- Email: [email protected]
Phylogenetic relationships among rodent Eimeria species determined by plastid ORF470 and nuclear 18S rDNA sequences
International Journal for Parasitology 31 (2001) 715±719
www.parasitology-online.com
Research note
Phylogenetic relationships among rodent Eimeria species determined by plastid ORF470 and nuclear 18S rDNA sequences Xiaomin Zhao*, Donald W. Duszynski Department of Biology, Castetter Hall, The University of New Mexico, Albuquerque, NM 87131, USA Received 20 October 2000; received in revised form 30 January 2001; accepted 30 January 2001
Abstract Phylogenetic analyses for 10 rodent Eimeria species from different host genera based on plastid ORF470 and nuclear 18S rDNA sequences were done to infer the evolutionary relationships of these rodent Eimeria species and their correlation to morphology and host speci®city. The phylogenies based on both data sets clearly grouped the 10 rodent Eimeria species into two major lineages, which re¯ect more their morphological differences than host speci®city. Species in lineage A have spheroidal to subspheroidal sporulated oocysts, are similar in size (18±29 £ 17-23; x 22 £ 20 mm), have an oocyst residuum and one-two polar granules; these include Eimeria albigulae (Neotoma), Eimeria arizonensis (Peromyscus, Reithrodontomys), Eimeria onychomysis (Onychomys) and Eimeria reedi (Perognathus). Species in lineage B, including Eimeria falciformis (Mus), Eimeria langebarteli (Reithrodontomys), Eimeria nieschulzi (Rattus), Eimeria papillata (Mus), Eimeria separata (Rattus) and Eimeria sevilletensis (Onychomys) have different shapes (ovoid, ellipsoid, elongated ellipsoid, etc.), differ greatly in size (10±27 £ 9±24; x 19 £ 16 mm) and all lack an oocyst residuum. Thus, The oocyst residuum was the most determinant feature that differentiated the two lineages. The accession numbers of ORF470 of E. albigulae, E. arizonensis, E. falciformis, E. nieschulzi, E. onychomysis, E. papillata, E. reedi, E. separata, E. sevilletensis, E. langebarteli are AF311630±AF311639 and 18S rDNA of E. langebarteli, E. papillata, E. reedi, E. separata, E. sevilletensis are AF311640±AF311644. q 2001 Australian Society for Parasitology Inc. Published by Elsevier Science Ltd. All rights reserved. Keywords: Eimeria; Oocysts; Rodent; Plastid ORF470; 18S rDNA gene; Phylogenetic analysis
Within the genus Eimeria most species have been named based on the qualitative and quantitative structures of their sporulated oocysts and the identity of their hosts (Joyner, 1982; Duszynski and Wilber, 1997). In general, they are reasonably host speci®c and most species transfer easily between congeneric hosts (Upton et al., 1992; Hnida and Duszynski, 1999a), less frequently between confamilial hosts (Todd and Hammond, 1968a,b; Wilber et al., 1998) and only rarely between families or orders (De Vos, 1970; Hendrichs, 1977). Reduker et al. (1987) used cladistic and phenetic analyses of isozyme banding patterns, sporulated oocyst morphology, and life history traits to examine the evolutionary relationships among nine Eimeria species from four genera of murid rodents. They concluded that two lineages of rodent Eimeria species corresponded perfectly to two morphologically distinct oocyst types rather than to host genera; in other words, two Eimeria species from same host species, but with different oocyst morphology, were grouped into different lineages. Similar results were * Corresponding author. Tel.: 11-505-277-6804; fax: 11-505-277-0304. E-mail address: [email protected] (X. Zhao).
reported by Hnida and Duszynski (1999b,c) based on phylogenetic analyses of molecular sequence and riboprinting data. More interestingly, we have noted that Eimeria species from different host orders, but with morphologically similar oocysts, are more closely related than species with oocysts that differ in morphology, but share host families or even genera (Zhao et al., 2001a). From these kinds of data it seems that, within the genus Eimeria, morphologic similarity of sporulated oocysts is more signi®cant in re¯ecting evolutionary relationships than is host speci®city. In this study, we have done phylogenetic analyses for 10 rodent Eimeria species from different host genera based on plastid open reading frame (ORF) 470 as well as nuclear 18S rDNA sequences to try to further clarify the evolutionary relationships of certain Eimeria species from rodents and their correlation to morphological and host speci®city features. The rodent Eimeria species used were from either naturally-infected hosts, or ampli®ed in laboratory-reared, coccidia-free hosts following methods described by Upton et al. (1992). The oocysts were collected, sporulated and puri®ed as described by Duszynski and Wilber (1997). DNA was extracted following methods described by
0020-7519/01/$20.00 q 2001 Australian Society for Parasitology Inc. Published by Elsevier Science Ltd. All rights reserved. PII: S 0020-751 9(01)00136-9
716
X. Zhao, D.W. Duszynski / International Journal for Parasitology 31 (2001) 715±719
Zhao et al. (2001b). Brie¯y, puri®ed oocysts were incubated with 60 ml lysis buffer (0.66 M EDTA, 1.3% N-lauroylsarcosine, 2 mg/ml proteinase-K) at 658C for 45 min, then 300 ml CTAB (Cetyl-Trimethyl Ammonium Bromide) buffer (2% w/v CTAB, 1.4 M NaCl, 0.2% b-mercapto-ethanol, 20 mM EDTA, 100 mM tris) was added and incubated for another h at 658C. DNA was extracted with an equal volume of phenol/chloroform/isoamyl alcohol (25:24:1), and precipitated by ethanol. Two genes, plastid ORF470 and nuclear 18S rDNA, were partially ampli®ed by polymerase chain reaction (PCR). The speci®c primers were designed using sequences from related species of Eimeria (Wilson et al., 1996; Denny et al., 1998). For ORF470, forward primer: 5 0 -GATGATATATCTTATTATTCAATTCCTT-3 0 , reverse primer: 5 0 -TCCAATATGTAACATTTTATTTCC. For 18S rDNA, forward primer: GCTTGTCTCAAAGATTAAGCC, reverse primer: AGCGACGGGCGGTGTGTACAA. PCR ampli®cations were carried out in 25 ml reactions under standard conditions on a T-gradient thermocycler (Scimetrics, Inc.). The reaction mixture contained 1 U of Taq polymerase, 2.5 ml 10 £ PCR buffer, 0.04 mM of each deoxynucleotide, 2.5 mM MgCl (PCR kit, Perkin Elmer), 1 mm of each ampli®cation primer, 1 ml DNA template and MiliQ H2O to volume. Cycling pro®le was as follows: 958C for 4 min in precycle, followed by 35 cycles of 928C denaturation for 45 s, primer annealing for 45 s at 508C for ORF470 and 658C for 18S rDNA, and elongation at 728C for 1.5 min. Final primer extension continued for addition 7 min to allow the complete elongation of all ampli®cations. The PCR products of 18S rDNA and ORF470 were directly cloned using Original TA cloning Kit (Invitrogen) following the manufacturer's instructions. Sequencing of clones was performed on both strands using BigDye terminator cycle sequencing ready reaction kit (ABI PRISM, Perkin Elmer). The sequences have been deposited in the GenBank database. The accession numbers of ORF470 of E. albigulae, E. arizonensis, E. falciformis, E. nieschulzi, E. onychomysis, E. papillata, E. reedi, E. separata, E. sevilletensis, E. langebarteli are AF311630±AF311639 and 18S rDNA of E. langebarteli, E. papillata, E. reedi, E. separata, E. sevilletensis are AF311640 ±AF311644. ORF470 of E. tenella(Y12333), 18S rDNA sequences of E. tenella (U67121), E. acervulina (U67115), E. nieschulzi (U40263) and E. falciformis (AF080614) were retrieved from the GenBank database. The sequences were aligned using ClustalW version 1.7. We aligned the sequences in three different ways by specifying different gap opening penalty (GOP) and gap extension penalty (GEP) as following: Alignment 1: GOP 10, GEP 5; alignment 2: GOP 10, GEP 0.5; alignment 3: GOP 10, GEP 0.05 to see if the different alignment parameters effect on the phyogenetic tree building. The phylogenetic analysis was carried out using Phylogenetic Analysis Using Parsimony (PAUP*) version 4.0b3 (Swofford, 1999). Maximum parsimony (MP), distance with mini-
mum evolution (ME) model, and maximum likelihood (ML) criteria were employed to do the analyses. A transition/ transversion ratio of 1.8:1 estimated from data via likelihood is speci®ed for MP analysis. Because the base composition bias test indicated that there was no signi®cant difference in base compositions among the sequences for both ORF470 and 18S rDNA, the hky85 model was chosen to measure the distances for ME analysis. ML analysis was performed using KHY 85 algorithm, with gamma model (shape pararmeter a 0:38, ti/tv ratio 1.8 estimated from the data sets). The best trees were searched by evaluating all possible trees using exhaustive search for MP and ME analyses. Heuristic search, with random addition of taxa, and the tree-bisection/reconnection swapping method, was used for ML analysis. Bootstrap values are based on 2000 replicates with heuristic search. The software TreeView version 1.5 (Page, 1996) was used for printing out phylogenetic trees. The tree-length distributions of all the possible trees under exhaustive search show that the tree number by tree length plot is heavily right-skewed for both data sets; the g1 value was 20.88 for the ORF470 data set and 20.66 for the 18S rDNA data set, and P-values were much less than 0.01, which indicated both data sets contain signi®cant phylogenetic information (Hillis and Huelsenbeck, 1992). For the ORF470 data set, the aligned sequence length was 696 bases with gaps, among which 449 are constant and 139 are phylogenetically informative. Under MP and ML criteria, the three different alignments produced the same single tree (Fig. 1). Eimeria tenella,which is a chicken coccidium, was used as the outgroup. This tree grouped 10 rodent Eimeriaspp. into two major clades with high bootstrap supports (2000 replicates). Using the terminology of Reduker et al. (1987), in lineage A: E. onychomysis was clustered together with E. albigulae,but bootstrap support for this branch was relatively poor (61%); these two species together with E. arizonensis formed a clade with 85% bootstrap support; E. reedi was placed at the base of this lineage with 100% bootstrap support. In lineage B: E. neischulzi clustered with E. papillata with 100% bootstrap support; E. falciformis and E. sevilletensis were clustered with 99% bootstrap support, and these two branches formed a clade with 84% bootstrap support; together they clustered with a branch of E. separata and E. langebarteli with 71% bootstrap support and formed a major group with 95% bootstrap support. Under distance criteria, the three different alignments produced a single tree that is slightly different from the MP and ML tree in that E. langebarteli and E. separata are clustered together in the MP and ML tree, but not in the distance tree (Fig. 2). The K±H test shows that these two trees are only one step different with P 0:77, which indicates that there is no signi®cant difference between the two trees. For this plastid ORF470 data set, different alignments and tree building methods had no signi®cant effect on the tree topology.
X. Zhao, D.W. Duszynski / International Journal for Parasitology 31 (2001) 715±719
Fig. 1. A single phylogenetic tree inferred from plastid ORF470 sequences under Parsimony and Likelihood (HKY85 with gamma model) criteria. E. tenella was used as the outgroup. The ®gures on the tree are bootstrap values under parsimony criterion with 2000 replicates. Parsimony steps: 377, CI: 0.78, CI excluding uninformative characters: 0.68, RC: 0.54, RI: 0.69. Distance Score: 0.55. likelihood -ln: 2724.
For the nuclear 18S rDNA data set, the aligned sequence was 1562 bases with gaps, among which 1558 were considered to be unambiguously aligned with 1401 constant and 64 phylogenetically informative. A single best tree (Fig. 3) was generated under parsimony criteria with 190 steps. This tree also groups the 10 rodent Eimeria species into two major lineages which are identical to the plastid ORF470 trees. The bootstrap support for the two major subgroups were 93 and 99%, respectively. Two equal best ME trees
Fig. 2. Phylogenetic tree inferred from plastid ORF470 sequences under distance (ME, hky85). The ®gures on the tree are bootstrap values with 2000 replicates, ,50% for unlabeled note. Distance Score: 0.55.
717
and two equal best ML trees were generated from the same data set. One of the two best ME trees and one of the two ML trees were identical to the best MP tree (Fig. 3). The differences among the other trees were different placements of some species in the subclades. The phylogenies based on both plastid ORF 470 and nuclear 18S rDNA sequences clearly grouped the 10 rodent Eimeria species into two major lineages. Bootstrap analysis shows that the level of con®dence in the topological pattern is highly signi®cant. In general, our results are consistent with previous studies. Reduker et al. (1987) ®rst noted that certain rodent Eimeria species divided into two independent lineages by phenetic and cladistic analysis of oocyst structure, life-history data, and isozyme banding patterns. Hnida and Duszynski (1999b,c), later, found similar results based on ITS1 and riboprinting phylogenies. However, some of the species contained in each lineage in the present study differ from their positions in the previous studies. The major differences are the positions of E. papillata and E. langebarteli. The work of Reduker et al. (1987) clustered E. papillata with E. arizonensis (three isolates), E. albigulae and E. peromysci, which they called type A Eimeria, while E. langebarteli was placed in the type B lineage that included E. nieschulzi, E. delicata, E. lachrymalis and E. ladroenesis. This result was supported by the phylogeny based on molecular riboprinting data (Hnida and Duszynski, 1999c). However, using phylogenetic analysis based on ITS1 sequences, Hnida and Duszynski (1999b) found that E. papillata grouped in the lineage B while E. langebarteli was clustered together with E. reedi in lineage A. In the present study, both E. papillata and E. langebarteli are placed in lineage B. We are quite con®dent with these results, because they were obtained from two gene phylogenies (plastid ORF470 and nuclear 18S rDNA) inferred under different criteria (parsimony, distance, and likelihood) using different alignment parameters, and the branches are well supported by bootstrap analyses (95% from plastid
Fig. 3. Phylogenetic trees inferred from nuclear 18S rDNA sequences under parsimony criterion. The ®gures on the tree are bootstrap values with 2000 replicates, ,50% for unlabelled notes. Parsimony steps: 190, CI: 0.82, CI excluding uninformative characters: 0.67, RC: 0.63, RI: 0.77.
718
X. Zhao, D.W. Duszynski / International Journal for Parasitology 31 (2001) 715±719
ORF470 data; 93% from nuclear 18S rDNA sequence data). The bootstrap analyses for riboprinting data (Hnida and Duszynski, 1999c) and ITS1 data (Hnida and Duszynski, 1999b) could not resolve the ingroup branches. The results in these studies (Reduker et al., 1987; Hnida and Duszynski, 1999b,c), including the present study, are similar in that both lineages re¯ect the morphological differences of the sporulated oocysts, rather than host speci®city (i.e. Eimeria species with distinctly different morphological features from the same host species or genus are grouped into different lineages). For example, both E. arizonensis and E. langebarteli use Peromyscus attwateri as a de®nite host, but they are grouped into different lineages. Similarly, E. sevilletensis and E. onychomysis, which both use Onychomys leucogaster as a host, also grouped into different lineages. Examination of the morphological features of the two Eimeria lineages shows that each lineage shares some common morphological features. The species in lineage A (E. reedi, E. arizonensis, E. onychomysis, E. albigulae) have spheroidal to subspheroidal sporulated oocysts, are similar in size (18±29 £ 17±23; x 22 £ 20 mm), and have an oocyst residuum. Species in lineage B (E. falciformis, E. langebarteli, E. nieschulzi, E. papillata, E. separata, E. sevilletensis) have different shapes (ovoidal, ellipsoidal, elongate ellipsoidal, etc.), differ greatly in size (10±27 £ 9±24; x 19 £ 16 mm) and all lack an oocyst residuum (see Fig. 4). It seems that the only obvious feature that differentiates the two lineages morphologically is the presence/absence of the oocyst residuum, because the oocyst size and shape often overlap in the different Eimeria species (Duszynski, 1971; Joyner, 1982; Long and Joyner, 1984; Parker and Duszynski, 1986; Gardner and Duszynski, 1990). For this reason, the placement of E. papillata and E. langebarteli into lineage B seems more reasonable because neither species contains an oocyst residuum. The oocyst residuum, which forms during sporulation, is one of the important morphological features that help differentiate the oocysts of Eimeria (and other) species. It is thought to be clusters of lipid granules eliminated from the cytoplasm of the zygote during sporogony (Kheysin, 1967); however, it is unknown why some eimeriid species have an oocyst residuum while others do not, and what its function is if it is functional. Further research should be done on testing more species and more genes because of the species limitation in the present study. The plastid is a recently identi®ed organelle genome, which we believe is widely spread or even universal the phylum Apicomplexa (Kilejian, 1975; Borst et al., 1984; Gardner et al., 1991; Lang-Unnasch et al., 1998; Gleeson and Johnson, 1999; Gleeson, 2000). Almost nothing is known about the plastids in mammalian Eimeria. This is the ®rst report to use plastid ORF470 DNA sequences inferring phylogenies in rodent Eimeria species to address the evolutionary relationships among these taxa. The congruence of the phylogenies for 10 rodent Eimeria species inferred from plastid ORF470 and nuclear 18S rDNA sequence indicates that the plastid ORF470 DNA sequence
is a good phylogenetic yardstick to infer phylogenetic relationships for Eimeria species. The nuclear 18S rDNA sequences are widely used to construct phylogenetic relationships among apicomplexan parasites (Gleeson, 2000). However, because of its high conservation, it appears not suitable for some closely related species (e.g. bootstrapping analyses using 18S rDNA sequences could not resolve the ®ve Eimeria species in this study, see Fig. 3). Compared to the nuclear 18S rDNA sequences, the ORF470 sequences have a higher rate of nucleotide substitutions and, therefore, contain much more phylogenetic information. In addition, the ORF470 sequences are conserved enough to make alignments possible across a wide range of taxa. As a phyloge-
Fig. 4. Comparison of the molecular phylogeny (plastid ORF470 MP tree) and some oocyst morphological features for 10 rodent Eimeria species. Species in lineage A have different size (small, medium, and big), different shape (ovoid, ellipsoid, elongated ellipsoid, etc.), and without oocyst residuum. Species in lineage B have a round or nearly round sporulated oocyst, big and similar in size, and with oocyst residuum represented by a black dot in the ®gure.
X. Zhao, D.W. Duszynski / International Journal for Parasitology 31 (2001) 715±719
netic tool, they seem particularly useful to resolve the phylogenetic relationships among closely related taxa. Acknowledgements Acknowledgments. We are indebted to Dr E.S. Loker for the use of the facilities in his laboratory. Special thanks to Lynn Hertel for the art work. We are grateful to the staff of the Biology Animal Resource Facility at UNM for their animal care, and the Biology Molecular Facility Laboratory at UNM for running sequence gels. This work was supported, in part, by grants from the UNM Of®ce of Graduate Studies, the UNM Graduate Students' Association, and the Biology Graduate Research Allocations Committee, and by a PEET grant (NSF, DEB-9521687) to DWD. References Borst, P., Overdulve, J.P., Weijers, P.J., Fase-Fowler, F., Van den Berg, M., 1984. DNA circles with cruciforms from Isospora (Toxoplasma) gondii. Biochim. Biophys. Acta 781, 100±11. Denny, P., Preiser, P., Williamson, D., Wilson, I., 1998. Evidence for a single origin of the 35 kb plastid DNA in apicomplexans. Protist 149, 51±59. De Vos, A.J., 1970. Studies on the host range of Eimeria chinchillae De Vos and Van der Westhuizen, 1968. Onderstepoort J. Vet. Res. 37, 29± 36. Duszynski, D.W., 1971. Increase in size of Eimeria separata oocysts during patency. J. Parasitol. 57, 948±52. Duszynski, D.W., Wilber, P.G., 1997. A guideline for the preparation of species descriptions in the Eimeriidae. J. Parasitol. 83, 333±6. Gardner, S.L., Duszynski, D.W., 1990. Polymorphism of eimerian oocysts can be a problem in naturally infected hosts: an example from subterranean rodents in Bolivia. J. Parasitol. 76, 805±11. Gardner, M.J., Williamson, D.H., Wilson, R.J.M., 1991. A circular DNA in malaria parasites encodes an RNA polymerase like that of prokaryotes and chloroplasts. Mol. Biochem. Parasitol. 44, 115±24. Gleeson, M.T., 2000. The plastid in Apicomplexa: what use is it? Int. J. Parasitol. 30, 1053±70. Gleeson, M.T., Johnson, A.M., 1999. Physical characterization of the plastid DNA in Neospora caninum. Int. J. Parasitol. 29, 1563±73. Hendrichs, L.D., 1977. Host range characteristics of the primate coccidian Isospora aratopitheci Rodhain, 1933 (Protozoa: Eimeriidae). J. Parasitol. 63, 32±35. Hillis, D.M., Huelsenbeck, J.P., 1992. Signal, noise, and reliability in molecular phylogenetic analyses. J. Heredity 83, 189±95. Hnida, J.A., Duszynski, D.W., 1999a. Cross-transmission studies with Eimeria arizonensis, E. arizonensis-like oocysts and Eimeria langebarteli: host speci®city at the genus and species level within the Muridae. J. Parasitol. 85, 873±7. Hnida, J.A., Duszynski, D.W., 1999b. Taxonomy and systematics of some
719
Eimeria species of murid rodents as determined by the ITS1 region of the ribosomal gene complex. Parasitol. 119, 349±57. Hnida, J.A., Duszynski, D.W., 1999c. Taxonomy and phylogeny of some Eimeria (Apicomplexa: Eimeriidae) species of rodents as determined by polymerase chain reaction/restriction-fragment-length polymorphism analysis of 18s rDNA. Parasitol. Res. 85, 887±94. Joyner, L.P., 1982. Host and site speci®city. In: Long, P.L. (Ed.), The biology of the coccidia, University Park Press, pp. 35±62. Kheysin, E.M., 1967. Zhiznennye tsikly koktsidii domashnikh zhivotnykh, Isdat Nauka, Leningrad (English translation by Plous Jr., F.K., edited by Todd Jr., K.S., 1971. Life cycles of coccidia of domestic animals. University Park Press, Baltimore). Kilejian, A., 1975. Circular mitochondrial DNA from the avian malaria parasite Plasmodium lophurae. Biochim. Biophys. Acta 390, 276±84. Lang-Unnasch, N., Reith, M.E., Munholland, J., Barta, J.R., 1998. Plastids are widespread and ancient in parasites of the phylum Apicomplexa. Int. J. Parasitol. 28, 1743±54. Long, P.L., Joyner, L.P., 1984. Problems in the identi®cation of species of Eimeria. J. Protozool. 31, 535±41. Page, R.D.M., 1996. TREEVIEW: An application to display phylogenetic trees on personal computers. Comput. Applic. Biosci. 12, 357±8. Parker, B.B., Duszynski, D.W., 1986. Polymorphism of eimerian oocysts: a dilemma posed by working with some naturally infected hosts. J. Parasitol. 72, 602±4. Reduker, D.W., Duszynski, D.W., Yates, T.L., 1987. Evolutionary relationships among Eimeria spp.(Apicomplexa) infecting cricetid rodents. Can. J. Zool. 65, 722±35. Swofford, D.T., 1999. PAUP*. Plylogenetic analysis using parsimony (*and other methods). Version 4b3, Sinauer Associates, Sunderland, MA. Todd Jr., K.S., Hammond, D.M., 1968a. Life cycle and host speci®city of Eimeria callospermophili Henry, 1932 from the Uinta ground squirrel Spermophilus armatus. J. Protozool. 15, 1±8. Todd Jr., K.S., Hammond, D.M., 1968b. Life cycle and host speci®city of Eimeria larimerensis Vetterling, 1964, from the Uinta ground squirrel, Spermophilus armatus. J. Protozool. 15, 268±75. Upton, S.L., Mcallister, C.T., Brillhart, D.B., Duszynski, D.W., Wash, C.W., 1992. Cross-transmission studies with Eimeria arizonensis-like oocysts (Apicomplexa) in New World rodents of the genera Baiomys, Neotoma, Onychomys, Peromyscus and Reithrodonmys Muridae. J. Parasitol. 78, 406±13. Wilber, P.G., Duszynski, D.W., Upton, S.J., Seville, R.S., Corliss, J.O., 1998. A revision of the taxonomy and nomenclature of the Eimeria spp. (Apicomplexa: Eimeriidae) from rodents in the Tribe Marmotini (Sciuridae). Syst. Parasitol. 39, 113±35. Wilson, R.J.M., Denny, P.W., Preiser, P.R., Rangachari, K., Roberts, K., Roy, A., Whyte, A., Strath, M., Moore, D.J., Moore, P.W., Williamson, D.H., 1996. Complete gene map of the plastid-like DNA of the Malaria parasite Plasmodium falciparum. J. Mol. Biol. 261, 155±72. Zhao, X., Duszynski, D.W., Lodier, E.S., 2001a. Phylogenetic position of Eimeria antrozoi, a bat coccidium (Apicomplexa: Eimeriidae) and its relationship to other morphologically similar Eimeria spp. from bats and rodents based on nuclear 185 and plastid 235 rDNA sequences. J. Parasitol. 78: In press. Zhao, X., Duszynski, D.W., Loker, E.S., 2001b. A simple method of DNA extraction for Eimeria species. J. Microbiol. Methods. 44, 131±7.
www.parasitology-online.com
Research note
Phylogenetic relationships among rodent Eimeria species determined by plastid ORF470 and nuclear 18S rDNA sequences Xiaomin Zhao*, Donald W. Duszynski Department of Biology, Castetter Hall, The University of New Mexico, Albuquerque, NM 87131, USA Received 20 October 2000; received in revised form 30 January 2001; accepted 30 January 2001
Abstract Phylogenetic analyses for 10 rodent Eimeria species from different host genera based on plastid ORF470 and nuclear 18S rDNA sequences were done to infer the evolutionary relationships of these rodent Eimeria species and their correlation to morphology and host speci®city. The phylogenies based on both data sets clearly grouped the 10 rodent Eimeria species into two major lineages, which re¯ect more their morphological differences than host speci®city. Species in lineage A have spheroidal to subspheroidal sporulated oocysts, are similar in size (18±29 £ 17-23; x 22 £ 20 mm), have an oocyst residuum and one-two polar granules; these include Eimeria albigulae (Neotoma), Eimeria arizonensis (Peromyscus, Reithrodontomys), Eimeria onychomysis (Onychomys) and Eimeria reedi (Perognathus). Species in lineage B, including Eimeria falciformis (Mus), Eimeria langebarteli (Reithrodontomys), Eimeria nieschulzi (Rattus), Eimeria papillata (Mus), Eimeria separata (Rattus) and Eimeria sevilletensis (Onychomys) have different shapes (ovoid, ellipsoid, elongated ellipsoid, etc.), differ greatly in size (10±27 £ 9±24; x 19 £ 16 mm) and all lack an oocyst residuum. Thus, The oocyst residuum was the most determinant feature that differentiated the two lineages. The accession numbers of ORF470 of E. albigulae, E. arizonensis, E. falciformis, E. nieschulzi, E. onychomysis, E. papillata, E. reedi, E. separata, E. sevilletensis, E. langebarteli are AF311630±AF311639 and 18S rDNA of E. langebarteli, E. papillata, E. reedi, E. separata, E. sevilletensis are AF311640±AF311644. q 2001 Australian Society for Parasitology Inc. Published by Elsevier Science Ltd. All rights reserved. Keywords: Eimeria; Oocysts; Rodent; Plastid ORF470; 18S rDNA gene; Phylogenetic analysis
Within the genus Eimeria most species have been named based on the qualitative and quantitative structures of their sporulated oocysts and the identity of their hosts (Joyner, 1982; Duszynski and Wilber, 1997). In general, they are reasonably host speci®c and most species transfer easily between congeneric hosts (Upton et al., 1992; Hnida and Duszynski, 1999a), less frequently between confamilial hosts (Todd and Hammond, 1968a,b; Wilber et al., 1998) and only rarely between families or orders (De Vos, 1970; Hendrichs, 1977). Reduker et al. (1987) used cladistic and phenetic analyses of isozyme banding patterns, sporulated oocyst morphology, and life history traits to examine the evolutionary relationships among nine Eimeria species from four genera of murid rodents. They concluded that two lineages of rodent Eimeria species corresponded perfectly to two morphologically distinct oocyst types rather than to host genera; in other words, two Eimeria species from same host species, but with different oocyst morphology, were grouped into different lineages. Similar results were * Corresponding author. Tel.: 11-505-277-6804; fax: 11-505-277-0304. E-mail address: [email protected] (X. Zhao).
reported by Hnida and Duszynski (1999b,c) based on phylogenetic analyses of molecular sequence and riboprinting data. More interestingly, we have noted that Eimeria species from different host orders, but with morphologically similar oocysts, are more closely related than species with oocysts that differ in morphology, but share host families or even genera (Zhao et al., 2001a). From these kinds of data it seems that, within the genus Eimeria, morphologic similarity of sporulated oocysts is more signi®cant in re¯ecting evolutionary relationships than is host speci®city. In this study, we have done phylogenetic analyses for 10 rodent Eimeria species from different host genera based on plastid open reading frame (ORF) 470 as well as nuclear 18S rDNA sequences to try to further clarify the evolutionary relationships of certain Eimeria species from rodents and their correlation to morphological and host speci®city features. The rodent Eimeria species used were from either naturally-infected hosts, or ampli®ed in laboratory-reared, coccidia-free hosts following methods described by Upton et al. (1992). The oocysts were collected, sporulated and puri®ed as described by Duszynski and Wilber (1997). DNA was extracted following methods described by
0020-7519/01/$20.00 q 2001 Australian Society for Parasitology Inc. Published by Elsevier Science Ltd. All rights reserved. PII: S 0020-751 9(01)00136-9
716
X. Zhao, D.W. Duszynski / International Journal for Parasitology 31 (2001) 715±719
Zhao et al. (2001b). Brie¯y, puri®ed oocysts were incubated with 60 ml lysis buffer (0.66 M EDTA, 1.3% N-lauroylsarcosine, 2 mg/ml proteinase-K) at 658C for 45 min, then 300 ml CTAB (Cetyl-Trimethyl Ammonium Bromide) buffer (2% w/v CTAB, 1.4 M NaCl, 0.2% b-mercapto-ethanol, 20 mM EDTA, 100 mM tris) was added and incubated for another h at 658C. DNA was extracted with an equal volume of phenol/chloroform/isoamyl alcohol (25:24:1), and precipitated by ethanol. Two genes, plastid ORF470 and nuclear 18S rDNA, were partially ampli®ed by polymerase chain reaction (PCR). The speci®c primers were designed using sequences from related species of Eimeria (Wilson et al., 1996; Denny et al., 1998). For ORF470, forward primer: 5 0 -GATGATATATCTTATTATTCAATTCCTT-3 0 , reverse primer: 5 0 -TCCAATATGTAACATTTTATTTCC. For 18S rDNA, forward primer: GCTTGTCTCAAAGATTAAGCC, reverse primer: AGCGACGGGCGGTGTGTACAA. PCR ampli®cations were carried out in 25 ml reactions under standard conditions on a T-gradient thermocycler (Scimetrics, Inc.). The reaction mixture contained 1 U of Taq polymerase, 2.5 ml 10 £ PCR buffer, 0.04 mM of each deoxynucleotide, 2.5 mM MgCl (PCR kit, Perkin Elmer), 1 mm of each ampli®cation primer, 1 ml DNA template and MiliQ H2O to volume. Cycling pro®le was as follows: 958C for 4 min in precycle, followed by 35 cycles of 928C denaturation for 45 s, primer annealing for 45 s at 508C for ORF470 and 658C for 18S rDNA, and elongation at 728C for 1.5 min. Final primer extension continued for addition 7 min to allow the complete elongation of all ampli®cations. The PCR products of 18S rDNA and ORF470 were directly cloned using Original TA cloning Kit (Invitrogen) following the manufacturer's instructions. Sequencing of clones was performed on both strands using BigDye terminator cycle sequencing ready reaction kit (ABI PRISM, Perkin Elmer). The sequences have been deposited in the GenBank database. The accession numbers of ORF470 of E. albigulae, E. arizonensis, E. falciformis, E. nieschulzi, E. onychomysis, E. papillata, E. reedi, E. separata, E. sevilletensis, E. langebarteli are AF311630±AF311639 and 18S rDNA of E. langebarteli, E. papillata, E. reedi, E. separata, E. sevilletensis are AF311640 ±AF311644. ORF470 of E. tenella(Y12333), 18S rDNA sequences of E. tenella (U67121), E. acervulina (U67115), E. nieschulzi (U40263) and E. falciformis (AF080614) were retrieved from the GenBank database. The sequences were aligned using ClustalW version 1.7. We aligned the sequences in three different ways by specifying different gap opening penalty (GOP) and gap extension penalty (GEP) as following: Alignment 1: GOP 10, GEP 5; alignment 2: GOP 10, GEP 0.5; alignment 3: GOP 10, GEP 0.05 to see if the different alignment parameters effect on the phyogenetic tree building. The phylogenetic analysis was carried out using Phylogenetic Analysis Using Parsimony (PAUP*) version 4.0b3 (Swofford, 1999). Maximum parsimony (MP), distance with mini-
mum evolution (ME) model, and maximum likelihood (ML) criteria were employed to do the analyses. A transition/ transversion ratio of 1.8:1 estimated from data via likelihood is speci®ed for MP analysis. Because the base composition bias test indicated that there was no signi®cant difference in base compositions among the sequences for both ORF470 and 18S rDNA, the hky85 model was chosen to measure the distances for ME analysis. ML analysis was performed using KHY 85 algorithm, with gamma model (shape pararmeter a 0:38, ti/tv ratio 1.8 estimated from the data sets). The best trees were searched by evaluating all possible trees using exhaustive search for MP and ME analyses. Heuristic search, with random addition of taxa, and the tree-bisection/reconnection swapping method, was used for ML analysis. Bootstrap values are based on 2000 replicates with heuristic search. The software TreeView version 1.5 (Page, 1996) was used for printing out phylogenetic trees. The tree-length distributions of all the possible trees under exhaustive search show that the tree number by tree length plot is heavily right-skewed for both data sets; the g1 value was 20.88 for the ORF470 data set and 20.66 for the 18S rDNA data set, and P-values were much less than 0.01, which indicated both data sets contain signi®cant phylogenetic information (Hillis and Huelsenbeck, 1992). For the ORF470 data set, the aligned sequence length was 696 bases with gaps, among which 449 are constant and 139 are phylogenetically informative. Under MP and ML criteria, the three different alignments produced the same single tree (Fig. 1). Eimeria tenella,which is a chicken coccidium, was used as the outgroup. This tree grouped 10 rodent Eimeriaspp. into two major clades with high bootstrap supports (2000 replicates). Using the terminology of Reduker et al. (1987), in lineage A: E. onychomysis was clustered together with E. albigulae,but bootstrap support for this branch was relatively poor (61%); these two species together with E. arizonensis formed a clade with 85% bootstrap support; E. reedi was placed at the base of this lineage with 100% bootstrap support. In lineage B: E. neischulzi clustered with E. papillata with 100% bootstrap support; E. falciformis and E. sevilletensis were clustered with 99% bootstrap support, and these two branches formed a clade with 84% bootstrap support; together they clustered with a branch of E. separata and E. langebarteli with 71% bootstrap support and formed a major group with 95% bootstrap support. Under distance criteria, the three different alignments produced a single tree that is slightly different from the MP and ML tree in that E. langebarteli and E. separata are clustered together in the MP and ML tree, but not in the distance tree (Fig. 2). The K±H test shows that these two trees are only one step different with P 0:77, which indicates that there is no signi®cant difference between the two trees. For this plastid ORF470 data set, different alignments and tree building methods had no signi®cant effect on the tree topology.
X. Zhao, D.W. Duszynski / International Journal for Parasitology 31 (2001) 715±719
Fig. 1. A single phylogenetic tree inferred from plastid ORF470 sequences under Parsimony and Likelihood (HKY85 with gamma model) criteria. E. tenella was used as the outgroup. The ®gures on the tree are bootstrap values under parsimony criterion with 2000 replicates. Parsimony steps: 377, CI: 0.78, CI excluding uninformative characters: 0.68, RC: 0.54, RI: 0.69. Distance Score: 0.55. likelihood -ln: 2724.
For the nuclear 18S rDNA data set, the aligned sequence was 1562 bases with gaps, among which 1558 were considered to be unambiguously aligned with 1401 constant and 64 phylogenetically informative. A single best tree (Fig. 3) was generated under parsimony criteria with 190 steps. This tree also groups the 10 rodent Eimeria species into two major lineages which are identical to the plastid ORF470 trees. The bootstrap support for the two major subgroups were 93 and 99%, respectively. Two equal best ME trees
Fig. 2. Phylogenetic tree inferred from plastid ORF470 sequences under distance (ME, hky85). The ®gures on the tree are bootstrap values with 2000 replicates, ,50% for unlabeled note. Distance Score: 0.55.
717
and two equal best ML trees were generated from the same data set. One of the two best ME trees and one of the two ML trees were identical to the best MP tree (Fig. 3). The differences among the other trees were different placements of some species in the subclades. The phylogenies based on both plastid ORF 470 and nuclear 18S rDNA sequences clearly grouped the 10 rodent Eimeria species into two major lineages. Bootstrap analysis shows that the level of con®dence in the topological pattern is highly signi®cant. In general, our results are consistent with previous studies. Reduker et al. (1987) ®rst noted that certain rodent Eimeria species divided into two independent lineages by phenetic and cladistic analysis of oocyst structure, life-history data, and isozyme banding patterns. Hnida and Duszynski (1999b,c), later, found similar results based on ITS1 and riboprinting phylogenies. However, some of the species contained in each lineage in the present study differ from their positions in the previous studies. The major differences are the positions of E. papillata and E. langebarteli. The work of Reduker et al. (1987) clustered E. papillata with E. arizonensis (three isolates), E. albigulae and E. peromysci, which they called type A Eimeria, while E. langebarteli was placed in the type B lineage that included E. nieschulzi, E. delicata, E. lachrymalis and E. ladroenesis. This result was supported by the phylogeny based on molecular riboprinting data (Hnida and Duszynski, 1999c). However, using phylogenetic analysis based on ITS1 sequences, Hnida and Duszynski (1999b) found that E. papillata grouped in the lineage B while E. langebarteli was clustered together with E. reedi in lineage A. In the present study, both E. papillata and E. langebarteli are placed in lineage B. We are quite con®dent with these results, because they were obtained from two gene phylogenies (plastid ORF470 and nuclear 18S rDNA) inferred under different criteria (parsimony, distance, and likelihood) using different alignment parameters, and the branches are well supported by bootstrap analyses (95% from plastid
Fig. 3. Phylogenetic trees inferred from nuclear 18S rDNA sequences under parsimony criterion. The ®gures on the tree are bootstrap values with 2000 replicates, ,50% for unlabelled notes. Parsimony steps: 190, CI: 0.82, CI excluding uninformative characters: 0.67, RC: 0.63, RI: 0.77.
718
X. Zhao, D.W. Duszynski / International Journal for Parasitology 31 (2001) 715±719
ORF470 data; 93% from nuclear 18S rDNA sequence data). The bootstrap analyses for riboprinting data (Hnida and Duszynski, 1999c) and ITS1 data (Hnida and Duszynski, 1999b) could not resolve the ingroup branches. The results in these studies (Reduker et al., 1987; Hnida and Duszynski, 1999b,c), including the present study, are similar in that both lineages re¯ect the morphological differences of the sporulated oocysts, rather than host speci®city (i.e. Eimeria species with distinctly different morphological features from the same host species or genus are grouped into different lineages). For example, both E. arizonensis and E. langebarteli use Peromyscus attwateri as a de®nite host, but they are grouped into different lineages. Similarly, E. sevilletensis and E. onychomysis, which both use Onychomys leucogaster as a host, also grouped into different lineages. Examination of the morphological features of the two Eimeria lineages shows that each lineage shares some common morphological features. The species in lineage A (E. reedi, E. arizonensis, E. onychomysis, E. albigulae) have spheroidal to subspheroidal sporulated oocysts, are similar in size (18±29 £ 17±23; x 22 £ 20 mm), and have an oocyst residuum. Species in lineage B (E. falciformis, E. langebarteli, E. nieschulzi, E. papillata, E. separata, E. sevilletensis) have different shapes (ovoidal, ellipsoidal, elongate ellipsoidal, etc.), differ greatly in size (10±27 £ 9±24; x 19 £ 16 mm) and all lack an oocyst residuum (see Fig. 4). It seems that the only obvious feature that differentiates the two lineages morphologically is the presence/absence of the oocyst residuum, because the oocyst size and shape often overlap in the different Eimeria species (Duszynski, 1971; Joyner, 1982; Long and Joyner, 1984; Parker and Duszynski, 1986; Gardner and Duszynski, 1990). For this reason, the placement of E. papillata and E. langebarteli into lineage B seems more reasonable because neither species contains an oocyst residuum. The oocyst residuum, which forms during sporulation, is one of the important morphological features that help differentiate the oocysts of Eimeria (and other) species. It is thought to be clusters of lipid granules eliminated from the cytoplasm of the zygote during sporogony (Kheysin, 1967); however, it is unknown why some eimeriid species have an oocyst residuum while others do not, and what its function is if it is functional. Further research should be done on testing more species and more genes because of the species limitation in the present study. The plastid is a recently identi®ed organelle genome, which we believe is widely spread or even universal the phylum Apicomplexa (Kilejian, 1975; Borst et al., 1984; Gardner et al., 1991; Lang-Unnasch et al., 1998; Gleeson and Johnson, 1999; Gleeson, 2000). Almost nothing is known about the plastids in mammalian Eimeria. This is the ®rst report to use plastid ORF470 DNA sequences inferring phylogenies in rodent Eimeria species to address the evolutionary relationships among these taxa. The congruence of the phylogenies for 10 rodent Eimeria species inferred from plastid ORF470 and nuclear 18S rDNA sequence indicates that the plastid ORF470 DNA sequence
is a good phylogenetic yardstick to infer phylogenetic relationships for Eimeria species. The nuclear 18S rDNA sequences are widely used to construct phylogenetic relationships among apicomplexan parasites (Gleeson, 2000). However, because of its high conservation, it appears not suitable for some closely related species (e.g. bootstrapping analyses using 18S rDNA sequences could not resolve the ®ve Eimeria species in this study, see Fig. 3). Compared to the nuclear 18S rDNA sequences, the ORF470 sequences have a higher rate of nucleotide substitutions and, therefore, contain much more phylogenetic information. In addition, the ORF470 sequences are conserved enough to make alignments possible across a wide range of taxa. As a phyloge-
Fig. 4. Comparison of the molecular phylogeny (plastid ORF470 MP tree) and some oocyst morphological features for 10 rodent Eimeria species. Species in lineage A have different size (small, medium, and big), different shape (ovoid, ellipsoid, elongated ellipsoid, etc.), and without oocyst residuum. Species in lineage B have a round or nearly round sporulated oocyst, big and similar in size, and with oocyst residuum represented by a black dot in the ®gure.
X. Zhao, D.W. Duszynski / International Journal for Parasitology 31 (2001) 715±719
netic tool, they seem particularly useful to resolve the phylogenetic relationships among closely related taxa. Acknowledgements Acknowledgments. We are indebted to Dr E.S. Loker for the use of the facilities in his laboratory. Special thanks to Lynn Hertel for the art work. We are grateful to the staff of the Biology Animal Resource Facility at UNM for their animal care, and the Biology Molecular Facility Laboratory at UNM for running sequence gels. This work was supported, in part, by grants from the UNM Of®ce of Graduate Studies, the UNM Graduate Students' Association, and the Biology Graduate Research Allocations Committee, and by a PEET grant (NSF, DEB-9521687) to DWD. References Borst, P., Overdulve, J.P., Weijers, P.J., Fase-Fowler, F., Van den Berg, M., 1984. DNA circles with cruciforms from Isospora (Toxoplasma) gondii. Biochim. Biophys. Acta 781, 100±11. Denny, P., Preiser, P., Williamson, D., Wilson, I., 1998. Evidence for a single origin of the 35 kb plastid DNA in apicomplexans. Protist 149, 51±59. De Vos, A.J., 1970. Studies on the host range of Eimeria chinchillae De Vos and Van der Westhuizen, 1968. Onderstepoort J. Vet. Res. 37, 29± 36. Duszynski, D.W., 1971. Increase in size of Eimeria separata oocysts during patency. J. Parasitol. 57, 948±52. Duszynski, D.W., Wilber, P.G., 1997. A guideline for the preparation of species descriptions in the Eimeriidae. J. Parasitol. 83, 333±6. Gardner, S.L., Duszynski, D.W., 1990. Polymorphism of eimerian oocysts can be a problem in naturally infected hosts: an example from subterranean rodents in Bolivia. J. Parasitol. 76, 805±11. Gardner, M.J., Williamson, D.H., Wilson, R.J.M., 1991. A circular DNA in malaria parasites encodes an RNA polymerase like that of prokaryotes and chloroplasts. Mol. Biochem. Parasitol. 44, 115±24. Gleeson, M.T., 2000. The plastid in Apicomplexa: what use is it? Int. J. Parasitol. 30, 1053±70. Gleeson, M.T., Johnson, A.M., 1999. Physical characterization of the plastid DNA in Neospora caninum. Int. J. Parasitol. 29, 1563±73. Hendrichs, L.D., 1977. Host range characteristics of the primate coccidian Isospora aratopitheci Rodhain, 1933 (Protozoa: Eimeriidae). J. Parasitol. 63, 32±35. Hillis, D.M., Huelsenbeck, J.P., 1992. Signal, noise, and reliability in molecular phylogenetic analyses. J. Heredity 83, 189±95. Hnida, J.A., Duszynski, D.W., 1999a. Cross-transmission studies with Eimeria arizonensis, E. arizonensis-like oocysts and Eimeria langebarteli: host speci®city at the genus and species level within the Muridae. J. Parasitol. 85, 873±7. Hnida, J.A., Duszynski, D.W., 1999b. Taxonomy and systematics of some
719
Eimeria species of murid rodents as determined by the ITS1 region of the ribosomal gene complex. Parasitol. 119, 349±57. Hnida, J.A., Duszynski, D.W., 1999c. Taxonomy and phylogeny of some Eimeria (Apicomplexa: Eimeriidae) species of rodents as determined by polymerase chain reaction/restriction-fragment-length polymorphism analysis of 18s rDNA. Parasitol. Res. 85, 887±94. Joyner, L.P., 1982. Host and site speci®city. In: Long, P.L. (Ed.), The biology of the coccidia, University Park Press, pp. 35±62. Kheysin, E.M., 1967. Zhiznennye tsikly koktsidii domashnikh zhivotnykh, Isdat Nauka, Leningrad (English translation by Plous Jr., F.K., edited by Todd Jr., K.S., 1971. Life cycles of coccidia of domestic animals. University Park Press, Baltimore). Kilejian, A., 1975. Circular mitochondrial DNA from the avian malaria parasite Plasmodium lophurae. Biochim. Biophys. Acta 390, 276±84. Lang-Unnasch, N., Reith, M.E., Munholland, J., Barta, J.R., 1998. Plastids are widespread and ancient in parasites of the phylum Apicomplexa. Int. J. Parasitol. 28, 1743±54. Long, P.L., Joyner, L.P., 1984. Problems in the identi®cation of species of Eimeria. J. Protozool. 31, 535±41. Page, R.D.M., 1996. TREEVIEW: An application to display phylogenetic trees on personal computers. Comput. Applic. Biosci. 12, 357±8. Parker, B.B., Duszynski, D.W., 1986. Polymorphism of eimerian oocysts: a dilemma posed by working with some naturally infected hosts. J. Parasitol. 72, 602±4. Reduker, D.W., Duszynski, D.W., Yates, T.L., 1987. Evolutionary relationships among Eimeria spp.(Apicomplexa) infecting cricetid rodents. Can. J. Zool. 65, 722±35. Swofford, D.T., 1999. PAUP*. Plylogenetic analysis using parsimony (*and other methods). Version 4b3, Sinauer Associates, Sunderland, MA. Todd Jr., K.S., Hammond, D.M., 1968a. Life cycle and host speci®city of Eimeria callospermophili Henry, 1932 from the Uinta ground squirrel Spermophilus armatus. J. Protozool. 15, 1±8. Todd Jr., K.S., Hammond, D.M., 1968b. Life cycle and host speci®city of Eimeria larimerensis Vetterling, 1964, from the Uinta ground squirrel, Spermophilus armatus. J. Protozool. 15, 268±75. Upton, S.L., Mcallister, C.T., Brillhart, D.B., Duszynski, D.W., Wash, C.W., 1992. Cross-transmission studies with Eimeria arizonensis-like oocysts (Apicomplexa) in New World rodents of the genera Baiomys, Neotoma, Onychomys, Peromyscus and Reithrodonmys Muridae. J. Parasitol. 78, 406±13. Wilber, P.G., Duszynski, D.W., Upton, S.J., Seville, R.S., Corliss, J.O., 1998. A revision of the taxonomy and nomenclature of the Eimeria spp. (Apicomplexa: Eimeriidae) from rodents in the Tribe Marmotini (Sciuridae). Syst. Parasitol. 39, 113±35. Wilson, R.J.M., Denny, P.W., Preiser, P.R., Rangachari, K., Roberts, K., Roy, A., Whyte, A., Strath, M., Moore, D.J., Moore, P.W., Williamson, D.H., 1996. Complete gene map of the plastid-like DNA of the Malaria parasite Plasmodium falciparum. J. Mol. Biol. 261, 155±72. Zhao, X., Duszynski, D.W., Lodier, E.S., 2001a. Phylogenetic position of Eimeria antrozoi, a bat coccidium (Apicomplexa: Eimeriidae) and its relationship to other morphologically similar Eimeria spp. from bats and rodents based on nuclear 185 and plastid 235 rDNA sequences. J. Parasitol. 78: In press. Zhao, X., Duszynski, D.W., Loker, E.S., 2001b. A simple method of DNA extraction for Eimeria species. J. Microbiol. Methods. 44, 131±7.