), with three suborders * Corresponding author. Fax: +1 910 790 2292. E-mail addresses: [email protected] (A. Roa-Varón), [email protected] (G. Ortí). 1055-7903/$ - see front matter Published by Elsevier Inc. doi:10.1016/j.ympev.2009.03.020

(1) Melanonoidei, (2) Macrouroidei, and (3) Gadoidei, and a total of 11 families (Table 1 and Fig. 1a). The composition and classification of the Gadiformes has changed substantially since the erection of the group by Müller (1845) within the Anacanthini (fishes without spiny rays in their fins, a group that also included flatfishes). Changes over the years involved the number of suborders, families, and subfamilies (see Table 1 and Fig. 1 for some examples). In 1986, a landmark workshop on the systematics of Gadiformes (WOGADS) addressed three main topics: (1) what belongs in the Gadiformes; (2) the relationships of Gadiformes with closely related groups, and (3) arrangement of some taxa within gadiforms. Contrary to expectations, no consensus about the phylogeny and classification of the order emerged from this effort. No contribution questioned the monophyly of the order, but rather focused at the family level, rearranging genera or subfamilies based on a diversity of evidence, such as ontogenetic characters, early life history, adult morphology, otolith morphology, karyology, and protein electrophoresis. Only three authors produced an explicit phylogenetic hypothesis for Gadiformes: Howes (1989) based his analysis on characters of muscles and joints, Markle (1989) used adult morphology, and Nolf and

Table 1 Alternative classification schemes proposed by several authors for the order Gadiformes. Families are numbered to highlight diversity of opinion. Cohen (1984)

Muraenolepidoidei 1. Muraenolepididae

Muraenolepidoidei 1. Muraenolepididae

Macrouroidei 2. Macrouridae Bathygadinae Macrourinae Trachyrincinae Macrouroidinae

Gadoidei

3. Euclichthyidae Gadoidei

Markle (1989)

Merlucciinae

Siebert (1990)

3. Steindachneriidae 4. Moridae 5. Euclichthyidae

4. Moridae 5. Gadidae

8. Gadidae

6. Lotidae 7. Phycidae

9. Lotidae 10. Phycidae

8. Merlucciidae Merlucciinae Steindachneriinae

11. Merlucciidae

1. Melanonidae

2. Melanonidae

2. Macrouridae Bathygadinae Macrourinae Trachyrincinae Macrouroidinae

3. Macrouridae

Bregmacerotoidei 10. Bregmacerotidae

Howes (1993)

Endo (2002)

Macrouroidei 1. Macrouridae

Melanonoidei 1. Melanonidae Macrouroidei 2. Macrouridae

Melanonoidei 1. Melanonidae Macrouroidei 2. Macrouridae Bathygadinae Macrourinae Trachyrincinae Macrouroidina 3. Steindachneriidae

Macrourinae Trachyrincinae Macrouroidinae 4. Steindachneriidae

3. Moridae 4. Euclichthyidae

5. Euclichthyidae

6. Gadidae Gadinae Lotinae Phycinae

6. Macruronidae 7. Moridae 8. Gadidae 9. Lotidae

2. Moridae 3. Gadidae 4. Lotidae 5. Phycidae 6. Merlucciidae

Merlucciinae Steindachneriinae

12. Bregmacerotidae Ranicipitoidei 13. Ranicipitidae

Gadoidei

Gadoidei

3. Macruronidae 4. Moridae 5. Gadidae

4. Macruronidae 5. Moridae 6. Gadidae Gadinae Lotinae Phycinae Gaidropsarinae 7. Merlucciidae

5. Muraenolepididae

7. Steindachneriidae 8. Euclichthyidae 9. Muraenolepididae 10. Melanonidae 11. Trachyrincidae 12. Bathygadidae

9. Melanonidae

4. Bregmacerotidae

Howes (1989)

1. Muraenolepididae Melanonoidei 1. Melanonidae Macrouroidei 2. Macrouridae

6. Muraenolepididae 7. Macruronidae 2. Moridae 3. Gadidae Gadinae Lotinae

Nolf and Steurbaut (1989)

7. Bregmacerotidae

6. 7. 8. 9.

Lotidae Phycidae Gaidropsaridae Merlucciidae

10. Euclichthyidae 11. Muraenolepididae

8. Euclichthyidae 9. Muraenolepididae

10. Bregmacerotidae

13. Bregmacerotidae

12. Bregmacerotidae

10. Bregmacerotidae

11. Ranicipitidae

14. Ranicipitidae

13. Ranicipitidae

11. Ranicipitidae

A. Roa-Varón, G. Ortí / Molecular Phylogenetics and Evolution 52 (2009) 688–704

Svetovidov (1948)

689

690

A. Roa-Varón, G. Ortí / Molecular Phylogenetics and Evolution 52 (2009) 688–704

Fig. 1. Morphology-based hypothesis for Gadiformes proposed by: (a) Endo (2002) and (b) Nelson (2006). Morphology and Molecular-based hypothesis of the family Gadidae proposed by: (c) Teletchea et al. (2006).

Steurbaut (1989) otolith morphology; each presented a different phylogenetic classification of recent gadiform taxa (Table 1). More recently, Endo (2002) published a comprehensive classification of Gadiformes (Fig. 1a), but many issues remained unresolved. For example, although he proposed a series of six synapomorphies for Gadiformes, unambiguous and unreversed synapomorphies have not been identified for all members of the order and/or for the exclusion of nonmembers (Patterson and Rosen, 1989; Endo, 2002). In addition, the very high incidence of homoplasy among morphological characters, and the relatively limited inclusion of fossil material in phylogenetic analyses hinder resolution of gadiform phylogenetic relationships. In spite of the exhaustive study of the available morphology, Endo (2002) recognized that the addition of more taxa and perhaps molecular data would clarify the phylogeny of the group. A recent assessment of knowledge on phylogenetic relationships among gadiforms by Nelson (2006) clearly reflects a lack of consensus (Fig. 1b). The Gadiformes are typically included within the supra-ordinal taxon Paracanthopterygii. However, what other taxa should be included in this group remains unsettled, and morphological and molecular data do not agree on the precise identity of the closest relative of Gadiformes. In fact, a long controversy over paracanthopterygian membership and interrelationships has been revitalized due to recent analyses of whole mitochondrial genome sequences that identified zeioids (order Zeiformes, suborder Zeioidei) as the sister group of Gadiformes (Miya et al., 2001, 2003, 2005). According to the mitogenomic data, the name ‘‘Paracanthoptherygii” should be retained for a clade that comprises Gadiformes, Zeioidei, Percopsiformes, and Polymixiiformes. No comprehensive molecular phylogeny for Gadiformes has been published to date. A few studies using mitochondrial DNA (mtDNA) sequences focused mainly on species relationships either within Gadinae or Merlucciidae (e.g. Carr et al., 1999; Møller et al., 2002). Teletchea et al. (2006) published a phylogeny of the family Gadidae based on 30 morphological characters and two mitochondrial genes: complete cytochrome b and partial cytochrome oxidase I (1530 bp). Their study included 19 out of the 22 genera

traditionally included in the group. Based on their results, they proposed a new provisional classification of the gadoids (Fig. 1c). von der Heyden and Matthee (2008) added 6 new sequences to the Teletchea et al. (2006) data set, representing 3 other gadiform genera: Lyconus (2 spp.), Macruronus (2 spp.), and Steindachneria (1 sp.), as well as two Merluccius species. Their results show conclusively that the Steindachneridae are a monophyletic group and that Lyconus, Macruronus, and Merluccius do not form a monophyletic group, thus proposing the resurrection of the family Lyconidae. Molecular systematic studies of Merlucciidae have been based on allozyme data (Roldan et al., 1999), mtDNA sequences (Quinteiro et al., 2000), or both (Grant and Leslie, 2001). These studies identified two well-supported clades within Merlucciidae: the Old-World (Europe plus Africa) and the New-World (West Atlantic and east Pacific) species, revealing a strong zoogeographical pattern. Grant and Leslie (2001), based on the genetic distance between these two clades, estimated the age of their separation to 10–15 Myr ago. 1.1. Unresolved questions on the systematics of Gadiformes Among several issues, we summarize here the critical problems by raising specific questions: (1) how many major lineages (e.g. suborders) are included in the Gadiformes? (2) How many families, and what are their phylogenetic relationships? Are all currently recognized families well-defined monophyletic groups? For example, is Melanonidae the sister group of all the other Gadiformes? Does Steindachneriidae belong to Gadoidei or Macrouroidei? Should Euclichthyidae be included in Moridae? Is Macruronidae and/or Steindachneriidae part of Merlucciidae? Does Ranicipitidae belong to Gadidae? Is Phycidae a subfamily of Gadidae? Is Muraenolepidae the earliest branching lineage among Gadiformes, as suggested by Okamura (1970a,b), Cohen (1984), and Balushkin and Prirodina (2005, 2006) or is it Ranicipitidae, as suggested by Markle (1989), or perhaps Melanonidae, following Howes (1993) and Endo (2002)?

691

A. Roa-Varón, G. Ortí / Molecular Phylogenetics and Evolution 52 (2009) 688–704

Table 2 List of species examined in this study, following the classification of Endo (2002) and GenBank Accession numbers for RAG1 and mitochondrial ribosomal genes collected in this study (FJ214986–FJ215303). Species

12S

16S

RAG1

Voucher No.

Lampridiformes Lampris guttatus

NC003165*

NC003165*

AY308764*

–

Percopsiformes Aphredoderus sayanus Percopsis transmontana

FJ214986 NC003168*

FJ215096 NC003168*

FJ215201 AY308766*

UKNHM-T860 –

Polymixiiformes Polymixia japonica

NC002648*

NC002648*

AY308765*

–

NC004398*

NC004398* AY308781*

–

Zeiformes Allocyttus niger Allocyttus verrucosus Zenopsis nebulosus Zenopsis conchifer Zeus faber

NC003173*

NC003173*

NC003190*

NC003190*

AY308778 FJ215202

– Donated tissuea

Gadiformes Euclichthyidae Euclichthys polynemus Euclichthys polynemus

FJ215026 FJ215027

FJ215135 FJ215136

– –

Donated tissueb Donated tissueb

Bregmacerotidae Bregmaceros nectabanus Bregmaceros atlanticus Bregmaceros cantori

NC008124* FJ214994 FJ214995

NC008124* FJ215104 FJ215105

– – –

– Donated tissuec UKNHM-T5132

Gadidae Boreogadus saida Ciliata mustela Eleginus gracilis Enchelyopus cimbrius Gadus macrocephalus Gadus morhua Gadus ogac Gaidropsaurus argenteus Gaidropsaurus ensis Lota lota Melanogrammus aeglefinus Merlangius merlangus Microgadus proximus Microgadus tomcod Micromesistius poutassou Molva molva Phycis chesteri Pollachius virens Theragra chalcogramma Trisopterus esmarkii Trisopterus minutus Urophycis chuss Urophycis floridana Urophycis regia Urophycis tenuis

FJ214993 FJ215012 FJ215024 FJ215025 FJ215032 NC002081 FJ215031 FJ215033 FJ215034 NC004379 DQ020497 FJ215053 FJ215062 FJ215063 FJ215064 FJ215065 FJ215077 FJ215079 FJ215085 FJ215089 FJ215090 FJ215093 FJ215094 FJ215091 FJ215092

FJ215103 FJ215121 FJ215133 FJ215134 FJ215141 NC002081 FJ215140 FJ215142 FJ215143 NC004379 DQ020497 FJ215161 FJ215170 FJ215171 FJ215172 FJ215173 FJ215184 FJ215186 FJ215192 FJ215195 FJ215196 FJ215197 FJ215198 FJ215200 FJ215199

– FJ215225 FJ215236 FJ215237 FJ215241 FJ215242 – FJ215243 FJ215244 FJ215254 FJ215262 FJ215265 FJ215274 – – FJ215275 FJ215287 FJ215289 FJ215294 – – FJ215299 FJ215300 FJ215301 FJ215302

ZMUC-375316 ZMUC-373657 UW-044916 UKNHM-T2787 UW-047711 UKNHM-T2937 UKNHM-T3533 UKNHM-T3621 UKNHM-T3675 UKNHM-T3772 Donated tissued UKNHM-T3774 UW-047300 UKNHM-T5884 UKNHM-T3777 ZMUC-373715 UKNHM-T2954 UKNHM-T359 UW-047697 ZMUC-375316 ZMUC-373708 UKNHM-T1035 UKNHM-T5084 UKNHM-T1000 UKNHM-366

Macrouridae Albatrossia pectoralis Bathygadus antrodes Bathygadus favosus Bathygadus macrops Bathygadus melanobranchus Coelorinchus acantiger Coelorinchus aspercephalus Coelorinchus biclizonalis Coelorinchus bollonsi Coelorinchus caribbaeus Coelorinchus cf. smithi Coelorinchus coelorhincus Coelorinchus fasciatus Coelorinchus geronimo Coelorinchus innotabilis Coelorinchus kaiyomaru Coelorinchus kermadecus Coelorinchus matamua Coelorinchus oliverianus Coelorinchus parvifasciatus Coelorinchus polli

FJ214987 AP008988* FJ214990 FJ214991 FJ214992 FJ214998 FJ215001 FJ215003 FJ215002 FJ215010 FJ215006 FJ215007 FJ215004 FJ215008 FJ215000 FJ214996 FJ214997 FJ215011 FJ214999 FJ215005 FJ215009

FJ215097 AP008988* FJ215100 FJ215101 FJ215102 FJ215108 FJ215110 – FJ215111 FJ215120 FJ215116 FJ215119 FJ215112 FJ215117 FJ215109 FJ215106 FJ215107 FJ215115 FJ215114 FJ215113 FJ215118

FJ215203 – FJ215206 FJ215207 FJ215208 FJ215209 FJ215210 FJ215211 FJ215212 FJ215214 FJ215224 FJ215213 FJ215215 FJ215216 FJ215217 FJ215218 FJ215219 FJ215220 FJ215221 FJ215222 FJ215223

KUNHM-T2094 – KUNHM-T3701 Donated tissuee CAS-224389 CAS-In process Donated tissueb Donated tissueb Donated tissueb KUNHM-4001 Donated tissuef KUNHM-T4976 Donated tissueb CAS-223169 Donated tissueb Donated tissueb CAS-In process Donated tissueb Donated tissueb Donated tissueb CAS-223427 (continued on next page)

692

A. Roa-Varón, G. Ortí / Molecular Phylogenetics and Evolution 52 (2009) 688–704

Table 2 (continued) Species

12S

16S

RAG1

Voucher No.

Coryphaenoides acrolepis Coryphaenoides alateralis Coryphaenoides cinereus Coryphaenoides dossenus Coryphaenoides guentheri Coryphaenoides marshalli Coryphaenoides paramarshalli Coryphaenoides rupestris Coryphaenoides serrulatus Coryphaenoides subserrulatus Coryphaenoides zaniophorus Gadomus colletti Gadomus dispar Hymenocephalus italicus Hymenocephalus longiceps Hymenocephalus striatissimus Lucigadus nigromaculatus Macrourus berglax Macrourus carinatus Malacocephalus laevis Malacocephalus occidentalis Mesobius antipodum Nezumia aequalis Nezumia africana Nezumia duodecim Nezumia liolepis Nezumia longebarbata Nezumia micronychodon Nezumia milleri Squalogadus modificatus Trachonurus sp. Trachonurus sulcatus Trachyrincus murrayi Trachyrincus scabrus Ventrifossa garmani Ventrifossa jhonboborum

FJ215013 FJ215022 FJ215014 FJ215023 FJ215018 FJ215016 FJ215017 FJ215021 FJ215019 FJ215020 FJ215015 FJ215029 FJ215030 FJ215038 FJ215036 FJ215037 FJ215044 FJ215045 FJ215046 FJ215050 FJ215049 FJ215061 FJ215070 FJ215072 FJ215074 FJ215075 FJ215076 FJ215073 FJ215071 – FJ215086 FJ215087 – FJ215088 AP008991 FJ215095

FJ215122 FJ215131 FJ215123 FJ215132 FJ215128 FJ215126 FJ215127 FJ215130 FJ215124 FJ215125 FJ215129 FJ215138 FJ215139 FJ215147 FJ215145 FJ215146 – FJ215153 FJ215154 FJ215158 FJ215157 FJ215169 FJ215178 FJ215181 – FJ215183 FJ215180 FJ215182 FJ215179 FJ215189 – FJ215193 – FJ215194 AP008991 –

FJ215226 FJ215227 FJ215228 FJ215229 FJ215231 FJ215232 FJ215233 FJ215234 FJ215235 FJ215230 FJ215239 FJ215240 FJ215246 FJ215248 FJ215247 FJ215255 FJ215256 FJ215257 FJ215260 FJ215261 FJ215273 FJ215280 FJ215281 FJ215282 FJ215283 FJ215284 FJ215285 FJ215286 – FJ215295 FJ215296 FJ215297 FJ215298 FJ215303 –

UW-111370 KUNHM-T3676 KUNHM-T2402 CAS-223379 ZMUC-375254 CAS-223380 CAS-223381 KUNHM-T3572 Donated tissueb Donated tissueb CAS-224774 Donated tissuef KUNHM-T3127 CAS-223180 Donated tissuef Donated tissuef Donated tissueb KUNHM-T970 Donated tissueb CAS-225354 CAS-223164 Donated tissueb CAS-223121 CAS-224399 CAS-223422 KUNHM-T2232 KUNHM-T3581 CAS-223426 CAS-223147 CAS-In process CAS-In process KUNHM-T3687 ZMUC-375245 CAS-223413 Donated tissuef CAS-In process

Macruronidae Macruronus novaezelandiae Macruronus novaezelandiae

FJ215155 FJ215156

FJ215155 FJ215156

FJ215258 FJ215259

Donated tissueb Donated tissueb

Melanonidae Melanonus gracilis Melanonus zugmayeri

FJ215159 FJ215160

FJ215159 FJ215160

FJ215263 FJ215264

CAS-In process CAS-222445

Merlucciidae Merluccius australis Merluccius bilinearis Merluccius capensis Merluccius gayi Merluccius hubbsi Merluccius polli Merluccius productus

FJ215162 FJ215165 FJ215166 FJ215163 FJ215168 FJ215167 FJ215164

FJ215162 FJ215165 FJ215166 FJ215163 FJ215168 FJ215167 FJ215164

FJ215266 FJ215267 FJ215268 FJ215269 FJ215270 FJ215271 FJ215272

Donated tissueg KUNHM-T367 CAS-224386 Donated tissueg Donated tissueg CAS-223407 KUNHM-T2306

Moridae Antimora microlepis Antimora rostrata Gadella jordani Halargyreus johnsonii Laemonema barbatulum Laemonema goodebeanorum Laemonema sp. Lepidion capensis Lepidion ensiferus Physiculus fulvus Physiculus japonicus

FJ214988 FJ214989 FJ215028 FJ215035 FJ215039 FJ215040 FJ215041 FJ215042 FJ215043 FJ215078 NC004377*

FJ215098 FJ215099 FJ215137 FJ215144 FJ215148 FJ215149 FJ215150 FJ215151 FJ215152 FJ215185 NC004377*

FJ215204 FJ215205 FJ215238 FJ215245 FJ215249 FJ215250 FJ215251 FJ215252 FJ215253 FJ215288 –

KUNHM-T2064 KUNHM-T3660 Donated tissuef NMFS-134 KUNHM-T3120 KUNHM-T3300 CAS-224371 CAS-In process KUNHM-T928 KUNHM-T3508 –

Muraenolepididae Muraenolepis marmoratus Muraenolepis microps Muraenolepis orangiensis Muraenolepis sp.

FJ215066 FJ215067 FJ215068 FJ215069

FJ215174 FJ215175 FJ215176 FJ215177

FJ215276 FJ215277 FJ215278 FJ215279

Donated Donated Donated Donated

Ranicipitidae Raniceps raninus Raniceps raninus

FJ215080 FJ215081

FJ215187 FJ215188

FJ215290 FJ215291

Donated tissuea ZMUC-375239

tissuea tissuea tissuea tissueb

693

A. Roa-Varón, G. Ortí / Molecular Phylogenetics and Evolution 52 (2009) 688–704 Table 2 (continued) Species

12S

16S

RAG1

Voucher No.

Steindachneriidae Steindachneria argentea Steindachneria argentea

FJ215083 FJ215084

FJ215190 FJ215191

FJ215292 FJ215293

KUNHM-T3549 KUNHM-T4002

KUNHM number, vouchers from The University of Kansas Natural History Museum. ZMUC number, vouchers from Zoological Museum University of Copenhagen. UW and NMFS number, vouchers from University of Washington. CAS number, voucher from California Academy of Sciences. CA, USA. Tissue samples donated by: a M. Miya (Chiba University). b P. McMillan (National Institute of Water and Atmospheric Research). c T. Sutton (Virginia Institute of Marine Science). d B. Collette and W. Bemis (NMNH and Shoals Marine Laboratory). e A. Oddgeir (Institute of Marine Research, Norway). f E. Hiromitsu (Kochi University). g G. Ortí (University of Nebraska, Lincoln). * Sequences taken from GenBank.

Table 3 List of primers used for PCR amplification (A) and sequencing (S). Primers for first-round PCR: Forward (F) and Reverse (R). Primers for second round-nested PCR: internal forward (IF), internal reverse (IR), and primers for sequencing: sequencing forward (SF), and sequencing reverse (SR). Name

Sequence 50 –30

Amp/Seq

Reference

12S 229 F 12S 954 R 16S 326 F 16S 995 IR 16S 1556 R RAG1 107 F RAG1 1455 R RAG1 115 IF RAG1 1234 IR RAG1 171 SF RAG1 1129 SR

50 GYCGGTAAAAYTCGTGCCAG30 50 YCCAAGYGCACCTTCCGGTA30 50 AYCCGTCTCTGTGGCAAWAGAGTGG30 50 AGGGTCTTCTCGTCTTAT30 50 CTCCGGTCTGAACTCAGATCACG30 50 CTGCCACGTGGGCATCATC30 50 TCGTTCCCCTCGCTGGCCCACGCG30 50 TGGGCATCATCRAYGGGCTCT30 50 GTAGATCTCCATGAGCTGC30 50 GACACCATCACCCGSCGCTTCCGC30 50 TTGCCGTTCATCCTCATCACCGG30

A/S A/S A/S A/S A/S A A A A S S

Li and Ortí (2007) Li and Ortí (2007) This study This study This study This study This study This study This study This study This study

In this study, we present the first comprehensive molecular phylogenetic study of the order that includes representative taxa from all gadiform families and subfamiies proposed to date (except Lyconidae), using both mtDNA and nuclear DNA sequences. As a first step toward resolution of gadiform phylogeny our study attempts to establish: (1) the status of the suborders of the Gadiformes (how many and membership); (2) the identity and phylogenetic relationships at the family level; and (3) the phylogenetic implications of morphological data available in the literature. We provide explicit tests of previous hypotheses based on the new molecular data.

2. Materials and methods 2.1. Taxon sampling and molecular data We included 117 species, representing approximately 20% of the species currently described for the order, sampled from 46 genera (more than 60% of the total number of recognized genera), and all families and subfamilies sensu Endo (2002), plus 7 species for the outgroup (Table 2). Since morphological studies remain ambiguous about the closest relatives of Gadiformes, we use representative taxa from the orders suggested by Miya et al. (2001, 2003, 2005) as ‘‘Paracanthoptherygii” outgroups (Zeioidei, Percopsiformes, and Polymixiiformes). One nuclear and two mitochondrial genes were used in this study. The mtDNA fragments chosen code for the ribosomal 12S and 16S subunits. These subunits are reasonably conserved within fishes and are typically used for higher-level (subfamily, family, superfamily, suborder, and order) analyses (Hillis and Dixon, 1991). The nuclear gene used in this study codes for the recombi-

nation-activating protein 1 (RAG1) gene, a relatively well-established marker for molecular systematics of fishes (e.g. Li and Ortí, 2007; Lopez et al., 2004; Clements et al., 2003; Lovejoy and Collette, 2001). 2.2. Laboratory procedures Genomic DNA was extracted from muscle, gill tissue, or blood samples. Tissues were preserved in 95% ethanol and stored at 20 °C. For each specimen, DNA was extracted from approximately 25 mg of tissue using the DNeasy tissue extraction kit (Qiagen). Polymerase chain reaction (PCR; Saiki, 1990) was used to amplify approximately 1188 bp and 689 bp of 16S and 12S mitochondrial DNA, respectively, and 858 bp of RAG1. Each reaction consisted of 2.5 ll of dNTP (1 mM each), 2.5 ll 10 buffer, 1.0 ll MgCl2 (50 mM), 1.0 ll of each primer (10 lM), 0.2 ll of Taq (5 U/ll), and dH2O to a final volume of 25 ll. Two primers were used for 12S and three primers for 16S (Table 3). The additional internal primer for 16S was designed based on Gadiformes sequences previously published in GenBank (Table 2) of Bathygadus artrodes (AP008988), Bregmaceros nectabanus (NC008124), Coelorinchus kishinouyei (NC003169), Melanogrammus aeglefinus (DQ020497), Physiculus japonicus (NC004377), and Squalogadus modificatus (AP008989). Amplification of the double-stranded 12S and 16S products consisted of the following thermal cycling profile: an initial denaturing at 94 °C for 3 min, followed by 31 cycles of the following: 94 °C denaturing for 1 min, 57 °C annealing for 1 min, and 72 °C extension for 1 min, and a final 72 °C extension step for 5 min. New PCR and sequencing primers were designed for RAG1 based on alignments of Gadiformes sequences available in GenBank (Merluccius albidus [AY30878] and Gadus morhua [AF369064]) and

694

A. Roa-Varón, G. Ortí / Molecular Phylogenetics and Evolution 52 (2009) 688–704

unpublished sequences from the Ortí lab (see Trachyrincus murrayi, Urophycis chesteri, Merlangius merlangus, Macrourus sp. Table 2). A nested-PCR approach was used to amplify a fragment of exon 3 of the RAG1 gene. Products of the first-round PCR were diluted 20 times and used as the template for a second PCR, with a set of primers inferred to nest within the fragment amplified in the first PCR. Conditions for amplification of the RAG1 fragment for both rounds of PCR used the following thermocycle profile: an initial denaturing step at 94 °C for 1 min followed by 31 cycles of 94 °C denaturing for 1 min, 62 °C annealing for 45 s, and 72 °C extension for 1 min, and final 72 °C extension step for 5 min. Primers for PCR, nested-PCR, and sequencing are listed in Table 3. Amplified products were purified using the EXO I/ SAP reaction and sequenced using ABI Prism BigDye Terminator Cycle Sequencing v3.0 Ready Reaction Kits (Applied Biosystems). Sequences were visually inspected for misreads and edited using Sequencher (Gene Codes). A consensus light-strand sequence was compiled from all sequenced DNA fragments for each gene and individual taxon and deposited in GenBank (Table 2). 2.3. Sequence alignment and phylogenetic analysis Mitochondrial gene sequences were aligned separately with Clustal X (Thompson et al., 1997). Default parameters were used as no substantial improvement was obtained after applying gap penality weights to simulate the relative frequency of the occurrence of indels relative to substitution events. Low gap costs favor alignments with larger numbers of indels and high gap costs generate alignments with fewer indels (Page and Holmes, 1998; Phillips et al., 2000). Regions where the amount of length variation was very high were discarded avoiding a resulting alignment that would likely contain invalid assertions of homology (Swofford et al., 1996). Protein-coding regions of RAG1 DNA sequences were aligned based on amino acid sequences applying the universal genetic code in ClustalW (under default conditions) integrated with MEGA 3.1 (Kumar et al., 2004). Given that both mtDNA fragments have similar functions (coding for ribosomal RNA) and also are closely linked in the mitochondrial genome, they were considered a single partition for phylogenetic analyses. But nuclear and mtDNA initially were treated as separate data partitions for phylogenetic analyses. RAG1 was partitioned further into 1st, 2nd, and 3rd codon positions. Alignment gaps were treated as missing data in all analyses. Subsequently, we combined all data for a ‘‘total evidence” analysis (Brower et al., 1996; Cognato and Vogler, 2001). Saturation of substitutions for each data partition (mtDNA and RAG1) was evaluated by plotting pairwise uncorrected p-distance against maximum-likelihood-corrected sequence divergence. A linear relationship is expected if there is no saturation (Gojobori, 1983). Deviation from a linear relationship between the number of nucleotide substitutions and the measure of sequence divergence is considered as evidence of mutational saturation and a potential cause for homoplasy and poor phylogenetic resolution. All

distance estimates were generated with PAUP* v. 4.0b10 (Swofford, 2003). Potential systematic errors in phylogenetic inference that may result from heterogeneous base composition among taxa were tested estimating the base composition (% G+C) at variable sites for each gene. Stationarity of base composition was tested further with a Chi-square test implemented in PAUP* v4.0b10 (Swofford, 2003). Maximum parsimony (MP) analyses were conducted on mtDNA, nuclear, and combined sequence data with PAUP* v. 4.0b10 (Swofford, 2003). The parsimony ratchet (Nixon, 1999) method was employed in the initial analysis to find the shortest tree using a batch file for PAUP*, generated by the PAUPRat program (Sikes and Lewis, 2001). The parsimony ratchet has been suggested as a good search strategy for large datasets involving a trade-off between visiting many tree islands and searching each island thoroughly (Sikes and Lewis, 2001). Twenty parsimony ratchet searches on mtDNA, nuclear, and combined data sets were performed with 200 replicates each. The searches employed the heuristic search option, with 100 random step-wise addition sequence replicates generated under the tree-bisection–reconnection (TBR) method. Support for the internal branches was assessed resampling 100 bootstrap pseudoreplications. Additional MP analyses were performed to determine whether the topology of trees reconstructed by mtDNA and nuclear data alone differed significantly from the topology resulting from a combined DNA evidence MP analysis. These searches also employed a heuristic search option with 100 random step-wise addition sequence replicates generated under the TBR method in PAUPRat. Wilcoxon ranked-sums tests (Templeton, 1983), were used to compare topologies resulting from MP analyses in this study with alternative a priori hypothesis of ordinal relationships taken from the literature (e.g. Fig. 1). Constrained-topology analyses were performed for each competing alternative hypothesis for Gadiformes proposed by the following authors: Markle (1989), Howes (1993), Nolf and Steurbaut (1989), and Endo (2002). Hypotheses at the family level were tested for Macrouridae (Okamura 1989 and Iwamoto, 1989) and Gadidae (Teletchea et al., 2006). Constraints were built using Treeview 1.6.6. (Page, 1996). Parsimony searches were implemented in PAUP* v. 4.0b10, in order to obtain the MP tree that satisfied each constraint best (Swofford, 2003). Maximum-likelihood analyses (ML) were implemented with a mixed model using Treefinder (Jobb, 2006; Jobb et al., 2004). The analyses were performed for mtDNA, RAG1, and combined data. RAG1 data were partitioned into, 1st, 2nd, and 3rd codon positions. Therefore, the combined analysis used four data partitions. Likelihood-ratio tests implemented in Modeltest v3.07 (Posada and Crandall, 1998) in combination with PAUP* v. 4.0b10 were used to determine the optimal model of nucleotide evolution for each data partition. Treefinder searches used default conditions under the general time reversible with invariant sites and among-site rate heterogeneity (GTR+I+U) for mtDNA, nuclear and combined analyses (Table 4). Bootstrap support values with 100 replicates

Table 4 Best-fit models selected by maximum likelihood-ratio test or the AIC implemented in ModelTest v3.07 for DNA sequences. Data partition

ML model

Estimate base frequencies

Substitution rate matrix

Invariable sites

Gamma-shape parameter

mtDNA

GTR+I+U

A = 0.3872 C = 0.2275 G = 0.1476 T = 0.2407

rA-C = 1.6365 rA-G = 6.2638 rA-T = 2.2826

rC-G = 0.3291 rC-T = 12.4104 rG-T = 1.0000

0.2605

0.6912

RAG1 (DNA)

GTR+I+U

A = 0.2098 C = 0.3049 G = 0.3199 T = 0.1659

rA-C = 1.3091 rA-G = 3.9751 rA-T = 0.9923

rC-G = 0.8744 rC-T = 4.8789 rG-T = 1.0000

0.3702

1.2176

A. Roa-Varón, G. Ortí / Molecular Phylogenetics and Evolution 52 (2009) 688–704

695

Fig. 2. Maximum likelihood phylogram for 124 taxa based on 2740 bp of concatenated data (mtDNA and RAG1). Numbers by the nodes indicate ML bootstrap support/ Bayesian posterior probabilities/MP bootstrap support (only bootstrap values >50% are shown). More detail for this phylogeny is shown in Figs. 3–5 as indicated by the vertical bar to the right.

696

A. Roa-Varón, G. Ortí / Molecular Phylogenetics and Evolution 52 (2009) 688–704

Fig. 3. Suborder Macrouroidei. Maximum likelihood phylogram from combined analysis (mtDNA and RAG1). For details, see text and Fig. 2.

for ML analysis were obtained using Treefinder (Jobb, 2006; Jobb et al., 2004). Alternative hypotheses were tested using one-tailed Shimodaira and Hasegawa (SH) test, RELL with 1000 bootstrap replicates (Shimodaira and Hasegawa, 1999). Alternative topologies were generated using maximum likelihood by a similar process described in Wilcoxon signed-ranks test. Bayesian analyses were conducted with MrBayes version 3.1.2 (Ronquist and Huelsenberck, 2003) for mtDNA, RAG1, and combined data. DNA sequence data were partitioned in the same way as for TreeFinder ML analyses (4 partitions: mtDNA, 1st, 2nd, and 3rd codon positions of RAG 1gene). The GTR+I+U model selected by Modeltest v3.07 (Posada and Crandall, 1998) was used as the optimal model of nucleotide substitution for each data partition (Table 4). Four chains were run simultaneously in each analysis and two independent runs were used to assess the convergence of posterior probability distributions. These analyses were run until the standard deviation of split frequencies reached values below 0.01. Trees sampled before reaching stationarity of MCMC sampling were discarded for computing the consensus tree and posterior probabilities. The frequency that a particular clade occurs within the collection of trees after the burn-in was interpreted as a measure of node support (posterior probability, or PP values).

3. Results 3.1. Sequence variation and data partitions Alignment of the 12S and 16S mitochondrial ribosomal DNA fragments resulted in 691 and 1188 sites, respectively. The combined mtDNA data totaled 1879 characters, of which 669 are constant and 1210 variable. Among the variable characters, 135 were parsimony uninformative and 1075 parsimony informative. The null hypothesis of base composition stationarity of variable sites in the combined data set was rejected (Chi-square = 453.212, df = 369, p = 0.0017). The GC content at variable sites ranged from 40.38% for Bathygadus melanobranchus to 49.18% for Trachonurus sp. Analysis of mutational substitution saturation on mitochondrial genes reveals some saturation suggested by deviation from linearity in the distance plots (results not shown). Alignment of RAG1 sequences resulted in 861 characters, with 67 variable positions that are parsimony uninformative and 405 that are parsimony informative. The hypothesis of base composition homogeneity at variable sites of the RAG1 gene was not rejected (Chi-square = 275.921, df = 321, p = 0.96). GC content at the third codon position in all gadiform taxa sequenced was higher than 70%, ranging between 72.9% and 94.4%. Low values for GC

A. Roa-Varón, G. Ortí / Molecular Phylogenetics and Evolution 52 (2009) 688–704

697

Fig. 4. Suborder Gadoidei: clade ((Trachyrincinae + Macrouroidinae) and clade ((Merlucciidae + Melanonidae) Euclichthyidae). Maximum likelihood phylogram from combined analysis (mtDNA and RAG1). For details, see text and Fig. 2.

Fig. 5. Suborder Gadoidei: family Gadidae and its four subfamilies. Maximum likelihood phylogram from combined analysis (mtDNA and RAG1). For details, see text and Fig. 2.

content in the outgroup species were obtained for zeioids (58.4– 66.2%), followed by Polymixiiformes with 66.2% and Percopsiformes with 76.3% and 80.5%. As GC content was uniformly high for all Gadiformes, potential systematic errors in phylogenetic inference that could result from heterogeneous base composition among taxa were considered negligible. Plots of p-distance against ML-corrected sequence divergence revealed an almost linear relationship for first and second codon position indicating little substitution saturation (results not shown). Plotting p-distance against ML-corrected sequence divergence for third codon position and all codon positions showed indication of some substitution saturation (results not shown). Models for maximum likelihood and Bayesian analyses with parameter estimates are shown in Table 4.

3.2. Phylogenetic relationships For simplicity of presentation, only the ML phylogram obtained from analysis of the concatenated data set (mtDNA+RAG1) is shown (Figs. 2–5). Given that this result is based on the largest amount of evidence, we use it as a base to present and discuss our preferred hypothesis of relationships and to construct a simplified classification scheme (Fig. 6). Results obtained by analyzing data partitions independently (mtDNA or RAG1) and using different methods of inference are discussed briefly in the following sections and are interpreted more easily by reference to Fig. 2. These were conducted to explore the sensitivity of our hypothesis to different approaches and, therefore, to identify areas of conflict and congruence that may raise caveats to the conclusions of our study.

698

A. Roa-Varón, G. Ortí / Molecular Phylogenetics and Evolution 52 (2009) 688–704

Fig. 6. Simplified phylogeny and classification scheme based on Fig. 2 and other considerations discussed in the text.

Table 5 Templeton’s test (Templeton, 1983) and Shimodaira–Hasegawa test (Shimodaira and Hasegawa, 1999) of alternative hypotheses of phylogenetic relationships among Gadiformes families based on the combined (mtDNA and RAG1 data). Constraint source

Lengthd

Differencee

Wilcoxonsigned-ranksf

Shimodaira–Hasegawagg

None (ML tree) Endo (2002)a Howes (1993)a Nolf and Steurbaut (1989)a Teletchea et al. (2006)c Okamura (1989)b Markle (1989)a Iwamoto (1989)b

10554 10727 10820 10928 12854 13095 13218 13218

0 173 266 374 2300 2541 2664 2664

Best 0.0001* 0.0001* 0.0001* 0.0001* 0.0001* 0.0001* 0.0001*

best 0.000* 0.000* 0.000* 0.471 0.000* 0.000* 0.479

a

Phylogeny of the order Gadiformes based on morphological characters. Phylogeny of the suborder Macrouroidei based on morphological characters. Phylogeny of Gadidae based on mitochondrial and molecular characters. d Tree lengths of MP trees that enforce topological constraints for Gadiforms interrelationships based on hypothesis from morphological or molecular data sets. e Tree length differences between constrained and unconstrained MP trees. f Parsimony-based Wilcoxon ranked-sums test using one tailed probability (Templeton, 1983). g Likelihood-based Shimodaira–Hasegawa test using one tailed probability (Shimodaira and Hasegawa, 1999). Statistically significant differences (p < 0.05). b

c

*

3.2.1. Mitochondrial ribosomal DNA sequences Twenty independent Parsimony Ratchet searches using the 1075 parsimony-informative characters obtained from 124 taxa yielded a total of 2739 trees. Among these, two shortest trees (L = 8323 steps) were found, with global consistency index (CI) = 0.272, and rescaled consistency index (RC) = 0.204. The strict consensus of these trees is in general agreement with the MP bootstrap majority-rule consensus tree. The MP topology is almost completely resolved, with the only topological ambiguity occurring within the Coelorinchus–Macrourus clade. Many clades within families are well supported, but support for relationships among Gadiformes families is weak. Following Endo’s (2002) taxonomic system, MP recovered two main clades. The first clade included ((Macrourinae + Bregmacerotidae) + Bathygadinae). The second clade included the other families within Gadiformes and a monophyletic group comprising the other two subfamilies traditionally included in Macrouridae (Trachyrincinae and Macrouroidinae). The families Gadidae and Macrouridae were recovered as a paraphyletic groups (results not shown). ML and Bayesian analyses were conducted with the GTR+I+U model of nucleotide substitution for each data partition. The

Bayesian analyses showed moderate levels of resolution, with strong support for nodes within families but low support for most relationships among families. Gadidae and Macrouridae were recovered as paraphyletic groups. ML analysis produced a tree similar to that found in the MP analysis, but recovering Moridae as a paraphyletic group, and Steindachneridae as sister group of all other Gadiformes. 3.2.2. Nuclear DNA sequences Parsimony analysis of RAG1 included 861 characters for 108 taxa of which 405 were parsimony-informative sites. Unweighted MP analysis of RAG1 sequences produced 2 MP trees of 2155 steps with CI = 0.367, and RC = 0.283. The MP topology was relatively well resolved. Two main clades were recovered. The first one including only Macrourinae and the second clade was partially resolved with a polytomy including the other taxa within the order. The subfamily Bathygadinae was recovered as a monophyletic group as well as Trachyrincinae + Macrouroidinae. Gadidae and Macrouridae were recovered as paraphyletic groups (results not shown). The family Macrouridae is recovered once again as a paraphyletic group, while Gadidae is recovered as a monophyletic group.

A. Roa-Varón, G. Ortí / Molecular Phylogenetics and Evolution 52 (2009) 688–704

ML and Bayesian analyses were conducted using the GTR+I+U model of nucleotide substitution. Topologies recovered from these analyses were highly congruent, differing only in the position of Ranicipitidae. Maximum parsimony, ML, and Bayesian topologies show all clades within families well supported. However, support for relationships among Gadiformes families was generally low. 3.2.3. Combined analysis Combined analyses were performed on concatenated mtDNA (12S and 16S) and nuclear gene (RAG1) sequences for 124 taxa. Heuristic MP searches yielded two most parsimonious trees with a total length of 10554 steps with CI = 0.289 and RC = 0.217. Maximum Parsimony, ML, and Bayesian topologies show all family-level clades well supported. However, support for relationships among Gadiformes families is, as before, generally low and the family Macrouridae always appeared paraphyletic. The placement of the families Bregmacerotidae, Steindachneriidae, Macruronidae, and Melanonidae was largely incongruent among analyses. The ML tree and support values for all criteria are shown in Fig. 2 and expanded views of this topology in Figs. 3–5. 3.3. Tests of prior hypotheses The results of Wilcoxon ranked-sums and Shimodaira–Hasegawa tests are shown in Table 5. The topology recovered by MP analysis of the combined data set (mtDNA and nuclear genes) is a statistically better descriptor of our data than topologies recovered under any constraint based on a priori hypotheses. The SH test failed to reject the phylogeny of Macrouroidei proposed by Iwamoto (1989) based on morphological characters and the phylogeny of Gadidae based on mitochondrial and molecular characters proposed by Teletchea et al. (2006). 4. Discussion This study is the first attempt to construct a molecular phylogeny with nuclear and mtDNA that includes an extensive taxonomic sampling of species from all families and subfamilies in the order Gadiformes (following the classification of Endo, 2002, but not including Lyconidae, a monotypic family supported by von der Heyden and Matthee, 2008). Although our results could not resolve every major question about phylogenetic relationships among gadiform fishes, it provides significant insight into many issues and direction for subsequent studies. In the following sections, we discuss the major implications of our results for gadiform systematics and summarize our working hypotheses and a phylogenetic classification in Fig. 6. 4.1. Monophyly of Gadiformes and gadiform suborders Gadiformes has been unquestionably accepted as a valid order within Paracanthopterygii, even though unambiguous diagnostic features for both adult (Marshall and Cohen, 1973; Lauder and Liem, 1983; Cohen, 1984; Patterson and Rosen, 1989; Markle, 1989; Howes, 1993; Endo, 2002) and early life history stages (Fahay and Markle, 1984) of gadiforms have been elusive. Well-defined synapomorphies supporting Gadiformes monophyly have been proposed by several authors (summarized by Endo, 2002), but many of these are secondarily lost in some gadiforms or they are also present in other paracanthoptergians. In fact, Fahay and Markle (1984) concluded: ‘‘There does not seem to be any unique diagnostic character for early stages of gadiforms”. The results obtained in this study (combined analysis, mtDNA and nuclear genes separately) and an exploratory molecular study to test the monophyly of Gadiformes with other taxa historically placed in Para-

699

canthopterygii (Roa-Varon and Ortí, unpublished results) show strong support for the monophyly of the Gadiformes. Among the molecular characters surveyed, a signature feature for Gadiformes can be found in RAG1 sequences as an insertion of 1–20 amino acids around position 658 of the complete RAG1 protein (in reference to the zebrafish gene, GenBank Accession U71093). This region of the RAG1 protein exhibits unique length variation patterns among gadiforms in comparison with most other teleosts examined to date among more than 500 RAG1 sequences compared (GenBank data and Ortí et al. unpublished results); as far as we know, only Clupeiformes exhibit length variation at this position in the RAG1 protein. Results from the combined data set (Fig. 2) suggest, albeit with low support values (BS < 50%, PP < 0.90), that Gadiformes can be split into three major lineages that generally correspond to the suborders Muraenolepidoidei, Macrouroidei, and Gadoidei. These results differ from the most current hypotheses proposed by Howes (1993) and Endo (2002), see Table 1. Svetovidov (1948) erected the suborder Muraenolepidoidei on the account of a peculiar structure exhibited by these fishes in the pectoral girdle and other unique characters for the group. Svetovidov’s hypothesis has been supported by several authors (Andriashev, 1965; Greenwood et al., 1966; Rosen and Patterson, 1969). In fact, Okamura (1970a,b) suggested that muraenolepids represent the most early-branching lineage among Gadiformes: ‘‘early offshoot of a Gadiform-like ancestor”. Similarly, Cohen (1984) stated that ‘‘muraenolepids are not obviously related to any other gadiforms and appears to represent an ancient lineage”. More recently, Balushkin and Prirodina (2005, 2006) while describing two new species of Muraenolepis also supported this view. In contrast, other authors have classified muraenolepids as a family within the suborder Gadoidei (Markle, 1989; Howes, 1990; Endo, 2002). While Howes (1990) did not provide any support for this placement, Markle (1989), based it on a single synapomorphy (secondary loss of the interarticular cartilage in the first epibranchial). Endo (2002) erroneously assigned the presence of X and Y bones in muranolepids, in contrast to other authors (see Patterson and Rosen, 1989; Balushkin and Prirodina, 2005, 2006). Although, the monophyly of Muraenolepis is strongly supported by all our analyses, its placement as sister group to all other Gadiformes is weakly supported, and therefore we are unable to draw a definitive conclusion. Further study should clarify if Muraenolepididae represents the most basal branch in the Gadiformes phylogeny. The suborder Macrouroidei has been traditionally defined to include the families Macrouridae and Steindachneriidae (Endo, 2002), but other authors also added Moridae Trachyrincidae, Macrouroididae, and Euclichthyidae (e.g. Okamura, 1970b; Cohen, 1984). Although there are many studies on the classification of the macrouroids (e.g. Glibert and Hubbs, 1916; Okamura, 1970a,b, 1989; Iwamoto, 1970, 1978, 1979, 1989; Marshall and Cohen, 1973; Cohen, 1984; Fahay and Markle, 1984; Endo, 2002), no consensus has been reached about which families belong in this suborder. Our results suggest that the suborder Macrouroidei contains three families: Macrouridae (with subfamilies Macrourinae and Bathygadinae only), Macruronidae, and Steindachneriidae. The third suborder recovered in our study, Gadoidei, also has been disputed by previous authors. For example, Gadoidei sensu Markle (1989) includes three super families: Macruronoidea (Macruronidae), Bregmacerotoidea (Bregmacerotidae, Muraenolepididae, and Phycidae), and Gadoidea (Gadidae, Lotidae, and Merlucciidae). Howes (1993) added Ranicipitidae, bathygadids, and steindachneriids. The same author in previous studies (1988, 1989, 1990, and 1991) included trachyrincids within Gadoidei and later returned them to Macruroidei without any explicit reason. The results obtained with our combined data set suggest that Gadoidei is composed by two principal clades: the first clade

700

A. Roa-Varón, G. Ortí / Molecular Phylogenetics and Evolution 52 (2009) 688–704

contains Moridae and the two groups traditionally considered subfamilies of Macrouridae (Trachyrincinae and Macrouroidinae), and the second clade includes Merlucciidae, Melanonidae, Euclichthyidae, Ranicipitidae, Bregmacerotidae, and Gadidae. 4.2. Monophyly of Gadiformes families 4.2.1. Suborder Muraenolepidoidei The family Muraenolepididae includes the genus Muraenolepis, with six nominal species that are poorly known (Andriashev, 1965; Balushkin and Prirodina, 2005). Descriptions for this family are limited to a small set of characters, hindering identification of the species (Chiu and Markle, 1990; Miller, 1993; Balushkin and Prirodina, 2005, 2006). Among the species analyzed in this study, no genetic differences were observed between Muraenolepis orangiensis, M. marmoratus, and M. microps, suggesting that this genus is in need of revision. This group has long been recognized as a distinct lineage by various authors (Okamura, 1970a,b; Cohen, 1984; Balushkin and Prirodina, 2005, 2006), and also is strongly supported by the molecular data (Fig. 2), but the position of Muraenolepididae as the sister group of all other gadiforms suggested by our analyses did not receive strong support. 4.2.2. Suborder Macrouroidei (Fig. 3) This clade contains three families: Macrouridae (with subfamilies Macrourinae and Bathygadinae only), Macruronidae, and Steindachneriidae. Macrouridae is the largest family in this suborder, with about 394 valid species in 27 genera (Iwamoto, 2008; Nelson, 2006). Currently, four subfamilies are recognized: Macrourinae, Bathygadinae, Trachyrincinae, and Macrouroidinae (e.g. Marshall, 1965; Cohen, 1984; Nolf and Steurbaut, 1989; Iwamoto, 1989; Cohen et al., 1990a; Endo, 2002). Our results recovered all four groups with high confidence but they do not support a monophyletic Macrouridae; only Macrourinae and Bathygadinae are sister taxa within Macrouridae (Fig. 2 and 3), whereas the other two nominal subfamilies (Trachyrincinae and Macrouroidinae) seem to be distantly related and are placed in the Gadoidei lineage (Figs. 2 and 4). This result was anticipated, at least in part, by Okamura (1970a,b, 1989), who proposed that the family Macrouridae include only Macrourinae and Bathygadinae based on morphological characters such as the number of epipleurals, circumorbital bones, and shape of the anal fin. In agreement with the classification by Endo (2002) and others (Table 1), our results support the inclusion of the monotypic family Steindachneriidae within the suborder Macruroidei. Recent hypotheses classify macruronids and steindachnerids as independent families belonging to Macrouroidei or Gadoidei. For example, Steindachneriidae has been inferred as a sister group of Macrouridae (Markle, 1989; Fahay, 1989; Endo, 2002), but Howes (1990, 1991) placed it within Gadoidei in an unresolved polytomy with Bathygadinae and Melanonidae. Macrouridae is deeply divided into two well-supported lineages that correspond to the subfamilies Macrourinae and Bathygadinae (Figs. 2 and 3); the unexpected depth of this divergence, however, suggests that Bathygadinae could be ranked at the family level (Fig. 6). To test this proposition, we compared genetic divergences among families and subfamilies throughout the Gadiformes. The uncorrected average p-distance between Macrourinae and Bathygadinae is p = 0.17, similar to average p-distances among different families in the order (e.g. Gadidae–Steindachneriidae p = 0.18, Moridae–Muraenolepididae p = 0.16, and Melanonidae–Muraenolepididae p = 0.17). Macrourinae has two main clades, labeled A and B in Fig. 3. The branching pattern within clade A supports the monophyly of all genera included in this study. Within clade B, however, analysis of the concatenated data results in Macrourus carinatus and M.

berglax nested within the Coelorinchus clade (Figs. 2 and 3), rendering the latter paraphyletic. Macrourus and the Pacific Coelorinchus are closely related, and this group is sister to a clade with Coelorinchus from the Atlantic Ocean. The placement of Macrourus within the Coelorinchus clade is not entirely surprising and was anticipated on the basis of some morphological characters (Iwamoto, pers. comm.). Another interesting result within clade B placed the giant grenadier Albatrosssia pectoralis close to Coryphaenoides acrolepis and C. cinereus in a derived position within 1912 the Coryphaenoides clade. All three species have a very similar North Pacific distribution, from northern Japan to the Okhotsk Sea, and the Bering Sea to the North American coast. This result corroborates earlier suggestions that Albatrossia should be synonymized with Coryphaenoides (Wilson and Attia, 2003; Morita, 1999; Wilson, 1994; Wilson et al., 1991). Macruronidae has been placed as an independent family composed of Macruronus and Lyconus (Markle, 1989; Howes, 1990, 1991a,b; Endo, 2002), as the sister group of the rest of the ‘‘higher gadoids”, or as a subfamily within Merlucciidae (e.g. Inada, 1989; Lloris et al., 2003). Based on molecular data, von der Heyden and Matthee (2008) proposed Steindachneriidae (S. argentea), Macruronidae (M. novaezelandiae and M. magellanicus), and Lyconidae (L. pinnatus and L. brachycolus) as independent families, but none of them related to Merlucciidae. Although we did not include Lyconus in this study, our results support this hypothesis for the other two groups; therefore, we suggest maintaining the family status for Steindachneriidae and Macrunonidae within Macrouroidei due to unique morphological characters that each taxon displays. Steindachneriidae, for example, has a unique separation of the anus and the urogenital pore, a modification of the first interhaemal spine, in addition to other characters that support its family status. A closer relation with Macruronus is also supported by sharing the character of anterior portion of the anal fin elevated into a lobe (Okamura, 1989). Unfortunately, due to the lack of samples for Lyconus spp., we were not able to test its phylogenetic relationship within the Gadiformes. 4.2.3. Suborder Gadoidei (Figs. 2, 4, and 5) Our results support the inclusion in this suborder of the families Moridae, Merlucciidae, Melanonidae, Euclichthyidae, Ranicipitidae, Bregmacerotidae and Gadidae, plus two groups usually considered subfamilies of Macrouridae (Trachyrincinae and Macrouroidinae). Trachyrincinae has a single genus (Trachyrincus) with six valid species. Smith and Radcliffe (1912) described Macrouroididae as a family based on the genus Macrouroides. Glibert and Hubbs (1916) classified it as a subfamily of Macrouridae, adding the genus Squalogadus. These two groups have been considered as separate families (e.g. Okamura, 1970a,b, 1989; Howes, 1988, 1989) or subfamilies (e.g. Cohen, 1984; Nolf and Steurbaut, 1989; Cohen et al., 1990b; Endo, 2002). Howes (1989) suggested that Trachyrincinae should be regarded as a family within the gadoid lineage (Table 1). The same author in 1991 could not determine the phylogenetic position of Trachyrincinae because of the modifications of the caudal skeleton and apparent loss of various elements. On the other hand, Satoh et al. (2006) based on whole mitogenome sequences from Squalogadus modificatus and Trachyrincus murrayi representing Macrouroidinae and Trachyrincinae, respectively, found an unusually identical gene order. The resultant trees showed these species as a monophyletic group having a sister group relationship to other macrourids. Our combined analysis showed Trachyrincinae and Macrouroidinae within Gadoidei as a monophyletic group with high support (Fig. 4). The molecular divergence of the clade Trachyrincinae + Macrouroidinae to other families was similar to the average value found in Gadiformes (p = 0.18). They are closely related to Moridae, although this placement received low statistical support (Fig. 4). Our data suggest that Trachyrincinae could

A. Roa-Varón, G. Ortí / Molecular Phylogenetics and Evolution 52 (2009) 688–704

be ranked at family level containing two subfamilies: Trachyrincinae and Macrouroidinae. Svetovidov (1937) proposed the family Moridae based on the unique swim bladder connection with the auditory capsules. Additional characters defining the group are four or five hypurals and X–Y bones in the caudal skeleton, distinct otolith features, and a joined first neural spine (Paulin, 1989). Moridae is a large family that comprises about 105 species in about 18 genera (Nelson, 2006). Our results overwhelmingly supported the monophyly of Moridae (except ML analysis of the mtDNA data alone) for the taxa included in our study. Based on examination of otoliths, morids have been split into three natural groups (Karrer 1971; Fitch and Baker 1972): (1) ‘‘Mora,” (2) Pseudophysis, and (3) ‘‘Physiculus,” plus a series of incertae sedis genera. Our results (Fig. 4) recovered ‘‘Mora” (with Antimora, Lepidion, and Halargyreus) and ‘‘Physiculus” (with Laemonema, Physiculus, and Gadella). Merluciidae (Gill, 1884) currently has a single genus (Merluccius) with 16 species. Since the description of M. merluccius by Linnaeus (1758), several taxonomic revisions of this group have been published (e.g. Norman, 1937a,b; Svetovidov, 1948; Ginsburg, 1954; Marshall, 1966; Marshall and Cohen, 1973; Inada, 1981, 1989; Lloris et al., 2003), but there is lack of consensus on both the composition of the family and its placement among gadiforms, in particular whether Merlucciidae is a separate family or a subfamily of Gadidae. Merlucciidae relationships within Gadoidei include its consideration as a derived sister lineage of Gadidae and Lotidae (Markle, 1989), or Gadidae alone (Howes, 1990, 1991, 1993), or higher gadoids except Macruronidae (Endo, 2002). Our study recovers Merlucciidae composed only of the genus Merluccius, placed squarely within Gadoidei with high support. A sistergroup relationship of Merlucciidae with Melanonidae was recovered from the ML and MP combined analyses, although weakly supported (Fig. 4). The relationships among the seven species of Merluccius included here are identical to those already obtained in previous molecular analyses (Roldan et al., 1999; Quinteiro et al., 2000; Grant and Leslie, 2001; von der Heyden and Matthee, 2008), confirming the Old World clade represented here by M. capensis and M. polli and the New World clade represented by M. bilinearis, M. australis, M. hubbsi, and M. productus (Fig. 4). Melanonidae contains one genus (Melanonus) with two species (Nelson, 2006). Melanonus was defined by Goode and Bean (1896) for first time as a genus of the subfamily Melanoninae within Gadidae. Subsequently, the genus has been included in Gadidae (Jordan, 1923), Moridae (Svetovidov, 1948), and Morinae within gadids (Norman, 1966). After Marshall and Cohen (1973), melanonids have maintained the family status. The phylogenetic position of melanonids has been controversial, changing from: (a) the sister group of all gadiforms except Ranicipitidae (Markle, 1989); (b) the sister group of steindachnerids (Howes, 1989), in a polytomy with Bathygadinae and Steindachneriidae within gadoids (Howes, 1990, 1991); and (c) as the sister group of all Gadiformes (Howes, 1993; Endo, 2002). Our study strongly supports the monophyly of Melanonidae as an independent unit within Gadoidei (Fig. 4). The monotypic family Euclichthyidae was first placed among the morids by Norman (1966). However, Svetovidov (1969) suggested the exclusion of the genus because it does not present the connection between the cranium and the swimbladder characteristic of morids. This author also noted an olfactory bulb position they have in common with Melanonus. Paulin (1983) inferred the possibility of Euclichthys occupying a phylogenetic position between morids and gadids. More recent studies suggested close relationship with morids (Markle, 1989; Howes, 1990, 1991, 1993) or a basal group among gadoids (Endo, 2002). Even though the RAG1 nuclear gene was impossible to sequence in species of this group, our mtDNA evidence presents strong support for considering Euclichthys as an independent family within Gadoidei.

701

The partial data from mtDNA (12S and 16S) used in the combined analysis and the Maximum Parsimony analyses recover the clade (Euclichthyidae + Melanonidae) with high support (BS = 100%). The ML analysis recovered a clade ((Melanonidae + Moridae) Euclichthyidae). The combined analysis suggested ((Merlucciidae + Melanonidae) Euclichthyidae) for MP and ML analyses (Fig. 4). The family Gadidae is probably one of the most studied groups among fishes due to its great importance to fisheries. The phylogeny and classification of constituent species, however, are still far from being established. Svetovidov (1948) considered 22 genera (including Merluccius) as belonging to the family and grouped them in three subfamilies: Lotinae, Merluccinae, and Gadinae. Only a few molecular studies based on mitochondrial DNA have been published for the group (Carr et al., 1999; Møller et al., 2002; Pogson and Mesa, 2004; Bakke and Johansen, 2002; Bakke and Johansen, 2005; Teletchea et al., 2006; Coulson et al., 2006). Teletchea et al. (2006) is the most comprehensive work for this family using two mitochondrial genes and 30 morphological characters, and including 19 of 22 genera traditionally placed in the group. According to their results, they proposed a new provisional classification of the gadoids, containing the families Merlucciidae (one genus) and Gadidae (21 genera) with four subfamilies: Gadinae (12 genera), Lotinae (3 genera), Gaidropsarinae (3 genera), and Phycinae (3 genera). Our data support a monophyletic clade for taxa in the family Gadidae, although with low to moderate support (Fig. 5). Within this clade, our analyses recover Phycinae, Gaidropsarinae, and Gadinae as strongly supported subfamilies. The putative subfamily Lotinae represented here by Lota lota and Molva molva, however, was not recovered as a monophyletic group. L. lota is more closely related to Gadinae than to M. molva (Fig. 5). Additional study is necessary to clarify the status of Lotinae, especially by including Brosme brosme in order to complete all the species in the subfamily before suggesting any change in the systematics of the group. Molecular distance among Gadinae–Gaidropsarinae and Gadinae–Phycinae are relatively low (average p-distance = 0.09 and 0.12, respectively). The Gadinae clade recovered in our study includes all the genera currently accepted for the subfamily, with the exception of Arctogadus and Gadiculus (not sampled). Previous molecular studies have shown some discordance about the relationship between Gadus and Theragra (clade A, Fig. 5). For example, Coulson et al. (2006) proposed that Theragra chalcogramma is more closely related to Gadus macrocephalus than to Gadus morhua and suggested that Theragra chalcogramma should thus be referred to the genus Gadus as originally described (Gadus chalcogrammus) by Pallas (1811). In addition, Coulson et al. (2006) established G. ogac as a subspecies of G. macrocephalus. On the other hand, Teletchea et al. (2006) suggested Theragra chalcogramma to be more closely related to G. macrocephalus, and G. ogac closely related to G. macrocephalus – all of them comprising a monophyletic clade. In all of our results, G. morhua and T. chalcogramma either group together or collapse in a polytomy including G. ogac and G. macrocephalus, in agreement with Coulson et al. (2006) hypothesis. Therefore, T. chalcogramma should be referred to the genus Gadus as originally described (Gadus chalcogrammus). Additionally, branch-lengths separating these otherwise distinct taxa are very short, suggesting a period of rapid differentiation associated with adaptive diversification (e.g. Jackman et al., 1999; Kontula et al., 2003; Poe and Chubb, 2004). Another interesting finding was related to the clade ((Microgadus proximus + Eleginus gracilis) Microgadus tomcod) recovered unanimously in all analyses (clade B, Fig. 5). Carr et al. (1999) found the same relationships among these genera, suggesting that Eleginus should be synonymized with Microgadus. The monotypic family Ranicipitidae, represented by Raniceps raninus, was established by Gill (1890). Since then, it has been

702

A. Roa-Varón, G. Ortí / Molecular Phylogenetics and Evolution 52 (2009) 688–704

regarded alternatively as a subfamily within the gadids (Berg, 1940), as a member of lotines (e.g. Svetovidov, 1948; Nolf and Steurbaut, 1989), or as a member of phycines (Dunn and Matarese, 1984; Fahay and Markle, 1984). Endo (2002) found that Ranicipitidae is the sister group of the ‘‘higher gadoids” excluding macruronids and merlucciids. Our results confirm the family ranking for Ranicipitidae within Gadoidei. Combined analysis show a monophyletic clade comprising (Ranicipitidae + Bregmacerotidae) as the sister group of Gadidae (Fig. 2). However, once again the interrelationships among clades were weakly supported. Finally, Bregmacerotidae is a monotypic family with about 16 nominal species (Torii et al., 2003a,b,c) but systematics of the genus Bregmaceros is poorly understood. Some of the species have been characterized based on larval, meristic, and osteological characters (D’Ancona and Cavinato, 1965; Houde, 1984; Nolf and Steurbaut, 1989; Swidnicki, 1991; Torii et al., 2003a,b,c, 2004). However, the phylogenetic position of the family remains unclear. It has been included among the gadoids (Svetovidov, 1948; Markle, 1989; Howes, 1990, 1991, 1993) or regarded as the suborder Bregmacerotoidei by Cohen (1984). Howes (1990, 1991, 1993) argued that the family is the sister group of higher gadoids excluding Macruronidae, while Markle (1989) and Endo (2002) suggest a sister relationship with Muraenolepididae. Our results are ambiguous and relationships of Bregmacerotidae remain poorly resolved (Fig. 2). Mitochondrial DNA data showed in all the analyses a close relationship of Bregmacerotidae with Macrourinae. On the other hand, the combined data set shows the family in a monophyletic clade with Ranicipitidae and this clade as sister group of Gadidae (Fig. 2). This discrepancy between mtDNA and nuclear DNA and the long branches separating Bregmaceros from the other taxa in all analyses suggest a rapid evolutionary rate of changes that could saturate the phylogenetic signal of mitochondrial genes, misleading interpretation of phylogenetic information. Additionally, other sources of error could be associated with missing sequences of RAG1, for some of the representatives of the family could not be sequenced even after numerous trials. Further morphological and phylogenetic appraisals may assist in clarifying these phylogenetic relationships. 5. Conclusions Fig. 6 represents our attempt to summarize the findings of this study in the context of previous knowledge about gadiform systematics. Keeping in mind the priority rule and the understandable resistance by the scientific community towards attempts to rename or reclassify taxa, but at the same time trying to be consistent with our results we propose this provisional classification of the Gadiformes. Acknowledgments We especially thank T. Iwamoto from the California Academy of Sciences for his generous help, inspiration, and support for this study. The following researchers and institutions provided tissue samples or fresh whole specimens: P. McMillan (National Institute of Water and Atmospheric Research), E. Hiromitsu (Kochi University), M. Miya (Chiba University), E.O. Wiley and A. Bentley (University of Kansas Natural History Museum), A. Oddgeir (Institute of Marine Research, Norway), T. Sutton (Virginia Institute of Marine Science), P. Møller and T. Menne (Zoological Museum University of Copenhagen), T. Pietsch (University of Washington), J.K. Galbraith and P. Chase (National Oceanographic Atmospheric Administration – NOAA), B. Collette (National Museum of Natural History), W. Bemis (Shoals Marine Laboratory). We thank two anonymous reviewers for their helpful suggestions to the manu-

script. This work was funded by SBS Special Funds and IEEA Funds from University of Nebraska-Lincoln to A.R-V and in part by Grants DEB-9985045 and DEB-0732838 from the U.S. National Science Foundation (NSF) to G.O. Comments on earlier versions of this manuscript were offered by T. Iwamoto, N. Aguilar-Amuchastegui, and members of the Ortí Lab. References Andriashev, A.P., 1965. A general review of the Antarctic fish fauna. In: van Mieghem, J., van Oye, P. (Ed.), Biogr. Ecol. Antarct., vol. 15, pp. 491–550. Bakke, I., Johansen, S., 2002. Characterization of mitochondrial ribosomal RNA genes in Gadiformes: sequence variations, secondary structural features, and phylogenetic implications. Mol. Phylogenet. Evol. 25, 87–100. Bakke, I., Johansen, S.D., 2005. Molecular phylogenetics of Gadidae and related Gadiformes based on mitochondrial DNA sequences. Mar. Biotech. 7, 61–69. Balushkin, A.V., Prirodina, V.P., 2005. A new species of eel cods Muraenolepis andriashevi sp. nova (Muraenolepididae) from the southern coasts of Africa with remarks on the taxonomic rank of the family in the system of the order Gadiformes. J. Ichthyol. 45, 489–495. Balushkin, A.V., Prirodina, V.P., 2006. A new species of eel cods Muraenolepis truvoni sp. nova (Muraenolepididae) from the Lazarev Sea with redescription of lectotypes Muraenolepis marmorata Günther, 1880, M. microps (Lönnberg, 1905. J. Ichthyol. 46, 687–693. Berg, L.S., 1940. Classification of fishes, both recent and fossil. Trudy. Zool. Inst. Leningrad 5, 87–517. Brower, A.V.Z., DeSalle, R., Vogler, A., 1996. Gene trees, species trees, and systematics: a cladistic perspective. Ann. Rev. Ecol. Syst. 27, 423–450. Carr, S.M., Kivlichan, D.S., Pepin, P., Crutcher, D.C., 1999. Molecular systematics of gadid fishes: implications for the biogeographic origins of Pacific species. Can. J. Zool. 77, 19–26. Chiu, T.S., Markle, D.F., 1990. Melanonidae. In: Gon, O., Heemstra, P.C. (Eds.), Fishes of the Southern Ocean. J.L.B. Smith Institute of Ichthyology, Grahamstown, pp. 188–189. Clements, K.D., Gray, R.D., Choat, J.H., 2003. Rapid evolutionary divergences in reef fishes of the family Acanthuridae (Perciformes: Teleostei). Mol. Phylogenet. Evol. 26, 190–201. Cognato, A.I., Vogler, A.P., 2001. Exploring data interaction and nucleotide alignment in a multiple gene analysis of Ips (Coleoptera: Scolytinae). Syst. Biol. 50, 758–780. Cohen, D.M., 1984. Gadiformes: overview. In: Moser, H.G., Richards, W.J., Cohen, D.M., Fahay, M.P., Kendall, A.W., Jr., Richardson, S.L. (Eds.), Ontogeny and Systematics of Fishes (Based on an International Symposium Dedicated to the Memory of Elbert Halvor Ahlstrom). American Society of Ichthyologists and Herpetologists, Lawrence, Kansas, USA, pp. 259–265. Cohen, D.M., Inada, T., Iwamoto, T., Scialabba, N., 1990a. FAO Species Catalogue, vol. 10. Gadiform Fishes of the World (Order Gadiformes), p. 242. Cohen, D.M., Inada, T., Iwamoto, T., Scialabba, N., 1990b. Gadiform fishes of the world (Order Gadiformes). FAO Fisheries Synopsis 125, vol. 10, 442pp. Coulson, M.W., Marshall, H.D., Pepin, P., Carr, S.M., 2006. Mitochondrial genomics of gadine fishes: implications for taxonomy and biogeographic origins from whole-genome data sets. Genome 49, 1115–1130. D’Ancona, U., Cavinato, G., 1965. The fishes of the family Bregmacerotidae. Dana Rep. 64, 1–92. Dunn, J.R., Matarese, A.C., 1984. Gadidae: development and relationships. In: Moser, H.G., Richards, W.J., Cohen, D.M., Fahay, M.P., Kendall, A.W., Jr., Richardson, S.L. (Eds.), Ontogeny and Systematics of Fishes. A.S.I.H, Lawrence, Kansas, USA, pp. 283–299. Endo, H., 2002. Phylogeny of the order Gadiformes (Teleostei, Paracanthopterygii). Mem. Grad. Sch. Fish. Sci. Hokkaido Univ. 49, 75–149. Fahay, M.P. 1989. The ontogeny of Steindachneria argentea Goode and Bean with comments on its relationships. In: Cohen, D.M. (Ed.), Papers on the Systematics of Gadiform Fishes. Natural History Museum of Los Angeles County, Science Series 32, pp. 143–158. Fahay, M.P., Markle, D.F., 1984. Gadiformes: development and relationships. In: Moser, H.G., Richards, W.J., Cohen, D.M., Fahay, M.P., Kendall, A.W., Jr., Richardson, S.L. (Eds.), Ontogeny and Systematics of Fishes. A.S.I.H, Lawrence, Kansas, USA, pp. 265–283. FAO, 2004. The Sate of World Fisheries and Aquaculture-Sofia 2004. FAO, Rome. Fitch, J.E., Baker, L.W., 1972. The fishes of the family Moridae in the eastern North Pacific with notes on morid otoliths, caudal skeletons, and the fossil record. Fish. Bull. 70, 565–584. Gill, T., 1884. On the Anacanthini fishes. Proc. Acad. Nat. Sci. Phila. 36, 167–183. Gill, T.N., 1890. On the family Ranicipitidae. Proc. US Nat. Mus. 13, 235–238. Ginsburg, I., 1954. Whitings on the coasts of the American continent. Fish. Bull. US Fish. Wild Life Serv. 56, 87–208. Glibert, C.H., Hubbs, C.L., 1916. Report on the Japanese macrouroid fishes collected by the United States fisheries steamer ‘‘Albatross” in 1906, with a synopsis of the genera. Proc. US Natl. Mus. 51, 135–214. Gojobori, T., 1983. Codon substitution in evolution and the ‘‘saturation” of synonymous changes. Genetics 105, 1011–1027. Goode, G.B., Bean, T.H., 1896. Oceanic Ichthyology. U.S. National Museum Special Bulletin No. 2.

A. Roa-Varón, G. Ortí / Molecular Phylogenetics and Evolution 52 (2009) 688–704 Grant, W.S., Leslie, R.W., 2001. Inter-ocean dispersal is an important mechanism in the zoogeography of hakes (Pisces: Merluccius spp.). J. Biogeogr. 28, 699–721. Greenwood, P.H., Rosen, D.E., Weitzman, S.H., Myers, G.S., 1966. Phyletic studies of teleostean fishes, with a provisional classification of living forms. Bull. Am. Mus. Nat. Hist. 131, 341–455. Hillis, D.M., Dixon, M.T., 1991. Ribosomal DNA – molecular evolution and phylogenetic inference. Q. Rev. Biol. 66, 410–453. Houde, E.D., 1984. Bregmacerotidae: development and relationships. In: Moser, H.G., Richards, W.J., Cohen, D.M., Fahay, M.P., Kendall, A.W., Jr., Richardson, S.L. (Eds.), Ontogeny and Systematics of Fishes. A.S.I.H, Lawrence, Kansas, pp. 300– 308. Howes, G.J., 1993. Anatomy of the Melanonidae (Teleostei: Gadiformes), with comments on its phylogenetic relationships. Bull. Nat. Hist. Mus. Zool. 59, 11– 31. Howes, G.J., 1991a. Anatomy, phylogeny and taxonomy of the gadoid fish genus Macruronus Günther, 1873, with a revised hypothesis of gadoid phylogeny. Bull. Br. Mus. Nat. Hist. 51, 77–110. Howes, G.J., 1991b. Biogeography of gadoid fishes. J. Biogeogr. 18, 595–622. Howes, G.J., 1990. The syncranial osteology of the southern eel-cod family Muraenolepididae, with comments on its phylogenetic relationships and on the biogeography of sub-Antarctic gadoid fishes. Zool. J. Linn. Soc. 100, 73–100. Howes, G.J. 1989. Phylogenetic relationships of macrourid and gadoid fishes based on cranial myology and arthrology. In: Cohen, D.M. (Ed.), Papers on the Systematics of Gadiform Fishes. Natural History Museum of Los Angeles County, Science Series No. 32, pp. 113–128. Howes, G.J., 1988. The cranial muscles and ligaments of macrouroid fishes (Teleostei: Gadiformes); functional, ecological and phylogenetic inferences. Bull. Br. Mus. Nat. Hist. Zool. 54, 1–62. Inada, T., 1989. Current status of the systematics of Merluciidae. In: Cohen, D.M. (Ed.), Papers on the Systematics of Gadiform Fishes. Natural History Museum of Los Angeles County, Science Series No. 32, pp. 197–207. Inada, T., 1981. Studies on the merluciid fishes. Bull. Far Seas Fish. Res. Lab. 18, 1– 172. Iwamoto, T., 2008. A brief taxonomic history of grenadiers. In: Orlov, A.M., Iwamoto, T. (Eds.), Grenadiers of the World Oceans: Biology, Stock Assessment, and Fisheries. American Fisheries Society. Symposium 63, p. 484. Iwamoto, T., 1989. Phylogeny of grenadiers (suborder Macrouroidei): Another interpretation. In: Cohen, D.M. (Ed.). Papers on the Systematics of Gadiform Fishes. Los Angeles County Natural History Museum Science Series No. 32, pp. 159–173. Iwamoto, T., 1979. Eastern Pacific macrourine grenadiers with seven branchiostegal rays (Pisces: Macrouridae). Proc. Calif. Acad. Sci. 42, 135–179. Iwamoto, T., 1978. Eastern Pacific macrourids of the genus Coelorinchus Giorna (Pisces: Gadiformes), with description of a new species from Chile. Proc. Calif. Acad. Sci. 4, 307–337. Iwamoto, T., 1970. Macrourid fishes of the Gulf of Guinea. The R/V Pillsbury DeepSea Biological expedition to the Gulf of Guinea, 1964–65. Stud. Tropical Oceanogr. 31, 6–431. Jackman, T.R., Larson, A., de Queiroz, K., Losos, J.B., 1999. Phylogenetic relationships and tempo of early diversification in Anolis lizards. Syst. Biol. 48, 254–285. Jobb, G., 2006. Treefinder, version of May 2006. Munich, Germany. Distributed by the author at http://www.treefinder.de. Jobb, G., von Haeseler, A., Strimmer, K., 2004. Treefinder: a powerful graphical analysis environment for molecular phylogenetics. BMC Evol. Biol. 4, 18. Jordan, D.S., 1923. A Classification of Fishes Including Families and Genera as Far as Known. Stanford. Stanford Univ. Publ., Univ. Ser., Biol. Sci. 3, pp. 77–243+i-x. Karrer, C., 1971. Die otolithen der Moridae (Teleostei, Gadiformes) und ihre systematicshe Bedeutung. Zool. Jb. Syst. 98, 153–204. Kontula, T., Kirilchik, S.V., Vainola, R., 2003. Endemic diversification of the monophyletic cottoid fish species flock in Lake Baikal explored with mtDNA sequencing. Mol. Phylogenet. Evol. 27, 143–155. Kumar, S., Tamura, K., Nei, M., 2004. MEGA3: integrated software for molecular evolutionary genetics analysis and sequence alignment. Brief. Bioinfor. 5, 150– 163. Lauder, G.V., Liem, K.F., 1983. The evolution and interrelationships of the actinopterygian fishes. Bull. Mus. Comp. Zool. 150, 95–197. Li, C., Ortí, G., 2007. Molecular phylogeny of Clupeiformes (Actinopterygii) inferred from nuclear and mitochondrial DNA sequences. Mol. Phylogenet. Evol. 44, 386–398. Lloris, D., Matallanas, J., Oliver, P., 2003. Merluzas Del Mundo (Familia Merlucidae). Catalogo Comentado e Ilustrado De Las Merluzas Conocidas. Lopez, J.A., Chen, W.J., Orti, G., 2004. Esociform phylogeny. Copeia 449, 464. Lovejoy, N.R., Collette, B.B., 2001. Phylogenetic relationships of New World needlefishes (Teleostei: Belonidae) and the biogeography of transitions between marine and freshwater habitats. Copeia 324, 338. Markle, D.F., 1989. Aspects of character homology and phylogeny of the Gadiformes. In: Cohen, D.M. (Ed.), Papers on the Systematics of Gadiform Fishes. Natural History Museum of Los Angeles County, Science Series No. 32, pp. 59–88. Marshall, N.B., 1966. The relationships of the anacanthine fishes Macruronus, Lyconus, and Steindachneria. Copeia 1966, 275–280. Marshall, N.B., 1965. Systematic and biological studies of the macrourid fishes (Anacanthini-Teleosteii). Deep Sea Res. 12, 299–322. Marshall, N.B., Cohen, D.M., 1973. Order Anacanthini (Gadiformes): characters and synopsis of families. Mem. Sears Found. Marine Res. 1, 479–495. Miller, R.G., 1993. History and atlas of the fishes of the Antarctic Ocean. Foresta Institute of Ocean and Mountain Studies, Carson City, Nevada, USA.

703

Miya, M., Kawaguchi, A., Nishida, M., 2001. Mitogenomic exploration of higher teleostean phylogenies: a case study for moderate-scale evolutionary genomics with 38 newly determined complete mitochondrial DNA sequences. Mol. Biol. Evol. 18, 1993–2009. Miya, M., Satoh, T.R., Nishida, M., 2005. The phylogenetic position of toadfishes (Order Batrachoidiformes) in the higher ray-finned fish as inferred from partitioned bayesian analysis of 102 whole mitochondrial genome sequences. Biol. J. Linn. Soc. 85, 289–306. Miya, M., Takeshima, H., Endo, H., Ishiguro, N.B., Inoue, J.G., Mukai, T., Satoh, T.P., Yamaguchi, M., Kawaguchi, A., Mabuchi, K., et al., 2003. Major patterns of higher teleostean phylogenies: A new perspective based on 100 complete mitochondrial DNA sequences. Mol. Phylogenet. Evol. 26, 121–138. Møller, P., Jordan, A.D., Gravlund, P., Steffensen, J.F., 2002. Phylogenetic position of the cryopelagic codfish genus Arctogadus Drjagin, 1932 based on partial mitochondrial cytochrome b sequences. Polar Biol. 25, 342–349. Morita, T., 1999. Molecular phylogenetic relationships of the deep-sea fish genus Coryphaenoides (Gadiformes: Macrouridae) based on mitochondrial DNA. Mol. Phylogenet. Evol. 13, 447–454. Müller, J., 1845. Über den Bau und die Grenzen der Ganoiden und über das natürliche System der Fische. Archiv. Für Naturgeschite 11, 91–141. Nelson, J.S., 2006. Fishes of the World. John Wiley and Sons, Hoboken, NJ. Nixon, K.C., 1999. The parsimony ratchet, a new method for rapid parsimony analysis. Cladistics 15, 407–414. Nolf, D., Steurbaut, E., 1989. Evidence from otoliths for establishing relationships between gadiforms and other groups. In: Cohen, D.M. (Ed.), Papers on the Systematics of Gadiform Fishes. Natural History Museum of Los Angeles County, Science Series No. 32, pp. 37–45. Norman, J.R., 1937a. Diagnoses of new nototheniiform fishes collected by the ‘Discovery’ expedition. Ann. Mag. Nat. Hist. 20, 475–476. Norman, J.R., 1937b. Coast fishes, part II. The Patagonian region. Discov. Rep. 16, 1– 150. Norman, J.R., 1966. A draft synopsis of the Orders, Families and genera of recent fishes and fish-like vertebrates. Trust. Brit. Mus. (Natural History), pp. 649. Okamura, O. 1989. Relationships of the suborder Macrouroidei and related groups, with comments on Merlucciidae and Steindachneria. In: Cohen, D.M. (Ed.), Papers on the Systematics of Gadiform Fishes. Natural History Museum of Los Angeles County, Science Series No. 32, pp. 129–142. Okamura, O., 1970a. Fauna Japonica, Macrourina. Academic Press of Japan, Tokyo. Okamura, O., 1970b. Studies on the macrouroid fishes of Japan, morphology, ecology and phylogeny. Rep. USA Mar. Biol. Stat. 17, 1–179. Page, R.D.M., 1996. TreeView: an application to display phylogenetic trees on personal computers. Comput. Appl. Biosci. 12, 357–358. Page, R.D.M., Holmes, E.C., 1998. Molecular Evolution, a Phylogenetic Approach. Blackwell Science, Oxford. Patterson, C., Rosen, D.E. 1989. The Paracanthopterygii revisited: order and disorder. In: Cohen, D.M. (Ed.), Papers on the Systematics of Gadiform Fishes. Natural History Museum of Los Angeles County, Science Series No. 32, pp. 5–36. Paulin, C.D., 1983. A revision of the family Moridae (Pisces: Anacanthini) within the New Zealand region. Natl. Mus. N. Z. Rec. 2 (9), 81–126. Paulin, C.D. 1989. Moridae: overview. In: Cohen D.M. (Ed.) Papers on the systematics of Gadiform Fishes. Natural History Museum of Los Angeles County, Science Series No. 32, pp. 243–250. Phillips, A., Janies, D., Wheeler, W., 2000. Multiple sequence alignment in phylogenetic analysis. Mol. Phylogenet. Evol. 16, 317–330. Poe, S., Chubb, A.L., 2004. Birds in a bush: five genes indicate explosive evolution of avian orders. Evolution 58, 404–415. Pogson, G.H., Mesa, K.A., 2004. Positive Darwinian selection at the Pantophysin (pan I) locus in marine gadid fishes. Mol. Biol. Evol. 21, 65–75. Posada, D., Crandall, K.A., 1998. MODELTEST: testing the model of DNA substitution. Bioinformatics 14, 817–818. Quinteiro, J., Vidal, R., Rey-Mendez, M., 2000. Phylogeny and biogeographic history of hake (genus Merluccius), inferred from mitochondrial DNA control-region sequences. Mar. Biol. 136, 163–174. Roldan, M.I., Garcia-Marin, J.L., Utter, F.M., Pla, C., 1999. Population genetic structure of European hake, Merluccius merluccius. Heredity 81, 327–334. Ronquist, F., Huelsenberck, J.P., 2003. MrBayes 3: Bayesian phylogenetic inference under mixed models. Bioinformatics 19, 1572–1574. Rosen, D.E., Patterson, C., 1969. The structure and relationships of the paracanthopterygian fishes. Bull. Am. Mus. Nat. Hist. 141, 357–474. Saiki, R.K., 1990. Amplification of genomic DNA. In: Linnis, M.A., Gelfand, D.H., Sninski, J.J., White, T.J. (Eds.), PCR Protocols: A Guide to Methods and Applications. Academic Press, San Diego, CA. Satoh, T.P., Miya, M., Hiromitsu, E., Mutsumi, N., 2006. Round and pointed-head grenadier fishes (Actinopterygii: Gadiformes) represent a single sister group: Evidence from the complete mitochondrial genome sequences. Mol. Phylogenet. Evol. 40, 129–138. Shimodaira, H., Hasegawa, M., 1999. Multiple comparisons of log-likelihoods with applications to phylogenetic inference. Mol. Biol. Evol. 16, 1114–1116. Siebert, D.J., 1990. Reviews. Papers on the systematics of gadiform fishes. Copeia 1990, 889–893. Sikes, D.S., Lewis, P.O., 2001. Beta software, version 1. PAUPRat: PAUP implementation of the parsimony ratchet. (Distributed by the authors. Department of Ecology and Evolutionary Biology, University of Connecticut, Storrs). Smith, H.M., Radcliffe, L., 1912. Description of a new family, two new genera and twenty-nine new species of Anacanthine fishes from the Philippine Islands and contiguous waters. Proc. US Natl. Mus. 43, 105–140. pls. 22–31.

704

A. Roa-Varón, G. Ortí / Molecular Phylogenetics and Evolution 52 (2009) 688–704

Svetovidov, A.N., 1969. On the taxonomical position of the genus Euclichthys (Pisces, Gadiformes). Zool. Zh. 48, 1824–1831. Svetovidov, A.N., 1948. Gadiformes. In Fauna of USSR, 9(4). Zoological Institute of the Academy of Sciences of the USSR (Translated by the Israel Program for Scientific Translations for the Natural Science Foundation and Smithsonian Institution as OTS 63-11071). Svetovidov, A.N., 1937. Ueber die klassification der Gadiformes order Anacanthini. Bull. Acad. Sci. URSS (Biol.) 4, 1281–1388. Swidnicki, J., 1991. New data on the osteology of some species of Bregmaceros (Teleostei, Gadiformes). J. Morphol. 208, 129–160. Swofford, D.L., 2003. PAUP*. Phylogenetic analysis using parsimony (* and other methods) version 4. Sinauer Associates, Sunderland, MA. Swofford, D.L., Olsen, G.J., Waddell, P.J., Hillis, D.M., 1996. Phylogenetic inference. In: Hiillis, D.M., Moritz, D., Mable, B.K. (Eds.), Molecular Systematics. Sinauer Associates, Sunderland, Massachusetts, pp. 407–514. Teletchea, F., Laudet, V., Hanni, C., 2006. Phylogeny of the Gadidae (sensu Svetovidov, 1948) based on their morphology and two mitochondrial genes. Mol. Phylogenet. Evol. 38, 189–199. Templeton, A.R., 1983. Phylogenetic inference from restriction endonuclease cleavage site maps with particular reference to the evolution of human and apes. Evolution 37, 221–244. Thompson, J.D., Gibson, T.J., Plewniak, F., Jeanmougin, F., Higgins, D.G., 1997. The CLUSTAL_X windows interface. Flexible strategies for multiple sequence alignment aided by quality analysis tools. Nucleic Acids Res. 25, 4876–4882.

Torii, A., Harold, A.S., Ozawa, T., Iwatsuki, Y., 2003a. Redescription of Bregmaceros mcclellandi Thompson, 1840 (Gadiformes: Bregmacerotidae). Ichthyol. Res. 50, 129–139. Torii, A., Harold, A.S., Ozawa, T., 2003b. Redescription of type specimens of three Bregmaceros species (Gadiformes: Bregmacerotidae): B. bathymaster, B. rarisquamosus, and B. cayorum. Mem. Fac. Fish. Kagoshima Univ. 52, 23–32. Torii, A., Ozawa, T., Harold, A.S., 2003c. Morphological characters of Bregmaceros japonicus Tanaka, 1908 (Gadiformes: Bregmacerotidae). Mem. Fac. Fish. Kagoshima Univ. 52, 43–50. Torii, A., Javonillo, R., Ozawa, T., 2004. Reexamination of Bregmaceros lanceolatus Shen, 1960 with description of a new species Bregmaceros pseudolanceolatus (Gadiformes: Bregmacerotidae). Ichthyol. Res. 51, 106–112. von der Heyden, S., Matthee, C.A., 2008. Towards resolving familial relationships within the Gadiformes and the resurrection of the Lyconidae. Mol. Phylogenet. Evol. 48, 764–769. Wilson, R.R., 1994. Interrelationships of the subgenera of Coryphaenoides (Gadiformes: Macrouridae): comparison of protein electrophoresis and peptide mapping. Copeia 1994, 42–50. Wilson, R.R., Attia, P., 2003. Interrelationships of the subgenera of Coryphaenoides (Teleostei: Gadiformes: Macrouridae): synthesis of allozyme, peptide mapping, and DNA sequence data. Mol. Phylogenet. Evol. 27, 343–347. Wilson, R.R., Siebenaller, J.F., Davis, B.J., 1991. Phylogenetic analysis of species of three subgenera of Coryphaenoides (Teleostei: Macrouridae) by peptide mapping of homologs of LDH-A4. Biochem. Syst. Ecol. 18, 565–572.