Phylogenetics of the pademelons (Macropodidae: Thylogale) and historical biogeography of the Australo-Papuan region

Molecular Phylogenetics and Evolution 57 (2010) 1134–1148

Contents lists available at ScienceDirect

Molecular Phylogenetics and Evolution journal homepage: www.elsevier.com/locate/ympev

Phylogenetics of the pademelons (Macropodidae: Thylogale) and historical biogeography of the Australo-Papuan region Peggy Macqueen a,⇑, Jennifer M. Seddon b, Jeremy J. Austin c,d, Steven Hamilton e, Anne W. Goldizen a a

The University of Queensland, School of Biological Sciences, St. Lucia, Queensland 4072, Australia The University of Queensland, School of Veterinary Science, Gatton, Queensland 4343, Australia c Australian Centre for Ancient DNA, The University of Adelaide, School of Earth and Environmental Sciences, North Terrace Campus, South Australia 5005, Australia d Sciences Department, Museum Victoria, GPO Box 666E, Melbourne, Victoria 3000, Australia e University of New South Wales, School of Biological Sciences, Sydney, New South Wales 2152, Australia b

a r t i c l e

i n f o

Article history: Received 22 March 2010 Revised 23 May 2010 Accepted 9 August 2010 Available online 19 August 2010 Keywords: Australia Glacial cycles New Guinea Nuclear intron Marsupial Pademelon Pleistocene Thylogale Torres Strait

a b s t r a c t Australia and New Guinea share a common biogeographical history and unique vertebrate fauna. Investigation of genetic relationships among the wet forest-restricted pademelons (Macropodidae: Thylogale) provides insight into the historical connections between the two regions and the evolution of the Australasian marsupial fauna. Molecular phylogenetic relationships among Thylogale species were analysed using mitochondrial (12S rRNA and cytochrome b) and nuclear (omega-globin intron) sequence data with Bayesian and maximum likelihood methods. Australian species were resolved as well-supported, monophyletic clades, whereas endemic New Guinean species did not form clades consistent with current morphological taxonomy. Estimates of divergence using a Bayesian relaxed molecular clock model with standard mammalian nucleotide substitution rates indicated radiation of the genus in Australia in the mid to late Miocene. Persistence of Australian species of Thylogale in both southern temperate and northern tropical forests throughout the drying of the Australian continent can be attributed to their having a greater dietary flexibility than other browsing forest macropods. Divergence of the endemic New Guinean lineage occurred in the late Miocene to early Pliocene, indicating the presence of a partially forested landbridge connecting Australia and New Guinea during the Miocene. Mid-Pleistocene divergence between subspecies of the trans-Torresian T. stigmatica implies gene flow during glacial maxima between forest populations in the southern lowlands of New Guinea and the northern Cape York region of Australia. Complex structuring and relatively limited differentiation among populations of the endemic New Guinean species appears to have been influenced by the uplift of land and climate-induced redistribution of forest habitats during the late Pliocene and Pleistocene period. This is in strong contrast to the long evolutionary history and comparatively deep genetic divergence of Thylogale species in Australia. Further evaluation of the species status of the New Guinean Thylogale using more informative nuclear markers and extensive sampling is required. Ó 2010 Elsevier Inc. All rights reserved.

1. Introduction Australia and New Guinea are well known for their high species endemism and distinctive vertebrate fauna. These regions share a common biogeographical history; however, the long-term geological stability of the Australian landscape strongly contrasts with the relatively rapid formation of the New Guinean landmass from the Oligo-Miocene to the present. Therefore, to understand the shared evolutionary history of the modern Australo-Papuan fauna,

⇑ Corresponding author. Fax: +61 7 3365 1655. E-mail addresses: [email protected] (P. Macqueen), [email protected] (J.M. Seddon), [email protected] (J.J. Austin), [email protected] (S. Hamilton), [email protected] (A.W. Goldizen). 1055-7903/$ - see front matter Ó 2010 Elsevier Inc. All rights reserved. doi:10.1016/j.ympev.2010.08.010

it is necessary to determine the influence of geological and climatic events during this period on species’ dispersal and vicariance. Throughout the Miocene, the northward drift of the Australian plate and concurrent global climatic changes resulted in major shifts in the regional climate (Hill, 2004). The onset of drier, cooler conditions from the mid to late Miocene drove the progressive fragmentation of rainforest until, by the late Pliocene and early Pleistocene, the Australian vegetation had become dominated by more open woodlands and grasslands (Kershaw et al., 1994; Hill et al., 1999; Martin, 2006). This widespread shift in vegetation type can also be inferred indirectly from the fossil record (Hope, 1982; Archer et al., 1994; Tedford et al., 2006), and from dated molecular phylogenies of Australian genera (Blacket et al., 1999; Krajewski et al., 2000; Crisp et al., 2004; Meredith et al., 2008), which indicate radiation of arid-zone adapted species and grazing macropods

P. Macqueen et al. / Molecular Phylogenetics and Evolution 57 (2010) 1134–1148

(wallabies and kangaroos) during the late Miocene and Pliocene. The subsequent climatic fluctuations of the Pleistocene period produced intermittent contraction and re-expansion of remnant wet forests in Australia, further fragmenting these habitats (Hope et al., 2004). Concurrent with these climatic changes, continental drift of the Australian landmass into lower latitudes resulted in collision between the Australian and Pacific plates and the formation and rapid uplift of the New Guinean landmass (Hall, 2002). Present-day New Guinea is therefore made up of the northern edge of the Australian plate (now the southern lowlands of New Guinea), a rugged central mountainous spine produced by orogenesis during the mid Miocene to Pliocene (the Central Cordillera), and a northern region comprised of numerous terranes that have progressively coalesced and uplifted at the margin of the Australian plate (Pigram and Davies, 1987; Hall, 2002). It is possible that much of this geologically composite region of northern New Guinea was submerged until the Plio-Pleistocene, with emergent ‘islands’ that now form isolated mountain ranges (Chappell, 1993; Hall, 2002). New Guinea is currently separated from the northeastern tip of Australia by a shallow sea strait (Torres Strait) only 150 km wide. Lowered sea levels (Fig. 1a) during the Pleistocene glacial periods provided recent, intermittent land connections between Australia and New Guinea across this region and the Arafura shelf to the

1135

west (Voris, 2000; Chivas et al., 2001; Yokoyama et al., 2001). During at least the Late Pleistocene Glacial Maximum (21,000 ± 2000 ybp), this landbridge was thought to be an extensive plain with rivers, grassland, open woodland and riparian gallery forest (Nix and Kalma, 1972; Chivas et al., 2001; Rowe, 2007). Determining the timing of divergence between Australian and New Guinean taxa, and the nature of the radiation of fauna endemic to New Guinea, has been of particular biogeographical interest (Schodde and Calaby, 1972; Ziegler, 1977; Flannery, 1989a; Archer et al., 1991; Aplin et al., 1993; Kirsch and Springer, 1993; Krajewski et al., 1993). Recent phylogenetic studies of a number of vertebrate taxa using mitochondrial and nuclear sequence data have inferred numerous dispersal events to, and from, New Guinea since the late Miocene (Table 1). These studies imply that at least some form of landbridge has existed intermittently from the early Miocene to the Holocene. Freshwater river connections both during and prior to the Pleistocene have also been inferred from studies of melanotaeniid fish (McGuigan et al., 2000) and crayfish (Cherax quadricarinatus) (Baker et al., 2008). Current patterns of genetic divergence within and among New Guinean genera are likely to be complex, reflecting the timing and availability of suitable habitat for dispersal of ancestral species between Australia and New Guinea, as well as the geologically mobile nature of much of the New Guinean landscape.

Fig. 1. (a) Map of Australia and New Guinea showing the approximate position of sea level at the Last Glacial Maximum (shaded). (b) Map of Australia showing distributions of Thylogale species (adapted from Strahan, 1995). (c) Map of New Guinea showing distributions of Thylogale species (adapted from Flannery, 1995). Locations for recently extinct populations of T. brunii and T. billardierii are indicated by broken lines. The Central Cordillera of New Guinea is represented by a dotted line.

1136

P. Macqueen et al. / Molecular Phylogenetics and Evolution 57 (2010) 1134–1148

Table 1 Summary of published estimates for the timing of divergence between Australian and New Guinean vertebrate taxa based on DNA sequence data. Genera

Group

Habitat

Molecular marker

Divergence estimates a

Study

Petaurus spp.

Marsupial

Open dry forest and montane wet forest Open dry forest and montane wet forest Open dry forest and montane wet forest

mtDNA (ND2, ND4)

4.5–5.8 Mya (Australian P. breviceps– New Guinean P. breviceps) 7.9–10.7 Myaa (P. abidi–P. norfolcensis/ P. gracilis/P. breviceps 17.9–23.9 Myaa (P. australis–all other Petaurus)

Malekian et al. (2010)

Phascolosoricines/ Dasyurus spp. and Sarcophilus spp.

Marsupial

Wet montane forests/wet forests, open forests

mtDNA (cyt b, 12S rRNA)

8 Mya (Phascolosorex/Neophascogale– Dasyurus/Sarcophilus)

Krajewski et al. (2004)

Echymipera spp.

Marsupial

Open dry forests, savannah, wet forests

mtDNA (12S rRNA)

1.7–3.6 Mya (E. rufescens rufescens–E. r. australis)

Westerman et al. (2001)

Myoictis spp./ Australian Dasyurins

Marsupial

Wet lowland forests/desert and shrublands

mtDNA (cyt b, 12S rRNA)

10.9–16.4 Mya (Myoictis–Dasyuroides/Dasycercus

Westerman et al. (2006)

Planigale spp.

Marsupial

Grasslands, open dry forests and wet forests

mtDNA (12S rRNA)

Late Pliocene to early Pleistocene (Australian P. maculata– New Guinean P. novaeguineae)

Blacket et al. (2000)

Cercartetus caudatus

Marsupial

Dry forests, heathland and wet forests

mtDNA (ND2)

3–4 Mya (Australian C. caudatus–New Guinean C. caudatus)

Osborne and Christidis (2002b)

Meliphaga spp.

Bird

Open forest, wet lowland forests Wet forests, open forest

mtDNA (ND2)

1.2–1.5 Mya (M. gracilis)

Norman et al. (2007)

4 Mya (M. lewinii/M. notata–M. aruensis, and M. albilineata/M. fordiana–New Guinean Meliphaga)

Sericulus spp.

Bird

Wet forests

mtDNA (cyt b, ND2)

3.7–4.3 Mya (Australian S. chrysocephalus–New Guinean Sericulus)

Zwiers et al. (2008)

Acanthophis spp.

Reptile

Grasslands, open, dry and wet forests Grasslands, open, dry and wet forests

mtDNA (cyt b, ND4)

0.43–0.60 Myaa (New Guinean A. rugosus–Australian A. rugosus) 5.60–7.82 Myaa (New Guinean Acanthophis–Australian Acanthophis).

Wüster et al. (2005)

Pseudechis spp.

Reptile

Open forests, wet forests, grasslands

mtDNA (cyt b, ND4)

1.95–2.95 Myaa (P. papuanus–P. guttatus/P. colletti) 3.57–5.89 Myaa (New Guinean P. cf. australis–Australian P. cf. australis)

Wüster et al. (2005)

Oxyuranus scutellatus

Reptile

Grasslands, open, dry and wet forests

mtDNA (cyt b, ND4)

Late Pleistocene (Oxyuranus s. scutellatus–Oxyuranus s. canni)

Wüster et al. (2005)

Pseudechis australis

Reptile

Grasslands, open, dry and wet forests

mtDNA (cyt b, ND4, tRNA)

Pliocene to Late Miocene (New Guinean P. australis–Australian P. australis)

Kuch et al. (2005)

a Ranges for divergence estimates are not confidence intervals but represent the range of means estimated with different dating methods or nucleotide substitution rates. All other divergence estimate ranges are indicated by the upper and lower confidence intervals, if reported, rather than the mean.

Pademelons (Thylogale spp.) are medium-sized wallabies found in the dense wet sclerophyll forests and rainforests of eastern Australia and New Guinea (Fig. 1b and c). In Australia there are three extant species (Tate, 1948; Ride, 1957; Sharman, 1961; Strahan, 1995): the Tasmanian pademelon (T. billardierii), now restricted to Tasmania but found in southern wet forests on the mainland up until the 1800s; the red-necked pademelon (T. thetis), distributed along the mid-east coast of Australia in disjunct areas of wet forest; and the red-legged pademelon (T. stigmatica), with subspecies T. s. wilcoxi in the mid-east coast of Australia (sympatric with T. thetis in the south of its range), T. s. stigmatica in the northeastern tropical rainforests, and T. s. coxenii in the monsoonal forests of Cape York. A Papuan subspecies, T. s. oriomo, is restricted to monsoonal forests in the TransFly region of southern Papua New Guinea (Tate and Archbold, 1937; Tate, 1948). An extinct species, T. ignis, has been described from the Hamilton Local Fauna (4.46 ± 0.1 My) in southeastern Australia (Flannery et al., 1992). In New Guinea, three extant endemic species have been described from a complex previously considered by Tate and Archbold (1937) as three species (Macropus browni, M. brunii, with two subspecies, and M. keysseri, with two subspecies), but then by Tate (1948) as a single species (T. brunii) with three subspecies. The revised T. brunii complex recognises T. brunii, T. browni, and a new

species, T. calabyi (Flannery, 1992). The dusky pademelon, T. brunii, includes populations on the Aru Islands and in the lowland monsoonal forests to the south of the central mountain range. A population of this species once found in the Port Moresby region is now thought to be extinct due to overhunting (Flannery, 1995). The New Guinea pademelon, T. browni, is comprised of a lowland/ mid-montane subspecies, T. b. browni, found predominantly north of the Central Cordillera and on some islands of the Bismarck Archipelago, and a montane subspecies, T. b. lanatus, found above 3000 m on the northeastern Huon Peninsula. The third newly described species, T. calabyi (Calaby’s pademelon), includes just two populations in subalpine grassland/forest areas above 3000 m on Mt. Albert Edward in Central Province and Mt. Giluwe in the Southern Highlands Province. Since this most recent taxonomic revision, additional populations of T. calabyi have been identified in the Kaijende Highland region of Enga Province at an altitude of 2300 m and near Pureni in the Southern Highlands Province (Helgen, 2009). A population also appears to have been recently extirpated on Mt. Wilhelm, most likely due to overhunting (Flannery, 1992). Fossil material attributable to Thylogale in New Guinea is dated only to the late Pleistocene (Thylogale sp. at approximately 1720 m altitude) from Chimbu Province (Flannery et al., 1982), and the Holocene (T. christenseni and Thylogale sp. in deposits at, and above,

P. Macqueen et al. / Molecular Phylogenetics and Evolution 57 (2010) 1134–1148

3000 m) from West Papua (Hope, 1981; Hope et al., 1993; Flannery, 1992). Thylogale are now extinct in the subalpine regions of West Papua, possibly also as a result of hunting during the mid to late Holocene (Hope et al., 1993). Hunting pressure still appears to be the greatest threat to the three extant species, with T. brunii and T. browni listed as Vulnerable, and T. calabyi as Endangered, under the IUCN (International Union for Conservation of Nature) (Leary et al., 2008a,b,c). The wide distribution of extant Thylogale species provides an opportunity to investigate the effects of historical contraction of Australo-Papuan rainforests on the evolution of intrageneric diversity in a forest-restricted marsupial. In addition, estimation of the timing of divergence between New Guinean and Australian Thylogale species may shed further light on the evolution of the endemic New Guinean fauna and historical connections between the two regions. While relationships among species of Thylogale have not been disputed, recent molecular studies of New Guinean taxa have identified cryptic variation within species, and/or inconsistencies between inferred phylogroups and groupings supported by morphological analyses (e.g. Westerman et al., 2001; Rawlings and Donnellan, 2003; Wüster et al., 2005; Murphy et al., 2007; Norman et al., 2007; Malekian et al., 2010). In view of the poor conservation status of the endemic New Guinean species, and the increasing pressure of human population expansion and forest degradation on native species in the region (e.g. Shearman et al., 2009), a molecular phylogenetic study of the genus is critical for both taxonomic and conservation purposes. In this study, we infer phylogenetic relationships among Thylogale species from mitochondrial (12S rRNA and cytochrome b) and nuclear (omega-globin gene intron) data, and use these to assess the historical dispersal of fauna within and between New Guinea and Australia. 2. Materials and methods 2.1. Sampling A total of 31 individuals were sampled, representing the 10 currently recognised species and subspecies in the Thylogale genus. At least two individuals per taxon were included, each sampled from different regions of the species’ known geographic range. Samples included tissue from preserved museum specimens (T. browni, T. brunii, T. calabyi, T. s. coxenii), frozen tissue from museum collections (T. browni, T. calabyi, T. s. stigmatica), fresh tissue from individuals trapped for this study (T. thetis, T. s. wilcoxi) or from legally culled individuals (T. billardierii), and specimens collected from hunters (T. brunii, T. s. oriomo). All fresh tissue samples were preserved in 70–100% ethanol or frozen in a DMSO/EDTA/saturated salt solution (Seutin et al., 1991) prior to DNA extraction. Two outgroups were included in phylogenetic analyses: mtDNA sequences were obtained from frozen tissue for one taxon (Dorcopsis hageni), while mtDNA and nuclear sequence data for a second taxon (Macropus eugenii) were accessed using GenBank. These species were considered appropriate outgroups as both genera have consistently resolved in an ancestral or sister position to Thylogale in recent molecular studies (Burk and Springer, 2000; Westerman et al., 2002; Cardillo et al., 2004; Meredith et al., 2008). Location and collection details for all samples and accession numbers for all sequences used in this study are listed in Table 2. 2.2. Laboratory protocols 2.2.1. Fresh and frozen tissue samples Total cellular DNA was extracted from a small fragment of tissue as described in Macqueen et al. (2009). Mitochondrial DNA (12S rRNA and cytochrome b) and nuclear DNA sequences were

1137

obtained by PCR using published primers and new primers designed for this study (Table 3). Nuclear primers were designed to sequence the complete second intron (including short flanking regions in exons 2 and 3) of the marsupial omega-globin gene described in Wheeler et al. (2001). PCR reactions were performed in 10 lL volumes using 0.3 lM forward and reverse primer, and 1 lL DNA template. PCR cycle conditions for the amplification of the 12S rRNA gene (12S) followed Springer et al. (1995). Conditions for amplification of the cytochrome b gene (cyt b) included initial denaturation at 94 °C for 2 min, followed by 35 cycles of 94 °C for 1 min, 50 °C for 1 min, and 72 °C for 1 min, with a final extension for 7 min at 72 °C. Conditions for amplification of the nuclear intron included initial denaturation at 94 °C for 2 min, followed by 35 cycles of 94 °C for 45 s, 60 °C for 45 s, and 72 °C for 1 min, and a final extension for 6 min at 72 °C. Products were purified using ExoSAP-IT (usb). Primers used in PCR amplification were also used in sequencing reactions with the BigDye Terminator v3.1 (Applied Biosystems) sequencing kit. Products were sequenced in both forward and reverse directions on an Applied Biosystems/Hitachi 3130xl Genetic Analyser. 2.2.2. Museum specimen samples All laboratory work on museum specimens was conducted at The Australian Centre for Ancient DNA with strict protocols to limit cross-contamination of samples. Sample preparation and DNA extraction were conducted in a laboratory and building separate from the post-PCR laboratory, and all sample extractions and PCR amplifications included negative controls to test for contamination. DNA extractions were carried out using Qiagen DNeasy Blood and Tissue Kits (Qiagen Inc.) following initial sample preparation. Bone and teeth samples were first ground to a fine powder. The powder (approximately 50–100 mg), or approximately 5 mm2 of the muscle or cartilage tissue fragments, was then incubated at room temperature for 24 h in 1.8 mL (for decalcification of powdered samples) or 1 mL (for soft tissue rehydration) 0.5 M EDTA. Powdered samples were centrifuged and the supernatant removed, and rehydrated tissue samples were finely minced with a scalpel blade. All samples were then incubated in 380 lL of the supplied Qiagen buffer with 20 lL proteinase K (20 mg/ml) at 55 °C for a further 24 h. DNA extraction followed the Qiagen manufacturer’s instructions except for the addition of 2 lL carrier RNA with the supplied AL buffer. Mitochondrial sequences were obtained via PCR amplification of short fragments of DNA (approximately 150 base pairs). In order to capture the most variable regions of the genes, internal primers for these fragments were designed from Thylogale tissue sample sequence data (Table 3); seven fragments were amplified from the 12S gene and three fragments from the cyt b gene. No nuclear sequences were obtained from museum specimens. PCR reactions were carried out in 25 lL volumes using 0.5 U Platinum Taq High Fidelity DNA Polymerase (Invitrogen), 0.4 lM forward and reverse primer, 25 lg Rabbit Serum Albumin, and 2 lL of the DNA template. PCR cycle conditions varied depending on the DNA fragment and species (Supplementary Table 1). PCR products were purified and sequenced as described for tissue samples. 2.3. Alignment protocols Sequences were edited and assembled manually in MEGA 4.0 (Tamura et al., 2007), and haplotypes were aligned using Clustal W (Thompson et al., 1994). All cyt b sequences were unambiguously aligned and translation to amino acids verified there were no premature stop codons. A dataset comprised of continuous cyt b sequences from a subset of individuals for which tissue samples were available was used only in chronophylogenetic analyses (see Section 2.5). 12S sequences were aligned with reference to

a Collection catalogue number

Specimen details

Thylogale billardierii (Australia)

K2 FL21

-

Thylogale browni browni (New Guinea)

A2 b A10

AMNH 194370 b AMNH 194805

b

b

b

b

b

b

92055

SAM ABTC92055

b

b

Thylogale browni lanatus

b

b

(New Guinea)

A42

AMNH 194815

Thylogale brunii (New Guinea)

A39 C1

Cytochrome b

Omega globin intron

King Island, Bass Strait, 2007 Flinders Island, Bass Strait, 2007

HQ283961 HQ283960

HQ283998 HQ283999

HQ283979 HQ283978

Whiteman Range, New Britain Island, 1958 Gang Gang Creek, Mt Rawlinson, Morobe Province, 1964 Gang Gang Creek, Mt Rawlinson, Morobe Province, 1964 Maprik, East Sepik Province Wigote, Torricelli Mountains, West Sepik Province 2° 34´ 22}138° 43´ 02}, Foja Mountains, ‘Bog Camp’, Papua, 2005 Haia, Chimbu Province

HQ283947 HQ283945

HQ283983 HQ283984

-

HQ283946

HQ283985

-

HQ283944 HQ283941

HQ283989 HQ283980

HQ283968

HQ283943

HQ283981

HQ283967

HQ283942

HQ283982

HQ283966

‘Top Camp’, Saruwaged Mountains, Morobe Province, 1964 Saruwaged Mountains, Morobe, 1964

HQ283948

HQ283986

-

HQ283949

HQ283988

-

AMNH 193422 ANWC Aru_A

Merauke River (‘60 miles up’), Papua, 1960 Namara, Kobroor Island, Aru Group (6° 03´ 134° 22´)

HQ283938 HQ283939

HQ283987 HQ283992

-

C2

ANWC Aru_B

HQ283940

HQ283993

-

UP3564 THBR1 THBR4

UPNG UP3564 PNGM 28138 PNGM 28140

Namara, Kobroor Island, Aru Group (6° 03´ 134° 22´) Varirata, Central Province Serki Village, Western Province, 2007 Serki Village, Western Province, 2007

HQ283935 HQ283936 HQ283937

HQ283994 HQ283990 HQ283991

HQ283963-HQ283964 HQ283965

A11 C16 44080

42942

Thylogale calabyi (New Guinea)

GenBank Accession Numbers 12S rRNA

A15

ANWC M8697 SAM ABTC44080

SAM ABTC42942 AMNH 194812

b

b

ANWC M15119 ANWC M15702 b SAM ABTC42494

Mt Giluwe, Southern Highlands Province Mt Giluwe, Southern Highlands Province Neon Basin, Mt Albert Edward, Central Province, 1981

HQ283933 HQ283934 HQ283932

HQ283996 HQ283997 HQ283995

-

Thylogale stigmatica coxenii

A33

AMNH 153640

HQ283953

-

-

(Australia)

A34

AMNH 153635

HQ283952

HQ284008

-

A44

AMNH 153 641

Portland Roads, Cape York Peninsula, Queensland, 1948 Red Island Point, Cape York Peninsula, Queensland, 1948 Portland Roads, Cape York Peninsula, Queensland, 1948

-

HQ284009

-

Thylogale stigmatica oriomo (New Guinea)

THST2 THST3

PNGM 28135 PNGM 28136

Serki Village, Western Province, 2007 Serki Village, Western Province, 2007

HQ283950 HQ283951

HQ284002 HQ284003

HQ283971 HQ283972

Thylogale stigmatica stigmatica

SAM1

SAM ABTC83267

HQ283954

HQ284004

HQ283969

(Australia)

SAM8

SAM ABTC80842

Lake Eacham, Atherton Tablelands, north Queensland, 1992 Mt Windsor Forest Reserve, north Queensland, 2004

HQ283955

HQ284005

HQ283970

Thylogale stigmatica wilcoxi (Australia)

MC1

-

HQ283956

HQ284006

HQ283973

PK10

-

21° 21´ 44.26}152° 53´ 10.89}, 439m, Mary Cairncross Scenic Reserve, Maleny, southeast Queensland, 2007 28° 13´ 59.33}153° 14´ 59.17}, 393m, Natural Bridge, Numinbah Valley, southeast Queensland, 2006

HQ283957

HQ284007

HQ283974

MM1

-

HQ283958

HQ284001

HQ283977

Thylogale thetis (Australia)

C8 C9 b 42494

AMNH 194806

27° 5´ 42.11}152° 42´ 4.27}, 515m,

P. Macqueen et al. / Molecular Phylogenetics and Evolution 57 (2010) 1134–1148

Sample number

Species

1138

Table 2 Taxa used in this study, including museum collection and catalogue numbers, collecting localities, year of collection if known, sample designations used in genetic analyses, and GenBank accession numbers

HQ284010 HQ283962 Foja Mountains, Papua, 2005 SAM ABTC91957 91957 Dorcopsis hageni (Outgroup)

AMNH = American Museum of Natural History, ANWC = Australian National Wildlife Collection; PNGM = Papua New Guinea National Museum and Art Gallery; UPNG = University of Papua New Guinea; SAM = South Australian Museum (Australian Biological Tissue Collection). b Specimens (or tissue samples from voucher specimens) included in the taxonomic revision of the Thylogale brunii complex in New Guinea (Flannery, 1992).

a

AY014769.1 (Wheeler et al., 2001) EF368028 (Bulazel et al., 2007) Macropus eugenii (Outgroup)

-

-

AY012092.1 (Murphy et al., 2007)

HQ283975-HQ283976 B16

-

Mt Mee, southeast Queensland, 2007 32° 3´ 33.72}151° 41´ 0.45}, 383m, Gloucester Tops, northern New South Wales, 2007

HQ283959

HQ284000

P. Macqueen et al. / Molecular Phylogenetics and Evolution 57 (2010) 1134–1148

1139

secondary structural characteristics (Springer and Douzery, 1996) to identify stem and loop regions. Alignment parameters were varied to assess the effect of different gap opening and extension parameter combinations on the final 12S alignment, but no combination affected gap placement or size. Following alignment, the full datasets were trimmed to remove sections of sequence amplified from tissue samples, but not from museum specimen samples. Complete nuclear omega-globin intron sequences were obtained from 15 individuals representing nine Thylogale species and subspecies (no sequence could be amplified from the single T. calabyi tissue sample, nor for the Cape York subspecies, T. s. coxenii). Only two individuals were heterozygous: B16 (T. thetis), with a 27 base pair insertion in one allele, and THBR1 (T. brunii), with a single base pair insertion in one allele. The alleles for these heterozygous individuals were separated using the visualisation method of Dolman and Moritz (2006). All other sequences were easily aligned by eye in MEGA. Four indels were coded as binary characters for inclusion in Bayesian phylogenetic analyses. 2.4. Model selection and phylogenetic analyses Phylogenies were estimated using maximum likelihood and Bayesian methods for each gene region (12S, cyt b and nuclear intron) and for the combined mitochondrial (mtDNA) dataset. All phylogenetic analyses were conducted using appropriate models for patterns of DNA substitution as selected in jModelTest 1.1 (Guindon and Gascuel, 2003; Posada, 2008) using the Akaike Information Criterion corrected for small sample size (AICc) as recommended in Posada and Buckley (2004). The complete mtDNA dataset included five partitions: 12S loop regions, 12S stem regions, and the three codon positions for cyt b. Genetic distances (d) within and between clades for all gene regions were estimated in MEGA using the Tamura-Nei (TrN) distance measure (Tamura and Nei, 1993), with 1000 bootstrap replicates to compute standard errors. This measure provides relatively robust measures of genetic distance, regardless of nucleotide substitution patterns, when d < 0.5 (Tamura and Kumar, 2002). Maximum likelihood (ML) phylogenies were estimated using a pre-release version of GARLI provided by Derrick Zwickl (Zwickl, 2006; Version 0.96r587, 2009), which allows for the analysis of partitioned data. Each dataset was analysed using the models chosen in jModelTest, with parameter values estimated from the data and unlinked across all partitions. For each gene region or combined dataset, 10 independent searches were conducted using the recommended default options for all settings (Zwickl, 2006). The ten tree topologies were compared by examining log likelihood values across searches and by computing distances between trees using the symmetric difference metric (Penny and Hendy, 1985) implemented in PAUP 4.0b5 (Swofford, 2003). Support for tree nodes was assessed using 100 bootstrap replicates. Bayesian estimation of phylogenetic trees was conducted using MrBayes 3.1.2 (Ronquist and Huelsenbeck, 2003) and models selected in jModelTest. Substitution rates were allowed to vary across partitions and parameter values were estimated from the data. All parameters, except tree topology and branch length, were unlinked across partitions. Six independent analyses were run for each dataset with 107 generations per run (2  107 for the combined mtDNA dataset) and a sampling frequency of 1000. All runs started with a randomly chosen tree, and four Markov chains were employed to improve MCMC sampling using the default heating scheme. Analyses were conducted using the Computational Biology Service Unit (CBSU) at Cornell University through the web-based interface (http://www.cbsuapps.tc.cornell.edu/mrbayes.aspx). Adequacy of chain mixing was assessed by examining ESS (estimated sample size) values in TRACER 1.4.1 (Rambaut and Drummond, 2007) and chain swap acceptance rates. Convergence

1140

P. Macqueen et al. / Molecular Phylogenetics and Evolution 57 (2010) 1134–1148 Table 3 Primers used for amplification and sequencing of the 12S rRNA, cytochrome b, and omega-globin genes in this study. Internal primer pairs used for amplification of DNA fragments from museum specimens are listed sequentially (50 –30 ) for each gene region. Primer pair

a

Gene region

Source

12S C forward 12S G reverse 12S Th1 forward 12S Th1 reverse 12S Th2 forward 12S Th2 reverse 12S Th3 forward 12S Th3 reverse 12S Th4 forward 12S Th4 reverse Mamm 12SE forward Mamm 12SH reverse 12S Th5 forward 12S Th5 reverse 12S Th6 forward 12S Th6 reverse

AAAGCAAA(A,G)CACTGAAAATG TTTCATCTTTTCCTTGCGGTAC (36) ACCTACACATGCAAGTTTCC (187) GCTTAATATTAGTCACTGCTGTA (151) ACACCCCCACGGGATACAG (290) TACGCCGTTTGTCTGTTAAT (266) CCCAAATTAACAGACAAACG (418) TCTTAGCTGTAGTGTGTTCAGC (358) GTTTATATCAAAATACATAACC (528) CAAGTCCTTTGAGTTTTAAGC (562) CTATAATCGATAAACCCCGATA (697) GCTACACCTTGACCTAAC (686) TCAAGGTGTAGCATATGAAAA (826) TTGCCTATTTCAATTAAGCTC (768) CAATATGAAGGAGGATTTAGT (917) GTTACGACTTTTCTCCTCTT

12S rRNA

Springer et al. (1995) Springer et al. (1995) This study This study This study This study This study This study This study This study This study This study This study This study This study This study

Thyl Cyt forward Mr2 reverse Cyt Th1 forward Cyt Th1 reverse Cyt Th2 forward Cyt Th2 reverse Cyt Th3 forward Cyt Th3 reverse

(93) AAACTTCGGCTCACTACTAGG AGGGTGTTATACCTTCATTTTTGG (328) AAAGAAACTTGAAATATCGGAG (516) CTTGTCTACAGAGAATCCGC (498) CGGATTCTCTGTAGACAAGG (669) AGTATGGGTGAAATGGGATT (954) CCAATCTCCCAAGTCCTATT (1118) TCAAATAAACCTGCTAGTGGTA

Cytochrome b

Thyl globin forward Thyl globin reverse

ATGTGAAGGCCACCTTTGAC GATGATCAGGTTGTCTCCAAG

Primer sequence (5–3)

Internal Internal Internal Internal Internal Internal Internal

This study Bulazel et al. (2007) This study This study This study This study This study This study

Internal Internal Internal Omega-globin intron

This study This study

a Numbers in brackets indicate the 50 position of the forward and reverse primer in an outgroup sequence used in this study (12S rRNA: Macropus eugenii, accession number AY012092.1; cytochrome b: Macropus eugenii, accession number EF368028).

for each run was assessed primarily by examining plots of log likelihood scores in TRACER. Two convergence diagnostics, potential scale reduction factors (Gelman and Rubin, 1992) and the average standard deviation of split frequencies, were also used to determine if the number of generations for each run was sufficient. An adequate relative burn-in fraction was determined for each run and this fraction of the sampled generations was discarded. Combined posterior probabilities from the six runs were then used to estimate a 50% majority-rule consensus tree. 2.5. Chronophylogenetic analyses We estimated the divergence times of phylogenetic clades for both the complete 12S and cyt b tissue datasets using the Bayesian approach implemented in BEAST 1.5.2 (Drummond and Rambaut, 2007). Analyses were conducted using the partitioned 12S dataset and models of evolution selected in jModelTest, and

the SRD06 model for the cyt b dataset (this model is included in BEAST and based on the codon position substitution model recommended by Shapiro et al. (2006)). Both datasets were analysed with a relaxed clock model (Drummond et al., 2006), assuming uncorrelated substitution rates for each lineage drawn from a lognormal distribution. As only a single fossil calibration date (the oldest known Thylogale fossil) was available, and it would be circular to employ putative times of landmass separation to calibrate nodes, we used standard rates of mammalian mtDNA nucleotide substitution to estimate times of species divergence. These rates were used to set an initial value for the parameter ucld.mean (mean of the branch rates) with a uniform prior and upper and lower bounds chosen to reflect rate estimate uncertainty. For the 12S rRNA gene, we used a substitution rate of 0.0029 per lineage per My with a lower boundary of 0.0024 and an upper boundary of 0.0034. This rate was based on the median estimates for dasyurid 12S rRNA sequence divergence rates (0.56–0.59%/My)

Table 4 Summary of sequence attributes and models of evolution for gene regions used in this study: number of sites in the final datasets (Sites), number of haplotypes and sample size (Haps/n), number of variable sites (Var sites). Dataset or partition

Sites

Haps/n

Var sites

Average nucleotide composition T(U)

A

Selected model G

Omega-globin intron

545

7/15

26

0.238

0.176

0.293

0.293

HKY

12S rRNA Stems Loops

718 347 371

19/30

108 28 80

0.214 0.252 0.178

0.238 0.268 0.210

0.386 0.246 0.518

0.162 0.234 0.094

– K80 + G TIM1 + G (aTrN + G)

Cytochrome b (full dataset) Codon position 1 Codon position 2 Codon position 3

396 132 132 132

23/30

124 22 7 95

0.281 0.218 0.456 0.168

0.298 0.243 0.265 0.386

0.298 0.310 0.158 0.425

0.124 0.229 0.121 0.022

– K80 + I F81 HKY + G

1001

16/16

294

0.268

0.304

0.302

0.126

–

Cytochrome b (‘tissue’ dataset) a

C

Model used in the Bayesian phylogenetic and chronophylogenetic analyses.

P. Macqueen et al. / Molecular Phylogenetics and Evolution 57 (2010) 1134–1148

in Krajewski et al. (2000), and sits within the upper and lower average sequence divergence rates estimated by Pesole et al. (1999) for a range of mammalian species (0.24–0.61%/My). For the cytochrome b dataset we used a substitution rate of 0.01 per lineage per My with a lower boundary of 0.005 and an upper boundary of 0.015. Based on studies that have estimated rates of substitution in protein-coding mtDNA genes for a variety of vertebrate species (Brown et al., 1979; Pesole et al., 1999; Krajewski et al., 2000; Weir and Schluter, 2008; Rheindt et al., 2009), this ‘standard’ average rate of divergence of 2%/My appears to be a relatively well-supported estimate for the cytochrome b gene. Remaining parameters were set to default priors and six independent analyses were run for each dataset. Each analysis started with a random tree and was run for 3  107 generations with sampling every 3000 generations. Analyses were conducted through the CBSU interface (http://www.cbsuapps.tc.cornell.edu/ beast.aspx). Adequacy of chain mixing and MCMC chain convergence were assessed by the examination of ESS values and plots of the posterior probabilities, respectively, for each parameter in TRACER. An adequate burn-in fraction was determined, and log files for each run were then combined using LogCombiner v

1141

1.5.1 (Drummond and Rambaut, 2007) to produce summary estimates of all parameters. 3. Results 3.1. Sequence attributes We obtained a total of 1114 aligned sites for the mtDNA dataset following the removal of regions amplified only from the tissue sample sequences and a five base pair indel in the 12S rRNA gene (insertion only present in the outgroup M. eugenii sequence). Alignments were otherwise unambiguous and the final trimmed datasets included partial sequence from the 12S rRNA gene (718 sites), and partial sequence from the cyt b gene (396 sites). A second cyt b sequence dataset obtained from tissue samples consisted of 1001 base pairs of continuous sequence. No premature stop codons or heterozygous sites were observed in any of the cyt b sequences indicating they had not amplified from nuclear pseudogenes. Number of haplotypes, numbers of variable characters and base composition for each gene region are shown in Table 4.

Fig. 2. Bayesian 50% majority-rule consensus trees estimated using (a) nuclear omega-globin intron data (all sequenced individuals are shown), and (b) combined mitochondrial 12S rRNA and cytochrome b data (only different haplotypes are shown). Haplotype or sample designations are indicated before the species name and sample location. Multiple individuals referred to as T. browni from the Huon Peninsula in ‘New Guinea Clade 2’ correspond to both T. b. lanatus and T. b. browni. Bootstrap values for the maximum likelihood analysis (first value) and Bayesian posterior probabilities (second value) are shown at each node. An asterisk indicates posterior probabilities of 1.00. Letters under nodes in (b) correspond to TMRCA estimates listed in Table 6.

1142

P. Macqueen et al. / Molecular Phylogenetics and Evolution 57 (2010) 1134–1148

Fig. 2 (continued)

Table 5 Net genetic distances between major clades and species (±S.E.) estimated using the Tamura-Nei (TrN) distance measure for (a) mitochondrial 12S rRNA (below diagonal) and cytochrome b (in italics above diagonal) data, and (b) nuclear omega-globin intron data. Average genetic distance (cytochrome b) within species or clades is shown in bold along the diagonal (a). Standard errors were assessed with 1000 bootstrap replicates. T. stigmatica

T. thetis

T. billardierii

T. brunii complex

(a) T. stigmatica T. thetis T. billardierii T. brunii complex

0.042 (0.007) 0.028 (0.006) 0.037 (0.007) 0.019 (0.005)

0.087 (0.015) 0.021 (0.007) 0.039 (0.008) 0.029 (0.006)

0.112 (0.019) 0.123 (0.020) 0.003 (0.002) 0.048 (0.008)

0.073 (0.013) 0.075 (0.014) 0.104 (0.017) 0.056 (0.008)

(b) T. stigmatica T. thetis T. billardierii T. brunii complex

– 0.008 (0.004) 0.010 (0.004) 0.004 (0.002)

– 0.009 (0.004) 0.011 (0.004)

– 0.013 (0.005)

–

Sequence length for the complete second intron of the omegaglobin gene in Thylogale species was between 538 and 566 base pairs. There were a total of 545 aligned sites used in phylogenetic analyses, including the second intron and partial exon 3, and four

indels were included as binary characters in Bayesian analyses. Within each of the Australian species, nuclear haplotypes were identical with the exception of a single allele for the heterozygous T. thetis individual, which lacked a 27 base pair insertion, and a

P. Macqueen et al. / Molecular Phylogenetics and Evolution 57 (2010) 1134–1148 Table 6 Divergence times (TMRCA) for species and clades in the Thylogale genus. Time of divergence (Mya: millions of years ago) was estimated from 12S rRNA and cytochrome b mitochondrial data (tissue dataset only) in BEAST using an uncorrelated relaxed lognormal clock model and standard mammalian nucleotide substitution rates.

a

Nodea

TMRCA (95% HPD Interval) (Mya) Cytochrome b

12S rRNA

A B C D E F G H I J

12.867 9.649 7.518 3.033 3.760 – – – – –

9.650 8.484 6.417 4.217 3.338 2.299 2.297 0.354 0.597 1.047

(7.012–22.239) (5.317–16.628) (4.129–13.019) (1.481–5.315) (1.951–6.530)

(6.453–13.070) (5.593–11.578) (4.281–8.828) (2.440–6.178) (1.949–4.824) (1.166–3.590) (1.144–3.591) (0.008–0.840) (0.097–1.211) (0.243–2.002)

Letters correspond to nodes labelled in Fig. 2b.

homozygous T. s. wilcoxi individual with a single transitional substitution. All T. thetis sequences shared a single base pair insertion, and another single base pair insertion was shared by the T. billardierii and M. eugenii (outgroup) sequences. All members of the New Guinean T. brunii complex shared a single nuclear haplotype, with the exception of a single allele for the heterozygous T. brunii individual, which had a one base pair insertion. 3.2. Model selection and phylogenetic analyses Models of nucleotide substitution selected using the AICc for each gene and data partition are shown in Table 4. All selected models had small AIC differences (D 6 2) indicating good support for the model (Burnham and Anderson, 2002). The best-fit model was used in all ML analyses and Bayesian analyses, with the exception of the 12S loop partition in Bayesian analyses, where the bestfit model was unavailable and the TrN + G model was used (D 6 2). In ML analyses, each of 10 independent searches for each dataset (nuclear intron, individual mtDNA genes and combined mtDNA genes) produced similar topologies with distances (symmetric differences) between trees from 0 to 2 (only the nuclear data produced a single different topology from 10 trees). For all Bayesian analyses, convergence of MCMC chains appeared to reach stationarity prior to 106 generations (2  106 for the concatenated dataset), and this relative burn-in of 10% was considered adequate. Additional diagnostics also indicated convergence and adequate chain mixing for each analysis: ESS values for individual runs were greater than 200, PSRF values were approximately equal to 1.0, and the average standard deviation of split frequencies was less than, or equal to, 0.004. Maximum likelihood and Bayesian methods produced identical topologies for 12S gene trees and also for nuclear intron gene trees. Nuclear intron data produced the least resolved topology with only 26 variable sites in the dataset; however, major clades were consistent with those of the 12S gene tree. Bayesian analysis of the cyt b dataset was unable to resolve relationships for T. stigmatica, T. thetis and T. billardierii and provided poor support for the ingroup node (0.51 posterior probability). ML analyses of the cyt b data were also unable to resolve the position of the branch for the Australian species, placing T. billardierii in a separate clade with the D. hageni outgroup, and T. thetis as sister group to T. stigmatica. Nevertheless, there was no conflict between strongly supported nodes for individual mtDNA genes and we felt that the combined analysis of these genetic regions was appropriate. As topologies for Bayesian and ML trees for the combined partitioned mtDNA dataset and also for the nuclear intron dataset were identical, only

1143

Bayesian 50% majority-rule consensus trees are shown in Fig. 2. The single representative for T. s. coxenii (A34) included in the combined mtDNA analysis was the only individual of this subspecies successfully sequenced for both genes. In the nuclear DNA and combined mtDNA analyses, there was support for T. billardierii in a basal position with relatively high genetic divergence from the remaining Thylogale. T. thetis formed a sister clade to all remaining Thylogale species, although with poor support from mtDNA data. The polytypic T. stigmatica species and the New Guinean T. brunii species complex were resolved as sister clades, and species-level genetic divergence estimated from both nuclear and mitochondrial data was lowest between these clades. Based on mtDNA data, T. s. wilcoxi was placed in a sister clade to remaining northern subspecies of the T. stigmatica group with divergence estimates of 0.022 (±S.E. 0.005)–0.024 (±S.E. 0.005) for 12S, and 0.032 (±S.E. 0.009)–0.048 (±S.E. 0.011) for cyt b. T. s. oriomo and T. s. coxenii were resolved as sister groups in both 12S and cyt b analyses with an estimated divergence of 0.039 (cyt b: ±S.E. 0.010) and 0.004 (12S: ±S.E. 0.002). 12S data indicated T. s. stigmatica was most divergent from T. s. wilcoxi (0.024 ± S.E. 0.005), although cyt b estimates showed similar levels of divergence between T. s. stigmatica and all other subspecies (between 0.026 ± S.E. 0.008 and 0.33 ± S.E. 0.009). Genetic distances based on mtDNA and nuclear DNA within and between all species, or species groups, are shown in Table 5. Within the New Guinean T. brunii complex, two clades were well-supported in the combined mtDNA analysis (Fig. 2b) and in the 12S rRNA gene tree, although the cyt b dataset could not resolve relationships in Clade 2. Genetic distances based on cyt b data within the clades were 0.046 (Clade 1: ±S.E. 0.008) and 0.032 (Clade 2: ±S.E. 0.007). Between the clades, net genetic distances were relatively low: 0.007 (±S.E. 0.002) for 12S data, and 0.030 (±S.E. 0.007) for cyt b data, and none of the currently recognised species was monophyletic. Subspecies of T. browni from the Huon Peninsula shared a single mtDNA haplotype (haplotype TNG5, Fig. 2b).

3.3. Chronophylogenetic analyses For both the 12S and cyt b tissue datasets, plots of posterior probabilities for different parameters estimated in multiple runs of BEAST indicated MCMC chain convergence following a burn-in of 3  106 generations in all runs. ESS values for all parameters in all individual runs were greater than 4500, indicating good sampling of the posterior distribution. Phylogenetic trees for both datasets had identical topologies to those produced with the ML approach in GARLI and Bayesian approach in MrBayes (not shown). The ucld.stdev parameter value for the combined run was 0.239 (95% HPD (highest posterior density) interval: 0–0.607) for the 12S data, and 0.183 (95% HPD interval: 0–0.427) for the cyt b data, indicating only minor rate variation across lineages. Dates of divergence estimated from the 12S and cyt b tissue datasets were generally similar (Table 6). Divergence of the Thylogale genus from outgroups used in this analysis was estimated to have occurred from 13.249 Mya (12S: 95% HPD interval = 8.806– 17.923) to 16.955 Mya (cyt b: 95% HPD interval = 8.874–29.304). Time to the most recent common ancestor (TMRCA) for Thylogale species (node A, Fig. 2b) was estimated to be in the mid to late Miocene. Divergence between T. stigmatica and the New Guinean T. brunii species complex (node C) was estimated to have occurred in the late Miocene, while divergence between subspecies of T. stigmatica across Torres Strait (node J: T. s. oriomo and T. s. coxenii) occurred in the mid-Pleistocene. Major clades within the New Guinean T. brunii species complex (node E) were estimated to have diverged in the mid Pliocene.

1144

P. Macqueen et al. / Molecular Phylogenetics and Evolution 57 (2010) 1134–1148

4. Discussion Phylogenetic clades obtained in this study are consistent with current species designations for Australian Thylogale, but not with those for the endemic New Guinean Thylogale. The basal positions of T. billardierii and T. thetis, and the sister position of T. stigmatica to the New Guinean clade, provides unambiguous evidence of an Australian origin for the genus consistent with the lack of prePleistocene fossil evidence for Thylogale in New Guinea. There have been at least two instances of dispersal of Thylogale between Australia and New Guinea; the endemic New Guinean Thylogale lineage diverged in the late Miocene to early Pliocene, while dispersal between populations of T. stigmatica in southern New Guinea and northern Australia occurred during the Pleistocene. Dispersal of pademelons across the Torres Strait and Arafura shelf implies intermittent, but substantial, dense forest habitat must have existed in the region in the Mio-Pliocene and during Pleistocene glacial maxima.

4.1. Phylogeny and biogeography of Australian Thylogale Phylogenetic relationships among Australian species are wellsupported in Bayesian analyses of the combined mtDNA data and the nuclear data, but have less support in ML analyses. The basal position of T. billardierii is consistent with a previous phylogenetic study based on morphology (Flannery, 1989b), which considered this species and the extinct Pliocene T. ignis to be plesiomorphic relative to other Australian species of Thylogale. Our data also indicate that T. billardierii is relatively highly divergent from other Thylogale as has been noted in morphological taxonomic studies (Tate, 1948; Ride, 1957; Flannery, 1989b), but are in agreement with the serological study of Kirsch (1977), which included this species in the Thylogale genus. Genetic divergence among Australian species and subspecies of Thylogale falls generally within the range found for other marsupial species based on mitochondrial protein-coding and 12S rRNA genes (e.g. Blacket et al., 1999, 2000; Westerman et al., 2001; Osborne and Christidis, 2001, 2002a; Bowyer et al., 2003; Malekian et al., 2010), although, as a result of targeting genetically variable regions for sequencing in the museum specimens, distance estimates in our study may be biased. Distances between species based on the omega-globin gene are generally lower than those found between species of another marsupial genus, Sminthopsis (Australian dunnart species), in which this genetic marker has also been used (Blacket et al., 2006). Our estimates for the date of divergence of the Thylogale genus are consistent with those from molecular dating analyses of phylogenetic relationships in the Macropodiformes (9.6–13.8 Mya) using fossil constraints on nodes (Meredith et al., 2008). Timing of the split between T. billardierii and the ancestor to T. thetis (9.7–12.9 Mya), and between T. thetis and the T. stigmatica/New Guinea clade (8.5–9.7 Mya), implies an evolutionary history in Australia encompassing the period of climatic drying and vegetational change during the late Miocene and Pliocene (Martin, 2006). Thylogale is the only one of five extant wet forest macropod genera to retain representatives in the southeastern temperate biome (sensu Burbidge, 1960) of Australia. The remaining four genera (Dendrolagus, Dorcopsis, Dorcopsulus and Hypsiprymnodon) are either limited to New Guinea (Dorcopsis and Dorcopsulus), and/or have contracted to a limited northern tropical distribution within Australia (Dendrolagus and Hypsiprymnodon). This is despite the occurrence of representatives from four of those genera (with the exception of Dorcopsulus) in a southern Australian early Pliocene fossil deposit (Flannery et al., 1992; Tedford, 1994). The contraction of rainforest during the late Miocene and Pliocene has been

linked to the extinction of the Plio-Pleistocene forest-dwelling vertebrate genera in southeastern Australia and the survival of extant representatives in relictual populations of the northern tropical forests (Archer et al., 1991, 1994). Thylogale, in particular T. billardierii, which presently occurs in a range of temperate forest types, are more generalist herbivores than other browsing forest macropods due to their adaptation to wet sclerophyll forest and disturbed or edge habitats. Fossil teeth ascribed to the extinct Pliocene pademelon, T. ignis, have similar morphology to those of T. billardierii (Flannery et al., 1992). Therefore, it is possible that during the late Miocene and Pliocene, ancestral Thylogale species were able to exploit the trend toward increasingly fragmented forest habitat, adapting to the wet sclerophyll and open forest mosaic that replaced the Australian rainforests (Martin, 2006). Such ‘adaptive flexibility’ has also been invoked to explain the widespread persistence of northern hemisphere herbivorous species with intermediate dentition through the changing environments of the Quaternary (Lister, 2004). Thylogale species are now common within both southern temperate and northern tropical forests, and still maintain a limited distribution in far northern monsoonal dry vine forests, also suggesting historical adaptability to changing climates and vegetation types. Within the T. stigmatica species complex, subclades inferred from the mtDNA gene trees are congruent with present subspecies delimitations, although these could not be resolved using the less variable nuclear intron data. Mitochondrial 12S data indicate levels of divergence among subspecies (up to 2.4%) reaching that of interspecific Thylogale comparisons (1.9–4.8%), with the exception of the comparison between subspecies T. s. oriomo and T. s. coxenii (0.4%). In contrast, cyt b data give levels of divergence (2.6–4.8%) well below those of the interspecific comparisons in this study. More extensive sampling and additional information from independent nuclear DNA data and morphological taxonomy is needed to further determine the status of these subspecies, in particular the evolutionary distinctiveness of T. s. wilcoxi. Divergence estimates indicate splitting of this southeastern T. s. wilcoxi lineage from the combined northeastern subspecies during the Pliocene. Pre-Pleistocene levels of divergence among populations of wet forest-restricted species and subspecies and some open forest species on the eastern Australian coast have been identified in other studies (e.g. Schneider et al., 1998; James and Moritz, 2000; Brown et al., 2006). The formation of dry climatic barriers in central eastern and northeastern Australia (e.g. Ford, 1987) during the increasingly arid conditions of the mid to late Pliocene appears to have also driven the divergence of northern and southern T. stigmatica populations. In comparison, the tropical T. s. stigmatica subspecies diverged from the far northern T. s. coxenii and T. s. oriomo subspecies during the Pleistocene, possibly reflecting a more recent connection provided by remnant dry vine forests. T. s. wilcoxi and T. thetis are sympatric in mid-eastern Australia, where they show some behavioural differences in their use of wet forest habitat. Unlike T. thetis and all other Australian Thylogale species and subspecies including other subspecies of T. stigmatica, T. s. wilcoxi is not an ‘edge’ species and does not graze near the forest/open habitat interface (Johnson, 1980; Jarman and Phillips, 1989; Vernes, 1995; le Mar, 2002). It seems likely that this behavioural partitioning has developed as a result of competition with T. thetis, as dietary studies indicate similar levels of grazing for T. s. stigmatica and T. thetis (Vernes, 1995). TMRCA for T. stigmatica and T. thetis is estimated at roughly 8.5–9.7 Mya; hence, speciation predated the severe drying of the Pliocene period, but was still coincident with the general drying trend during the late Miocene (Martin, 2006). It is possible that following allopatric speciation due to the contraction of forest habitat, T. stigmatica re-colonised the southern part of its present range during the moderation of aridity in the early Pliocene (Martin, 2006). A population of this

P. Macqueen et al. / Molecular Phylogenetics and Evolution 57 (2010) 1134–1148

1145

Fig. 3. Map of New Guinea showing sample locations and phylogenetic clades for New Guinean Thylogale inferred from combined mitochondrial 12S rRNA and cytochrome b data. Clade 1 is represented by the solid symbols and Clade 2 is represented by unfilled symbols. Triangles correspond to subalpine populations (Mt. Giluwe, Mt. Albert Edward and the Saruwaged Range). Broken lines indicate the clades including T. calabyi and T. brunii populations. Dotted line shows the approximate position of the Central Cordillera.

species may then have been isolated in the southeastern forests during the return to dry conditions of the late Pliocene. 4.2. Dispersal between Australia and New Guinea Mitochondrial 12S rRNA and nuclear data support a sister relationship between the New Guinean T. brunii species complex and T. stigmatica, and all data show strong support for monophyly of the endemic New Guinean clade. Chronophylogenetic analyses indicate isolation of an ancestral lineage within New Guinea sometime between divergence of this clade from T. stigmatica (roughly 6.4– 7.5 Mya) and the further subdivision of endemic lineages within New Guinea (roughly 3.3–3.8 Mya). This coincides with early Pliocene dates for divergence of some other vertebrate species across Torres Strait and the Arafura shelf (Kuch et al., 2005; Wüster et al., 2005; Norman et al., 2007; Rowe et al., 2008; Malekian et al., 2010). While dates based on molecular divergence may represent the divergence of genetic lineages prior to dispersal or vicariance, it is clear that the isolation of many genera in New Guinea has also occurred both earlier and later than the period above (see Table 1). Substantial terrestrial connections between the present AustraloPapuan landmasses must therefore have existed intermittently from the Miocene to the present. All Thylogale species are associated with relatively dense forested habitats, and it seems reasonable to assume on the basis of fossil evidence that habitat associations have changed very little in this genus. Thus, some form of relatively continuous, dense forest habitat can be inferred to have existed during pre-Pleistocene periods of landbridge exposure between New Guinea and Australia. A more recent Australia–New Guinea connection can be inferred from the limited genetic distance between trans-Torresian sister subspecies of T. stigmatica. T. s. oriomo and T. s. coxenii presently have restricted distributions in the monsoonal forests of the southern lowlands of New Guinea and the remnant monsoonal vine forests of Cape York in northern Australia, respectively (Fig. 1b and c). Both cyt b and 12S gene trees indicate these subspecies are sister clades, and molecular dating estimates divergence in the mid-Pleistocene. Sea level changes have been well characterised for the late Pleistocene, and terrestrial connections between Australia and New Guinea are thought to have been maintained for much of the Quaternary period (Torgersen et al., 1988; Voris,

2000). During warmer, wetter climatic conditions toward the end of glacial periods, expansion of forest habitats may have allowed gene flow between populations of forest fauna (e.g. Rowe, 2007), particularly in the geographically proximate southern New Guinea lowland and Cape York regions. Final inundation of the strait occurred during the early Holocene (Torgersen et al., 1988). Molecular dating indicates a much earlier cessation of gene flow than this most recent sea level rise, although at such shallow timeframes, estimations of divergence using slowly evolving 12S rRNA data should be considered as only rough approximations. 4.3. Phylogeny and biogeography of New Guinean Thylogale Molecular relationships among New Guinean Thylogale species are not consistent with current morphological species designations. Within Clade 1 (major clades identified in the combined mtDNA analysis are shown in Fig. 2b and locations are shown in Fig. 3), there is subdivision into a group including southern lowland (TransFly: T. brunii) and southern montane (Mt. Giluwe: T. calabyi) individuals, and a more disparate group including the southwestern Aru Islands individuals, and individuals from the northern Torricelli Ranges and central cordillera (Haia). The western Foja Mountains individual appears basal to these subclades. In Clade 2, subclades include a north/northeastern group (individuals from the Huon Peninsula, New Britain Island and north of the cordillera) and an eastern peninsular group (including the montane T. calabyi and lowland T. brunii individuals from Central Province). MtDNA genetic distances between the two major clades are similar to, or less than, those between subspecies of T. stigmatica, and estimates of divergence among populations within clades indicate isolation during the late Pliocene and Pleistocene. Hence, there is no clear genetic distinction of northern and southern populations corresponding to distributions of T. brunii and T. browni. In addition, individuals of the subalpine species from Mt. Albert Edward and Mt. Giluwe, T. calabyi, are more closely related to nearby lowland populations of T. brunii than to each other, while T. b. lanatus, from subalpine habitats of the Huon Peninsula, shares a mtDNA haplotype with lower montane T. b. browni individuals. Divergence of New Guinean Thylogale populations is estimated to have occurred in the late Pliocene and Pleistocene, following the uplift of the central range during the Mio-Pliocene and the

1146

P. Macqueen et al. / Molecular Phylogenetics and Evolution 57 (2010) 1134–1148

subaerial emergence of accreted northern terranes in the Plio-Pleistocene (Hall, 2002). A more comprehensive study of phylogeographical structure among New Guinean populations is presently underway; however, from the limited sampling in this study, it can be hypothesised that colonisation of northern New Guinea occurred across both the eastern and western regions of the uplifted cordillera. This is in contrast to studies of other taxa, where deeper genetic divergence between northern and southern populations or species suggests vicariance following orogenesis in the Mio-Pliocene (e.g. McGuigan et al., 2000; Rawlings and Donnellan, 2003; Zwiers et al., 2008). The absence of such a pattern among Thylogale populations may reflect the less restricted altitudinal and ecological preferences of members of this genus. Climatic changes of the Pleistocene have also affected dispersal among New Guinean populations. The inclusion of T. brunii individuals from the Aru Islands in a clade with the northern (Torricelli Range) and cordilleran (Haia) T. browni browni individuals implies that a landbridge in the region of the western Arafura shelf provided forested habitat for pademelon dispersal to and from the New Guinea mainland. Limited divergence between montane T. calabyi and lowland T. brunii populations, and between montane T. browni lanatus and mid to lower montane T. b. browni populations, may also reflect the influence of Pleistocene climatic fluctuations. Field surveys have indicated that populations of the subalpine ‘edge’ species, T. calabyi, are currently isolated from nearby lowland populations, and from each other, by dense mid and upper montane forests (Flannery, 1992, 1995; Helgen, 2009). Our data indicate dispersal during the Pleistocene, possibly due to the altitudinal compression of montane forest zones. New Guinea experienced extensive glaciation during the Pleistocene, with treelines dropping by more than 1000 m (Löffler, 1970, 1971; Hope et al., 1983; Brown, 1990). Thus, in both the Huon Peninsula and Central Cordillera, the subalpine grassland/forest edge now exploited by Thylogale would have been brought into closer proximity with lowland forest regions. Divergence between T. calabyi and T. brunii populations in both the eastern peninsular and the southern highland regions has occurred within a similar timeframe, further supporting such a scenario. Sharing of a single mtDNA haplotype between the subalpine and lower montane subspecies of T. browni, however, suggests very recent gene flow between these populations. The Huon Peninsula region has been emergent above sea level for only around 1.3 My (Abbott et al., 1994). Limited differentiation of higher and lower montane populations likely reflects the rapid uplift of mountain ranges, as well as the effects of Pleistocene climatic fluctuations on the distribution of newly formed habitats. MtDNA 12S rRNA and cyt b data provide no support for present New Guinean Thylogale species distinctions based on morphological characteristics. Despite similar TMRCA estimates for divergence within the clades of T. stigmatica and the T. brunii species complex, mtDNA lineages within the New Guinean species were polyphyletic. It is possible that the lack of mtDNA monophyly may be explained by recent divergence and large effective historical population sizes resulting in the retention of ancestral polymorphisms and incomplete lineage sorting (Moritz et al., 1987). We were unable to obtain sufficient information from the intron marker to examine intraspecific variation in nuclear DNA; however, given the broad congruence between subclades and geographic regions, it seems more likely that dispersal between the sampled New Guinean populations during the Pleistocene is responsible for the mitochondrial gene tree topology rather than stochastic sorting of ancestral polymorphisms. The apparent decoupling of genetic and morphological variation might be expected as a result of the rapid development of significant altitudinal variation and topographical complexity in New Guinea, overlain by cyclic fluctuations in climate and sea level during the Pleistocene.

Thylogale populations in New Guinea show substantial phylogenetic structure at a local scale, implying limited contemporary gene flow among regions. Maintaining genetic potential within this endemic species complex will therefore depend on conservation of populations across New Guinea. Additionally, given the present ecological isolation of subalpine T. calabyi from southern lowland populations (and in the case of the Mt. Albert Edward population, the local extinction of lowland Thylogale), these montane populations should still be considered of high conservation concern. Further phylogeographic analyses using the more rapidly evolving mtDNA control region and more extensive sampling are in progress and, together with the data presented here, will assist in evaluating the conservation status of Thylogale populations across northern and southern New Guinea. Acknowledgments We would like to thank Ken Aplin from the Australian National Wildlife Collection for providing samples and insight into the New Guinean pademelons. We are also grateful to Robert Voss and Darrin Lunde for assistance with sampling at the American Museum of Natural History, and to the South Australian Museum and The Australian Museum for providing tissue samples. Sean Corley provided very useful advice and much assistance with laboratory work. Samples for this project were collected under the approval of The University of Queensland Animal Ethics Committee (permits SIB/511/06/ and SIB/444/07/) and the Papua New Guinea Department of Environment and Conservation (permit 070329). Funding for this project was supplied by the WV Scott Charitable Trust (P.M. and J.M.S.), The Ecological Society of Australia Student Research Grant (P.M.), an American Museum of Natural History Collection Study Grant (P.M.), and a University of Queensland Travel Grant (P.M.). Appendix A. Supplementary data Supplementary data associated with this article can be found, in the online version, at doi:10.1016/j.ympev.2010.08.010. References Abbott, L.D., Silver, E.A., Thompson, P.R., Filewicz, M.V., Schneider, C., Abdoderrias, 1994. Stratigraphic constraints on the development and timing of arc-continent collision in northern Papua New Guinea. J. Sediment. Res. B64, 169–183. Aplin, K.P., Baverstock, P.R., Donnellan, S.C., 1993. Albumin immunological evidence for the time and mode of origin of the New Guinean terrestrial mammal fauna. Sci. New Guinea 19, 131–145. Archer, M., Hand, S.J., Godthelp, H., 1991. Riversleigh, the Story of Animals in Ancient Rainforests of Inland Australia. Reed Books, Victoria, Australia. Archer, M., Hand, S.J., Godthelp, H., 1994. Patterns in the history of Australia’s mammals and inferences about palaeohabitats. In: Hill, R.S. (Ed.), History of the Australian Vegetation: Cretaceous to Recent. Cambridge University Press, Melbourne, pp. 80–103. Baker, N., De Bruyn, M., Mather, P.B., 2008. Patterns of molecular diversity in wild stocks of the redclaw crayfish (Cherax quadricarinatus) from northern Australia and Papua New Guinea: impacts of Plio-Pleistocene landscape evolution. Freshwater Biol. 53, 1592–1605. Blacket, M.J., Adams, M., Krajewski, C., Westerman, M., 2000. Genetic variation within the dasyurid marsupial genus Planigale. Aust. J. Zool. 48, 443–459. Blacket, M.J., Cooper, S.J.B., Krajewski, C., Westerman, M., 2006. Systematics and evolution of the dasyurid marsupial genus Sminthopsis: II. The Murina species group. J. Mammal. Evol. 13, 125–138. Blacket, M.J., Krajewski, C., Labrindis, A., Cambron, B., Cooper, S., Westerman, M., 1999. Systematic relationships within the dasyurid marsupial tribe Sminthopsini – a multigene approach. Mol. Phylogenet. Evol. 12, 140–155. Bowyer, J.C., Newell, G.R., Metcalfe, C.J., Eldridge, M.B.D., 2003. Tree-kangaroos Dendrolagus in Australia: are D. lumholtzi and D. bennettianus sister taxa? Aust. Zool. 32, 207–213. Brown, I.M., 1990. Quaternary glaciations of New Guinea. Quat. Sci. Rev. 9, 273–280. Brown, M., Cooksley, H., Carthew, S.M., Cooper, S.J.B., 2006. Conservation units and phylogeographic structure of an arboreal marsupial, the yellow-bellied glider (Petaurus australis). Aust. J. Zool. 54, 305–317.

P. Macqueen et al. / Molecular Phylogenetics and Evolution 57 (2010) 1134–1148 Brown, W.M., George, M., Wilson, A.C., 1979. Rapid evolution of animal mitochondrial DNA. Proc. Natl. Acad. Sci. USA 76, 1967–1971. Bulazel, K.V., Ferreri, G.C., Eldridge, M.D.B., O’Neill, R.J., 2007. Species-specific shifts in centromere sequence composition are coincident with breakpoint reuse in karyotypically divergent lineages. Gen. Biol. 8, R170. Burbidge, N.T., 1960. The phytogeography of the Australian region. Aust. J. Bot. 8, 75–211. Burk, A., Springer, M.S., 2000. Intergeneric relationships among macropodoidea (Metatheria: Diprotodontia) and the chronicle of kangaroo evolution. J. Mammal. Evol. 7, 213–237. Burnham, K.P., Anderson, D.A., 2002. Model Selection and Multi-model Inference. A Practical Information–Theoretic Approach. Springer, New York. Cardillo, M., Bininda-Emonds, O.R.P., Boakes, E., Purvis, A., 2004. A species-level phylogenetic supertree of marsupials. J. Zool. 264, 11–31. Chappell, J., 1993. Contrasting Holocene sedimentary geologies of lower Daly River, northern Australia, and lower Sepik-Ramu, Papua New Guinea. Sediment. Geol. 83, 339–358. Chivas, A.R., GarcÌa, A., van der Kaars, S., Couapel, M.J.J., Holt, S., Reeves, J.M., Wheeler, D.J., Switzer, A.D., Murray-Wallace, C.V., Banerjee, D., Price, D.M., Wang, S.X., Pearson, G., Edgar, N.T., Beaufort, L., De Deckker, P., Lawson, E., Cecil, C.B., 2001. Sea-level and environmental changes since the last interglacial in the Gulf of Carpentaria, Australia: an overview. Quat. Int. 83–85, 19–46. Crisp, M., Cook, L., Steane, D., 2004. Radiation of the Australia flora: what can comparisons of molecular phylogenies across multiple taxa tell us about the evolution of diversity in present-day communities? Philos. Trans. Biol. Sci. 359, 1551–1571. Dolman, G., Moritz, C., 2006. A multilocus perspective on refugial isolation and divergence in rainforest skinks (Carlia). Evolution 60, 573–582. Drummond, A.J., Ho, S.Y.W., Phillips, M.J., Rambaut, A., 2006. Relaxed phylogenetics and dating with confidence. PLoS Biol. 4, 699–710. Drummond, A.J., Rambaut, A., 2007. BEAST: Bayesian evolutionary analysis by sampling trees. BMC Evol. Biol. 7, 214. Flannery, T., 1995. Mammals of New Guinea. Reed Books, Chatswood. Flannery, T., Mountain, M.-J., Aplin, K., 1982. Quaternary kangaroos (Macropodidae: Marsupialia) from Nombe rock shelter, Papua New Guinea, with comments on the nature of Megafaunal extinction in the New Guinea Highlands. Proc. Linn. Soc. New South Wales 107, 75–97. Flannery, T.F., 1989a. Origins of the Australo-Pacific land mammal fauna. Aust. Zool. Rev. 1, 15–24. Flannery, T.F., 1989b. Phylogeny of the Macropodoidea: a study in convergence. In: Grigg, G., Jarman, P., Hume, I. (Eds.), Kangaroos, Wallabies and Rat-Kangaroos. Surrey, Beatty & Sons Pty. Ltd., New South Wales, pp. 1–46. Flannery, T.F., 1992. Taxonomic revision of the Thylogale brunii complex (Macropodidae: Marsupialia) in Melanesia with description of a new species. Aust. Mammal. 15, 7–23. Flannery, T.F., Rich, T.H.V., Lundelius, E.L.J., Turnbull, W.D., 1992. The Macropodoidea (Marsupialia) of the early Pliocene Hamilton local fauna, Victoria, Australia. Field. Geol. 25, 1–37. Ford, J., 1987. Hybrid zones in Australian birds. Emu 87, 158–178. Gelman, A., Rubin, D.B., 1992. Inference from iterative simulation using multiple sequences. Stat. Sci. 7, 457–472. Guindon, S., Gascuel, O., 2003. A simple, fast and accurate method to estimate large phylogenies by maximum-likelihood. Syst. Biol. 52, 696–704. Hall, R., 2002. Cenozoic geological and plate tectonic evolution of SE Asia and the SW Pacific: computer-based reconstructions, model and animations. J. Asian Earth Sci. 20, 353–431. Helgen, K.M., 2009. The mammal fauna of the Kaijende Highlands, Enga Province, Papua New Guinea. A rapid biodiversity assessment of the Kaijende Highlands, Enga Province, Papua New Guinea. Conserv. Int. 52-68. Hill, R.S., 2004. Origins of the southeastern Australian vegetation. Philos. Trans. R. Soc. B: Biol. Sci. 359, 1537–1549. Hill, R.S., Truswell, E.M., McLoughlin, S., Dettman, M.E., 1999. Evolution of the Australian flora: fossil evidence. In: Orchard, A.E., Thompson, H.S. (Eds.), Flora of Australia. ABRS/CSIRO, Melbourne, pp. 251–320. Hope, G., Flannery, T., Boeardi, 1993. A preliminary report of changing Quaternary mammal faunas in subalpine New Guinea. Quat. Res. 40, 117–126. Hope, G., Kershaw, A.P., van der Kaars, S., Xiangjun, S., Liew, P.M., Heusser, L.E., Takahara, H., McGlone, M., Miyoshi, N., Moss, P.T., 2004. History of vegetation and habitat change in the Austral-Asian region. Quat. Int. 118–119, 103–126. Hope, G.S., Golson, J., Allen, J., 1983. Palaeoecology and prehistory in New Guinea. J. Hum. Evol. 12, 37–60. Hope, J., 1982. Late Cainozoic vertebrate faunas and the development of aridity in Australia. In: Barker, W.R., Greenslade, P.J.M. (Eds.), Evolution of the Flora and Fauna of Arid Australia. Peacock Publications, Frewville, pp. 85–100. Hope, J.H., 1981. A new species of Thylogale (Marsupialia: Macropodidae) from Mapala rockshelter, Jaya (Carstensz) Mountains, Irian Jaya (Western New Guinea). Rec. Aust. Mus. 33, 369–387. James, C.H., Moritz, C., 2000. Intraspecific phylogeography in the sedge frog Litoria fallax (Hylidae) indicates pre-Pleistocene vicariance of an open forest species from eastern Australia. Mol. Ecol. 9, 349–358. Jarman, P.J., Phillips, C.M., 1989. Diets in a community of macropod species. In: Grigg, G., Jarman, P., Hume, I. (Eds.), Kangaroos, Wallabies and Rat-Kangaroos. Surrey Beatty & Sons Pty. Ltd., New South Wales, pp. 143–149. Johnson, K.A., 1980. Spatial and temporal use of habitat by the red-necked pademelon, Thylogale thetis (Marsupialia, Macropodidae). Aust. Wild. Res. 7, 157–166.

1147

Kershaw, A.P., Martin, H.A., McEwen Mason, J.R.C., 1994. The Neogene: a period of transition. In: Hill, R.S. (Ed.), History of the Australian Vegetation: Cretaceous to Recent. Cambridge University Press, Melbourne, pp. 299–327. Kirsch, J.A.W., 1977. The comparative serology of Marsupialia, and a classification of marsupials. Aust. J. Zool. Suppl. Ser. 52, 1–152. Kirsch, J.A.W., Springer, M.S., 1993. Timing of the molecular evolution of New Guinean marsupials. Sci. New Guinea 19, 147–156. Krajewski, C., Moyer, G.R., Sipiorski, J.T., Fain, M.G., Westerman, M., 2004. Molecular systematics of the enigmatic ‘phascolosoricine’ marsupials of New Guinea. Aust. J. Zool. 52, 389–415. Krajewski, C., Painter, J., Driskell, A.C., Buckley, L., Westerman, M., 1993. Molecular systematics of New Guinean dasyurids (Marsupialia: Dasyuridae). Sci. New Guinea 19, 157–166. Krajewski, C., Wroe, S., Westerman, M., 2000. Molecular evidence for the pattern and timing of cladogenesis in dasyurid marsupials. Zool. J. Linn. Soc. 130, 375– 404. Kuch, U., Keogh, J.S., Weigel, J., Smith, L.A., Mebs, D., 2005. Phylogeography of Australia’s king brown snake (Pseudechis australis) reveals Pliocene divergence and Pleistocene dispersal of a top predator. Naturwissenschaften 92, 121–127. Leary, T., Seri, L., Flannery, T., Wright, D., Hamilton, S., Helgen, K., Singadan, R., Menzies, J., Allison, A., James, R., 2008a. Thylogale browni. IUCN Red List. . Leary, T., Seri, L., Flannery, T., Wright, D., Hamilton, S., Helgen, K., Singadan, R., Menzies, J., Allison, A., James, R., 2008b. Thylogale brunii. IUCN Red List of Threatened Species. . Leary, T., Seri, L., Flannery, T., Wright, D., Hamilton, S., Helgen, K., Singadan, R., Menzies, J., Allison, A., James, R., Aplin, K., Salas, L., Dickman, C., 2008c. Thylogale calabyi. IUCN Red List of Threatened Species. . Lister, A.M., 2004. The impact of Quaternary Ice Ages on mammalian evolution. Philos. Trans. R. Soc. Lond. B 359, 221–241. Löffler, E., 1970. Evidence of Pleistocene glaciation in East Papua. Aust. Geog. Stud. 8, 16–26. Löffler, E., 1971. The Pleistocene glaciation of the Saruwaged Range, Territory of New Guinea. Aust. Geog. XI, 463–472. McGuigan, K., Zhu, D., Allen, G.R., Moritz, C., 2000. Phylogenetic relationships and historical biogeography of melanotaeniid fishes in Australia and New Guinea. Mar. Freshwater Res. 51, 713–723. Macqueen, P., Goldizen, A.W., Seddon, J.M., 2009. Response of a southern temperate marsupial, the Tasmanian pademelon (Thylogale billardierii), to historical and contemporary forest fragmentation. Mol. Ecol. 18, 3291–3306. Malekian, M., Cooper, S.J.B., Norman, J.A., Christidis, L., Carthew, S.M., 2010. Molecular systematics and evolutionary origins of the genus Petaurus (Marsupialia: Petauridae) in Australia and New Guinea. Mol. Phylogenet. Evol. 54, 122–135. le Mar, K., 2002. Spatial organisation and habitat selection patterns of three marsupial herbivores within a patchy forestry environment. Ph.D. Thesis, School of Zoology, Univ. Tasmania, Hobart. Martin, H.A., 2006. Cenozoic climatic change and the development of the arid vegetation in Australia. J. Arid Environ. 66, 533–563. Meredith, R.W., Westerman, M., Springer, M.S., 2008. A phylogeny and timescale for the living genera of kangaroos and kin (Macropodiformes: Marsupialia) based on nuclear DNA sequences. Aust. J. Zool. 56, 395–410. Moritz, C., Dowling, T.E., Brown, W.M., 1987. Evolution of animal mitochondrial DNA: relevance for population biology and systematics. Annu. Rev. Ecol. Syst. 18, 269–292. Murphy, S.A., Double, M.C., Legge, S.M., 2007. The phylogeography of palm cockatoos, Probosciger aterrimus, in the dynamic Australo-Papuan region. J. Biogeogr. 34, 1534–1545. Nix, H.A., Kalma, J.D., 1972. Climate as a dominant control in the biogeography of northern Australia and New Guinea. In: Walker, D. (Ed.), Bridge and Barrier: The Natural and Cultural History of Torres Strait. Australian National University, Canberra, pp. 61–91. Norman, J.A., Rheindt, F.E., Rowe, D.L., Christidis, L., 2007. Speciation dynamics in the Australo-Papuan Meliphaga honeyeaters. Mol. Phylogenet. Evol. 42, 80– 91. Osborne, M.J., Christidis, L., 2001. Molecular phylogenetics of Australo-Papuan possums and gliders (Family Petauridae). Mol. Phylogenet. Evol. 20, 211–224. Osborne, M.J., Christidis, L., 2002a. Molecular relationships of the cuscuses, brushtail and scaly-tailed possums (Phalangerinae). Aust. J. Zool. 50, 135–149. Osborne, M.J., Christidis, L., 2002b. Systematics and biogeography of pygmy possums (Burramyidae: Cercartetus). Aust. J. Zool. 50, 25–37. Penny, D., Hendy, M.D., 1985. The use of tree comparison metrics. Syst. Zool. 34, 75– 82. Pesole, G., Gissi, C., De Chirico, A., Saccone, C., 1999. Nucleotide substitution rate of mammalian mitochondrial genomes. J. Mol. Evol. 48, 427–434. Pigram, C.J., Davies, H.L., 1987. Terranes and the accretion history of the New Guinea orogen. BMR J. Aust. Geol. Geophys. 10, 193–211. Posada, D., 2008. JModelTest: phylogenetic model averaging. Mol. Biol. Evol. 25, 1253–1256. Posada, D., Buckley, T.R., 2004. Model selection and model averaging in phylogenetics: advantages of Akaike Information Criterion and Bayesian approaches over likelihood ratio tests. Syst. Biol. 53, 793–808. Rambaut, A., Drummond, A.J., 2007. Tracer v1.4. . Rawlings, L.H., Donnellan, S.C., 2003. Phylogeographic analysis of the green python, Morelia viridis, reveals cryptic diversity. Mol. Phylogenet. Evol. 27, 36–44.

1148

P. Macqueen et al. / Molecular Phylogenetics and Evolution 57 (2010) 1134–1148

Rheindt, F.E., Christidis, L., Cabanne, G.S., Miyaki, C., Norman, J.A., 2009. The timing of Neotropical speciation dynamics: a reconstruction of Myiopagis flycatcher diversification using phylogenetic and paleogeographic data. Mol. Phylogenet. Evol. 53, 961–971. Ride, W.D.L., 1957. Protemnodon parma (Waterhouse) and the classification of related wallabies (Protemnodon, Thylogale, Setonix). Proc. Zool. Soc. Lond. 128, 327–346. Ronquist, F., Huelsenbeck, J.P., 2003. MrBayes 3: Bayesian phylogenetic inference under mixed models. Bioinformatics 19, 1572–1574. Rowe, C., 2007. A palynological investigation of Holocene vegetation change in Torres Strait, seasonal tropics of northern Australia. Paleogeogr. Paleoclimat. Paleoecol. 251, 83–103. Rowe, K.C., Reno, M.L., Richmond, D.M., Adkins, R.M., Steppan, S.J., 2008. Pliocene colonization and adaptive radiations in Australia and New Guinea (Sahul): multilocus systematics of the old endemic rodents (Muroidea: Murinae). Mol. Phylogenet. Evol. 47, 84–101. Schneider, C.J., Cunningham, M., Moritz, C., 1998. Comparative phylogeography and the history of endemic vertebrates in the Wet Tropics rainforests of Australia. Mol. Ecol. 7, 487–498. Schodde, R., Calaby, J.H., 1972. The biogeography of the Australo-Papuan bird and mammal faunas in relation to Torres Strait. In: Walker, D. (Ed.), Bridge and Barrier: The Natural and Cultural History of Torres Strait. Australian National University, Canberra, pp. 257–300. Seutin, G., White, B.N., Boag, P.T., 1991. Preservation of avian blood and tissue samples for DNA analyses. Can. J. Zool. 69, 82–90. Shapiro, B., Rambaut, A., Drummond, A.J., 2006. Choosing appropriate substitution models for the phylogenetic analysis of protein-coding sequences. Mol. Biol. Evol. 23, 7–9. Sharman, G.B., 1961. The mitotic chromosomes of marsupials and their bearing on taxonomy and phylogeny. Aust. J. Zool. 9, 38–60. Shearman, P.L., Ash, J., Mackey, B., Bryan, J.E., Lokes, B., 2009. Forest conversion and degradation in Papua New Guinea 1972–2002. Biotropica 41, 379–390. Springer, M.S., Douzery, E., 1996. Secondary structure and patterns of evolution among mammalian mitochondrial 12S rRNA molecules. J. Mol. Evol. 43, 357– 373. Springer, M.S., Hollar, L.J., Burk, A., 1995. Compensatory substitutions and the evolution of the mitochondrial 12S rRNA gene in mammals. Mol. Biol. Evol. 12, 1138–1150. Strahan, R. (Ed.), 1995. The Mammals of Australia. Reed Books, Australia. Swofford, D.L., 2003. PAUP*: Phylogenetic Analysis Using Parsimony (* and Other Methods). Version 4. Sinauer Associates, Sunderland, MA. Tamura, K., Dudley, J., Nei, M., Kumar, S., 2007. MEGA4: Molecular Evolutionary Genetics Analysis (MEGA) Software Version 4.0. Mol. Biol. Evol. 24, 1596–1599. Tamura, K., Kumar, S., 2002. Evolutionary distance estimation under heterogenous substitution pattern among lineages. Mol. Biol. Evol. 19, 1727–1736. Tamura, K., Nei, M., 1993. Estimation of the number of nucleotide substitutions in the control region of mitochondrial DNA in humans and chimpanzees. Mol. Biol. Evol. 10, 512–526. Tate, G.H.H., 1948. Results of the Archbold Expeditions. No. 59. Studies on the anatomy and phylogeny of the Macropodidae (Marsupialia). Bull. Am. Mus. Nat. Hist. 91, 233–352.

Tate, G.H.H., Archbold, R., 1937. Results of the Archbold Expeditions. No. 16. Some Marsupials of New Guinea and Celebes. Bull. Am. Mus. Nat. Hist. 73, 331–476. Tedford, R.H., 1994. Succession of Pliocene through medial Pleistocene mammal faunas of southeastern Australia. Rec. Aust. Mus. 27, 79–93. Tedford, R.H., Wells, R.T., Prideaux, G.J., 2006. Pliocene and earlier Pleistocene marsupial evolution in southeastern Australia. Alcheringa SI 1, 313–322. Thompson, J.D., Higgins, D.G., Gibson, T.J., 1994. Clustal W: improving the sensitivity of progressive multiple sequence alignment through sequence weighting, position-specific gap penalties and weight matrix choice. Nucl. Acids Res. 22, 4673–4680. Torgersen, T., Luly, J., De Deckker, P., Jones, M.R., Searle, D.E., Chivas, A.R., Ullman, W.J., 1988. Late Quaternary environments of the Carpentaria Basin, Australia. Palaeogeogr. Palaeoclimat. Palaeoecol. 67, 245–261. Vernes, K., 1995. The diet of the red-legged pademelon Thylogale stigmatica (Gould) (Marsupialia: Macropodidae) in fragmented tropical rainforest, north Queensland, Australia. Mammalia 59, 517–525. Voris, H.K., 2000. Maps of Pleistocene sea levels in Southeast Asia: shorelines, river systems and time durations. J. Biogeogr. 27, 1153–1167. Weir, J.T., Schluter, D., 2008. Calibrating the avian molecular clock. Mol. Ecol. 17, 2321–2328. Westerman, M., Burk, A., Amrine-Madsen, H.M., Prideaux, G.J., Case, J.A., Springer, M.S., 2002. Molecular evidence for the last survivor of an ancient kangaroo lineage. J. Mammal. Evol. 9, 209–223. Westerman, M., Springer, M.S., Krajewski, C., 2001. Molecular relationships of the New Guinean bandicoot genera Microperoryctes and Echymipera (Marsupialia: Peramelina). J. Mammal. Evol. 8, 93–105. Westerman, M., Young, J., Donnellan, S., Woolley, P.A., Krajewski, C., 2006. Molecular relationships of New Guinean three-striped dasyures (Myoictis, Marsupialia: Dasyuridae). J. Mammal. Evol. 13, 211–222. Wheeler, D., Hope, R., Cooper, S.J.B., Dolman, G., Webb, G.C., Bottema, C.D.K., Gooley, A.A., Goodman, M., Holland, R.A.B., 2001. An orphaned mammalian beta-globin gene of ancient evolutionary origin. Proc. Natl. Acad. Sci. USA 98, 1101–1106. Wüster, W., Dumbrell, A.J., Hay, C., Pook, C.E., Williams, D.J., Fry, B.G., 2005. Snakes across the Strait: trans-Torresian phylogeographic relationships in three genera of Australasian snakes (Serpentes: Elapidae: Acanthophis, Oxyuranus, and Pseudechis). Mol. Phylogenet. Evol. 34, 1–14. Yokoyama, Y., Purcell, A., Lambeck, K., Johnston, P., 2001. Shore-line reconstruction around Australia during the Last Glacial Maximum and Late Glacial Stage. Quat. Int. 83–85, 9–18. Ziegler, A.C., 1977. Evolution of New Guinea’s marsupial fauna in response to a forested environment. In: Stonehouse, B., Gilmore, D. (Eds.), The Biology of Marsupials. Univ. Park Press, London, pp. 117–138. Zwickl, D.J., 2006. Genetic algorithm approaches for the phylogenetic analysis of large biological sequence datasets under the maximum likelihood criterion. Ph.D. Thesis, The Univ. Texas, Austin. Zwiers, P.B., Borgia, G., Fleischer, R.C., 2008. Plumage based classification of the bowerbird genus Sericulus evaluated using a multi-gene, multi-genome analysis. Mol. Phylogenet. Evol. 46, 923–931.