Phylogenetic relationships of Echinolaena and Ichnanthus within Panicoideae (Poaceae) reveal two new genera of tropical grasses

Accepted Manuscript Phylogenetic relationships of Echinolaena and Ichnanthus within Panicoideae (Poaceae) reveal two new genera of tropical grasses Christian da Silva, Cristiane Snak, Alessandra Selbach Schnadelbach, Cássio van den Berg, Reyjane Patrícia de Oliveira PII: DOI: Reference:

S1055-7903(15)00219-5 http://dx.doi.org/10.1016/j.ympev.2015.07.015 YMPEV 5250

To appear in:

Molecular Phylogenetics and Evolution

Received Date: Revised Date: Accepted Date:

23 April 2015 17 July 2015 21 July 2015

Please cite this article as: Silva, C.d., Snak, C., Schnadelbach, A.S., Berg, s.v.d., Oliveira, R.P.d., Phylogenetic relationships of Echinolaena and Ichnanthus within Panicoideae (Poaceae) reveal two new genera of tropical grasses, Molecular Phylogenetics and Evolution (2015), doi: http://dx.doi.org/10.1016/j.ympev.2015.07.015

This is a PDF file of an unedited manuscript that has been accepted for publication. As a service to our customers we are providing this early version of the manuscript. The manuscript will undergo copyediting, typesetting, and review of the resulting proof before it is published in its final form. Please note that during the production process errors may be discovered which could affect the content, and all legal disclaimers that apply to the journal pertain.

1

Phylogenetic relationships of Echinolaena and Ichnanthus within Panicoideae (Poaceae) reveal two new genera of tropical grasses

Christian da Silva a,*, Cristiane Snak a, Alessandra Selbach Schnadelbach b, Cássio van den Berg a, Reyjane Patrícia de Oliveira a

a

Universidade Estadual de Feira de Santana, Departamento de Ciências Biológicas,

Programa de Pós-graduação em Botânica, Av. Transnordestina s.n., Feira de Santana, Bahia 44036-900, Brazil b

Instituto de Biologia, Universidade Federal da Bahia, Av. Barão de Geremoabo s.n.,

Ondina, Salvador, Bahia 40150-170, Brazil

*

Corresponding author.

E-mail addresses: [email protected] (C. Silva), [email protected] (C. Snak), [email protected] (A.S. Schnadelbach), [email protected] (C. van den Berg), [email protected] (R.P. Oliveira)

2

ABSTRACT. Echinolaena and Ichnanthus are two tropical grass genera distributed mostly in the Americas, characterized by the presence of rachilla appendages in the shape of convex swellings, scars or wings at the base of the upper anthecium. However, recent studies have shown that rachilla appendages arose several times independently in several groups within Paniceae and Paspaleae (Panicoideae). Thus, this study aimed to assess the monophyly of Echinolaena and Ichnanthus and their relationship to other genera of Paniceae and Paspaleae, especially those including species with rachilla appendages. Parsimony and Bayesian analyses of the cpDNA regions ndhF, rpl16, trnH-(rps19)-psbA, trnL-trnF, trnS-(psbZ)-trnG, and the rDNA ITS region included 29 of the 39 known species of Echinolaena and Ichnanthus, 23 of which were sampled for the first time. The multiple loci analyses indicated that Echinolaena and Ichnanthus are polyphyletic in their current circumscriptions, with species in four distinct lineages within subtribe Paspalinae, each one characterized by a single type of rachilla appendage. Thus, Echinolaena and Ichnanthus are each circumscribed in a narrow sense, and the other two lineages excluded from them are proposed as the new genera Hildaea and Oedochloa, resulting in 15 new combinations and the restablishment of I. oplismenoides Munro ex Döll.

Key words: Molecular phylogeny; Paniceae; Paspaleae; rachilla appendages; taxonomy.

3

1. Introduction The genera Echinolaena Desv. and Ichnanthus P. Beauv. belong to the grass family (Poaceae), one of the five highly diverse angiosperm families comprising more than 11,000 species (GPWG II, 2012). They are both included within Paspaleae, one of the major tribes of the Panicoideae, and comprise plants mostly of the Americas, with the base chromosome number x = 10 as its potential synapomorphy (Morrone et al., 2012). Paspaleae is among the 13 tribes currently recognized for Panicoideae, the second largest subfamily in Poaceae with 220–250 genera and approximately 3300 species, part of the PACMAD clade which encompasses about half of the diversity of the family (Sánchez-Ken and Clark 2010; GPWG II, 2012; Morrone et al., 2012; Besnard et al., 2013). Echinolaena includes six species distributed in the American tropics and one species endemic to Madagascar: E. madagascariensis Baker (Stieber, 1987; Filgueiras, 1994). It is characterized by the inflorescences composed of one to several unilateral racemes, laterally compressed spikelets, lower glume equal or exceeding the rest of the spikelet, and the presence of wings, scars or convex swellings at the base of the upper lemma (Stieber, 1987). The Malagasy E. madagascariensis was transferred to Chasechloa A. Camus along with the proposition of C. egregia (Mez) A. Camus by Camus (1948). Thereafter, she added the species C. humbertiana A. Camus to the genus (Camus, 1954). According to Camus (1948), the Malagasy taxa are distinct from the American Echinolaena especially due to the inflorescence branches not articulated at the base, continuous with the main axis, and their stipitate upper anthecium. However, Clayton and Renvoize (1986) and Soreng et al. (2015) considered it as a synonym of Echinolaena despite the lack of molecular evidence.

4

Ichnanthus includes 32 species confined to the Neotropics, distributed from Mexico and West Indies to northern Argentina, and one Pantropical species, namely I. pallens (Sw.) Munro ex Benth. (Stieber, 1982, 1987; Boechat, 2005; Mota and Oliveira, 2012; Silva et al., 2013). Its center of diversity is Brazil where 28 species are found (Silva et al., 2015). It is characterized by the paniculate inflorescences, laterally compressed spikelets, and the presence of wings, scars or convex swellings at the base of the upper lemma, just like those of Echinolaena (Stieber, 1982, 1987). According to the infrageneric classification proposed by Pilger (1940) based on the groups of Döll’s (1877) treatment, the species provided with wings are placed in section Ichnanthus and the ones with scars or convex swellings are placed in section Foveolatus Pilg. These appendages at the base of the upper lemma shared by Echinolaena and Ichnanthus also occur in other panicoid genera as in the Australian Arthragrostis Lazarides and Yakirra Lazarides & R.D. Webster, the Malagasy Lecomtella A. Camus, the American Dichanthelium (Hitchc. & Chase) Gould, Ocellochloa Zuloaga & Morrone and Renvoizea Zuloaga & Morrone, the Pantropical Paspalum L., and in the species of Panicum sect. Rudgeana (Hitchc.) Zuloaga. However, the appendages are represented only by a stipe in most of these genera, except in Lecomtella and Yakirra which have a winged stipe (Morrone et al., 2012). Another genus that supposedly has appendages is Ottochloa Dandy. This is due to Ichnanthus oblongus Hughes, a species currently synonymized to Ottochloa nodosa (Kunth) Dandy (Lazarides, 1961), which was described by Hughes (1923) in Ichnanthus because of the presence of small appendages (0.3 mm) at the base of the upper anthecium. The function of the rachilla appendages is apparently related to fruit (caryopsis) dispersal. Berg (1985) showed the presence of fatty oils in the

5

appendages of Yakirra australiensis (Domin) Lazarides & R.D. Webster, strongly suggesting that they represent an elaiosome and linking it to fruit dispersal by ants (myrmecochory). Davidse (1987) also found oils in the appendages of some panicoid genera, including Panicum cervicatum Chase (P. sect. Rudgeana), Echinolaena gracilis Swallen and E. inflexa (Poir.) Chase, and several species of Ichnanthus from both sections, also defining them as elaiosomes. According to Morrone et al. (2012), a stipitate upper anthecium arose several times independently within Paniceae and Paspaleae. Indeed, molecular phylogenetic studies have shown that some of these taxa are not directly related to each other (e.g., Aliscioni et al., 2003; GPWG II, 2012; Morrone et al., 2012). The majority of the molecular phylogenetic studies done so far which included members of Echinolaena and Ichnanthus only sampled a few representatives, most of them comprising only E. inflexa and I. pallens (Duvall et al., 2001; Giussani et al., 2001; Aliscioni et al., 2003; Kellogg et al., 2004; Zuloaga et al., 2006, 2007, 2010, 2014; Morrone et al., 2007, 2012; Sede et al., 2008, 2009b; Christin et al. 2009a, 2009b; Ibrahim et al., 2009; Besnard et al., 2013 [for phyB]; Scataglini and Zuloaga 2013; Bouchenak-Khelladi et al., 2014; Lizarazu et al., 2014; Scataglini et al., 2014a, 2014b). A few other studies sampled more than one species of Ichnanthus (Christin et al., 2007, 2008, 2013; GPWG II, 2012; Salariato et al., 2012) and/or Echinolaena (Sede et al., 2009a), providing evidence that these genera are polyphyletic, despite the low sampling within them. Furthermore, given that Echinolaena and Ichnanthus comprise species with three different kinds of appendages, the hypothesis of nonmonophyly is strengthened by the fact that the rachilla appendages arose several times independently within the Paniceae and Paspaleae (Morrone et al., 2012).

6

Thus, the present study aimed to assess the monophyly of Echinolaena and Ichnanthus and their relationship to other genera of Panicoideae, especially those including species provided with rachilla appendages. In order to accomplish these goals, DNA sequence data from five plastid regions (ndhF, rpl16, trnH-(rps19)-psbA, trnL-trnF, and trnS-(psbZ)-trnG) and one nuclear region (ITS) were used to unravel the phylogenetic relationships. Two approaches were used to analyze the molecular data: one analysis using the newly generated sequences for all six regions, aiming to evaluate the monophyly of Echinolaena and Ichnanthus; and one analysis based on the ndhF gene using our data set and the sequences available in GenBank, including all panicoid tribes with a focus on Paniceae and Paspaleae, aiming to verify their relationship to other panicoid genera.

2. Materials and methods 2.1. Taxon sampling For the first approach including all six regions, as many species of Echinolaena and Ichnanthus as possible were sampled (5/7, and 24/32). Several other panicoid genera with appendages at the base of the upper anthecium were sampled: Ocellochloa (1/12), Ottochloa (1/3), Panicum sect. Rudgeana (1/5), Renvoizea (1/10), and Yakirra (5/7). These taxa were included in the ingroup along with other representatives from tribes Andropogoneae, Gynerieae, Paniceae and Paspaleae, comprising a total of 49 species and two varieties. It was not possible to obtain samples of Chasechloa. Orthoclada laxa (Rich.) P. Beauv. from tribe Zeugiteae was chosen as the outgroup based on previous results (Morrone et al., 2012). In total, 360 new sequences were generated and submitted to GenBank for

7

this study. Plant material and voucher information for this analysis are given in Table 1. For the second approach using the ndhF gene in a comprehensive data set (here designated as ‘ndhF extended’), the sequences generated in this study were used along with sequences downloaded from GenBank. Representatives from all tribes of Panicoideae (Andropogoneae, Arundinelleae, Centotheceae, Chasmanthieae, Cyperochloeae, Gynerieae, Lecomtelleae, Paniceae, Paspaleae, Steyermarkochloeae, Thysanolaeneae, Tristachyideae and Zeugiteae) were chosen for this analysis, with a broader sampling within Paniceae and Paspaleae, comprising 484 species and two varieties. A total of 66 of the 83 genera of Paniceae and about 33 of the 40 genera of Paspaleae were sampled. Compared to the first approach, the sampling within Echinolaena was increased with the inclusion of E. standleyi (Hitchc.) Stieber but remained the same within Ichnanthus. The sampling among the other panicoid genera with appendages at the base of the upper anthecium was also increased: Dichanthelium (9/120), Lecomtella (1/1), Ocellochloa (8/12), Ottochloa (2/3), Panicum sect. Rudgeana (2/5), Paspalum (22/350), and Renvoizea (7/10). The sampling within Yakirra remained the same and no sequences were available for Chasechloa and Arthragrostis. All panicoids were included in the ingroup and 18 representatives from subfamilies Arundinoideae, Chloridoideae, Danthonioideae and Micrairoideae were selected as outgroups based on previous studies (GPWG II, 2012; Morrone et al., 2012). The GenBank accessions of the sequences used in this analysis are given in Appendix A.

2.2. DNA extraction, amplification, and sequencing

8

All procedures were performed in the Laboratory of Plant Molecular Systematics at the Universidade Estadual de Feira de Santana, Bahia, Brazil. DNA was extracted mostly from silica gel-dried leaves using a modified version of the 2X CTAB procedure of Doyle and Doyle (1987). For herbarium samples the DNA was extracted using the DNeasy Plant Mini Kit (QIAGEN GmbH, Hilden, Germany). PCR reactions were performed using the TopTaq Master Mix Kit (QIAGEN GmbH, Hilden, Germany) following the manufacturer’s protocol with an adjustment for a final volume of 10 µL. For ITS only, the PCR reaction setup also included 0.2 µL of BSA 0.3% (bovine serum albumin), 2 µL of betaine 5 M, and 0.2 µL of DMSO 99.5% (dimethyl sulfoxide). We selected five chloroplast DNA regions from the large single copy (LSC), the small single copy (SSC) and the inverted repeat B (IR-B) regions of the genome: ndhF (coding region, SSC), rpl16 (coding region, intron, LSC), trnH-psbA (coding region, spacer, IR-B/LSC junction), encompassing the rps19 gene (Hiratsuka et al., 1989; Chang et al., 2006), trnL-trnF (coding region, intron, spacer, LSC) and trnS-trnG (coding region, spacer, LSC), encompassing the psbZ gene (e.g., see Fig. S1 in Besnard et al., 2013); and one nuclear DNA region: ITS (18S, 5.8S and 26S ribosomal RNA genes, and internal transcribed spacers 1 and 2). Primers used for amplification and sequencing, and PCR conditions are shown in Table 2. PCR products were cleaned using PEG 20% (polyethylene glycol; Paithankar and Prasad, 1991) and then sequenced in both directions using the Big Dye Terminator v3.1 Cycle Sequencing Kit (Applied Biosystems, Austin, Texas, USA) according to the following protocol: a hot start with 3 min of initial denaturation at 96°C, 30 cycles of 96°C denaturation for 20 s, 50°C annealing for 15 s, and 60°C extension for 4 min. Sequenced products were cleaned using isopropanol 80% and

9

ethanol 70%, and analyzed on a 3130xl Genetic Analyzer (Applied Biosystems/HITACHI, Tokyo, Japan).

2.3. Phylogenetic analyses Electropherograms were edited and assembled using the Staden Package v.1.7.0 (Staden et al., 2003). The resulting sequences were first aligned using MUSCLE (Edgar, 2004) at the EMBL-EBI website (http://www.ebi.ac.uk/Tools/msa/muscle/), and then checked and adjusted manually using BioEdit v.7.1.3.0 (Hall, 1999) and Geneious Pro v.4.8.4 (Kearse et al., 2012). The alignments for each data set are available upon request to the first author. Gaps were considered as missing data. Regions with ambiguous alignment were excluded from the analyses, corresponding to the following positions in the combined matrix (plastids + ITS): 952–958, 1190–1208, 1634–1640, 2008–2020 (trnL-trnF; 3.7% sites of the original matrix); 2338–2342, 2388–2400, 2785–2793 (trnS-(psbZ)-trnG; 2.6%); 3468–3472, 3503–3525, 3963–3976, 4155–4165 (rpl16; 3.8%); 6865–6870, 7201– 7208 (trnH-(rps19)-psbA; 2.1%). No data was excluded from ndhF and ITS, however, the positions 1–69, 1981–1992, and 2185–2313 were excluded from the ndhF extended data set (9.1% sites of the original matrix), corresponding to the ends of the matrix and one ambiguous region. Data was analyzed using Maximum parsimony (MP) and Bayesian inference (BI). Each region was analyzed individually and in combination in two data sets: all plastid data, and all data (except excluded bases). The ndhF extended data set was analyzed separately. The MP analyses were performed using PAUP* v.4.0b10 (Swofford, 2002) with Fitch parsimony as the optimality criterion (equal weights, unordered characters; Fitch, 1971). Heuristic searches were performed with 1000 random taxa-addition

10

replicates using tree bisection and reconnection (TBR) branch-swapping, limiting the number of trees saved per replicate to 15 to avoid extensive swapping on large islands of trees. The resulting trees were used as starting trees for TBR swapping with an upper limit of 10,000 trees. Internal support was evaluated using nonparametric bootstrapping (Felsenstein, 1985) with 2000 replicates, as indicated by Hedges (1992) and Müller (2005), simple taxon-addition and TBR algorithm, saving 15 trees per replicate. Bootstrap percentages (BP) of 50–70 were considered as weak, 71–85 as moderate, and > 85 as strong (Kress et al., 2002). Model-based analyses were performed with BI using MrBayes v.3.2.3 (Ronquist and Huelsenbeck, 2003) in the Cyberinfrastructure for Phylogenetic Research (CIPRES) Portal v.2.0 (Miller et al., 2010). The best-fitting nucleotide substitution models selected by the Akaike information criterion (AIC) in MrModeltest v.2.3 (Nylander, 2004) for coding and noncoding genes, exons and introns, and spacers are shown in Table 3. Two parallel simultaneous runs using the Metropoliscoupled MCMC (Markov Chain Monte Carlo) algorithm (MC3) with four randominitiated chains (one ‘cold’ and three ‘heated’; Huelsenbeck et al., 2001) were run for 10,000,000 generations, sampling trees every 1000 generations. The convergence of the runs was assessed by checking if the standard deviation of split frequencies reached a value below 0.01. Likelihoods of the trees produced by each run were analyzed graphically using Tracer v.1.5 (Rambaut and Drummond, 2009) and, after discarding the initial 2500 trees of each run as burn-in, the remaining trees were summarized in a majority-rule consensus including the posterior probabilities as branch support estimates. Due to the conservatism of the bootstrap percentages in relation to the posterior probabilities, only values ≥ 95 PP are considered as strongly supported (Erixon et al., 2003). Arundo donax L. was chosen as the outgroup for the

11

analysis of the ndhF extended data set because only one taxon may be assigned to the outgroup in MrBayes v.3.2.3. The trees were edited using FigTree v.1.3.1 (Rambaut, 2009) and CorelDRAW X3 (Corel Corporation). Combinability of the individual matrices was assessed by comparing incongruent clades with high bootstrap support (Wiens, 1998). Due to the unexpected placement of Ichnanthus adpressus C. Silva & R.P. Oliveira, I. lancifolius Mez, and I. leptophyllus Döll in our analyses, we performed the ShimodairaHasegawa test (SH test; Shimodaira and Hasegawa, 1999) to test our expected (alternative) hypothesis that these species are related to the other species of Ichnanthus with wings at the base of the upper anthecium (clade D). For this, we first generated unconstrained maximized likelihood estimate (MLE) trees for the combined plastid data set and the ITS data set under the model GTR + I + Γ using RAxML v.8.1.20 (Stamatakis, 2006). Thereafter, constraint MLE trees were generated for the following alternative hypothesis for both data sets: I. adpressus + I. lancifolius + I. leptophyllus + clade D (constraint 1). In addition, as the combined plastid data set recovered I. lancifolius + I. leptophyllus as sister to clade A (constraint 2), we tested this hypothesis based on the ITS data set. The tests between unconstrained and constrained MLE topologies were performed in PAUP* v.4.0b10 (Swofford, 2002) using RELL and 1,000 bootstrap replicates. Significant difference was determined by a significance value of p = 0.01. The evolution of the rachilla appendages within Panicoideae was evaluated by reconstruction of ancestral character states. The reconstruction was performed in Mesquite v.2.74 (Maddison and Maddison, 2010) using the likelihood method under the Mk1 model (Pagel, 1999). The rachilla appendages were treated as a discrete character with seven states [absent (0), heterogeneous stipe (1), swollen stipe with

12

two acute lobes (2), short stipe (3), short scars (4), convex swellings (5), long scars (6), wings (7)]. We used a Bayesian tree from the analysis of the combined data set without Ichnanthus adpressus, I. lancifolius, and I. leptophyllus to avoid that their unexpected placement could have affected the reconstruction. For the tree from the analysis of the ndhF extended data set, we only indicated the panicoid taxa with rachilla appendages without performing the reconstruction of ancestral character states.

2.4. Morphological data The identification key and the comments about morphology are based on field observations, data from the literature, and study of herbarium specimens (AAU, ALCB, BHCB, BR, CANB, CEN, CEPEC, CESJ, CVRD, EAC, F, GH, GUA, HUEFS, IAN, K, MBM, MBML, MO, NY, P, RB, RBR, SP, TAN, UB and US; herbaria acronyms according to Thiers, 2015). Descriptions of the genera follow those of Clayton and Renvoize (1986) with some modifications. Images of the upper anthecium were taken under the stereomicroscope ZEISS Stemi SV6 (Carl Zeiss Vision GmbH, München-Hallbergmoos, Germany) in the Laboratory of Plant Taxonomy at the Universidade Estadual de Feira de Santana, Bahia, Brazil. Data about protologues and type specimens are in accordance with the Catalogue of the New World Grasses (Zuloaga et al., 2003).

3. Results General features of the DNA data sets used in this study are shown in Table 3 (except for the ndhF extended data set). Plastid trnH-(rps19)-psbA had the highest sequencing success with 100% of the taxa recovered in the data set, followed by

13

ITS with 97.1%, trnL-trnF with 91.2%, ndhF with 89.7%, trnS-(psbZ)-trnG with 78%, and rpl16 with 73.5%. The low sequencing success rates for trnS-(psbZ)-trnG and rpl16 may be explained by their extended length and the use of only one pair of primers for amplification and sequencing. So, we recommend the use of internal primers for these regions. The length of the sequences obtained varied from 642–655 bp (base pairs) for trnH-(rps19)-psbA, 785–827 bp for ITS, 856–1002 bp for trnL-trnF, 904–989 bp for trnS-(psbZ)-trnG, 990–1210 bp for rpl16, and 2130–2154 bp for ndhF. We failed to amplify one part of the ndhF gene (primers 1660F/2110R) for the sequences of Ichnanthus aff. bambusiflorus (Trin.) Döll BA, I. bambusiflorus MG, I. breviscrobs Döll, Ottochloa nodosa 2, Yakirra australiensis var. australiensis (Domin) Lazarides & R.D. Webster, Y. majuscula (F. Muell. ex Benth.) Lazarides & R.D. Webster, Y. muelleri (Hughes) Lazarides & R.D. Webster, and Y. pauciflora (R. Br.) Lazarides & R.D. Webster 1, 2, 3 and 4. ITS was the most variable data set with 33.3% potentially informative sites (PIS), more than three times as variable as ndhF, which was most variable plastid data set with 9.82% PIS. The least variable data set was trnH-(rps19)-psbA with only 4.52% PIS. Consistency index (CI) was similar among plastid data sets, ranging from 0.7 (rpl16) to 0.77 (trnH-(rps19)-psbA and trnS-(psbZ)-trnG), just as the retention index (RI), ranging from 0.78 (rpl16) to 0.87 (trnS-(psbZ)-trnG). ITS had the lowest CI (0.37) and RI (0.68).

3.1. Combined and individual parsimony analyses No major strongly supported incongruences were observed in the individual analyses. The only incongruencies detected were related to the position of a few

14

taxa at the species level between the combined plastid data and ITS, however, they do not affect any conclusions of this study. So, the combined analysis of all data was performed and the incongruencies are discussed below. The combined analysis produced 36 trees with L (length) = 3395 steps, CI = 0.56, and RI = 0.76. Because MP strict consensus and BI consensus were fully congruent, showing the same strongly supported clades, we chose to show the Bayesian tree in Fig. 1 with the bootstrap percentages indicated below the branches (only values > 50%). The strict consensus is almost fully resolved. At the tribal level, Paspaleae (100 BP) was recovered as the sister group of Andropogoneae with 95 BP, followed successively by Paniceae (100 BP), Gynerieae (100 BP), and the outgroup Zeugiteae. Within Paniceae, subtribes Panicinae (100 BP) and Melinidinae were recovered in clade with 100 BP sister to Boivinellinae (58 BP) with 100 BP. Within Paspaleae, subtribes Arthropogoninae and Otachyriinae were recovered in a clade with 87 BP sister to Paspalinae (97 BP) with 100 BP. Members of Echinolaena and Ichnanthus were recovered in four distinct clades, named from A to D. Clade A (99 BP) includes part of Ichnanthus sect. Foveolatus, clade B (100 BP) includes part of Echinolaena and part of I. sect. Foveolatus, clade C (100 BP) includes part of Echinolaena, and clade D (100 BP) includes part of Echinolaena and part of I. sect. Ichnanthus and sect. Foveolatus. Ichnanthus lancifolius and I. leptophyllus grouped together in a clade (100 BP) sister to clade A with 100 BP, and I. adpressus was recovered as sister to clade B with < 50 BP. These species were not included in any of the clades from A to D and their phylogenetic placement and taxonomic position are discussed below.

3.2. Bayesian analyses

15

Similar to the MP analyses, the data sets were analyzed separately and no strongly supported incongruences were observed. A combined analysis was carried out and the tree resulting from the majority-rule consensus of 15,000 trees produced by the two runs of MCMC under mixed models is presented in Fig. 1. All relationships of the combined Bayesian tree were the same as those obtained by MP, however, some clades attained higher support, namely Boivinellinae (100 PP), Andropogoneae + Paspaleae (100 PP), Arthropogoninae + Otachyriinae (100 PP), Paspalinae (100 PP), and clade A (100 PP). Trees resulting from the individual analyses are available in Appendices B.1–B.6 and the combined plastid tree is available in Appendix B.7.

3.3. ndhF extended analyses (MP and BI) The MP analysis produced 10,000 trees (maximum limit in the search) with L = 4839 steps, CI = 0.35, and RI = 0.84. As in the combined analyses, the MP strict consensus and the BI consensus were fully congruent and thus only the Bayesian tree is shown in Figs. 2 and 3. In order to reduce the size of the tree for display, the nodes were collapsed at the generic level. The full tree is available in Appendix B.8. For BI analysis, the model selected by AIC for all codon positions was GTR + I + G. The tree resulting from the majority-rule consensus of 15,000 trees produced by the two runs of MCMC under the selected model is presented in Figs. 2 and 3. Compared to the MP strict consensus, the reduced outgroup did not affect the ingroup relationships. Subfamily Panicoideae was recovered as monophyletic with 100 PP/84 BP. Its internal relationships were poorly resolved or attained low support, however, the individual support of each tribe was mostly high, except for Centotheceae (73 PP/ 53 BP). There was a lack of resolution between Arundinelleae and Andropogoneae but they were recovered in a clade with 100 PP/ 100 BP, sister

16

to Lecomtelleae with 80 PP/-. Paspaleae and Paniceae were highly supported but the relationships among their subtribes were poorly resolved. Clades A to D were recovered within Paspalinae as in the combined analyses. Ichnanthus lancifolius, I. leptophyllus and clade A were recovered in a clade with 100 PP/ 75 BP; clade B (100 PP/ 100 BP) appeared as sister to Panicum venezuelae Hack. with 59 PP/ 57 BP, followed successively by I. adpressus with 64 PP/ 61 BP; and clade C (100 PP/ 100 BP) was sister to Ocellochloa with 100 PP/ 92 BP, followed successively by clade D (100 PP/ 99 BP) with 96 PP/ 55 BP.

3.4. Alternative hypothesis testing (SH test) The hypothesis that Ichnanthus adpressus, I. lancifolius, and I. leptophyllus are related to clade D was rejected by the combined plastid data set (constraint 1: p = 0.000), however, the ITS data set did not reject it (constraint 1: p = 0.326). The sister group relationship of I. lancifolius + I. leptophyllus and clade A was not rejected by the ITS data set (constraint 2: p = 0.095).

4. Discussion 4.1. Molecular evolution The high level of variation of the ITS compared to the plastid regions is mainly due to the spacers ITS1 and ITS2, which had more than half of their length composed of parsimony informative sites (Table 3). This level of variation of the ITS is higher than those found in other groups of Poaceae such as Bambusoideae (15.8% PIS; Yang et al., 2008; 25.3% PIS; Oliveira et al., 2014), Chloridoideae (26% PIS; Siqueiros-Delgado et al., 2013), or even Panicoideae (29.6% PIS; López and Morrone, 2012). However, higher values were found in other groups such as

17

Aristidoideae, Arundinoideae, Chloridoideae, Danthonioideae, Micrairoideae, and Panicoideae [Arundinoideae sensu lato] (42% PIS; Hsiao et al., 1998), and Pooideae (37.4% PIS; Hsiao et al., 1995; 45.5% PIS; Quintanar et al., 2007). Despite the high variation, the raw performance of the ITS (measured by CI and RI) was worse than the plastid data sets (Table 3). This may be explained by the number of changes per site which is two to three times higher than the other regions, being just a natural consequence of different levels of variation among regions as argued by van den Berg et al. (2005). The levels of variation were similar among plastid regions, except for trnH-(rps19)-psbA (less variable), and their performance were also similar to each other (Table 3). However, it is worth pointing out that the ndhF gene and the rpl16 region (almost entirely composed of the rpl16 intron) were the most variable among plastid data sets. The ndhF gene has been widely used in phylogenetic studies within Panicoideae (e.g., Giussani et al., 2001; Aliscioni et al., 2003; Sánchez-Ken and Clark 2010; Morrone et al., 2012), as well as the rpl16 region (e.g., Donadío et al., 2009; Giussani et al., 2009; Salariato et al., 2010; Scataglini et al., 2014a), proving to be very useful for phylogenetic reconstruction within the subfamily. The transition/transversion ratio (ts : tv) was high for coding regions and low for noncoding regions as expected (Table 3), because transitions are less likely to result in amino acid substitutions.

4.2. Relationships within Panicoideae The major clades recovered in these analyses are in agreement with previous results reported by Giussani et al. (2001), Sánchez-Ken and Clark (2010), Morrone et al. (2012), GPWG II (2012), and Besnard et al. (2013). Although this study is focused on the relationships among Echinolaena, Ichnanthus, and related genera with rachilla

18

appendages, it is worth mentioning some strongly supported relationships in Panicoideae such as Steyermarkochloeae (represented by Steyermarkochloa Davidse & R.P. Ellis) as sister to Zeugiteae (Fig. 2); Lecomtelleae nested with Andropogoneae, Arundinelleae, Paspaleae, and Paniceae (Fig. 2); Poecilostachys Hack. nested within Boivinellinae (Fig. 3); and, Homopholis C.E. Hubb. + Walwhalleya Wills & J.J. Bruhl (named as clade C by Morrone et al., 2012) as sister to the clade composed of Cenchrinae, Melinidinae, and Panicinae (Fig. 3). Despite the weak support, the position of Dichantheliinae as sister to the remaining groups of Paniceae (GPWG II, 2012) is corroborated here (Fig. 3). The placement of Hylebates Chippin. is still unclear, however, it was placed as sister to Anthephorinae (Fig. 3) with higher support than as sister to Neurachninae, as recovered by GPWG II (2012).

4.3. Polyphyly of Echinolaena and Ichnanthus The increased sampling within Echinolaena and Ichnanthus allied with analysis of multiple markers allowed us to confirm their polyphyly, previously reported based on a low sample size (Christin et al., 2007, 2008, 2013; Sede et al., 2009a; GPWG II, 2012; Salariato et al., 2012). Following the statement of Morrone et al. (2012) about the independent origin of the rachilla appendages in the upper anthecium within Paniceae and Paspaleae, corroborated in this study (see optimization in Fig. 4), it was already expected that each group of species distinguished by a type of appendix (wings, scars or convex swellings) would be recovered in a different monophyletic group (Figs. 1 and 2). The sections of Ichnanthus (Pilger, 1940) do not correspond to monophyletic groups because they were recovered in three distinct clades (A, B, and D; Figs. 1 and 2), two of them composed of species from both sections (B and D; Figs. 1 and 2). Despite the lack of

19

an infrageneric classification for Echinolaena, its species were also recovered in distinct clades (B–D; Figs. 1 and 2) confirming that, like Ichnanthus, its current circumscription is highly artificial.

4.3.1. Clade A Clade A includes the species of Ichnanthus provided with short scars at the base of the upper anthecium, which is its synapomorphy (Figs. 4 and 5A1–A7). These species, namely I. breviscrobs, I. pallens (var. pallens and var. major (Nees) Stieber), I. ruprechtii Döll, and I. tenuis (J. Presl & C. Presl) Hitchc. & Chase., along with the unsampled I. nemorosus (Sw.) Döll are decumbent, stoloniferous to scandent plants with broad and membranaceous to coriaceous leaves, which occur at the edges of or inside forests. Ichnanthus breviscrobs is a bamboo-like easily recognizable species, however, the remaining four species correspond to a species complex resulting from the synonymization of several taxa into only four species and two varieties. Gerritea pseusopetiolata Zuloaga, Morrone & T. Killeen was recovered as sister to this clade (Appendix B.8), as well as in previous studies including only Ichnanthus pallens (e.g., GPWG II, 2012; Morrone et al., 2012). However, despite the high support obtained in the analysis conducted by GPWG II (2012) including the plastid ndhF, rbcL and trnK/matK, and three accessions (100 PP/ 96 BP), the support obtained here in the analysis of the ndhF extended data set including a broader sampling within this clade was very low (62 PP/-; Appendix B.8). Gerritea is a monotypic genus characterized by a caespitose habit, a prominent pseudopetiole up to 2 cm long, inflorescences paniculate and lax, spikelets long-pilose (trichomes up to 7 mm long), and an upper anthecium without rachilla appendages at its base

20

(Zuloaga et al., 1993). The species of clade A differ from Gerritea by their habit, pseudopetiole absent or less than 0.5 mm long, spikelets glabrous or shortly pilose (trichomes not surpassing the spikelet), and an upper anthecium with short scars at its base (Fig. 5A1–A7). In this clade, one of the two incongruences between the ITS tree (Appendix B.6) and the combined plastid tree (Appendix B.7) was found. It involves the relationships among I. pallens var. pallens, I. pallens var. major, Ichnanthus sp. PA, and I. tenuis. These incongruences will be further explored in a study that is already being carried out by the first author aiming to understand species delimitation in the species complex composed of I. nemorosus, I. pallens, I. ruprechtii, and I. tenuis.

4.3.2. Clade B Clade B includes the species of Echinolaena and Ichnanthus provided with convex swellings at the base of the upper anthecium, which is its synapomorphy (Figs. 4 and 5B1–B11). These species, namely Echinolaena minarum (Nees) Pilger, E. standleyi, Ichnanthus grandifolius (Döll) Zuloaga & Soderstr., I. camporum Swallen, I. cordatus Ekman, and I. procurrens (Nees ex. Trin.) Swallen, along with the unsampled E. ecuadoriana Filg., I. lanceolatus Scribn. & J.G. Sm., and I. mayarensis (C. Wright) Hitchc. are caespitose, creeping or scandent plants with broad and membranaceous to chartaceous leaves, most of them bearing short to long pseudopetioles, which occur at the edge or inside forests, along riverbanks, or in open field areas. In this clade, we found the second incongruence between the ITS tree (Appendix B.6) and the combined plastid tree (Appendix B.7), about the phylogenetic placement of E. minarum and I. grandifolius. In the ITS tree (Appendix B.6), I.

21

grandifolius is sister to the clade composed of I. camporum + I. cordatus + I. procurrens, whereas in the combined plastid tree (Appendix B.7), E. minarum is sister to this clade. Moreover, even sampling one more species of Echinolaena, the relationships among the basal lineages were unclear in the ndhF extended tree (Appendix B.8). The species of Echinolaena and Ichnanthus with convex swellings at the base of the upper anthecium differ in the type of inflorescence, which is a racemose inflorescence composed of 3–7 unilateral racemes in the former, and a paniculate inflorescence in the latter. However, despite the overall distinction in their inflorescences, they have the same general pattern, both having the proximal primary branch longer than the others, which become shorter towards the apex of the inflorescence, which ends in a single spikelet. So, the inflorescence is a nontruncated paniculodium in both of them, but it is fully homogenized in Echinolaena and partially homogenized in Ichnanthus (for definition of terms see Reinheimer and Vegetti, 2008). Furthermore, in these species of Echinolaena the spikelets have the lower glume equaling or exceeding their length whereas in these species of Ichnanthus the lower glume has 1/2–3/4 the length of the spikelet. Considering these aspects, the species of Echinolaena and Ichnanthus may represent distinct lineages within this clade, which could be assigned to a generic or infrageneric rank. A new study including the unsampled taxa is already being carried out in order to test this hypothesis. Panicum venezuelae was recovered as sister to this clade (Appendix B.8), corroborating the results of Sede et al. (2009a), however, the support obtained here was weak. Sede et al. (2009a) sampled only Echinolaena minarum and E. standleyi (among the species with convex swellings) and stated that there were no obvious

22

morphological synapomorphies shared between P. venezuelae and those species of Echinolaena, so they excluded the species from Panicum sect. Stolonifera (Hitchc. & Chase) Pilg. and left it as incertae sedis. The rachilla appendage in P. venezuelae is represented only by a short stipe (Zuloaga and Sendulsky, 1988). Moreover, its spikelets are dorsally compressed, contrasting to the laterally compressed spikelets of the members of this clade. So, although the phylogenetic placement of P. venezuelae is still unclear, here we confirm that this clade should not be expanded to include this species.

4.3.3. Clade C Clade C includes the species of Echinolaena provided with long scars at the base of the upper anthecium, which is its synapomorphy (Figs. 4 and 5C1–C3). These species, namely E. gracilis Swallen and E. inflexa (the type species of Echinolaena) are caespitose, decumbent to scandent plants with narrow and coriaceous leaves, which occur in open field areas. They are also characterized by the inflorescences composed of a single unilateral raceme which has the main axis ending in a sterile prolongation (truncated fully homogenized paniculodium; Reinheimer and Vegetti, 2008). There is no other species currently described in Echinolaena which have these features, however, E. inflexa encompasses a large morphological variation that may hide other species that should be segregated from it. The sister group of this clade is Ocellochloa (Fig. 1; Appendix B.8), in agreement with previous studies (e.g., Sede et al., 2009a; GPWG II, 2012; Morrone et al., 2012). It is characterized by membranaceous to chartaceous broad leaves with a short pseudopetiole, paniculate inflorescences, lax or composed of few to

23

numerous (always more than one) unilateral racemes (non-truncated nonhomogenized to fully homogenized paniculodium; Reinheimer and Vegetti, 2008), lower glume 1/4–3/4 the length of the spikelet, crateriform glands often present on lower lemma, and an upper anthecium with appendages represented by a short stipe at its base (Sede et al., 2009a). Members of Echinolaena of this clade differs from Ocellochloa by their leaves (without pseudopetiole), inflorescences, lower glume equal or exceeding the length of the spikelet, lower lemma without crateriform glands, and an upper anthecium with long scars at its base. Despite the similarity between the rachilla appendages of the members of this clade and those from clade A, they are only analogous because these clades are distinct lineages. Although there are no studies about the ontogeny of these structures, there is a difference in their morphology. The scars of the members of clade A are short, usually 1/4–1/3 the length of the upper lemma (Fig. 5A1–A7), whereas the scars of the members of this clade are long, with 1/2–2/3 the length of the upper lemma (Fig. 5C1–C3). Thus, in this study these structures were designated as short scars (clade A) and long scars (clade C). An ontogenetic study involving the members of these clades is already being carried out (L.A. Jesus Junior, Universidade Estadual de Feira de Santana, unpublished data).

4.3.4. Clade D Clade D includes the species of Echinolaena and Ichnanthus provided with wings at the base of the upper anthecium, which is its synapomorphy (Figs. 4 and 5D1–D24). These species, namely E. oplismenoides (Munro ex Döll) Stieber, I. bambusiflorus, I. calvescens (Trin.) Döll, I. dasycoleus Tutin, I. glaber (Raddi) Hitchc., I. hirtus (Raddi) Chase, I. inconstans (Trin. ex Nees) Döll, I. leiocarpus (Spreng.)

24

Kunth, I. longiglumis Mez, I. mollis Ekman, I. nemoralis (Schrad.) Hitchc. & Chase, I. panicoides P. Beauv. (the type species of Ichnanthus), I. riedelii (Trin.) Döll, I. zehntneri Mez, along with the unsampled I. ephemeroblepharis G.A. Black & Fróes, I. hoffmannseggii (Roem. & Schult.) Döll, I. longhi-wagnerae A.C. Mota & R.P. Oliveira, I. mexicanus E. Fourn., and I. tarumanensis G.A. Black & Fróes are cespitose, decumbent or scandent plants with narrow to broad and membranaceous to coriaceous leaves which occur at the edge or inside forests, or in open field areas. They are also characterized by the paniculate inflorescence, which may be open and lax to contracted (non-truncated non-homogenized to partially homogenized paniculodium; Reinheimer and Vegetti, 2008). Echinolaena oplismenoides was recovered within this clade. This species was transferred to Ichnanthus by Stieber (1987) due to its racemose inflorescence. However, besides possessing conspicuous wings at the base of the upper anthecium (Fig. 5D19, D20), its inflorescence is not ‘racemose’ (i.e., a unilateral raceme/ fully homogenized) because it bears branches of second and third order. It only resembles a racemose inflorescence because the secondary and tertiary branches are very short. Ichnanthus bambusiflorus was treated by Stieber (1987) as possessing scars at the base of the upper anthecium and placed in I. sect. Foveolatus. Indeed, the appendages in the upper anthecium are not scars but short wings (Fig. 5D2, D3). These wings are easier to see in the lateral view when the anthecium is fertile (carrying a caryopsis; Fig. 5D3) or hydrated. The placement of I. bambusiflorus among the species with wings at the base of the upper anthecium is in agreement with Döll’s (1877) treatment.

25

The clade composed of Echinolaena sensu stricto (clade C) + Ocellochloa is the sister group of this clade. Echinolaena s.s. differs from the members of this clade by its inflorescences (see discussion above) and the presence of long scars at the base of the upper anthecium, whereas Ocellochloa differs from Ichnanthus mainly by its inflorescence (see discussion above) and the upper anthecium with a short stipe, without wings. The first lineages that diverged within this clade are represented by Ichnanthus bambusiflorus and Ichnanthus sp. BA, a new species that is being described in this group (R.P. Oliveira, Universidade Estadual de Feira de Santana, unpublished data). These two taxa have the smallest wings among the species with wings at the base of the upper anthecium (Fig. 5D2, D3; I. bambusiflorus). It suggests that small wings are symplesiomorphic for these two taxa, and longer wings are synapomorphic for the remaining taxa.

4.4. Phylogenetic placement of Ichnanthus adpressus, I. lancifolius, and I. leptophyllus Among the species of Ichnanthus with wings at the base of the upper anthecium sampled in this study, the phylogenetic placement of I. adpressus, I. lancifolius, and I. leptophyllus was an unexpected result. In the combined analyses, I. lancifolius + I. leptophyllus were recovered as sister to clade A with high support, and I. adpressus was recovered in a polytomy along with clade B and the clade composed of Ocellochloa + clade C + clade D (Fig. 1, marked with asterisks). The placement of I. lancifolius + I. leptophyllus in the combined plastid tree was the same as in the combined tree (plastids + ITS), however, the support for clade A was lower in the former (95 PP/ 51 BP; Appendix B.7, marked with

26

asterisks). In the ITS tree, they were not recovered as sister to clade A (Appendix B.6, marked with asterisks) and the support for clade A was moderate to high (100 PP/ 78 BP). Despite the lack of support, they were recovered as sister to clade D (Ichnanthus sensu stricto) in the MP strict consensus of ITS (tree not shown). Their removal from the combined matrix (plastids + ITS), increases the bootstrap support for clade A from 51 to 93 BP, but decreases the posterior probability from 95 to 91 PP (trees not shown). The placement of I. adpressus was uncertain or weakly supported in all analyses (Figs. 1 and 2, and Appendices B.1–B.6). Ichnanthus adpressus, I. lancifolius, and I. leptophyllus, along with the unsampled I. ephemeroblepharis are the only species within the genus in which the spikelets are slightly laterally compressed, almost subterete. The glumes and lower lemma of these species are membranaceous and vinaceous at the apex. Furthermore, their winged appendages present macrohairs in the surface, as shown by Shaw and Webster (1983) and Silva et al. (2013) for I. leptophyllus and I. adpressus, and observed for I. ephemeroblepharis and I. lancifolius (C. Silva, Universidade Estadual de Feira de Santana, unpublished data). These morphological similarities suggest that these taxa are members of the same lineage. As the SH tests indicated, the ITS data set did not reject the hypothesis that Ichnanthus adpressus, I. lancifolius, and I. leptophyllus are members of clade D (Ichnanthus s.s.), however, the combined plastid data set rejected this hypothesis. Furthermore, the ITS data set did not reject the sister group relationship of I. lancifolius + I. leptophyllus and clade A (Hildaea). Specifically for I. lancifolius and I. leptophyllus, their placement as sister to clade A in the combined plastid analyses may represent an event of hybridization involving the pollen from a member of Ichnanthus s.s. and the ovule of a member of Hildaea. The unresolved position of

27

these two taxa in the ITS analyses would be the result of recombination of characters of both clades in the ITS. In the case of I. adpressus, the position is of difficult explanation since it did not display any plastid similarity with Hildaea. One possibility is that I. adpressus is a member of the same hybrid lineage of I. lancifolius and I. leptophyllus (due to the morphological similarities discussed above), which would have been dispersed in a large area and then have been subjected to backcrosses with its Hildaea and Ichnanthus s.s. progenitors in different portions of its distribution. Much more detailed populational and phylogeographical studies should be performed to investigate the origin of the remarkable topological conflicts in these three species that have several morphological similarities and also evident morphological affinities to Ichnanthus s.s. Such studies will also need to include I. ephemeroblepharis which shares the same morphological patterns.

4.5. Other genera with rachilla appendages We recovered the other genera with rachilla appendages in several groups within Panicoideae. Lecomtella was recovered as a separate lineage in a polytomy including Arundinelleae, Andropogoneae, Paniceae, and Paspaleae (Fig. 2). Lecomtella madagascariensis A. Camus, the only species of the genus, is a rare bamboo-like endemic to Madagascar characterized by its paniculate inflorescences with 2–15 branches, each branch with 1–4 staminate spikelets and one terminal bisexual spikelet, upper lemma in the bisexual spikelet subtended by wing-like rachilla appendages, apically with 2–6 digitate appendages (Besnard et al., 2013). These morphological peculiarities and the phylogenetic placement of L. madagascariensis motivated Besnard et al. (2013) to treat it separatelly in the tribe Lecomtelleae.

28

Dichanthelium, Panicum sect. Rudgeana, Ottochloa, and Yakirra were recovered within Paniceae, subtribes Boivinellinae, Dichantheliinae, and Panicinae (Figs. 1 and 3). The first two taxa are American (Zuloaga, 1987; Aliscioni et al., 2003), Ottochloa occur in tropical Africa, Australia, India to Indo-China, Malaysia, and Phillippines (Lazarides, 1961), and Yakirra is mostly endemic to Australia, with one species in Myanmar (Lazarides and Webster, 1984; Clayton, 1987; Simon, 1992). Dichanthelium differs from the members of clades A–D by the floral and vegetative dimorphism usually present, spikelets ellipsoid, upper glume and lower lemma (5–)7– 11(–15)-nerved, upper anthecium with simple papillae all over its surface, and upper lemma apiculate or crested at the apex (Aliscioni et al., 2003) (vs. floral and vegetative dimorphism absent, spikelets ovate to lanceolate or oblong, upper glume and lower lemma 3–9-nerved, upper anthecium usually without simple papillae all over its surface, and upper lemma muticous). The species of Panicum sect. Rudgeana differ from the members of the clades recognized in this study (A–D) mainly by the spikelets dorsally compressed and the presence of a heterogeneous stipe at the base of the upper anthecium (Zuloaga, 1987) (vs. spikelets laterally compressed and rachilla appendages in the shape of convex swellings, short scars, long scars or wings), and Ottochloa also differs by the spikelets dorsally compressed. However, morphological analysis of several specimens showed that there are no rachilla appendages in any of its species, but it should be further studied in detail. As well as the species of Panicum sect. Rudgeana and Ottochloa, Yakirra also differs from the members of clades A–D by the spikelets dorsally compressed, but it is also distinct due to the presence of winged appendages at the base of the upper anthecium. These appendages are only analogous to the wings of the members of

29

clade D (Fig. 5D1–D24), as well as the scars of the members of clade A (Fig. 5A1– A7) and C (Fig. 5C1–C3). As stated by Lazarides and Webster (1984), in Ichnanthus the appendages originate from the lower part of a curved stipe (sometimes very short) and are adnate to the upper lemma, whereas in Yakirra the appendages originate from the apex of the stipe and are free of the upper lemma. Thus, in this study the rachilla appendages of Yakirra were designated as swollen stipe with two acute lobes, as described by Berg (1985). The monophyly of Yakirra is demonstrated for the first time in the present study (Figs. 1 and 3). The genus was recovered in a polytomy with other members of Panicum s.s. (Panicum L. subg. Panicum), including P. sect. Dichotomiflora (Hitchc.) Hitchc. & Chase ex Honda, P. sect. Panicum, P. sect. Rudgeana, P. sect. Urvilleana (Hitchc.) Pilg., and P. sect. Virgata Nees. It is in agreement with previous results reported by GPWG II (2012) and Scataglini et al. (2014b). Zuloaga (1987) and Morrone et al. (2012) emphasized the similarity of Arthragrostis and Yakirra to Panicum sect. Rudgeana regarding their habit, leaf blades, ligules, inflorescences, spikelet compression and length, and nervation of glumes and lower lemma. Arthragrostis is a genus with four species endemic to Australia (Lazarides, 1984; Simon, 1986, 1992, 2010). According to Zuloaga (1987) and Morrone et al. (2012), P. sect. Rudgeana differs from these genera by the presence of a heterogeneous stipe below the upper anthecium (vs. swollen stipe with two acute lobes [Yakirra] or slender stipe [Arthragrostis]), lower palea well-developed (vs. almost absent), and compound papillae present only at the apex of the upper palea (vs. simple papillae in longitudinal rows all over the lemma and palea in Yakirra [information lacking for Arthragrostis]).

30

Ocellochloa, Paspalum, and Renvoizea were recovered within Paspaleae, subtribe Paspalinae (Figs. 1 and 2). The diagnostic features of Ocellochloa were presented above in the discussion of clade C. Paspalum is one of the largest genera within Poaceae with ca. 350 species (Rua et al., 2010) mostly American, and a few found in the Old World, distributed in tropical and subtropical areas (Clayton and Renvoize, 1986). The genus was recovered as non-monophyletic in this study with P. inaequivalve Raddi and P. microstachyum J. Presl in the same clade as Anthaenantiopsis Mez ex Pilg., and Spheneria kegelii (Müll. Hal.) Pilg. embedded within it (Fig. 2), in agreement with the results reported by Scataglini et al. (2014b). Paspalum differs from the members of clades A–D by the inflorescences composed of unilateral racemes, spikelets dorsally compressed with lower glume, lower palea, and lower flower usually absent, and upper glume usually present (Scataglini et al., 2014a) (vs. inflorescences paniculate or racemose, spikelets laterally compressed with glumes and lower palea always present, and lower flower absent or staminate). Renvoizea differs from the members of clades A–D mainly by the leaves pungent, inflorescences paniculate, contracted and spiciform (as in Setaria P. Beauv.), and an upper anthecium stipitate or not (Sede et al., 2008) (vs. leaves not pungent, muticous, inflorencences paniculate, open to contracted [when spiciform, branches appressed to the main axis, not shortened with congested spikelets], and an upper anthecium with appendages in the shape of convex swellings, short scars, long scars or wings).

4.6. Phylogenetic placement of Chasechloa

31

Although samples of Chasechloa were not available for DNA analysis, we evaluated their morphological similarity to the American Echinolaena (here shown as polyphyletic) in order to understand the relationships between them. The Malagasy taxa are most similar to the species of Echinolaena recovered in clade B (Oedochloa) due to their broad leaves and racemose inflorescences. However, despite the overall similarity among them, they have distinct morphological patterns. The inflorescences of the species of Echinolaena from clade B are composed of 3–7 racemes, with the proximal raceme longer than the others, which become shorter towards the apex of the inflorescence, which ends in a single spikelet, whereas the inflorescences of Chasechloa are composed of 1–3 racemes, with the proximal racemes shorter than the terminal, which is erect and continuous to the main axis, as in Thuarea involuta (G. Forst.) R. Br. ex Sm. (see Fig. 8a in Reinheimer and Vegetti, 2008). The species of Chasechloa also differ from the species of Echinolaena from clade B by the rachilla appendages in the upper anthecium, which are represented only a stipe (vs. convex swellings), and the geographical distribution, being endemic to Madagascar, whereas the species of clade B are endemic to the American continent.

5. Conclusions Based on the molecular and morphological evidence presented in this study we confirm the polyphyly of Echinolaena and Ichnanthus as currently circumscribed. In order to make them monophyletic, we propose that Echinolaena should be restricted to the species bearing inflorescences composed of a single unilateral raceme, main axis ending in a sterile prolongation, spikelets laterally compressed, and an upper anthecium with long scars (> 1/2 its length; Clade C; Fig. 5C1–C3),

32

Ichnanthus should be restricted to the species with paniculate inflorescences, main axis ending in a single spikelet, spikelets usually laterally compressed (subterete in a few species), and an upper anthecium with wings (Clade D; Fig. 5D1–D24), and all remaining species should be excluded from them. Two new genera are herein proposed to accommodate the excluded species: Hildaea for the species with paniculate inflorescences, main axis ending in a single spikelet, spikelets laterally compressed, and an upper anthecium with short scars (up to 1/4–1/3 its length; Clade A; Fig. 5A1–A7); and, Oedochloa for the species paniculate or racemose inflorescences, main axis ending in a single spikelet, spikelets laterally compressed, and an upper anthecium with convex swellings (Clade B; Fig. 5B1–B11). The former includes plants mostly distributed in the New World tropics, but also found in the Old World tropics, and the latter is Neotropical. Despite the complications in the phylogenetic placement of Ichnanthus adpressus, I. lancifolius, and I. leptophyllus explained in section 4.4., they possess conspicuous wings at the base of the upper anthecium (Fig. 5D1, D11, D13). Thus, pending future studies, for the moment we are treating them within Ichnanthus s.s., as well as I. ephemeroblepharis (Fig. 5D6), solely on grounds of their morphology. Regarding the species of Chasechloa, based on the morphological and geographical differences among them and the American species of Echinolaena (see discussion), we believe that Chasechloa is not related to any of the clades recognized in this study and may represent a lineage endemic to Madagascar. New studies are already in progress to evaluate the phylogenetic relationships of these taxa. The phylogenetic placement of Gerritea pseudopetiolata and Panicum venezuelae is still uncertain and needs to be further investigated using more

33

molecular markers, including nuclear ones. All genera with rachilla appendages within Paniceae and Paspaleae represent independent lineages. We believe that Arthragrostis and Yakirra should continue to be considered as independent of Panicum sect. Rudgeana. However, in this study Arhtragrostis was not sampled and only ca. 37% of the diversity of Panicum s.s. was included. So, in order to evaluate the phylogenetic relationships between Arthragrostis, Yakirra and Panicum s.s., it is necessary to sample Arhtragrostis and increase the sampling within Panicum s.s.

Taxonomic treatment An identification key to the genera of Panicoideae with rachilla appendages and descriptions for the recircumscribed and the new genera are presented below along with a list of accepted species within each genus and the proper nomenclatural changes. For full synonymy of the species treated here, see Zuloaga et al. (2003).

Key to distinguish Echinolaena, Hildaea, Ichnanthus, and Oedochloa from other genera of Panicoideae with rachilla appendages

1. Spikelets staminate and bisexual, the staminate ones proximal in the branches of the inflorescence (1–4 per branch), and the bisexual ones distal (1 per branch) …………………………………………………………………………………….. Lecomtella 1. Spikelets all bisexual …………………..……………………………………………….. 2 2. Spikelets dorsally compressed ...…………………………………………………… 3 3. Inflorescences racemose; lower glume usually absent ….…………. Paspalum 3. Inflorescences paniculate; lower glume always present ……………………... 4

34

4. Upper anthecium apex shortly apiculate or crested ……..…. Dichanthelium 4. Upper anthecium apex acute, rounded or obtuse …………..……………... 5 5. Panicle branches deciduous …………………………..…..... Arthragrostis 5. Panicle branches not deciduous ………………………….………………. 6 6. Upper anthecium with a heterogeneous stipe; plants from the Neotropics ………….....................……….. Panicum (P. sect. Rudgeana) 6. Upper anthecium with a swollen stipe with two acute lobes (lobes inconspicuous in Y. nulla Lazarides & R.D. Webster); plants from Australia (mostly) and Myanmar ………………………………..…. Yakirra 2. Spikelets laterally compressed ……………………………………….…………….. 7 7. Upper anthecium with or without a short stipe ……………...……………….… 8 8. Leaves pungent; inflorescences paniculate, contracted and spiciform ………………………………………………………………………….... Renvoizea 8. Leaves not pungent; inflorescences racemose (paniculate, lax and diffuse in Ocellochloa latissima (Mikan ex Trin.) Zuloaga & Morrone) .………..…..... 9 9. Inflorescences with the proximal racemes shorter than the terminal ones, main axis ending in a single spikelet; lower lemma often with crateriform glands; plants from the Neotropics ………..….…… Ocellochloa 9. Inflorescences with the proximal racemes longer than the terminal one, which is erect and continuous to the main axis; lower lemma without glands; plants from Madagascar ………………...……..……….. Chasechloa 7. Upper anthecium with short scars, long scars, wings or convex swellings .. 10 10. Upper anthecium with short or long scars …………..............…………... 11 11. Inflorescences paniculate, main axis ending in a single spikelet; upper anthecium with short scars (up to 1/4–1/3 its length) …………….... Hildaea

35

11. Inflorescences racemose, composed of a single raceme, main axis ending in a sterile prolongation; upper anthecium with long scars (> 1/2 its length) ……………………………………………………………... Echinolaena 10. Upper anthecium with wings or convex swellings ………………...…..… 12 12. Inflorescences paniculate; upper anthecium with wings ...... Ichnanthus 12. Inflorescences paniculate or racemose; upper anthecium with convex swelings ……………………….…………………………………….. Oedochloa

Echinolaena Desv., J. Bot. Agric. 1: 75. 1813. ≡ Panicum sect. Echinolaena (Desv.) Nees, Fl. Bras. Enum. Pl. 2(1): 127–128. 1829. Type: Echinolaena hirta Desv., nom. illeg. superfl. Cenchrus inflexus Poir. (≡ Echinolaena inflexa (Poir.) Chase) Annual or perennial; rhizomes present; culms erect, decumbent or scandent. Leaf-blades linear, linear-lanceolate to lanceolate; acuminate at the apex; subcordate to cordate at the base; pseudopetiole absent. Inflorescences racemose, terminal, composed of a single unilateral raceme; no secondary and tertiary branchings; main axis ending in a sterile prolongation. Spikelets laterally compressed; glumes coriaceous; lower glume 7-nerved, acuminate to caudate, equal or longer than the upper glume and anthecia; upper glume 5–9-nerved, acuminate, longer than the anthecia; lower anthecium staminate or sterile, similar to the glumes in color and consistency; lower lemma 5-nerved; upper anthecium bisexual, indurate, whitish to light brown; lower palea present, well developed; upper lemma margins involute, exposing the palea; back of the upper lemma without a transversal thickening at the base; rachilla appendages in the shape of long scars, adnate to the upper lemma, > 1/2 its length (Fig. 5C1–C3).

36

This genus includes two species distributed in the tropics of the New World where they inhabit open field areas, with records in the following countries: Belize, Bolivia, Brazil, Colombia, Costa Rica, French Guiana, Guatemala, Guyana, Honduras, Mexico, Nicaragua, Suriname, and Venezuela (Tropicos, 2015). Echinolaena is here proposed in a narrower sense, including part of the American species previously circumscribed within it (Stieber, 1987; Filgueiras, 1994), and excluding the species with convex swellings at the base of the upper anthecium (Oedochloa, see below) and the Malagasy E. madagascariensis (here considered under Chasechloa).

Echinolaena gracilis Swallen, J. Wash. Acad. Sci. 23: 457. 1933. Echinolaena inflexa (Poir.) Chase, Proc. Biol. Soc. Washington 24: 117. 1911.

Hildaea C. Silva & R.P. Oliveira, gen. nov. ≡ Ichnanthus sect. Foveolatus Pilg., Nat. Pflanzenfam. (ed. 2) 14e: 30. 1940. Type: Panicum pallens Sw. (≡ Hildaea pallens (Sw.) C. Silva & R.P. Oliveira). Hildaea differs from other genera of Paspalinae by the paniculate inflorescences and the upper anthecium with rachilla appendages in the shape of short scars, adnate to the upper lemma, up to 1/4–1/3 its length. Annual or perennial; rhizomes absent; culms stoloniferous, decumbent or scandent, sometimes erect via stout and rigid adventitious roots which emerge from the lower nodes. Leaf-blades linear-lanceolate, ovate to lanceolate; acuminate at the apex; attenuate, subcordate, cordate to amplexicaul at the base; pseudopetiole absent, sometimes present. Inflorescences paniculate, terminal or terminal and axillary, open or contracted; primary branches with or withour other degrees of

37

branching; main axis ending in a single spikelet. Spikelets laterally compressed; glumes membranous to chartaceous; lower glume 3–5-nerved, subobtuse, acute, acuminate to caudate, 1/2–3/4 the length or longer than the upper glume and anthecia; upper glume 3–7-nerved, subacute, acute, acuminate to shortly-apiculate, equal or longer than the anthecia; lower anthecium staminate or sterile, similar to the glumes in color and consistency; lower lemma 3–7-nerved; upper anthecium bisexual, indurate, whitish, stramineous to light brown; lower palea present, well developed; upper lemma margins involute, exposing the palea; back of the upper lemma without a transversal thickening at the base; rachilla appendages in the shape of short scars, adnate to the upper lemma, up to 1/4–1/3 its length (Fig. 5A1–A7). The new genus is named in honor of Dr. Hilda Maria Longhi-Wagner, a renowned Brazilian agrostologist who has been contributing to the advances in the taxonomy of Poaceae. Hildaea comprises five species and one variety mostly distributed in the New World tropics, but also found in the Old World tropics, where they inhabit forest areas. The genus has records in the following countries: Argentina, Assam, Australia, Belize, Bolivia, Brazil, Burma, Cameroon, China, Colombia, Costa Rica, Ecuador, El Salvador, French Guiana, Gabon, Guatemala, Guyana, Honduras, India, Irian Jaya, Java, Liberia, Malaysia, Mexico, New Guinea, Nicaragua, Panama, Papua New Guinea, Paraguay, Peru, Philippines, Sabah, Sierra Leone, Sri Lanka, Suriname, Taiwan, Thailand, United States, Uruguay, Venezuela, Vietnam, and in the West Indies (Tropicos, 2015). Within Hildaea are included part of the species previously circumscribed within Ichnanthus sect. Foveolatus by Stieber (1987).

38

Hildaea breviscrobs (Döll) C. Silva & R.P. Oliveira, comb. nov., based on Ichnanthus breviscrobs Döll, Fl. Bras. 2(2): 294. 1877. Type: Brazil, Pará, near Santarém, ca. 1851, Spruce 385 [lectotype: K!; isolectotypes: P!, US-2767362! (fragm. ex K & P); designated by Stieber, Syst. Bot. 12: 190. 1987]. Hildaea nemorosa (Sw.) C. Silva & R.P. Oliveira, comb. nov., based on Panicum nemorosum Sw., Prodr. 22. 1788. [≡ Ichnanthus nemorosus (Sw.) Döll, Fl. Bras. 2(2): 289. 1877]. Type: 1 of 2. Jamaica, s.d., O.P. Swartz 3096 [lectotype: S!; isolectotypes: BM! (2 sheets), M, US-2489449! (fragm. ex S), US-2489450! (fragm. ex M); designated by Stieber, Syst. Bot. 12: 210. 1987]. 2 of 2. Santo Domingo, s.d., Poiteau s.n. [isosyntypes: LE-TRIN-0847.02 (fig. & spec.), LE-TRIN-0847.01 (illustration of 0847.02)], fig.: Panicum nemorosum Sw. ipso teste. Hildaea pallens (Sw.) C. Silva & R.P. Oliveira, comb. nov., based on Panicum pallens Sw., Prodr. 23. 1788. [≡ Ichnanthus pallens (Sw.) Munro ex Benth., Fl. Hongk. 414. 1861.] Type: Jamaica, s.d., O.P. Swartz s.n. [lectotype: M; isolectotypes: BM, G!, S!, US-2489445! (fragm. ex M), US-2489446! (fragm. ex S); designated by Stieber, Syst. Bot. 12: 203. 1987]. Hildaea pallens var. major (Nees) C. Silva & R.P. Oliveira, comb. nov., based on Panicum pallens var. majus Nees, Fl. Bras. Enum. Pl. 2: 137. 1829. [≡ Ichnanthus pallens var. major (Nees) Stieber, Syst. Bot. 12(2): 207. 1987]. Type (protologue): In Brasiliae sylvis, V. in Herb. cl. Trin.: P. pallens var. grandiflora. first cited. Type (specimen): Brazil, in sylvaticis prope Mandioeam Brasil, 11 Jan 1815–1820, G.H. von Langsdorff s.n. (holotype: LE-TRIN-0867.09). This variety is herein recognized on the basis of Stieber’s (1987) circumscription, but studies in progress may clarify its relationships within the species complex composed of H. nemorosa, H. pallens, H. ruprechtii, and H. tenuis.

39

Hildaea ruprechtii (Döll) C. Silva & R.P. Oliveira, comb. nov., based on Ichnanthus ruprechtii Döll, Fl. Bras. 2(2): 293. 1877. Type: 1 of 2. Brazil, Goiás, near Pilar, ca. 1817–1821, J.B.E. Pohl 5067 [lectotype: BR!; isolectotypes: G! (2 sheets), US-2487288! (fragm. ex G, W), W! (2 sheets); designated by Stieber, Syst. Bot. 12: 195. 1987]. 2 of 2. Brazil, Minas Gerais, ad Congo Soco, s.d., Bunbury s.n. (syntype: BR). Hildaea tenuis (J. Presl & C. Presl) C. Silva & R.P. Oliveira, comb. nov., based on Oplismenus tenuis J. Presl & C. Presl, Reliq. Haenk. 1(4–5): 319. 1830. [≡ Ichnanthus tenuis (J. Presl & C. Presl) Hitchc. & Chase, Contr. U.S. Natl. Herb. 18: 334. 1917]. Type: Hab. in Mexico, Panama, s.d., Haenke s.n. [holotype: PR; isotypes: BR!, LE, MO-1837505!, MO-5117061! (line drawing), US-2489447! and US2489448! (fragm. ex LE)].

Ichnanthus P. Beauv., Ess. Agrostogr. 56. 1812. ≡ Ischnanthus Roem. & Schult., nom. illeg. superfl., Syst. Veg. 2: 28, 497. 1817. ≡ Panicum sect. Ichnanthus (P. Beauv.) Trin., Mem. Acad. Imp. Sci. Saint-Petersbourg, Ser. 6, Sci. Math., Seconde Pt. Sci. Nat. 3,1(2–3): 195, 320. 1834. Type: Ichnanthus panicoides P. Beauv. = Navicularia Raddi, nom. illeg. hom., Agrostogr. Bras. 38. 1823. Type: Navicularia lanata Raddi (= Ichnanthus leiocarpus (Spreng.) Kunth). Annual or perennial; rhizomes present or absent; culms erect, decumbent or scandent. Leaf-blades linear-lanceolate, ovate to lanceolate; acute to acuminate at the apex; attenuate, rounded, subcordate to cordate at the base; pseudopetiole present or absent. Inflorescences paniculate, terminal or terminal and axillary, open or contracted; primary branches with or withour other degrees of branching

40

(secondary and tertiary branches sometimes short, giving a false racemose appearance to the panicle); main axis ending in a single spikelet. Spikelets usually laterally compressed, subterete in a few species; glumes membranous to chartaceous; lower glume 3–7-nerved, obtuse, acute, acuminate to caudate, 1/2–4/5 the length, equal or longer than the upper glume and anthecia; upper glume 5–7(–9)nerved, obtuse, acute, acuminate, apiculate to caudate, shorter, equal or longer than the anthecia; lower anthecium staminate or sterile, similar to the glumes in color and consistency; lower lemma 3–7(–9)-nerved; upper anthecium bisexual, indurate, whitish, yellowish, stramineous to dark brown, sometimes vinaceous or with dark spots; lower palea present, well developed; upper lemma margins involute, exposing the palea; back of the upper lemma without a transversal thickening at the base; rachilla appendages in the shape of wings, adnate to the upper lemma at the base, free above, variable in length, from very short to longer than the length of the upper anthecium (Fig. 5D1–D24). This genus includes 22 species distributed in the tropics of the New World where they usually inhabit forests, or less commonly open field areas, with records in the following countries: Argentina, Belize, Bolivia, Brazil, Colombia, Costa Rica, French Guiana, Guatemala, Guyana, Honduras, Mexico, Nicaragua, Panama, Paraguay, Peru, Suriname, Venezuela, and in the West Indies (Tropicos, 2015). Ichnanthus is here proposed in a narrow sense, including one species previously circumscribed within Echinolaena (E. oplismenoides; Filgueiras, 1994) and one within I. sect. Foveolatus (I. bambusiflorus; Stieber, 1987), all species previously circumscribed within I. sect. Ichnanthus (Stieber, 1982), and excluding the species with short scars and convex swellings at the base of the upper anthecium (Hildaea and Oedochloa).

41

Ichnanthus adpressus C. Silva & R.P. Oliveira, Phytotaxa 104(1): 22. 2013. Ichnanthus bambusiflorus (Trin.) Döll, Fl. Bras.2(2): 288. 1877. Ichnanthus calvescens (Trin.) Döll, Fl. Bras. 2(2): 285. 1877. Ichnanthus dasycoleus Tutin, J. Bot. 72(864): 337. 1934. Ichnanthus ephemeroblepharis G.A. Black & Fróes, Bol. Tecn. Inst. Agron. N. 15: 5. 1948. Ichnanthus glaber (Raddi) Hitchc., Contr. U.S. Natl. Herb. 22: 10. 1920. Ichnanthus hirtus (Raddi) Chase, J. Wash. Acad. Sci. 13(9): 175. 1923. Ichnanthus hoffmannseggii (Roem. & Schult.) Döll, Fl. Bras. 2(2): 287. 1877. Ichnanthus inconstans (Trin. ex Nees) Döll, Fl. Bras. 2(2): 284. 1877. Ichnanthus lancifolius Mez, Repert. Spec. Nov. Regni Veg. 15: 126. 1918. Ichnanthus leiocarpus (Spreng.) Kunth, Révis. Gramin. 2: 507. 1831. Ichnanthus leptophyllus Döll, Fl. Bras. 2(2): 287. 1877. Ichnanthus longhi-wagnerae A.C. Mota & R.P. Oliveira, Syst. Bot. 37(1): 117– 120. 2012. Ichnanthus longiglumis Mez, Repert. Spec. Nov. Regni Veg. 15: 131. 1918. Ichnanthus mexicanus E. Fourn., Mexic. Pl. 2: 34. 1886. Ichnanthus mollis Ekman, Ark. Bot. 10(17): 20. 1911. Ichnanthus nemoralis (Schrad.) Hitchc. & Chase, Contr. U.S. Natl. Herb. 18: 334. 1917. Ichnanthus oplismenoides Munro ex Döll, Fl. Bras. 2(2): 288. 1877. Echinolaena oplismenoides (Munro ex Döll) Stieber, Syst. Bot. 12: 212. 1987. Ichnanthus panicoides P. Beauv., Ess. Agrostogr. 56. 1812. Ichnanthus riedelii (Trin.) Döll, Fl. Bras. 2(2): 277. 1877.

42

Ichnanthus tarumanensis G.A. Black & Fróes, Bol. Tecn. Inst. Agron. N. 20: 33. 1950. Ichnanthus zehntneri Mez, Bot. Jahrb. Syst. 56(Beibl. 125): 9. 1921.

Oedochloa C. Silva & R.P. Oliveira, gen. nov. Type: Panicum procurrens Nees ex Trin. (≡ Oedochloa procurrens (Nees ex Trin.) C. Silva & R.P. Oliveira). Oedochloa differs from other genera of Paspalinae by the paniculate or racemose inflorescences with the main axis ending in a single spikelet, the upper anthecium with rachilla appendages in the shape of convex swellings, and back of the upper lemma with a transversal thickening at the base. Annual or perennial; rhizomes present or absent; culms erect, decumbent or scandent. Leaf-blades linear, oblong, ovate to lanceolate; subacute, acute to acuminate; rounded, subcordate to cordate at the base; pseudopetiole present or absent. Inflorescences paniculate or racemose, main axis ending in a single spikelet; the paniculate ones terminal or terminal and axillary, open, primary branches without branchings or scarcely branched; the racemose ones terminal, composed of 3–7 unilateral racemes, no secondary and tertiary branchings. Spikelets laterally compressed; glumes membranous to chartaceous; lower glume 3–5-nerved, obtuse, subacute, acute, acuminate to caudate, 1/5–3/4 the length or longer than the upper glume and anthecia; upper glume 5–7-nerved, subacute, acute, acuminate to apiculate, equal or longer than the anthecia; lower anthecium staminate or sterile, similar to the glumes in color and consistency; lower lemma 5–7-nerved; lower palea present, well developed; upper anthecium bisexual, indurate, whitish, stramineous to light brown; upper lemma margins well developed, flat or slightly involute,

43

overlapping in the apex, covering 1/3–2/3 the palea (sometimes less when the anthecium fertile expands due to the development of the caryopsis); back of the upper lemma with a transversal thickening at the base (small and inconspicuous in a few species) (Fig. 5B2, B3); rachilla appendages in the shape of convex swellings (small and inconspicuous in a few species) (Fig. 5B1–B11). The name of the new genus is derived from the conjunction of the Greek words “oidos” = swelling, and “chloa” = grass (Clifford and Bostock, 2007), referring to the convex swellings present at the base of the upper anthecium. Oedochloa comprises nine species distributed in the New World tropics, where they inhabit forests, riverbanks, and open field areas. The genus has records in the following countries: Argentina, Belize, Bolivia, Brazil, Colombia, Ecuador, Guatemala, Honduras, Mexico, Paraguay, Peru, Venezuela, and in the West Indies (Tropicos, 2015). Within Oedochloa are included part of the species previously circumscribed within Ichnanthus sect. Foveolatus (Stieber, 1987), and part of the American species previously circumscribed within Echinolaena (Stieber, 1987; Filgueiras, 1994).

Oedochloa camporum (Swallen) C. Silva & R.P. Oliveira, comb. nov., based on Ichnanthus camporum Swallen, Phytologia 11(3): 149. 1964. Type: Brazil, Goiás, between Vianópolis and Ponta Funda, 990–1000 m, 17 Mar 1930, A. Chase 11274 (holotype: US-1448744!; isotype: US-2529251!). Oedochloa cordata (Ekman) C. Silva & R.P. Oliveira, comb. nov., based on Ichnanthus cordatus Ekman, Ark. Bot. 10(17): 18. 1911. Type: Brazil, Mato Grosso, Cuiabá, in silvula vallis, 29 Apr 1903, Malme 3187 [holotype: S! (2 sheets); isotypes: US-2489451! (fragm. ex S), US-702285! (fragm. ex S)].

44

Oedochloa ecuadoriana (Filg.) C. Silva & R.P. Oliveira, comb. nov., based on Echinolaena ecuadoriana Filg., Nordic J. Bot. 14(4): 379. 1994. Type: Ecuador, Guayas, Capeira, km 21, Guayaquil to Daule, 20–200 m, 15 Feb 1982, C.H. Dodson & A.H. Gentry 12439 (holotype: MO!; isotype: US!). Oedochloa grandifolia (Döll) C. Silva & R.P. Oliveira, comb. nov., based on Panicum grandifolium Döll, Fl. Bras. 2(2): 195. 1877. [≡ Ichnanthus grandifolius (Döll) Zuloaga & Soderstr., Smithsonian Contr. Bot. 59: 31. 1985]. Type: Brazil, Bahia, habitat in sylvis ad Itahypé fluvium et Camacorum vic. um S. Pedro d’Alcantara, s.d., Martius s.n. [holotype: M; isotypes: B!, US! (fragm. ex M)]. Oedochloa lanceolata (Scribn. & J.G. Sm.) C. Silva & R.P. Oliveira, comb. nov., based on Ichnanthus lanceolatus Scribn. & J.G. Sm., Bull. Div. Agrostol., U.S.D.A. 4: 36–37. 1897. Type: Mexico, Yucatán, old fields about Izamal, Sep 1895, G.F. Gaumer 854 (lectotype: US-744253!; isolectotyipes: F!, MO-1836415!, NY!, P!; designated by Stieber, Syst. Bot. 12: 193. 1987). Oedochloa mayarensis (C. Wright) C. Silva & R.P. Oliveira, comb. nov., based on Panicum mayarense C. Wright, Anales Acad. Ci. Med. Habana 8: 206. 1871. [≡ Ichnanthus mayarensis (C. Wright) Hitchc., Contr. U.S. Natl. Herb. 12(6): 228. 1909]. Type: Cuba, Holguín, Pinar de Mayarí Abajo, 1860–1864, Wright 3468 [lectotype: GH-24134!; isolectotypes: B!, GH-24133!, K!, MO-1836419!, S!, NY-71086! (fragm.), US-80793! (fragm. ex GH & photo); designated by Hitchcock, Contr. U.S. Natl. Herb. 12: 228. 1909]. Oedochloa minarum (Nees) C. Silva & R.P. Oliveira, comb. nov., based on Oplismenus minarum Nees, Fl. Bras. Enum. Pl. 2(1): 268–269. 1829. [≡ Echinolaena minarum (Nees) Pilger, Notizbl. Bot. Gart. Berlin-Dahlem 11: 246. 1931]. Type: Brazil, Minas Gerais, Vila Rica (Ouro Preto), 1823–1824, Martius s.n. [lectotype: M;

45

isolectotypes: B! (fragm.), US-976280 (fragm. & photo); designated by Stieber, Syst. Bot. 12: 213. 1987]. Oedochloa procurrens (Nees ex Trin.) C. Silva & R.P. Oliveira, comb. nov., based on Panicum procurrens Nees ex Trin., Gram. Panic. 183. 1826. [≡ Ichnanthus procurrens (Nees ex Trin.) Swallen, Phytologia 11: 149. 1964]. Type: Brazil, Minas Gerais, in campis glareosis, s.d., G.H. von Langsdorff s.n. [holotype: LE-TRIN0903.01; isotype: US-974728 (fragm. ex LE)]. Oedochloa standleyi (Hitchc.) C. Silva & R.P. Oliveira, comb. nov., based on Ichnanthus standleyi Hitchc., Contr. U.S. Natl. Herb. 24: 662. 1930. [≡ Echinolaena standleyi (Hitchc.) Stieber, Syst. Bot. 12: 214. 1987]. Type: Honduras, Comayagua, Siguatepeque, wet shaded bank, 1080–1400 m, 14–27 Feb 1928, P.C. Standley 56207 (holotype: US-1387083!; isotype: F!).

Acknowledgments We thank C. Urbanetz (Embrapa CPAP), L.C. Marinho (UEFS), D. Zappi (Kew), F.M. Ferreira (UFJF), G. Davidse (MO), G.H. Rua (BAA), H.M. LonghiWagner (UFRGS), L. Gautier (G), M. Fonseca (IBGE), P.L. Viana (MG), P. Reis (UnB), R.A. Rodrigues (IAN), R.C. Oliveira (UnB), R.C.V.M. Silva (IAN), R. Letsara (Univ. of Antananarivo), S. Laegaard (Univ. de Aarhus), S.N. Moreira (UFMG), T. Heavermans (P), and other colleagues for their suggestions, samples and photographs, and help with literature; the curators of the cited herbaria for loans, samples, support during the visits, and for providing images of the specimens; Instituto Estadual de Florestas (IEF) and Instituto Chico Mendes de Conservação da Biodiversidade (ICMBio) for issuing collecting permits; Plantações Michelin da Bahia, Programa de Pesquisa em Biodiversidade do Semi-Árido (PPBio), Sistema Nacional

46

de Pesquisa em Biodiversidade (SISBIOTA), grants CNPq 563084/2010-3 and FAPESB PES0053/2011, Fundação de Amparo à Pesquisa do Estado da Bahia (FAPESB), grants PNX0014/2009 and T.O.PNE0020/2011, and Conselho Nacional de Desenvolvimento Científico e Tecnológico (CNPq), grants 562349/2010-3 and 563558/2010-5 for financial support. CS is especially grateful to the Missouri Botanical Garden for the 2013 Shirley A. Graham Fellowship in Systematic Botany and Biogeography, and to B. Lepschi, J. Palmer, M. Nightingale, and S. Alasya (CANB herbarium) for the loan and samples of the Australian taxa. RPO and CvdB thank CNPq for the research productivity grant (PQ-1D, and PQ-1B). This paper is part of the first author’s M.Sc. thesis, developed in the Programa de Pós-Graduação em Botânica of the Universidade Estadual de Feira de Santana, and supported by CNPq (grant 134184/2011-4).

References Aliscioni, S.S., Giussani, L.M., Zuloaga, F.O., Kellogg, E.A., 2003. A molecular phylogeny of Panicum (Poaceae: Paniceae): tests of monophyly and phylogenetic placement within the Panicoideae. Am. J. Bot. 90, 796–821. Berg, R.Y., 1985. Spikelet structure in Panicum australiense (Poaceae): taxonomic and ecological implications. Aust. J. Bot. 33, 579–583. Besnard, G., Christin, P.-A., Malé, P.-J.G., Coissac, E., Ralimanana, H., Vorontsova, M.S., 2013. Phylogenomics and taxonomy of Lecomtelleae (Poaceae), an isolated panicoid lineage from Madagascar. Ann. Bot. 112, 1057–1066. Boechat, S.C., 2005. O gênero Ichnanthus (Poaceae - Panicoideae - Paniceae) no Brasil. Iheringia, Sér. Bot. 60, 189–248.

47

Bouchenak-Khelladi, Y., Muasya, A.M., Linder, H.P., 2014. A revised evolutionary history of Poales: origins and diversification. Bot. J. Linn. Soc. 175, 4–16. Camus, A.A., 1948. Chasechloa A. Camus (Graminées), genre nouveau de Madagascar et de Nossi-Bé. B. Soc. Bot. Fr. 95, 329–331. Camus, A.A., 1954. Chasechloa A. Camus, genre de Graminées Malgaches. Mém. Inst. Sci. Madagascar, Sér. B, Biol. Vég. 5, 201–204. Chang, C.-C., Lin, H.-C., Lin, I.-P., Chow, T.-Y., Chen, H.-H., Chen, W.-H., Cheng, C.-H., Lin, C.-Y., Liu, S.-M., Chang, C.-C., Chaw, S.-M., 2006. The chloroplast genome of Phalaenopsis Aphrodite (Orchidaceae): comparative analysis of evolutionary rate with that of grasses and its phylogenetic implications. Mol. Biol. Evol. 23, 279–291. Christin, P.-A., Petitpierre, B., Salamin, N., Büchi, L., Besnard, G., 2009a. Evolution of C4 phosphoenolpyruvate carboxykinase in grasses, from genotype to phenotype. Mol. Biol. Evol. 26, 357–365. Christin, P.-A., Osborne, C.P., Chatelet, D.S., Columbus, J.T., Besnard, G., Hodkinson, T.R., Garrison, L.M., Vorontsova, M.S., Edwards, E.J., 2013. Anatomical enablers and the evolution of C4 photosynthesis in grasses. P. Natl. Acad. Sci. USA 110, 1381–1386. Christin, P.-A., Besnard, G., Samaritani, E., Duvall, M.R., Hodkinson, T.R., Savolainen, V., Salamin, N., 2008. Oligocene CO2 decline promoted C4 photosynthesis in grasses. Curr. Biol. 18, 37–43. Christin, P.-A., Salamin, N., Savolainen, V., Duvall, M.R., Besnard, G., 2007. C4 Photosynthesis evolved in grasses via parallel adaptive genetic changes. Curr. Biol. 17, 1241–1247.

48

Christin, P.-A., Salamin, N., Kellogg E.A., Vicentini, A., Besnard, G., 2009b. Integrating phylogeny into studies of C4 variation in the grasses. Plant Physiol. 149, 82–87. Clayton, W.D., 1987. Miscellaneous notes on panicoid grasses. Kew Bull. 42, 401– 403. Clayton, W.D., Renvoize, S.A., 1986. Genera graminum. Grasses of the world. Kew Bull. Add. Series 13, 1–389. Clifford, H.T., Bostock, P.D., 2007. Etymological Dictionary of Grasses. SpringerVerlag, Berlin. Davidse, G., 1987. Fruit dispersal in the Poaceae, in: Soderstrom, T.R., Hilu, K.W., Campbell, S.C., Barkworth, M.E. [Eds.], Grass systematics and evolution. Smithsonian Institution Press, Washington, DC, pp. 143–155. Desfeux, C., Maurice, S., Henry, J.P., Lejeune, B., Gouyon, P.H., 1996. The evolution of reproductive system in the genus Silene. Proc. R. Soc. B 263, 409–414. Döll, J.C., 1877. Gramineae I. Paniceae, in: von Martius, C.F.P. [Ed.], Flora Brasiliensis. R. Oldenbourg, Munich and Leipzig, pp. 276–296. Donadío, S., Giussani, L.M., Kellogg, E.A., Zuloaga, F.O., Morrone, O., 2009. A preliminary molecular phylogeny of Pennisetum and Cenchrus (PoaceaePaniceae) based on the trnL-F, rpl16 chloroplast markers. Taxon 58, 392–404. Doyle, J.J., Doyle, J.L., 1987. A rapid DNA isolation procedure for small quantities of fresh leaf tissue. Phytochem. Bull. 19, 11–15. Duvall, M.R., Noll, J.D., Minn, A.H., 2001. Phylogenetics of Paniceae (Poaceae). Am. J. Bot. 88, 1988–1992.

49

Edgar, R.C., 2004. MUSCLE: multiple sequence alignment with high accuracy and high throughput. Nucleic Acids Res. 32, 1792–1797. Erixon, P., Svennblad, B., Britton, T., Oxelman, B., 2003. Reliability of Bayesian posterior probabilities and bootstrap frequencies in phylogenetics. Syst. Biol. 52, 665–673. Felsenstein, J., 1985. Confidence limits on phylogenies: an approach using the bootstrap. Evolution 39, 783–791. Filgueiras, T.S., 1994. A new species of Echinolaena (Poaceae: Paniceae) from Ecuador and a key to the New World species of the genus. Nord. J. Bot. 14, 379–381. Fitch, W.M., 1971. Towards defining the course of evolution: minimum change for a specific tree topology. Syst. Zool. 20, 406–416. Giussani, L.M., Zuloaga, F.O., Quarín, C.L., Cota-Sánchez, J.H., Ubayasena, K., Morrone, O., 2009. Phylogenetic relationships in the genus Paspalum (Poaceae: Panicoideae: Paniceae): an assessment of the Quadrifaria and Virgata informal groups. Syst. Bot. 34, 32–43. Giussani, L.M., Cota-Sánchez, J.H., Zuloaga, F.O., Kellogg, E.A., 2001. A molecular phylogeny of the grass subfamily Panicoideae (Poaceae) shows multiple origins of C4 photosynthesis. Am. J. Bot. 88, 1993–2012. GPWG II (Grass Phylogeny Working Group II), 2012. New grass phylogeny resolves deep evolutionary relationships and discovers C 4 origins. New Phytol. 193, 304–312. Hall, T.A., 1999. BioEdit: a user-friendly biological sequence alignment editor and analysis program for Windows 95/98/NT. Nucleic Acids Symp. Ser. 41, 95–98.

50

Hedges, S.B., 1992. The number of replications needed for accurate estimation of the bootstrap p value in phylogenetic studies. Mol. Biol. Evol. 9, 366–369. Hiratsuka, J., Shimada, H., Whittier, R., Ishibashi, T., Sakamoto, M., Mori, M., Kondo, C., Honji, Y., Sun, C.-R., Meng, B.-Y., Li, Y.-Q., Kanno, A., Nishizawa, Y., Hirai, A., Shinozaki, K., Sugiura, M., 1989. The complete sequence of the rice (Oryza sativa) chloroplast genome: intermolecular recombination between distinct tRNA genes accounts for a major plastid DNA inversion during the evolution of the cereals. Mol. Genet. Genomics 217, 185–194. Hsiao, C., Chatterton, N.J., Asay, K.H., Jensen, K.B., 1995. Molecular phylogeny of the Pooideae (Poaceae) based on nuclear rDNA (ITS) sequences. Theor. Appl. Genet. 90, 389–398. Hsiao, C., Jacobs, S.W.L., Barker, N.P., Chatterton, N.J., 1998. A molecular phylogeny of the subfamily Arundinoideae (Poaceae) based on sequences of rDNA. Aust. Syst. Bot. 11, 41–52. Huelsenbeck, J.P., Ronquist, F., Nielsen, R., Bollback, J.P., 2001. Bayesian inference of phylogeny and its impact on evolutionary biology. Science 294, 2310–2314. Hughes, D.K., 1923. The genus Panicum of the Flora Australiensis. Kew Bull. 9, 305–332. Ibrahim, D.G., Burke, T., Ripley, B.S., Osborne, C.P., 2009. A molecular phylogeny of the genus Alloteropsis (Panicoideae, Poaceae) suggests an evolutionary reversion from C4 to C3 photosynthesis. Ann. Bot. 103, 127–136. Kearse, M., Moir, R., Wilson, A., Stones-Havas, S., Cheung, M., Sturrock, S., Buxton, S., Cooper, A., Markowitz, S., Duran, C., Thierer, T., Ashton, B., Meintjes, P., Drummond, A., 2012. Geneious Basic: an integrated and extendable desktop

51

software platform for the organization and analysis of sequence data. Bioinformatics 28, 1647–1649. Kellogg, E.A., Hiser, K.M., Doust, A.N., 2004. Taxonomy, phylogeny, and inflorescence development of the genus Ixophorus (Panicoideae: Poaceae). Int. J. Plant Sci. 165, 1089–1105. Kress, W.J., Prince, L.M., Williams, K.J., 2002. The phylogeny and a new classification of the gingers (Zingiberaceae): evidence from molecular data. Am. J. Bot. 89, 1682–1696. Lazarides, M., 1961. The genus Ottochloa Dandy (Gramineae) in Australia and its relationship to Ichnanthus oblongus Hughes. Aust. J. Bot. 9, 209–215. Lazarides, M., 1984. New taxa of tropical Australian grasses (Poaceae). Nuytsia 5, 273–303. Lazarides, M., Webster, R.D., 1984. Yakirra (Paniceae, Poaceae), a new genus for Australia. Brunonia 7, 289–296. Lizarazu, M.A., Nicola, M.V., Salariato, D.L., 2014. Taxonomic re-evaluation of Panicum sections Tuerckheimiana and Valida (Poaceae: Panicoideae) using morphological and molecular data. Taxon 63, 265–274. López, A., Morrone, O., 2012. Phylogenetic studies in Axonopus (Poaceae, Panicoideae, Paniceae) and related genera: morphology and molecular (nuclear and plastid) combined analyses. Syst. Bot. 37, 671–676. Maddison, W.P., Maddison, D.R., 2010. Mesquite: a modular system for evolutionary analysis. Version 2.74. Miller, M.A., Pfeiffer, W., Schwartz, T., 2010. Creating the CIPRES Science Gateway for inference of large phylogenetic trees, in: Proceedings of the Gateway

52

Computing Environments Workshop (GCE), November 2010. New Orleans, pp. 1–8. Morrone, O., Aagesen, L., Scataglini, M.A., Salariato, D.L., Denham, S.S., Chemisquy, M.A., Sede, S.M., Giussani, L.M., Kellogg, E.A., Zuloaga, F.O., 2012. Phylogeny of the Paniceae (Poaceae: Panicoideae): integrating plastid DNA sequences and morphology into a new classification. Cladistics 28, 333– 356. Morrone, O., Scataglini, M.A., Zuloaga, F.O., 2007. Cyphonanthus, a new genus segregated from Panicum (Poaceae: Panicoideae: Paniceae) based on morphological, anatomical and molecular data. Taxon 56, 521–532. Mota, A.C., Oliveira, R.P., 2012. Ichnanthus longhi-wagnerii (Panicoideae): new grass from the Atlantic Moist Forest of Bahia, Brazil. Syst. Bot. 37, 117–121. Müller, K.F., 2005. The efficiency of different search strategies in estimating parsimony jackknife, bootstrap, and Bremer support. BMC Evol. Biol. 5, 58. Nylander, J.A.A., 2004. MrModeltest v. 2. Program distributed by the author. Evolutionary Biology Centre, Uppsala University, Uppsala, Sweden. Oliveira, R.P., Clark, L.G., Schnadelbach, A.S., Monteiro, S.H.N., Borba, E.L., Longhi-Wagner, H.M., van den Berg, C., 2014. A molecular phylogeny of Raddia and its allies within the tribe Olyreae (Poaceae, Bambusoideae) based on noncoding plastid and nuclear spacers. Mol. Phylogenet. Evol. 78, 105–117. Olmstead, R.G., Sweere, J.A., 1994. Combining data in phylogenetic systematics: an empirical approach using three molecular data sets in the Solanaceae. Syst. Biol. 43, 467–481. Pagel, M., 1999. The maximum likelihood approach to reconstructing ancestral character states of discrete characters on phylogenies. Syst. Biol. 48, 612–622.

53

Paithankar, K.R., Prasad, K.S.N., 1991. Precipitation of DNA by polyethylene glycol and ethanol. Nucleic Acids Res. 19, 1346. Pilger, R.K.F., 1940. Gramineae III. Unterfamilie Panicoideae, in: Engler, A., Prantl, K. [Eds.], Die natürlichen Pflanzenfamilien, Zweite Auflage, second ed., 14e. Engelmann, Leipzig, pp. 1–208. Quintanar, A., Castroviejo, S., Catalán, P., 2007. Phylogeny of the tribe Aveneae (Pooideae, Poaceae) inferred from plastid trnT-F and nuclear ITS sequences. Am. J. Bot. 94, 1554–1569. Rambaut, A., 2009. FigTree version 1.3.1: tree figure drawing tool. Computer program and documentation distributed by the author. . Rambaut, A., Drummond, A.J., 2009. Tracer version 1.5. Computer program and documentation distributed by the author. . Reinheimer, R., Vegetti, A.C., 2008. Inflorescence diversity and evolution in the PCK Clade (Poaceae: Panicoideae: Paniceae). Plant Syst. Evol. 275, 133–167. Ronquist, F., Huelsenbeck, J.P., 2003. MrBayes 3: Bayesian phylogenetic inference under mixed models. Bioinformatics 19, 1572–1574. Rua, G.H., Speranza, P.R., Vaio, M., Arakaki, M., 2010. A phylogenetic analysis of the genus Paspalum (Poaceae) based on cpDNA and morphology. Plant Syst. Evol. 288, 227–243. Salariato, D.L., Zuloaga, F.O., Giussani, L.M., Morrone, O., 2010. Molecular phylogeny of the subtribe Melinidinae (Poaceae: Panicoideae: Paniceae) and evolutionary trends in the homogenization of inflorescences. Mol. Phylogenet. Evol. 56, 355–369.

54

Salariato, D.L., Morrone, O., Zuloaga, F.O., 2012. Mayariochloa, a new monotypic genus segregated from Scutachne (Poaceae, Panicoideae, Paniceae). Syst. Bot. 37: 105–116. Sánchez-Ken, J.G., Clark, L.G., 2010. Phylogeny and a new tribal classification of the Panicoideae s.l. (Poaceae) based on plastid and nuclear sequence data and structural data. Am. J. Bot. 97, 1732–1748. Scataglini, M.A., Zuloaga, F.O., 2013. Morronea, a new genus segregated from Panicum (Paniceae, Poaceae) based on morphological and molecular data. Syst. Bot. 38, 1076–1086. Scataglini, M.A., Zuloaga, F.O., Giussani, L.M., Denham, S.S., Morrone, O., 2014a. Phylogeny of New World Paspalum (Poaceae, Panicoideae, Paspaleae) based on plastid and nuclear markers. Plant Syst. Evol. 300, 1051–1070. Scataglini, M.A., Lizarazu, M.A., Zuloaga, F.O., 2014b. A peculiar amphitropical genus of Paniceae (Poaceae, Panicoideae). Syst. Bot. 39, 1108–1119. Sede, S.M., Zuloaga, F.O., Morrone, O., 2009a. Phylogenetic Studies in the Paniceae (Poaceae-Panicoideae): Ocellochloa, a New Genus from the New World. Syst. Bot. 34, 684–692. Sede, S.M., Morrone, O., Giussani, L.M., Zuloaga, F.O., 2008. Phylogenetic studies in the Paniceae (Poaceae): a realignment of section Lorea of Panicum. Syst. Bot. 33, 284–300. Sede, S.M., Morrone, O., Aliscioni, S.S., Giussani, L.M., Zuloaga, F.O., 2009b. Oncorachis and Sclerochlamys, two new segregated genera from Streptostachys (Poaceae, Panicoideae, Paniceae): a revision based on molecular, morphological and anatomical characters. Taxon 58, 365–374.

55

Shaw, J., Lickey, E., Beck, J.T., Farmer, S.B., Liu, W., Miller, J., Siripun, K.C., Winder, C.T., Schilling, E.E., Small, R.L., 2005. The tortoise and the hare II: relative utility of 21 noncoding chloroplast DNA sequences for phylogenetic analysis. Am. J. Bot. 92, 142–166. Shaw, R.B., Webster, R.D., 1983. Characteristics of the upper anthecia of Ichnanthus (Poaceae: Paniceae). Bot. Gaz. 144, 363–370. Shimodaira, H., Hasegawa, M., 1999. Multiple comparisons of log-likelihoods with applications to phylogenetic inference. Mol. Biol. Evol. 16, 1114–1116. Silva, C., Ferreira, F.M., Viana, P.L., Oliveira, R.P., 2013. A new species of Ichnanthus (Poaceae, Paspaleae) endemic to Southern Minas Gerais, Brazil. Phytotaxa 104, 21–29. Silva, C., Filgueiras, T.S., Oliveira, R.P., 2015. Ichnanthus, in: Lista de Espécies da Flora do Brasil. Jardim Botânico do Rio de Janeiro. . Simon, B.K., 1986. Studies in Australian grasses: 2. Austrobaileya 2, 238–242. Simon, B.K., 1992. Studies in Australian grasses: 5 new species of and new combinations for Queensland panicoid grasses. Austrobaileya 3, 585–607. Simon, B.K., 2010. New taxa, nomenclatural changes and notes on Australian grasses in the tribe Paniceae (Poaceae: Panicoideae). Austrobaileya 8, 187– 219. Siqueiros-Delgado, M.E., Ainouche, M., Columbus, J.T., Ainouche, A., 2013. Phylogeny of the Bouteloua curtipendula complex (Poaceae: Chloridoideae) based on nuclear ribosomal and plastid DNA sequences from diploid taxa. Syst. Bot. 38, 379–389.

56

Soreng, R.J., Peterson, P.M., Romaschenko, K., Davidse, G., Zuloaga, F.O., Judziewicz, E.J., Filgueiras, T.S., Davis, J.I., Morrone, O., 2015. A worldwide phylogenetic classification of the Poaceae (Gramineae). J. Syst. Evol. 53, 117–137. Staden, R., Judge, D.P., Bonfield, J.K., 2003. Analysing sequences using the Staden Package and EMBOSS, in: Krawetz, S.A., Womble, D.D. [Eds.], Introduction to Bioinformatics: a theoretical and practical approach. Humana Press, Totowa, New Jersey, pp. 393–410. Stamatakis, A., 2006. RAxML-VI-HPC: maximum likelihood-based phylogenetic analyses with thousands of taxa and mixed models. Bioinformatics 22, 2688– 2690. Stieber, M.T., 1982. Revision of Ichnanthus sect. Ichnanthus (Gramineae, Panicoideae). Syst. Bot. 7, 85–115. Stieber, M.T., 1987. Revision of Ichnanthus sect. Foveolatus (Gramineae, Panicoideae). Syst. Bot. 12, 187–216. Sun, Y., Skinner, D.Z., Liang, G.H., Hulbert, S.H., 1994. Phylogenetic analysis of Sorghum and related taxa using internal transcribed spacer of nuclear ribosomal DNA. Theor. Appl. Genet. 89, 26–32. Swofford, D.L., 2002. PAUP*. Phylogenetic analysis using parsimony (*and other methods), version 4.0b10. Sinauer, Sunderland, Massachusetts, USA. Taberlet, P., Gielly, L., Pautou, G., Bouvet, J., 1991. Universal primers for amplification of three non-coding regions of chloroplast DNA. Plant Mol. Biol. 17, 1105–1109.

57

Thiers, B., 2015 (continuously updated). Index Herbariorum: a global directory of public herbaria and associated staff. New York Botanical Garden's Virtual Herbarium. . Tropicos, 2015 (continuously updated). Missouri Botanical Garden. . van den Berg, C., Goldman, D.H., Freudenstein, J.V., Pridgeon, A.M., Cameron, K.M., Chase, M.W., 2005. An overview of the phylogenetic relationships within Epidendroideae inferred from multiple DNA regions and recircumscription of Epidendreae and Arethuseae (Orchidaceae). Am. J. Bot. 92, 613–624. White, T.J., Bruns, T., Lee, S., Taylor, J., 1990. Amplification and direct sequencing of fungal ribosomal RNA genes for phylogenetics, in: Innis, M.A., Gelfand, D.H., Sninsky, J.J., White, T.J. [Eds.], PCR: A guide to methods and applications. Academic Press, San Diego, California, pp. 315–322. Wiens, J.J., 1998. Combining data sets with different phylogenetic histories. Syst. Biol. 47, 568–581. Yang, H.-Q., Yang, J.-B., Peng, Z.-H., Gao, J., Yang, Y.-M., Peng, S., Li, D.-Z., 2008. A molecular phylogenetic and fruit evolutionary analysis of the major groups of the paleotropical woody bamboos (Gramineae: Bambusoideae) based on nuclear ITS, GBSSI gene and plastid trnL-F DNA sequences. Mol. Phylogenet. Evol. 48, 809–824. Zuloaga, F.O., 1987. A revision of Panicum subgenus Panicum section Rudgeana (Poaceae: Paniceae). Ann. MO Bot. Gard. 74, 463–478. Zuloaga, F.O., Giussani, L.M., Morrone, O., 2006. On the taxonomic position of Panicum aristellum (Poaceae: Panicoideae: Paniceae). Syst. Bot. 31, 497–505.

58

Zuloaga, F.O., Giussani, L.M., Morrone, O., 2007. Hopia, a new monotypic genus segregated from Panicum (Poaceae). Taxon 56, 145–156. Zuloaga, F.O., Salomón, L., Scataglini, M.A., 2014. Phylogeny of sections Clavelligerae and Pectinatae of Panicum (Poaceae, Panicoideae, Paniceae): establishment of the new subtribe Dichantheliinae and the genus Adenochloa. Plant Syst. Evol. (without volume and page numbers; published online in 31 December 2014). Zuloaga, F.O., Morrone, O., Killeen, T., 1993. Gerritea, a new genus of Paniceae (Poaceae: Panicoideae) from South America. Novon 3, 213–219. Zuloaga, F.O., Morrone, O., Davidse, G., Filgueiras, T.S., Peterson, P.M., Soreng, R., Judziewicz, E.J., 2003. Catalogue of the New World Grasses (Poaceae): III. Subfamilies Panicoideae, Aristidoideae, Arundinoideae and Danthonioideae. Contrib. U. S. Natl. Herb. 46, 1–662. Zuloaga, F.O., Scataglini, M.A., Morrone, O., 2010. A phylogenetic evaluation of Panicum sects. Agrostoidea, Megista, Prionitia and Tenera (Panicoideae, Poaceae): two new genera, Stephostachys and Sorengia. Taxon 59, 1535– 1546. Zuloaga, F.O., Sendulsky, T., 1988. A revision of Panicum subgenus Phanopyrum section Stolonifera (Poaceae: Paniceae). Ann. MO Bot. Gard. 75, 420–455.

59

Table 1 Voucher information and GenBank accession numbers for DNA sequences generated in this study. Species

Locality

Voucher

Apochloa euprepes (Renvoize) Zuloaga & Morrone

Brazil, Bahia, Palmeiras

Echinochloa colona (L.) Link Echinolaena gracilis Swallen Echinolaena inflexa (Poir.) Chase Gynerium sagittatum (Aubl.) P. Beauv. Hildaea breviscrobs (Döll) C. Silva & R.P. Oliveira Hildaea pallens (Sw.) C. Silva & R.P. Oliveira Hildaea pallens var. major (Nees) C. Silva & R.P. Oliveira Hildaea ruprechtii (Döll) C. Silva & R.P. Oliveira Hildaea tenuis (J. Presl & C. Presl) C. Silva & R.P. Oliveira Hildaea sp. Ichnanthus adpressus C. Silva & R.P. Oliveira Ichnanthus bambusiflorus (Trin.) Döll

Ichnanthus aff. bambusiflorus (Trin.) Döll

Ichnanthus calvescens (Nees ex Trin.) Döll

Ichnanthus dasycoleus Tutin Ichnanthus glaber (Raddi) Hitchc. Ichnanthus hirtus (Raddi) Chase Ichnanthus aff. hoffmannnseggii (Roem. & Schult.) Döll Ichnanthus inconstans (Trin. ex Nees) Döll

GenBank accession numbers trnH-(rps19)-psbA trnL-trnF

ndhF

rpl16

trnS-(psbZ)-trnG

ITS

C. Silva et al. 711 (HUEFS)

KP878922

KP878984

KP879034

KP879102

KP879164

KP878857

C. Silva 850 (HUEFS)

KP878923

KP878985

KP879035

KP879103

KP879165

KP878858

S.N. Moreira 1530 (BHCB)

KP878924

KP878986

KP879036

KP879104

KP879166

KP878859

Brazil, Bahia, Palmeiras

C. Silva et al. 271 (HUEFS)

KP878925

KP878987

KP879037

KP879105

KP879167

KP878860

Brazil, Paraná, Guaíra

C. Snak et al. 914 (HUEFS)

KP878926

KP878988

KP879038

KP879106

KP879168

KP878861

Brazil, Amapá, Porto Grande Brazil, Rio de Janeiro, Mangaratiba Australia, Queensland, El Arish (GO): Brazil, Goiás, Pirenópolis (RJ): Brazil, Rio de Janeiro, Petrópolis

R.P. Oliveira et al. 1885 (HUEFS) C. Silva & N.M. Corrêa 327 (HUEFS) R.J. Jago & B. Wannan 5716 (CANB)

KP878927

KP878989

KP879039

KP879107

KP879169

KP878862

KP878928

KP878990

KP879040

KP879108

KP879170

KP878863

–

–

KP879041

–

–

KP878864

C. Silva et al. 636 (HUEFS)

KP878929

–

KP879042

KP879109

–

KP878865

C. Silva 745 (HUEFS)

KP878930

KP878991

KP879043

KP879110

KP879171

KP878866

A.C. Mota & C. Silva 431 (HUEFS)

KP878932

KP878993

KP879045

KP879112

KP879173

KP878868

Costa et al. 903 (BHCB)

KP878931

KP878992

KP879044

KP879111

KP879172

KP878867

C. Silva & C. Snak 993 (HUEFS)

KP878933

KP878994

KP879046

KP879113

KP879174

KP878869

C. Silva et al. 255 (HUEFS)

–

–

KP879051

KP879118

KP879179

–

C. Silva et al. 746 (HUEFS)

KP878938

KP878999

KP879052

KP879119

KP879180

KP878874

C. Silva et al. 722 (HUEFS)

KP878934

KP878995

KP879047

KP879114

KP879175

KP878870

C. Silva et al. 751-A (HUEFS)

KP878935

KP878996

KP879048

KP879115

KP879176

KP878871

(BA): Brazil, Bahia, Olivença

C. Silva et al. 416 (HUEFS)

KP878939

KP879000

KP879053

KP879120

KP879181

KP878875

(CE): Brazil, Ceará, Ibiapina

A.C. Mota & C. Silva 452 (HUEFS)

KP878940

KP879001

KP879054

KP879121

KP879182

KP878876

C. Silva et al. 648 (HUEFS)

KP878941

–

KP879055

KP879122

KP879183

KP878877

C. Silva 769 (HUEFS)

KP878942

KP879002

KP879056

KP879123

KP879184

KP878878

KP878943

KP879003

KP879057

KP879124

KP879185

KP878879

Brazil, Bahia, Feira de Santana Brazil, Mato Grosso do Sul, Coxim

Brazil, Ceará, Baturité (PA): Brazil, Pará, Canaã dos Carajás Brazil, Minas Gerais, Lima Duarte (BA): Brazil, Bahia, Morro do Chapéu (MG): Brazil, Minas Gerais, Lima Duarte (BA): Brazil, Bahia, Palmeiras (MG): Brazil, Minas Gerais, Lima Duarte

(GO): Brazil, Goiás, Pirenópolis Brazil, Bahia, Morro do Chapéu Brazil, Bahia, Feira de Santana Brazil, Rio de Janeiro, Mangaratiba

C. Silva & J.G. Freitas 315 (HUEFS) C. Silva & N.M. Corrêa 357 (HUEFS)

KP878944

KP879005

KP879058

KP879125

KP879186

KP878880

Brazil, Maranhão, Carolina

C. Silva et al. 815 (HUEFS)

KP878936

KP878997

KP879049

KP879116

KP879177

KP878872

Brazil, Minas Gerais, Grão Mogol

C. Silva et al. 475 (HUEFS)

KP878945

KP879006

KP879059

KP879126

–

KP878881

60

Species Ichnanthus lancifolius Mez Ichnanthus leiocarpus (Spreng.) Kunth Ichnanthus aff. leiocarpus (Spreng.) Kunth Ichnanthus leptophyllus Döll Ichnanthus longiglumis Mez Ichnanthus mollis Ekman Ichnanthus nemoralis (Schrad.) Hitchc. & Chase Ichnanthus oplismenoides Munro ex Döll Ichnanthus panicoides P. Beauv. Ichnanthus riedelii (Trin.) Döll Ichnanthus zehntneri Mez Ichnanthus sp.

Melinis repens (Willd.) Zizka Ocellochloa stolonifera (Poir.) Zuloaga & Morrone Oedochloa camporum (Swallen) C. Silva & R.P. Oliveira Oedochloa cordata (Ekman) C. Silva & R.P. Oliveira Oedochloa grandifolia (Döll) C. Silva & R.P. Oliveira Oedochloa minarum (Nees) C. Silva & R.P. Oliveira Oedochloa procurrens (Nees ex Trin.) C. Silva & R.P. Oliveira Oplismenus hirtellus (L.) P. Beauv. Orthoclada laxa (Rich.) P. Beauv. Ottochloa nodosa (Kunth) Dandy

Panicum aquaticum Poir. Panicum cervicatum Chase Panicum racemosum (P. Beauv.) Spreng. Pseudechinolaena polystachya (Kunth) Stapf

Locality

Voucher

Brazil, Rio de Janeiro, Mangaratiba Brazil, Rio de Janeiro, Mangaratiba Brazil, Rio de Janeiro, Mangaratiba Brazil, Maranhão, Carolina Brazil, Minas Gerais, Diamantina Brazil, Goiás, Pirenópolis

C. Silva & N.M. Corrêa 347 (HUEFS) C. Silva & N.M. Corrêa 339 (HUEFS) C. Silva & N.M. Corrêa 332 (HUEFS) C. Silva et al. 892 (HUEFS)

GenBank accession numbers trnH-(rps19)-psbA trnL-trnF

ndhF

rpl16

trnS-(psbZ)-trnG

ITS

KP878946

KP879007

KP879060

KP879127

KP879187

KP878882

KP878947

KP879008

KP879061

KP879128

KP879188

KP878883

KP878937

KP878998

KP879050

KP879117

KP879178

KP878873

KP878948

KP879009

KP879062

KP879129

KP879189

KP878884

C. Silva et al. 522 (HUEFS)

KP878949

KP879010

KP879063

KP879130

KP879190

KP878885

C. Silva 990 (HUEFS)

KP878950

KP879011

KP879064

KP879131

KP879191

KP878886

Brazil, Bahia, Ilhéus

C. Silva et al. 260 (HUEFS)

KP878951

KP879012

KP879065

KP879132

KP879192

KP878887

Brazil, Maranhão, Carolina

C. Silva et al. 891 (HUEFS)

KP878952

KP879013

KP879066

KP879133

KP879193

KP878888

Brazil, Amapá, Serra do Navio Brazil, Bahia, Olivença Brazil, Bahia, Morro do Chapéu (BA): Brazil, Bahia, Barro Preto (MG): Brazil, Minas Gerais, Santana do Riacho Brazil, Distrito Federal, Brasília Brazil, Rio de Janeiro, Paracambi Brazil, Goiás, Alto Paraíso de Goiás

R.P. Oliveira et al. 1857 (HUEFS) C. Silva et al. 422 (HUEFS)

KP878953

KP879014

KP879067

KP879134

KP879194

KP878889

KP878954

KP879016

KP879068

KP879135

KP879195

KP878890

C. Silva 771 (HUEFS)

KP878957

KP879019

KP879071

KP879138

KP879198

KP878893

R.P. Oliveira et al. 1216 (HUEFS)

KP878955

KP879017

KP879069

KP879136

KP879196

KP878891

C. Silva et al. 550 (HUEFS)

KP878956

KP879018

KP879070

KP879137

KP879197

KP878892

C. Silva et al. 626 (HUEFS)

KP878958

KP879020

KP879072

KP879139

KP879199

KP878894

C. Silva & T.A. Amorim 368 (HUEFS)

KP878959

KP879021

KP879073

KP879140

KP879200

KP878895

C. Silva et al. 676 (HUEFS)

KP878960

KP879022

KP879074

KP879141

KP879201

KP878896

Brazil, Maranhão, Loreto

C. Silva et al. 872 (HUEFS)

KP878961

KP879023

KP879075

KP879142

KP879202

KP878897

KP878962

KP879004

KP879076

KP879143

KP879203

KP878898

KP878963

KP879024

KP879077

KP879144

KP879204

KP878899

KP878964

KP879015

KP879078

KP879145

KP879205

KP878900

KP878965

–

KP879079

KP879146

KP879206

KP878901

–

KP878983

KP879033

KP879101

KP879163

KP878856

–

–

KP879080

–

–

KP878902

KP878966

–

KP879081

–

–

KP878903

Brazil, Bahia, Igrapiúna Brazil, Minas Gerais, Datas

K.M. Pimenta & R.P. Oliveira 50 (HUEFS) Z.L. Wagner & P.L. Viana 9613 (BHCB)

Brazil, Bahia, Palmeiras

C. Silva et al. 270-A

Brazil, Rio de Janeiro, Mangaratiba Brazil, Bahia, Ilhéus (1): Australia, Queensland, State Forest (2): Australia, Queensland, Bluewater range (3): Indonesia, Papua, Mount Jaya Brazil, Bahia, Camaçari Brazil, Goiás, Cristalina

C. Silva & N.M. Corrêa 351 (HUEFS) C. Silva et al. 939 (HUEFS) E.J. Thompson et al. 102 (CANB) R.J. Cumming 15324 (CANB)

–

–

KP879082

–

–

KP878904

C. Silva 853 (HUEFS) C. Silva 591 (HUEFS)

KP878967 KP878968

KP879025 KP879026

KP879083 KP879084

KP879147 KP879148

KP879207 KP879208

KP878905 KP878906

Brazil, Bahia, Camaçari

C. Silva 852 (HUEFS)

KP878969

KP879027

KP879085

KP879149

KP879209

KP878907

Brazil, Rio de Janeiro, Paracambi

C. Silva & T.A. Amorim 365 (HUEFS)

KP878970

KP879028

KP879086

KP879150

KP879210

KP878908

F.R. Willis et al. 87 (CANB)

61

Species

Locality

Voucher

Renvoizea trinii (Kunth) Zuloaga & Morrone

Brazil, Bahia, Lençóis

C. Silva et al. 718 (HUEFS)

Renvoizea sp.

(BA): Brazil, Bahia, Mucugê

Rugoloa pilosa (Sw.) Zuloaga Schizachyrium condensatum (Kunth) Nees Streptostachys asperifolia Desv. Yakirra australiensis var. australiensis (Domin) Lazarides & R.D. Webster Yakirra australiensis var. intermedia R.D. Webster Yakirra majuscula (F. Muell. ex Benth.) Lazarides & R.D. Webster Yakirra muelleri (Hughes) Lazarides & R.D. Webster Yakirra nulla Lazarides & R.D. Webster Yakirra pauciflora (R.Br.) Lazarides & R.D. Webster

GenBank accession numbers trnH-(rps19)-psbA trnL-trnF

ndhF

rpl16

trnS-(psbZ)-trnG

ITS

KP878972

KP879029

KP879088

KP879151

KP879211

KP878909

KP878971

–

KP879087

–

–

–

KP878973

KP879030

KP879089

KP879152

KP879212

KP878910

C. Silva 843 (HUEFS)

KP878974

KP879031

KP879090

KP879153

KP879213

KP878911

C. Silva et al. 775 (HUEFS)

KP878975

KP879032

KP879091

KP879154

KP879214

KP878912

Australia, Western Australia, Fitzgerald district

S. Legge & S. Murphy 22 (CANB)

KP878976

–

KP879092

KP879155

–

KP878913

Australia, Western Australia, Moorak Australia, Western Australia, Fitzgerald district Australia, Queensland, Moorina

K.F. Keneally 10619 (CANB) S. Legge & S. Murphy 856 (CANB) R.J. Cumming 15771 (CANB) L.A. Craven & G. Whitbread 8135 (CANB)

–

–

KP879093

–

KP878914

KP878977

–

KP879094

KP879157

KP879215

KP878915

KP878978

–

KP879095

KP879158

–

KP878916

–

–

KP879096

–

–

KP878917

I. Cowie 2698 (CANB)

KP878979

–

KP879097

KP879159

–

KP878918

K. Pajimans 2355 (CANB)

KP878980

–

KP879098

KP879160

–

KP878919

A.A. Mitchell 3820 (CANB)

KP878981

–

KP879099

KP879161

–

KP878920

I. Cowie & G. Leach 3891 (CANB)

KP878982

–

KP879100

KP879162

–

KP878921

Brazil, Rio de Janeiro, Mangaratiba Brazil, Rio de Janeiro, Angra dos Reis Brazil, Piauí, São Raimundo Nonato

Australia, Jabiru (1): Australia, Northern Territory, Groote Eylandt (2): Australia, 40 km NE of Wyndham (3): Australia, Baines, Keep River National Park (4): Australia, Northern Territory, Bickerton Island

R.P. Oliveira et al. 2081 (HUEFS) C. Silva & N.M. Corrêa 335 (HUEFS)

KP879156

62

Table 2 Primers used for amplification and sequencing, and PCR conditions. PCR Conditions DNA region

Primer name

Primer Sequence 5’–3’

Reference

17SE (F)

ACG AAT TCA TGG TCC GGT GAA GTG TTC G

Sun et al. (1994)

26SE (F)

TAG AAT TCC CCG GTT CGC TCG CCG TTA C

Sun et al. (1994)

92 (F)*

AAG GTT TCC GTA GGT GAA C

Desfeux et al. (1996)

4 (R)*

TCC TCC GCT TAT TGA TAT GC

White et al. (1990)

C (F)

CGA AAT CGG TAG ACG CTA CG

Taberlet et al. (1991)

F (R)

ATT TGA ACT GGT GAC ACG AG

Taberlet et al. (1991)

Pre-melting

Denaturation (I)

Primer Annealing (II)

Primer Extension (III)

Cycles (I + II + III)

Final Extension

94 °C (1 min)

94 °C (30 s)

50 °C (40 s)

72 °C (40 s)

28

72 °C (5 min)

ITS

trnL-trnF UUC

(F)

GTA GCG GGA ATC GAA CCC GCA TC

Shaw et al. (2005)

GCU

(R)

AGA TAG GGA TTC GAA CCC TCG GT

Shaw et al. (2005)

F71 (F)

GCTATGCTTAGTGTGTGTCTC

Giussani et al. (2009)

R1661 (R)

CCAKATTTTTCCACCACGAC

Giussani et al. (2009)

psbA (F)

GTT ATG CAT GAA CGT AAT GCT C

Shaw et al. (2005)

CGC GCA TGG TGG ATT CAC AAT TC

Shaw et al. (2005)

1 (F)

ATG GAA CA(GT) ACA TAT (CG)AA TAT GC

Olmstead and Sweere (1994)

536 (F)

TTG TAA CTA ATC GTG TAG GGG A

Olmstead and Sweere (1994)

536 (R)

TCC CCT ACA CGA TTA GTT ACA A

Olmstead and Sweere (1994)

972 (F)

GTC TCA ATT GGG TTA TAT GAT G

Olmstead and Sweere (1994)

972 (R)

CAT CAT ATA ACC CAA TTG AGA C

Olmstead and Sweere (1994)

1318 (F)

GGA TTA AC(CT) GCA TTT TAT ATG TTT CG

Olmstead and Sweere (1994)

1318 (R)

CGA AAC ATA TAA AAT GC(AG) GTT AAT CC

Olmstead and Sweere (1994)

1660 (F)

CTT TTT ACT TTG TTC ATT GGA T

Aliscioni et al. (2003)

1660 (R)

ATC CAA TGA ACA AAG TAA AAA G

Aliscioni et al. (2003)

2110 (R)

CCC CCT A(CT)A TAT TTG ATA CCT TCT CC

Olmstead and Sweere (1994)

trnG trnS-(psbZ)-trnG

trnS rpl16

trnH-(rps19)-psbA trnH

GUG

(R)

ndhF

Following manufacterer’s protocol

94 °C (1 min)

94 °C (30 s)

55 °C (40 s)

72 °C (40 s)

40

72 °C (5 min)

94 °C (1 min)

94 °C (45 s)

55 °C (40 s)

72 °C (1 min, 10 s)

35

72 °C (5 min)

94 °C (1 min)

94 °C (45 s)

55 °C (40 s)

72 °C (2 min)

35

72 °C (5 min)

94 °C (1 min)

94 °C (30 s)

53 °C (40 s)

72 °C (40 s)

35

72 °C (5 min)

94 °C (1 min)

94 °C (30 s)

53 °C (40 s)

72 °C (40 s)

35

72 °C (5 min)

Notes: Primers marked with an asterisk were used for sequencing only. The remaining were used both for amplifying and sequencing.

63

Table 3 Features of the DNA data sets used in this study based on one of the most parsimonious trees from the combined parsimony analysis (percentages calculated in relation to aligned length), and nucleotide substitution models selected for the Bayesian analyses. DNA region

Aligned length (bp)

No. variable sites (except excluded sites)

No. parsimony informative sites (except excluded sites)

No. changes/ variable sites

Fitch tree length

CI

RI

ts:tv

Bayesian model

849

361 (42.52%)

283 (33.33%)

4.49

1621

0.37

0.68

1.78

–

18S

111

11 (9.91%)

6 (5.40%)

2.18

24

0.54

0.73

5

SYM+I+G

ITS1

242

153 (63.22%)

126 (52.07%)

4.94

756

0.36

0.69

1.77

SYM+I+G

5.8S

165

21 (12.73%)

14 (8.48%)

3.33

70

0.36

0.63

4

SYM+I+G

ITS2

238

167 (70.17%)

131 (55.04%)

4.45

743

0.37

0.68

1.59

SYM+I+G

26S

93

9 (9.68%)

6 (6.45%)

3.11

28

0.39

0.68

3.67

SYM+I+G

trnL-trnF

1241

214 (17.24%)

101 (8.14%)

1.49

320

0.76

0.86

0.81

–

587

109 (18.57%)

50 (8.52%)

1.49

162

0.76

0.87

1.16

GTR+G

ITS

trnL intron trnL exon 2

50

1 (2%)

0

1

1

1

0/0

–

K80

trnL-trnF interg. spacer

604

104 (17.22%)

51 (8.44%)

1.51

157

0.74

0.85

0.54

GTR+G

1037

185 (17.84%)

84 (8.10%)

1.52

282

0.77

0.87

1.24

–

trnS gene

72

3 (4.17%)

1 (1.39%)

1.67

5

0.6

0.5

–

HKY+I

trnS-psbZ interg. spacer

368

86 (23.37%)

45 (12.23%)

1.55

133

0.74

0.85

1.05

GTR+G

psbZ gene

189

18 (9.52%)

5 (2.64%)

1.22

22

0.91

0.89

2.67

HKY+I

psbZ-trnG interg. spacer

340

75 (22.06%)

30 (8.82%)

1.59

119

0.79

0.88

1.16

GTR+G HKY+I

trnS-(psbZ)-trnG

68

3 (4.41%)

3 (4.41%)

1

3

1

1

–

1409

284 (20.16%)

134 (9.51%)

1.69

481

0.70

0.78

0.79

–

rpl16 intron

1271

269 (21.16%)

129 (10.15%)

1.73

465

0.69

0.77

0.79

GTR+I+G

rpl16 exon 2

138

15 (10.87%)

5 (3.62%)

1.07

16

0.94

92

1

F81

trnH-(rps19)-psbA

663

60 (9.05%)

30 (4.52%)

1.57

94

0.77

0.84

1.54

–

96

8 (8.33%)

3 (3.12%)

1.25

10

0.9

0.86

9

GTR+I HKY+I+G

trnG gene rpl16

trnH gene trnH-rps19 interg. spacer

82

7 (8.54%)

5 (6.10%)

1.29

9

0.89

0.96

1.25

rps19 gene

282

20 (7.09%)

10 (3.55%)

1.65

33

0.70

0.71

1.75

GTR+I

rps19-psbA interg. spacer

136

22 (16.18%)

11 (8.09%)

1.77

39

0.74

0.84

1.05

HKY+I+G GTR+I

psbA gene

67

3 (4.48%)

1 (1.49%)

1

3

1

1

2

2169

391 (18.03%)

213 (9.82%)

1.67

655

0.71

0.84

1.53

–

ndhF gene (1st positions)

–

120

60

1.6

192

0.74

0.87

1.21

GTR+I+G

ndhF gene (2nd positions)

–

63

29

1.49

94

0.75

0.88

0.88

GTR+I+G

ndhF gene (3rd positions)

–

208

124

1.77

369

0.68

0.82

2.02

GTR+G

6519

1134 (17.39%)

562 (8.62%)

1.61

1832

0.73

0.84

1.11

mixed

Plastids + ITS 7368 1495 (20.29%) 845 (11.47%) Notes: bp = base pairs; CI = consistency index; RI = retention index; ts:tv = transition/transversion ratio.

2.31

3453

0.56

0.76

1.38

mixed

ndhF

Plastids

64

Fig. 1. Majority-rule consensus cladogram tree and respective phylogram resulting from the combined nuclear (ITS) and plastid (ndhF, rpl16, trnH-(rps19)-psbA, trnLtrnF, and trnS-(psbZ)-trnG) Bayesian analysis showing the relationships among the species of Echinolaena and Ichnanthus within Panicoideae. Bayesian posterior probabilities (only values > 50%) and parsimony bootstrap support values are reported above and below branches, respectively. Branches supported by 100% posterior probability are in bold. Arrowheads indicate nodes collapsed in the Maximum Parsimony strict consensus. Asterisks indicate the placement of Ichnanthus adpressus, I. lancifolius, and I. leptophyllus.

Fig. 2. First part of the majority-rule consensus phylogram tree resulting from the ndhF extended Bayesian analysis showing the relationships among the species of Echinolaena and Ichnanthus within Panicoideae. Bayesian posterior probabilities (only values > 50%) and parsimony bootstrap support values are reported above and below branches, respectively. Branches supported by 100% posterior probability are in bold. Arrowheads indicate nodes collapsed in the Maximum Parsimony strict consensus. Asterisks indicate the placement of Ichnanthus adpressus, I. lancifolius, and I. leptophyllus. Names of other panicoid taxa with rachilla appendages are highlighted in blue. Nodes corresponding to genera were collapsed to reduce the length of the tree. Full tree available in Appendix B.8.

Fig. 3. Second part of the majority-rule consensus phylogram tree resulting from the ndhF extended Bayesian analysis showing the relationships among the species of Echinolaena and Ichnanthus within Panicoideae. Bayesian posterior probabilities (only values > 50%) and parsimony bootstrap support values are reported above and

65

below branches, respectively. Branches supported by 100% posterior probability are in bold. Arrowheads indicate nodes collapsed in the Maximum Parsimony strict consensus. Names of other panicoid taxa with rachilla appendages are highlighted in blue. Nodes corresponding to genera were collapsed to reduce the length of the tree. Full tree available in Appendix B.8.

Fig. 4. Likelihood ancestral reconstruction of the rachilla appendages within Panicoideae based on the majority-rule consensus tree resulting from the combined data set Baysian analysis (without Ichnanthus adpressus, I. lancifolius, and I. leptophyllus).

Fig. 5. Morphological variation in the upper anthecium and rachilla appendages of the species of Hildaea (A1–A7), Oedochloa (B1–B11), Echinolaena (C1–C3) and Ichnanthus (D1–D24). (A1, A2) H. breviscrobs. (A1) F/VV, and (A2) F/LV. (A3) H. nemorosa. F/VV. (A4) H. pallens var. pallens. NF/VV. (A5) H. pallens var. major. NF/VV. (A6) H. ruprechtii. NF/VV. (A7) H. tenuis. F/VV. (B1–B3) O. camporum. (B1) NF/VV, (B2) NF/LV, and (B3) NF/DV. (B4) O. cordata. NF/VV. (B5) O. ecuadoriana. NF/VV. (B6) O. grandifolia. NF/VV. (B7). O. lanceolata. NF/VV. (B8) O. mayarensis. NF/VV. (B9) O. minarum. NF/VV. (B10; hydrated) O. procurrens. NF/VV. (B11) O. standleyi. NF/VV. (C1) E. gracilis. NF/VV. (C2, C3; hydrated) E. inflexa. (C2) NF/VV. (C3) NF/LV. (D1; hydrated) I. adpressus. F/VV. (D2, D3) I. bambusiflorus. (D2) F/VV, and (D3) F/LV. (D4) I. calvescens. F/VV. (D5) I. dasycoleus. NF/VV. (D6) I. ephemeroblepharis. NF/VV. (D7) I. glaber. F/VV. (D8) I. hirtus. F/VV. (D9) I. hoffmannseggii. NF/VV. (D10) I. inconstans. F/VV. (D11) I. lancifolius. NF/VV. (D12) I. leiocarpus. F/VV. (D13) I. leptophyllus. F/VV. (D14) I. longhi-wagnerae. NF/VV.

66

(D15) I. longiglumis. NF/VV. (D16) I. mexicanus. NF/VV. (D17) I. mollis. F/VV. (D18) I. nemoralis. F/VV. (D19, D20) I. oplismenoides. (D19) NF/VV, and (D20) F/VV. (D21) I. panicoides. NF/VV. (D22) I. riedelii. NF/VV. (D23) I. tarumanensis. NF/VV. (D24) I. zehntneri. NF/VV. Notes: DV = dorsal view; F = fertile; LV = lateral view; NF = nonfertile; VV = ventral view.

67

68

69

70

71

72

Highlights



Multi-locus phylogenetic analyses recovered the tropical grass genera Echinolaena and Ichnanthus as polyphyletic.



The independent origin of rachilla appendages in Paniceae and Paspaleae is corroborated.



Two new genera within Paspaleae are proposed: Hildaea and Oedochloa.



The phylogenetic placement of Ichnanthus adpressus, I. lancifolius and I. leptophyllus is uncertain.



Morphological data suggests that Malagasy Chasechloa is an independent lineage from Echinolaena.