Phylogeny reconstruction in the Caesalpinieae grade (Leguminosae) based on duplicated copies of the sucrose synthase gene and plastid markers

Molecular Phylogenetics and Evolution 65 (2012) 149–162

Contents lists available at SciVerse ScienceDirect

Molecular Phylogenetics and Evolution journal homepage: www.elsevier.com/locate/ympev

Phylogeny reconstruction in the Caesalpinieae grade (Leguminosae) based on duplicated copies of the sucrose synthase gene and plastid markers Vincent Manzanilla, Anne Bruneau ⇑ Institut de recherche en biologie végétale, Département de Sciences biologiques, Université de Montréal, 4101 Sherbrooke est, Montréal, Québec, Canada H1X 2B2

a r t i c l e

i n f o

Article history: Received 29 July 2011 Revised 30 May 2012 Accepted 31 May 2012 Available online 12 June 2012 Keywords: Caesalpinieae Caesalpinioideae Leguminosae Nodulation Nuclear genes Phylogeny Sucrose synthase (SUSY)

a b s t r a c t The Caesalpinieae grade (Leguminosae) forms a morphologically and ecologically diverse group of mostly tropical tree species with a complex evolutionary history. This grade comprises several distinct lineages, but the exact delimitation of the group relative to subfamily Mimosoideae and other members of subfamily Caesalpinioideae, as well as phylogenetic relationships among the lineages are uncertain. With the aim of better resolving phylogenetic relationships within the Caesalpinieae grade, we investigated the utility of several nuclear markers developed from genomic studies in the Papilionoideae. We cloned and sequenced the low copy nuclear gene sucrose synthase (SUSY) and combined the data with plastid trnL and matK sequences. SUSY has two paralogs in the Caesalpinieae grade and in the Mimosoideae, but occurs as a single copy in all other legumes tested. Bayesian and maximum likelihood phylogenetic analyses suggest the two nuclear markers are congruent with plastid DNA data. The Caesalpinieae grade is divided into four well-supported clades (Cassia, Caesalpinia, Tachigali and Peltophorum clades), a poorly supported clade of Dimorphandra Group genera, and two paraphyletic groups, one with other Dimorphandra Group genera and the other comprising genera previously recognized as the Umtiza clade. A selection analysis of the paralogs, using selection models from PAML, suggests that SUSY genes are subjected to a purifying selection. One of the SUSY paralogs, under slightly stronger positive selection, may be undergoing subfunctionalization. The low copy SUSY gene is useful for phylogeny reconstruction in the Caesalpinieae despite the presence of duplicate copies. This study confirms that the Caesalpinieae grade is an artificial group, and highlights the need for further analyses of lineages at the base of the Mimosoideae. Ó 2012 Elsevier Inc. All rights reserved.

1. Introduction The evolutionary history of subfamily Caesalpinioideae in the Leguminosae remains poorly understood despite numerous recent analyses of relationships within the subfamily and in the legume family as a whole (Doyle, 1994; Chappill, 1995; Käss and Wink, 1996; Doyle et al., 1997, 2000; Kajita et al., 2001; Doyle and Luckow, 2003; Herendeen et al., 2003a; Wojciechowski et al., 2004; Lavin et al., 2005; Bruneau et al., 2001, 2008). As described recently by Lewis et al. (2005) subfamily Caesalpinioideae is paraphyletic; it includes the monophyletic tribes Cercideae and Detarieae, and the paraphyletic tribes Cassieae and Caesalpinieae. Among these tribes, the Caesalpinieae is particularly problematic. Polhill and Vidal (1981) divided the Caesalpinieae into eight informal generic groups (Table 1), which were modified to nine groups by Polhill (1994). Tribe Caesalpinieae has since generally been resolved as paraphylet-

⇑ Corresponding author. Fax: +1 514 343 2288. E-mail addresses: [email protected] (V. Manzanilla), anne.bruneau@ umontreal.ca (A. Bruneau). 1055-7903/$ - see front matter Ó 2012 Elsevier Inc. All rights reserved. http://dx.doi.org/10.1016/j.ympev.2012.05.035

ic and intergeneric relationships within the nine generic groups have been adjusted with developing knowledge of the tribe (Lewis and Schrire, 1995; Du Puy et al., 1995; Doyle et al., 1997; Lewis, 1998; Bruneau et al., 2001; Simpson and Lewis, 2003; Simpson et al., 2004; Simpson and Ulibarri, 2006; Table 1). In their recent analyses of subfamily Caesalpinioideae based on plastid sequences, Bruneau et al. (2008) found this tribe to comprise six informal clades that previously mostly were included in tribe Caesalpinieae (the Umtiza, Caesalpinia, Tachigali, Peltophorum, and two Dimorphandra Group lineages), as well as the Cassia clade (subtribe Cassiinae; Table 1), the latter historically placed in tribe Cassieae. Here we focus on these seven lineages, which for simplicity will hereafter be referred to as the Caesalpinieae grade. In addition, because the caesalpinioid Dimorphandra Group (Polhill, 1994) shares numerous floral, pollen and wood features with subfamily Mimosoideae and has in the past been considered taxonomically as a ‘‘transitional link’’ between the caesalpinioids and mimosoids (Polhill and Vidal, 1981; Luckow et al., 2000, 2003), another interest of this study is to better determine the taxonomic delimitation of the Mimosoideae relative to the Caesalpinioideae. In short, some caesalpinioid genera may best be placed within the Mimosoideae or may belong among

150

V. Manzanilla, A. Bruneau / Molecular Phylogenetics and Evolution 65 (2012) 149–162

Table 1 Phylogenetic and taxonomic history of the Caesalpinieae grade. Caesalpinieae tribe or grade taxa are noted in bold type.

NA, DNA material not available. a Polhill and Vidal (1981) recognized eight generic groups; the Poeppigia Group is not listed here. b Placed in the Caesalpinia Group by Simpson et al. (2003). c Placed in the Peltophorum Group by Simpson et al. (2003). d Placed in the Dimorphandra Group by Banks et al. (2003).

the close relatives of the basal mimosoid genera as observed for the genus Dinizia (Luckow et al., 2000). The tribe Caesalpinieae has long been considered problematic because of a proposed recent and rapid speciation, from which would have resulted a wide range of morphological diversity and complexity (Pettigrew and Watson, 1977; Polhill et al., 1981). Since, there have been numerous studies using molecular data aimed at improving our understanding of the evolutionary history of the Caesalpinieae grade (Simpson and Miao, 1997; Banks et al., 2003; Simpson and Lewis, 2003; Herendeen et al., 2003b; Simpson et al., 2003; Haston et al., 2005; Marazzi et al., 2006). Early studies were mainly based either on chloroplast DNA markers (e.g., matK,

trnL, rpL16), on nuclear ribosomal DNA markers (e.g., ITS), or more rarely on low copy nuclear markers (e.g., LEAFY/FLORICAULA; Archambault and Bruneau, 2004) and partially on morphological characters (Lewis and Schrire, 1995; Herendeen et al., 2003a; Simpson et al., 2004). Despite these studies, relationships among lineages within this grade remain poorly resolved. In order to improve our understanding of phylogenetic relationships within Caesalpinieae, we examine relationships using a lowcopy nuclear marker. In the last decade, genomic and bioinformatic studies have yielded new molecular markers for phylogenetic and biogeographic studies (Choi et al., 2004; Yu et al., 2004; Chapman et al., 2007; Steele et al., 2008). In particular, Choi et al. (2004,

V. Manzanilla, A. Bruneau / Molecular Phylogenetics and Evolution 65 (2012) 149–162

2006) and Scherson et al. (2005) developed single copy nuclear phylogenetic markers for the Leguminosae based on genomic comparisons. They provided a wide range of markers with putatively conserved exonic regions and highly variable introns. Based on these studies, we tested several single copy nuclear markers in order to resolve the complex evolutionary history of the Caesalpinieae grade. We were particularly interested in the SUSY locus, which is a part of the sucrose synthase gene (SUSY, SUS, SucS). This gene has a key role in crop plant metabolism, because it transforms sucrose into starch. Recent studies also have shown its implication in the functionality of the root nodules in legumes (Silvente et al., 2003; Baier et al., 2007; Horst et al., 2007). SUSY is necessary in the metabolism of legumes for the establishment and maintenance of an efficient N-fixing symbiosis (Baier et al., 2007). Nitrogen fixation is commonly present in the Papilionoideae, but in the Caesalpinioideae is known to occur only in certain members of the Caesalpinieae grade (i.e., confirmed in Campsiandra Benth., Chamaecrista Moench, Dimorphandra Schott, Erythrophleum Afzel. ex R.Br., Melanoxylon Schott, Moldenhawera Schrad. and Tachigali Aubl. (including Sclerolobium Vogel), and possibly in Recordoxylon Ducke and Vouacapoua Aubl.; Sprent, 2001, 2009). Based on previous studies, we postulate that the Caesalpinieae grade consists of seven groups and test this hypothesis using both nuclear and plastid markers. As part of this study, we evaluate the utility of seven single copy nuclear genes as phylogenetic markers for further understanding the complex evolutionary history of lineages within this grade. Phylogenetic relationships are studied using the low-copy nuclear sucrose synthase locus, and the nuclear data are combined with two chloroplast loci, trnL and matK. To determine whether the SUSY gene evolved under the same evolutionary pressure within the Papilionoideae and the Caesalpinieae grade, we examine the evolution of the SUSY gene based upon the topology obtained. 2. Materials and methods 2.1. Taxon sampling We sampled 50 of the 56 genera of the Caesalpinieae sensu Lewis (2005; Table 2). The genera Stenodrepanum Harms, Lophocarpinia Bukart, Sympetalandra Stapf and Orphanodendron Barneby & J.W. Grimes are not included because we could not obtain leaf material; two others are not included because of poor quality of the material (Zuccagnia Cav. and Caesalpinia L.). Genera from subtribe Cassiinae (Cassieae) were also included in the study (Chamaecrista, Senna Mill., Cassia L.), as was Dinizia Ducke (Mimosoideae) because previous studies placed them as derived within the Caesalpinieae grade (Bruneau et al., 2001, 2008). Adenanthera L., Calpocalyx Harms, Cylicodiscus Harms, Entada Adans., Pentaclethra Benth., Piptadenia Benth., and Parkia R.Br. were selected to represent the basal Mimosoideae (Luckow et al., 2003). Two genera from the Dialiinae clade and nine from subfamily Papilionoideae were chosen as outgroup taxa. Most of the genera are represented by a single species and each species by up to three individuals. We use the generic delimitation of Lewis et al. (2005). Most samples are from fresh leaf material preserved in silica gel. 2.2. Loci sequenced We selected nuclear markers developed by Choi et al. (2004, 2006), Scherson et al. (2005) and J.J. Doyle (Cornell University, unpublished data). The objective of our analyses being phylogeny reconstruction at and below the subfamily level, we selected markers with a relatively large coding region because we considered that the structure of the exon would be better preserved within

151

the large Caesalpinieae grade and that the intron sequences would be too variable at this phylogenetic level. We evaluated the variability of seven markers (Table 3) for a restricted sampling of 12 Caesalpinieae grade taxa (Table 2). After sequencing, we manually edited chromatograms and performed a sequence similarity search (Blastn) (Altschul et al., 1997) on GenBank to ensure correspondence with the targeted locus. We aligned the sequences with the Sequence-Tagged Sites (STS) from Choi et al. (2004) and DNA sequences from Scherson et al. (2005). We performed preliminary Bayesian analyses to test for paralogs and to establish marker variability within the grade. Following these initial surveys, we pursued our phylogenetic analyses with SUSY and PP1, but subsequently only SUSY was retained for further analyses (see Results). In addition, we sequenced the chloroplast trnL and matK loci for several taxa which had not been studied by Bruneau et al. (2008) (Table 2). The potential marker saturation for PP1 and SUSY was assessed using a substitution saturation test (Xia et al., 2003), implemented in DAMBE version 5.0.52 (Xia and Xie, 2001). 2.3. DNA extraction, amplification and sequencing DNA was isolated from leaf tissue using a modified CTAB protocol (Joly et al., 2006) or the Qiagen Dneasy™ Kit (QIAGEN, Mississauga, Ontario, Canada). For the trnL region, the primers, PCR reaction mix, amplification, and sequencing procedures followed those described by Bruneau et al. (2001). The matK region was amplified using the conditions optimized by Bruneau et al. (2008). Several of the primers for the nuclear markers, initially developed for the Papilionoideae, were redesigned and optimized as specific primers for the Caesalpinioideae, including those for SUSY and PP1 (Table 3). Using BioEdit 7.0.5.3 (Hall, 1999), we aligned all publicly available SUSY sequence-tag sites (STS), express sequence tags (ESTs) and genomic sequences from the Leguminosae available, as well as outgroup sequences from the Brassicaceae Arabidopsis thaliana (L.) Heynh. Based on this alignment, conserved regions were identified and new primers were designed using the Amplify program version 3.1.4 (Engels, 2005). These new primers increased the length of the targeted region for SUSY and PP1 by, respectively 211 bp and 209 bp, relative to the original fragment sequenced by Choi et al. (2004). The PCR amplification reaction mix for the nuclear markers contained 1 Roche Diagnostics Buffer (Laval, Quebec, Canada), 100 lmol/L dNTP, 0.3 mmol/L primers, 1 unit Taq DNA polymerase, 50–150 ng genomic DNA, and 2.5–5% Dimethyl sulfoxide (DMSO), 0.05% Tween 20, or 2.5 lg Bovine serum albumin (BSA), topped with distilled water for a final reaction volume of 25 ll. Amplifications were conducted with a ‘‘hot start’’ cycle (Taq DNA polymerase added at 95 °C), followed by 40 cycles consisting of 3 min denaturation at 95 °C, annealing at 48–64 °C (depending on the species) for 30 s, and an extension step at 72 °C for 3 min. The sequencing reaction ended with an extension period at 10 °C. The PCR mix was aliquoted into three separate PCR tubes prior to thermocycling in order to minimize PCR recombination errors (Joly et al., 2006) and negative controls with no genomic DNA template were run on all amplifications. The presence of polymorphisms in initial sequences obtained from direct sequencing suggested that cloning was required. Therefore, all PCR products were cloned using a PGEM-T vector and transformed into chemically competent E. coli DH5-a. The transformed bacteria were screened on selective solid LB media containing 50 mg/ml kanamycin and 100 mg/ml ampicillin, and kept overnight at 37 °C. For each PCR product, six to 24 colonies were selected. The positive colonies were grown overnight in LB broth and then amplified. For each clone, PCR reactions first were performed to verify for the presence of the full-length desired sequence, and then purified and sequenced. The amplification and

152

V. Manzanilla, A. Bruneau / Molecular Phylogenetics and Evolution 65 (2012) 149–162

Table 2 Voucher specimen information and GenBank accession numbers. For SUSY 1, SUSY 2 and PP1 only alleles used in the analyses presented here are listed, but all sequenced alleles have been deposited in GenBank Generic segregates for species of Caesalpinia are given in parentheses following the currently recognized generic name. Taxonomic groups follow the grouping described in the present study. Genera marked by an asterisk represent the sampling for testing the seven nuclear markers. Species Caesalpinieae grade  Acrocarpus fraxinifolius Arn. Arapatiella psilophylla (Harms) R.S. Cowan Arcoa gonavensis Urb. Arcoa gonavensis Urb. Balsamocarpon brevifolium Clos  Batesia floribunda Benth. Burkea africana Hook. Bussea occidentalis Hutch. Bussea perrieri R. Vig. Caesalpinia (Tara) cacalaco Humb. & Bonpl. Caesalpinia (Guilandina) crista (L.) Small Caesalpinia (Libidibia) ferrea Mart.  Caesalpinia (Coulteria) gracilis Benth. ex Hemsl. Caesalpinia (Coulteria) violacea (Mill.) Standl. Caesalpinia (Poincianella) yucatanensis Greenm. Campsiandra comosa Benth. Cassia javanica L. Cenostigma gardnerianum Tul. Cenostigma macrophyllum Tul. Ceratonia siliqua L. Chamaecrista nictitans (L.) Moench Chidlowia sanguinea Hoyle Colvillea racemosa Bojer Colvillea racemosa Bojer Conzattia multiflora (Robinson) Standl. Conzattia multiflora (Robinson) Standl. Conzattia multiflora (Robinson) Standl. Cordeauxia edulis Hemsl.  Delonix elata (L.) Gamble Delonix regia (Hook.) Raf. Delonix regia (Hook.) Raf. Delonix regia (Hook.) Raf.  Dimorphandra conjugata Sandwith Dimorphandra mollis Benth. Dinizia excelsa Ducke Dinizia excelsa Ducke Taxon nov. (cf. Dinizia) Diptychandra aurantiaca Tul. Erythrophleum chlorostachys (F. Muell.) Baill. Erythrophleum guineense G.Don Erythrophleum ivorense A. Chev. Erythrophleum suaveolens (Guill. & Perr.) Brenan Erythrophleum suaveolens (Guill. & Perr.) Brenan  Erythrophleum suaveolens (Guill. & Perr.) Brenan Erythrostemon gilliesii (Hook.) D. Dietr. Gleditsia caspica Desf.  Gymnocladus dioica (L.) Koch Haematoxylum brasiletto H. Karst. Haematoxylum brasiletto H. Karst.  Hoffmannseggia glauca (Ortega) Eifert Jacqueshuberia brevipes Barneby Lemuropisum edule H. Perrier Melanoxylon brauna Schott Melanoxylon brauna Schott Mezoneuron angolensis (Oliv.) Herend. & Zarucchi Mezoneuron kauaiensis H. Mann Moldenhawera brasiliensis Yakovlev Moldenhawera floribunda Schrad. Mora gonggrijpii (Kleinh.) Sandwith Moullava spicata (Dalzell) Nicolson Pachyelasma tessmannii (Harms) Harms Pachyelasma tessmannii (Harms) Harms Parkinsonia aculeata L. Peltophorum dubium (Spreng.) Taub. Peltophorum dubium (Spreng.) Taub. Peltophorum pterocarpum (DC.) K. Heyne U. Peltophorum pterocarpum (DC.) K. Heyne U.  Pomaria jamesii (Torr. & Gray) Walper Pterogyne nitens Tul. Pterolobium stellatum (Forssk.) Brenan

Voucher or accession number

trnL intron

matK

SUSY 1

SUSY 2

Manos 1416 (DUKE) Carvalho 6095 (K) Jiménez 3522 (JBSD) Zanoni 35606 (NY) Baxter DCI 1869 (K, E) Grenand 3032 (CAY) Cook 48 (K) Moris 19245 (NY) Randrianasolo 527 (P) Lewis 1789 (K) Herendeen 1-V-99-3 (US) Fougère-Danezan 21 (MT) Lewis 2067 (K) Lewis 1763 (NY) Lewis 1766 (NY) Redden 1100 (US) Fougère 6 (MT) Thomas 9615 (K) Ferreira et al. 6371 (MO) Wieringa 3341 (WAG) Klitgaard 654 (K) Jongkind 7948 (WAG) Lewis 2147 (K) Bruneau 1360 (MT) Werling 399 (ASU) Hughes 1915 (NY) Hughes 2071 (K, FHO, MEXU) Kucher 17803 (K) Herendeen 20-XII-97-1 (US) Marazzi & Flores BM183 (MEXU) Haston V200304 (K) Archambault 3 (MT) Breteler 13800 (WAG) Aranjo 90 (NY) Jansen-Jacobs 1900 (NY) Sergio de Faria s.n. (BH) Folli 4884 (K) Klitgaard 70 (NY) Wieringa 4178 (WAG) Carvalho 4851 (K) Breteler 15446 (WAG) Herendeen 11-XII-97-2 (US) Fougère-Danezan 31 (MT) Herendeen 17-XII-97-3 (US) Spellenberg 12701 (MT) Herendeen 7-V-2002-2 (US) Montréal Botanical Garden, no. 1830-72 (MT) Wojciechowski 953 (ASU) Smith 258 (MT) Spellenberg 12699 (MT) Redden 1240 (US) Phillipson 3460 (K) Lopes & Andrall 113 (K) Nüschelet 10 (NY) Herendeen 12-XII-97-1 (US) Joel 1602 (NY) Queiroz 5530 (K) Klitgaard 30 (K) Breteler 13792 (WAG) Critchett 1179 (K) Harris 3972 (K) Breteler 1532 (WAG) Spellenberg 12704 (MT, NMC) Hughes, 2436 (K, FHO, BOLV, LPB, USZ) No. 90.2705, Wojciechowski 892 (ASU) Herendeen 12-XII-97-2 (US) Goyder 3719 (K) Higgins 17628 (NY) Herendeen 13-XII-97-1 (US) Herendeen 17-XII-97-9 (US)

AF365098j EU361738k AY232787l

EU361843k EU361859k

GQ293144

GQ293188

GQ293145

GQ293189

GQ293146

GQ293190

GQ293147

GQ293191

AF365063j EU361761k JX073260 AF365061j EU361778k

EU361861k EU361864k EU361869k EU361895k JX099327 EU361896k EU361898k EU361900k EU361901k EU361902k JX099334

EU361780k EU361782k

EU361908k EU361910k

EU361739k AF365109j EU361755k JX073259

PP1

GQ293184 GQ293167 GQ293154 GQ293155 GQ293177 JX175081

GQ293197 GQ293218 JX175055 GQ293193

GQ293151 JX073262 AF365075j AF365093j JX073263 EU361785k

EU361911k EU361914k JX099329 EU361916k

GQ293152 JX175048

GQ293194 JX175050

GQ293153

GQ293195

AY386918n GQ293196 EU361786k EU361787k AF365106j

k

EU361920 EU361928k AM086834q

GQ293157

GQ293199

JX175187

EU361934k

GQ293158 GQ293159

GQ293200 GQ293201

JX175189 JX175206 JX175209

EU361808k EU361799k

AF521827m EU361951k EU361935k

GQ293160

GQ293202

AF365102j

EU361948k GQ293162

GQ293205

AF365103j JX073265 AY232785l AF365095j

EU361949k JX099328 JX099330 EU361966k

GQ293176 GQ293163 GQ293164

GQ293217 GQ293206 GQ293207

AY386905n

JX175051

AY899734q AF365099j EU361798k

AF365067j AF365069j EU361815k AF365070j EU361822k

EU361969 EU361984k EU361991k EU362000k

AF365068j JX073266 EU361824k

EU361897k EU361897 EU362004k

AF365104j JX073267 AF365105j

EU362005k JX099331 EU362013k

AF365072j

EU362019k

EU361828k

AY386846n

AF365107j EU361830k AF365074j AF365073j

EU362023k EU362029k EU362031k EU362032k

k

GQ293204

JX175211 JX175212 JX175214 JX175215 JX175220 JX175216 JX175218 JX175217

JX175223

GQ293165 JX175053 GQ293168 GQ293148 GQ293149

GQ293209

GQ293169 GQ293170

GQ293210

GQ293171 GQ293172 GQ293173

GQ293211 GQ293212 GQ293213

GQ293174

GQ293214

JX175228

JX175229

GQ293178 GQ293179

JX175230

153

V. Manzanilla, A. Bruneau / Molecular Phylogenetics and Evolution 65 (2012) 149–162 Table 2 (continued) Species

Voucher or accession number

trnL intron

Recordoxylon amazonicum (Ducke) Ducke Recordoxylon amazonicum (Ducke) Ducke  Schizolobium parahyba (Vell.) Blake Senna occidentalis (L.) Roxb. Senna spectabilis (DC.) H.S. Irwin & Barneby Senna spectabilis (DC.) H.S. Irwin & Barneby Stachyothyrsus staudtii Harms Stahlia monosperma (Tul.) Urb. Stuhlmannia moavi Taub.  Tachigali sp. Tachigali sp. Tachigali amplifolia (Ducke) Barneby Tetrapterocarpon geayi Humbert Tetrapterocarpon geayi Humbert  Umtiza listeriana Sim Vouacapoua macropetala Sandwith

Lima 3333 (MO) Molino 1683 (CAY, MPV) Klitgaard 694 (K) Bruneau 1257 (MT) Marazzi et al. BM029 (PY, CTES, Z) Herendeen 74-IV-99-6 (US) Andel 4054 (WAG) Gardner 7029 (E) Robertson 7509 (K) Clarke 7212 (US) Klitgaard 687 (K) Motis et al. 24793 (NY) Bruneau 1395 (WAG) DuPuy M421 (MO) Schrire 2602 (K) Breteler 13793 (WAG)

AY899699p

Dialiinae clade Dialium guianense (Aubl.) Sandwith Koompassia excelsa (Becc.) Taub. Mimosoideae Adenanthera pavonina L. Calpocalyx dinklagei Harms Cylicodiscus gabunensis Harms Entada phaseoloides (L.) Merr. Entada polyphylla Benth. Pentaclethra macrophylla Benth. Pentaclethra macrophylla Benth. Piptadenia anolidurus Barneby Piptadenia robusta Pittier Parkia multijuga Benth. Papilionoideae Bobgunnia fistuloides (Harms) J.H. Kirkbr. & Wiersema Dussia macroprophyllata (Donn. Sm.) Harms Dussia tessmannii Harms Glycine max Merr. (L.) Leucomphalos callicarpus (Benth.) Breteler Medicago sativa L. Medicago truncatula L. Phaseolus vulgaris L. Pisum sativum L. Swartzia cardiosperma Spruce ex Benth. Vicia faba L. Vigna radiata (L.) R. Wilczek

AF365108j EU361836k

matK

SUSY 1

SUSY 2

EU362036k

GQ293180 GQ293181

GQ293219

AM086900q GQ293182

GQ293220

JX099332 EU362050k JX099335 EU362054k EU362040k

GQ293183

GQ293221 JX175054

JX099333

GQ293185

AF365101j AF365126j AF365110j

EU362062k EU362063k

GQ293186 GQ293187

Klitgaard 686 (K) Herendeen 1-V-99-7 (US)

AF365079j EU361816k

EU361930k EU361988k

JX175052 GQ293166

Major Howell Seeds (BH) Breteler 15461 (WAG) Breteler 14866 (WAG) Lorence 7994 (PTBG) Klitgaard 613 (K) BNBG 87-1143 (BR) J. deWilde 11496 (WAG) Klitgaard 691 (K) Arroyo 850 (NY) Klitgaard 697 (K)

AF278486i AF365043j AY125845p EU366228k

AF521808m EU361907k AF521819k EU366222k

GQ293150 GQ293156

Breteler 14870 (WAG) Landrum 10293 Klitgaard 628 (K) – Breteler 12331 (MO, K) – – – – Klitgaard 664 (K) – –

PP1

JX073268 AF430787j EU361839k AF365113j AF365111j

JX175231

GQ293222 GQ293223

GQ293192 GQ293198 GQ293203

AF521853m AF365051j

GQ293175 GQ293216

DQ784674o AF365050j

DQ790632o EU362018k

AF365038j

EU361885k AY386903n

JX073264 DQ131547r

AF142700w

DQ131554r DQ311712s GQ279376t DQ311717s AF365040j X51471u AB304065v

AY386881n AF522109x DQ450863y AY386961n EU362053k AY386899n DQ445950y

GQ293161 AF030231b AF049487z AJ131943c AF315375d AY386961n X69773f VIRVSS1g

JX175204 JX175226 AJ002488h

AB038648i

Accession numbers marked by a letter are from the following publications: a Choi et al. (2004), b Zhang et al. (1997), c Hohnjec et al. (1999), d Camas (GenBank, unpublished data), e Craig et al. (1999), f Heim et al. (1993), g Arai et al. (1992), h Vissi et al. (1998), i Takemiya et al. (2006), j Bruneau et al. (2001), k Bruneau et al. (2008), l Herendeen et al. (2003a), m Luckow et al. (2003), n Wojciechowski et al. (2004), o Jobson and Luckow (2007), p Haston et al. (2005), q Marazzi et al. (2006), r James and Schmidt (2004), s Ellison et al. (2006), t Ou et al. (GenBank, unpublished data), u Herdenberger et al. (1990), v Tun and Yamaguchi (2007), w Hu et al. (2000), x Steele and Wojciechowski (2003), y Delgado-Salinas et al. (2006), z Robinson et al. (GenBank, unpublished data).

sequencing conditions were the same as above except that the vector primer was used (i.e., SP6-T7). All PCR products were purified using a PEG purification protocol (Joly et al., 2006). Cycle sequencing was performed from both ends with ‘‘Big Dye Terminator’’ chemistry (Applied Biosystems, Foster City, California, USA), using one eighth of the reaction volume suggested in the manufacturer’s instructions for a total volume of 10 ll reaction with 0.25 ll of Big Dye Terminator. Sequenced products were run on an ABI 3100–avant automated DNA sequencer (Applied Biosystems). Chromatograms were manually edited and the two chromatograms of a fragment were assembled with Sequencher v.4.7 (Gene Codes Corp., Maddison, Wisconsin, USA). 2.4. Sequence alignment and phylogenetic analyses DNA sequences were aligned in Clustal W (Thompson et al., 1997) and manually adjusted in BioEdit 7.0.5.3 (Hall, 1999). The SUSY and matK loci, both protein-coding sequences, were translated to amino acids to verify the alignment. Regions in which positional homology was ambiguous were excluded from the analysis

for the matK and trnL loci. Gaps (indels) were coded as separate presence/absence characters as implemented in SeqState (Müller, 2005); a total of 42 indels were coded for the two chloroplast markers. Introns in SUSY were excluded because we were unable to align them with certainty. No indels were observed in the SUSY exons. Initially, phylogenetic analyses were conducted with all SUSY alleles for all individuals sequenced to test whether alleles of single individuals formed monophyletic groups (Manzanilla, 2009). Subsequently, one allele was chosen at random to represent each monophyletic individual. SeqState also was used to evaluate the range of sequence divergence and the proportion of informative sites for each of the loci. Aligned DNA sequences are available in TreeBASE (12744). Because a partitioning strategy may help capture the underlying evolutionary process with accuracy, we divided the sequence data into biologically relevant partitions. We developed four partition models taking into account region sequenced, gap data, and codon position for the coding regions (see Table 4 legend). For each partition, we selected the best-fitting model using the AIC criterion implemented in jModelTest (Posada, 2008). We used the standard

154

V. Manzanilla, A. Bruneau / Molecular Phylogenetics and Evolution 65 (2012) 149–162

Table 3 Nuclear markers tested on a subsample of Caesalpinieae genera. F corresponds to the forward primer sequence and R to the reverse primer sequence. Marker name

Putative function

Orientation

Primer sequences

Aluminum-induced protein-like Size 450–850 bp

F R

GAAGAAGCTTTGAATGGCACTGTTACAGT TATGTACACTTGAAAATGTAAGAAATACAT

CNGC4a

Cyclic nucleotide-regulated ion channel Size 735–1350 bp

F R

AGAGATGAGAATCAAGAGGAGGGATGCAd TTTCGTCCACTGGACTCACAGCAAAGT

FENRa

Ferredoxin-NADP reductase precursor Size 489–754 bp

F R

ATGCTTATGCCAAAAGATCCAAATGCd CTCACAGCAAAGTCGAGCCTGAAGTd

HINDc

Cytosolic tRNA-Ala synthetase Size 450–690 bp

F R

CCGCAACTCGCCGGCGAAACCCGCGd CATGCTATCTTGCTCCACGAGCCTCCAd

PP1c

Proteine phosphatase 1 Size 675–783 bp

F R

GTGACATTCATGGGCAGTACAGTGA GCAGGCTTAAGAATCTGGAAGANCACATC

S24MTc

Putative methyltransferase Size 880–1020 bp

F R

GCTGATTTCATGAAGATGCCATTCd GTCAGGAAGCCCATCTCCAATCTCd

SUSYa

Sucrose synthase Size 691–948 bp

F R

GCACTTGAGA AGACCAAGTATCCTG TTCCAAGTCCTTTGACTCCTTCCTCC

ARG10

a b c d

b

Primers are from Choi et al. (2004, 2006). Primers are from Scherson et al. (2005). Primers are from J. J. Doyle (Cornell University, unpublished data). Unmodified from the original publication.

Bayes Factor (BF) to compare the effect of the segmentation of our data on the Bayesian analysis (Kass and Raftery, 1995; Nylander et al., 2004). We followed the recommendation of Kass and Raftery (1995) and accepted a BF higher than 10 as strongly supporting a more partitioned model. We estimated the marginal likelihood using Tracer v1.4 (Rambaut and Drummond, 2007) and we applied the smoothing estimate correction option with 1000 bootstrap replicates. Bayesian analyses were performed using a parallel version of MrBayes v3.1.2 (Huelsenbeck and Ronquist, 2001; Ronquist and Huelsenbeck, 2003; Altekar et al., 2004). The rate of variation between partitions and model parameters were unlinked across partitions to obtain a mixed model, and the rate multiplier (branch length) was unlinked as suggested by Marshall et al. (2006). Each Bayesian analysis was implemented using a random starting tree and was run for a total of 10 million generations, sampling every 1000 generations. Four Markov runs were conducted with 16 chains per run and fixing the number of swaps at eight (Nswaps = 8). To assess the convergence of the analysis, we first inspected the density log likelihood and the overlap of the mutation rate with Tracer (Rambaut and Drummond, 2007). We used AWTY (Wilgenbusch et al., 2004) to trace the evolution of the posterior probabilities (PP) of clades during the analyses. The burn-in was determined from the log distribution and PP clade stabilization. Maximum likelihood (ML) analyses were performed with the Treefinder program (Jobb et al., 2004) using the model proposed by jModelTest (Posada, 2008). The phylogeny was reconstructed

Table 4 2log Bayes Factors results of comparisons of all partitioning strategies. Negative values represent evidence against alternative hypotheses. Partition model 1 (11 partitions): each codon position as a separate partition for three coding regions (SUSY1, SUSY2, matK), one partition each for trnL and gap data; Partition model 2 (8 partitions): third codon position separate from first two positions for three coding regions, one partition each for trnL and gap data; Partition model 3 (5 partitions): no distinction between codon positions for three coding regions, one partition each for trnL and gap data; Partition model 4 (2 partitions): one partition each for all nucleotide data and for gap data. Partition model 1 2 3 4

Likelihood

1

18521.90 18415.85 18714.12 18866.64

–

2 37.889 –

3

4

91.237 129.125 –

156.49 194.379 65.254 –

with five of the starting trees, which were obtained using the command ‘‘Generate Start Trees.’’ We performed a parametric bootstrap with 1000 replicates with the same starting trees. 2.5. Nuclear paralog evolution The presence of a duplication event in the sucrose synthase gene was inferred based on the topology obtained from the phylogenetic analyses. To detect the type of putative selective pressure that predominates in the evolution of the SUSY paralogs, we tested various evolutionary models using the CODEML package from PAML v4.2 (Yang, 2007), which is based on a ML framework with codon-based models of sequence evolution. The nonsynonymous (dN; amino acid replacement) and synonymous (dS; silent) substitution rate ratios (dN/dS or x) were estimated over the SUSY topology with a variety of site-specific and branch-site codon substitution models. For these analyses, we used a species tree for each paralog based on a ML analysis implemented in Treefinder. We first applied site-specific models (i.e., M0, M1a, M2a, M3; Yang, 2006), which allow x to vary among codon sites. The one-ratio model (M0) assumes a single x for all sites over all branches in the phylogeny and was used to estimate global x values independently for the SUSY 1 and 2 lineages. The nearly neutral model (M1a) assumes two site classes, conserved sites (x0 < 1) and neutral sites (x1 = 1), whereas the selection model (M2a) adds a third class of sites under positive selection (x2 > 1) where x2 is estimated from the data. If the M2a model is found to provide a better fit than the M1a model (a special case of the M2a model) using a likelihood ratio test (LRT; tested against a chi-square distribution), a Bayes Empirical Bayes (BEB) is used to identify which sites are evolving under positive selection. The discrete model (M3) partitions the sites among three site classes, where x is estimated for each site class. We compared the fit of the M3 model against the M0 model using a LRT to test for heterogeneity in selection pressures among codons. A branch site model (MA) was also applied to determine whether the SUSY 2 lineage as a whole has evolved at a different evolutionary rate compared to the rest of the phylogeny. In this model there are two branch categories: one category corresponds to the background branches (i.e. all lineages in the phylogeny excluding the SUSY 2 lineages) and the other is for the foreground branches (i.e. all SUSY 2 lineages). There are also three site categories: one neutral (x1 = 1), one under purifying selection (x0 < 1),

V. Manzanilla, A. Bruneau / Molecular Phylogenetics and Evolution 65 (2012) 149–162

and a third one for the foreground branches only that is under positive selection (x2 > 1). To test for evidence of positive selection in SUSY 2, we compared this model with a more specific one with no positive selection (x2 = 1) using a LRT. The same analysis was also performed using the SUSY 1 lineage as foreground. 3. Results 3.1. Nuclear phylogenetic markers Although seven low-copy nuclear loci were tested for their phylogenetic utility in the Caesalpinioideae (Table 3), only one proved appropriate. The screening of ARGI and CNGC4 sequences showed a high degree of variability, with sequence length variations among species of up to 400 bp and 300 bp, respectively. The FERN and S24MT loci amplifications yielded multiple bands and variation in length up to 500 bp. Amplification of the HIND marker was unsuccessful. PP1 amplified easily and seemed to provide an appropriate level of variation for the group studied, but the phylogenetic pattern obtained was chaotic (Manzanilla, 2009). By examining the conceptual translation of the PP1 gene sequences, we found a stop codon indicating the presence of a pseudogene and the presence of paralogous copies of PP1. Despite the identification of paralogs, we were unable to recover a coherent phylogenetic signal. Moreover, this locus showed a significant level of saturation with a proportion of invariable sites at 0.561, as calculated by jModelTest (Iss = 0.296, Iss.c = 0.707, p = 0.0918). The SUSY locus had a high variation rate and was sufficiently long, which corresponded to the criteria set for this study. SUSY is composed of three exons (150 bp, 221 bp, 174 bp, respectively) and two introns (80–130 bp and 76–273 bp). Two copies of SUSY (named SUSY 1 and SUSY 2) were detected for the majority of the taxa sampled here. We did not observe a second copy of the marker for genera within the Dialiinae clade and the Papilionoideae, despite extensive sampling of clones (24–48 clones per sample). The translation into amino acid sequences of both partial copies did not reveal stop codons, suggesting that both copies might be functional. We treated these paralogs as two phylogenetic markers. The intron regions were removed from the alignment because they were hyper-variable; however these introns may prove useful in phylogenetic studies at the inter-specific level in caesalpinioid legumes. The sequence comparisons using SeqState (Müller, 2005) suggested that overall among Caesalpinieae grade taxa, the SUSY coding sequences were strongly divergent (range of up to 4% for SUSY 1 sequences; up to 4.25% for SUSY 2 sequences), compared to 2.7% for the matK coding region. However, the PAML (Yang, 2007) analyses indicated that the 182 amino acid sequences are highly conserved with 0.35% and 0.5% divergence for SUSY 1 and SUSY 2 across the Caesalpinieae grade, in comparison with 0.7% divergence for the matK gene. Approximately 13% of SUSY 1 and 11% of SUSY 2 sites are phylogenetically informative, compared to 10% of sites for the matK coding region and 12% for the trnL intron. 3.2. Phylogenetic analyses In the final matrix, at least one SUSY sequence was obtained for 42 of 60 genera of the Caesalpinieae grade (47 species; 16 samples with only one of the two SUSY paralogs), six genera of subfamily Mimosoideae, two from the Dialiinae clade, and eight from the Papilionoideae (seven previously published). All sequences are deposited in GenBank (Table 2). We were unable to obtain nuclear sequences for 12 genera for which we had plastid data, but these genera were included in the combined plastid plus nuclear matrix to achieve a better representation of the phylogeny of the group.

155

The combined matrix included 3437 characters, of which 10% were informative. The final alignment contained 8% missing data. Using AWTY and Tracer, we estimated at around five million generations per run the convergence of each run of the Bayesian analysis to an apparent stationary position. The plot of the likelihood score for each run revealed that some runs were stuck on a local maximum, leading us to re-start the analysis. The likelihood score of partition models 1 and 2 (that take into consideration codon position) fitted the data better than partition models 3 and 4 (see Table 4). The partition model 2, which distinguishes the third codon position for all coding regions, had fewer parameters to estimate than partition model 1 and fit the data better.

3.3. Phylogenetic relationships The nuclear gene phylogenetic analysis revealed the presence of two paralogous clades, SUSY 1 and SUSY 2 (Fig. 1). The tree is rooted with the Dialiinae and, in this analysis, the Papilionoideae are weakly supported as sister to the SUSY 1 clade. Within both the SUSY 1 and SUSY 2 clades, our analyses resolved four clades (Peltophorum, Cassia, Caesalpinia, Mimosoideae), with the same pattern of relationships in the two clades, albeit not always wellsupported. The previously recognized Umtiza clade (Herendeen et al., 2003b) is not supported as monophyletic and relationships of genera in the Dimorphandra Group (Lewis, 2005) remain poorly resolved relative to their placement with the Mimosoideae and Peltophorum clades. No major dissimilarities between the ML and the Bayesian combined analyses were found except for the position of a few terminal nodes. In the combined nuclear and plastid analysis with both Bayesian and ML, we identified five strongly supported clades within the Caesalpinieae grade: Cassia, Caesalpinia, Peltophorum, Tachigali, Mimosoideae; PP = 0.89–1.00, ML = 74–100 (Fig. 2). As in the SUSY only analysis, the Umtiza clade recognized by Herendeen et al. (2003b) is not resolved as monophyletic, but includes three paraphyletic lineages that are each well supported. The Dimorphandra Group also is not supported as monophyletic. These combined plastid and nuclear DNA analyses suggest that Cordeauxia and Stuhlmannia are sister to the other genera in a wellsupported Caesalpinia clade. The remainder of the Caesalpinia clade clearly separates into two strongly supported groups. One clade includes Pomaria, Erythrostemon and Poincianella as a monophyletic group sister to a group consisting of Libidibia, Hoffmannseggia, Stahlia and Balsamocarpon. The other Caesalpinia clade resolves Tara and Coulteria as sister to a clade formed by Moullava, Pterolobium, Guilandina, Cenostigma, and Mezoneuron, but with no clear resolution among these two subclades and the genus Haematoxylum. As resolved here, the Cassia clade groups together with moderate support values (PP = 0.89, ML = 74) seven genera that previously had not been considered closely related. However, relationships among these genera are unclear. The topology presents Cassia as sister to Senna, both sister to a clade that includes Vouacapoua, Recordoxylon, Melanoxylon, Chamaecrista and Batesia. The genus Pterogyne is in an ambiguous position and, depending on the marker or the analysis, it can be placed either in the Caesalpinia clade (plastid data) or in the Cassia clade (nuclear and combined data, Figs. 1 and 2). Moreover, Pterogyne distinguishes itself from other taxa by a longer branch, both in the nuclear and chloroplast DNA topologies. The Peltophorum clade has high support values and the relationships within the clade are well supported. Nevertheless the relationships between Delonix, Lemuropisum and Colvillea remain unclear, and Delonix appears polyphyletic. The relationship of the Tachigali clade (all three genera sampled; PP = 1.00, ML = 84) with

156

V. Manzanilla, A. Bruneau / Molecular Phylogenetics and Evolution 65 (2012) 149–162

Fig. 1. Bayesian inference of the sucrose synthase paralogs in a phylogenetic analysis of the Caesalpinieae grade. Numbers above the branches indicate the Bayesian posterior probabilities, those below the branches indicate bootstrap values from the ML analysis (values below 50% are not indicated and branches supported by less than 50% posterior probabilities are collapsed).

the Peltophorum clade and one of the Dimorphandra groups is poorly resolved.

The Dimorphandra Group is divided into two groups, here named A and B. The Dimorphandra Group A is a weakly supported

V. Manzanilla, A. Bruneau / Molecular Phylogenetics and Evolution 65 (2012) 149–162

157

Fig. 2. ML tree from the partition model 2 from sucrose synthase and plastid data for the Caesalpinieae grade. Numbers above the branches indicate the Bayesian posterior probabilities, those below the branches indicate bootstrap values from the ML analysis (values below 50% are not indicated and branches with less than 50% bootstrap support are collapsed). Taxa in bold are those reported to nodulate by Sprent (2001, 2009).

clade that includes five genera: Dinizia, placed in subfamily Mimosoideae by Lewis (2005), Dimorphandra, Stachyothyrsus, Mora, and

Burkea. Depending on the analysis (and locus sampled), the genus Campsiandra sometimes groups with the Dimorphandra Group A.

158

V. Manzanilla, A. Bruneau / Molecular Phylogenetics and Evolution 65 (2012) 149–162

Table 5 Maximum likelihood parameter estimates for two copies of the SUSY gene in the Caesalpinieae grade. x, ratio of synonymous/non-synonymous substitutions; p, proportion of sites estimated. Model

SUSY 1 Log likelihood

MO (one-ratio) M1a (neutral)

5595.83 5476.04

M2a (selection)

5483.60

M3 (discrete)

5465.07

Branch site model A Background Foreground

5483.82

SUSY 2 Parameter estimates

Positively selected sites

x = 0.022

None Not allowed

4591.39 4456.68

103R (p > 0.5)

4443.08

103R (p > 0.99)

4427.19

p0 = 0.98 (p1 = 0.016) x0 = 0.01, x1 = 1 p0 = 0.984, p1 = 0.016 (p2 = 0) x0 = 0.012, x1 = 1, x2 = 13.47 p0 = 0.971, p1 = 0.024 (p2 = 0.005) p0 = 0.918, p1 = 0.015, p2a = 0.066, p2b = 0.001 x0 = 0.012, x1 = 1.0 x0 = 0.012, x1 = 1.0, x2a = 1.0, x2b = 1.0

Our analysis of the closest relatives of subfamily Mimosoideae suggests that a grade of several caesalpinioid genera may be at the base of the Mimosoideae (Moldenhawera, Diptychandra, Pachyelasma and Erythrophleum). This grade of Dimorphandra Group B genera always occurs as close relatives of Mimosoideae, but relationships are never well supported. The Mimosoideae clade is strongly supported (PP = 1.00, ML = 100) and includes the caesalpinioid genus Chidlowia. 3.4. Nuclear marker evolution The codon selection model analyses with PAML (Yang, 2007) found low values for x, suggesting strong purifying selection for both the SUSY1 and SUSY2 paralogs (xsusy1 = 0.022 and xsusy2 = 0.038, given the one-ratio model (M0); Table 5). The M2a model fits significantly better the data than the M1a model (2Dlsusy1 = 15.12, 2Dlsusy2 = 27.2, p < 0.0001, df = 2) suggesting that there could be positive selection in both paralog lineages. The maximum likelihood estimates under the selection model, M2a, suggest that about 0% and 0.5% of the SUSY 1 and SUSY 2 sites, respectively, are under positive selection, with a much higher estimated x for SUSY 1 (x2 = 13.5) than for SUSY 2 (x2 = 4). The comparison of the one ratio (M0) model with the discrete model (M3) (2Dlsusy1 = 261.5, 2Dlsusy2 = 328.38, p < 0.0001, df = 4) suggests heterogeneity across sites in both SUSY lineages. The paralogous genes may have experienced different evolutionary pressures, which would be visible with the estimation of different classes of sites. The M2a (and M3) model identifies four sites (codons) as potentially under positive selection: 102K, 103R, 132N and 160R (Table 5). Because both paralogs appear to evolve by positive selection for just one or a few amino acid changes, the x ratios are not very different between the SUSY 1 and SUSY 2 clades. The MA branch site model shows that 87% of the SUSY 2 sequences are under strong purifying selection, against 97% for SUSY 1, suggesting that SUSY 1 is under stronger purifying selection than SUSY 2. The MA model did not provide a significantly better fit to the data than the null hypothesis of neutrality with x2 = 1, providing no evidence for directional selection either for the SUSY 2 lineage, or for the SUSY 1 lineage, relative to the background lineages. 4. Discussion 4.1. Nuclear loci evolution The two SUSY paralog clades form well-supported gene subfamilies, in which the evolutionary patterns among lineages is similar. The Papilionoideae and Dialiinae clades do not appear to possess

Log likelihood

4456.82

Parameter estimates

Positively selected sites

x = 0.038 p0 = 0.961 (p1 = 0.039) x0 = 0.017, x1 = 1 p0 = 0.960, p1 = 0.035 (p2 = 0.005) x0 = 0.01, x1 = 1 x2 = 3.99 p0 = 0.874, p1 = 0.109 (p2 = 0.017)

None Not allowed 160R (p > 0.99) 102K, 132N, 160R (p > 0.99)

p0 = 0.878, p1 = 0.036, p2a = 0.083, p2b = 0.003 x0 = 0.017, x1 = 1.0 x0 = 0.017, x1 = 1.0, x2a = 1.0, x2b = 1.0

the two copies of SUSY according to our sampling (see also Choi et al., 2004, 2006), but we cannot exclude the possibility that additional paralogs could be present in earlier diverged lineages. The Mimosoideae sampled have both SUSY copies identified in this study. In consequence, we consider that SUSY may have undergone a duplication event following the divergence of the Papilionoideae clade (Fig. 3). However, it is also possible that the duplication occurred prior to the divergence of the Papilionoideae clade (Fig. 1) but this would imply SUSY 2 paralog loss in this subfamily. Single gene duplication events occur stochastically and are known for contributing to gene polymorphisms (Lynch and Conery, 2000; Moore and Purugganan, 2005). At higher phylogenetic levels, similar independent duplication events are known to have occurred regularly in the evolution of plant genes and have been identified in other groups, including other Leguminosae (e.g., Lavin et al., 1998; Citerne et al., 2003; Archambault and Bruneau, 2004). Although the observed conservation in the phylogenetic pattern of the two paralogs is remarkable and particularly useful for phylogeny reconstruction, congruent phylogenetic signals of paralogs have been noted elsewhere (e.g., Ree et al., 2004). Immediately following a duplication event, paralogs are co-expressed and preserve their function, but this functional redundancy may have several outcomes within an organism (Lynch and Conery, 2000; Moore and Purugganan, 2005). Thus, we were interested in better understanding the evolutionary pressure experienced after the duplication event in both sucrose synthase copies. For example, following a duplication event, either paralog may accumulate degenerative mutations to become a pseudogene. Pseudogenization implies relaxed evolution (x = 1), where the gene accumulates neutral mutations, often at an observed accelerated rate. Alternatively the new gene may take on a new function driven by positive selection due to new selective pressures (x > 1) with a predominance of adaptive mutations (neofunctionalization). In addition, the duplicated genes may conserve the same function but with different spatial or temporal actions due to differences in the coding or regulatory regions. This subfunctionalization may be the result of the accumulation of degenerate mutations (x > 1), where positive selection may also have played a key role. The codon selection model analyses suggest that the SUSY amino acid sequence is relatively conserved with no major differences among lineages due to purifying selection. Assuming that an ancestrally duplicated copy was not subsequently lost in the Papilionoideae, the phylogenetic analyses (Fig. 1) indicate that the SUSY 1 sequences, rather than the SUSY 2 sequences, are more similar to the unduplicated sequences of the SUSY gene. Regardless, the absence of strong differences in selection pressure between the two paralogs, as noted by the codon model selection, suggests that subfunctionalization rather than

V. Manzanilla, A. Bruneau / Molecular Phylogenetics and Evolution 65 (2012) 149–162

159

Dialiinae clade, Outgroup

1 100

1

Papilionoideae

1 98 1 100

100

1 99

Duplication of SUSY

Umtiza grade

0.89 74

0.95 50

Cassia clade

1 97

Caesalpinia clade

0.92 67

1 99

Dimorphandra group B

1 87

1 100

1 84

Mimosoideae

Tachigali clade

Dimorphandra group A

0.75 0.72

Documented nodulation

1 100

Peltophorum clade

0.3 Fig. 3. Summary maximum likelihood (ML) tree using the partition model 2 (Table 4) for sucrose synthase and plastid data for the Caesalpinieae grade. Numbers above the branches indicate the Bayesian posterior probabilities, while those below the branches indicate bootstrap values from the ML analysis. The major clades observed in Fig. 2 are indicated; branches with less than 50% bootstrap support are collapsed. Black stars indicate nodulating taxa for species and genera studied, following Sprent (2001, 2009).

neofunctionalization may be a more plausible explanation for the evolution of the sucrose synthase gene is caesalpinioid legumes. The SUSY gene is implicated in root nodule formation and metabolism (Baier et al., 2007). The possible subfunctionalization of this gene may be the consequence of particular morphological, structural or regulatory features of root nodules (Sprent, 2009). Our phylogenetic study supports multiple origins of nodules and their presence throughout all the Caesalpinieae clades and in the Cassieae clade as well (Fig. 3). The evolutionary history of nodules appears to be a complex problem within the Caesalpinieae grade, which could be further studied through phylogenies of genes implicated in the N-fixating process (see Doyle, 2011).

4.2. Caesalpinieae grade phylogeny The addition of nuclear sequence data provides a stronger phylogenetic signal compared to previous plastid phylogenetic analyses of subfamily Caesalpinioideae (e.g., Bruneau et al., 2001, 2008). The nuclear markers studied have a faster evolutionary rate than most plastid markers used to date. With the addition of these numerous variable characters, we obtain a more complete view of phylogenetic relationships in the Caesalpinieae grade and in the early diverging lineages of the Mimosoideae. The SUSY duplication event, which is common to the Caesalpinieae grade and the Mimosoideae, adds a valuable taxonomic character which supports the monophyly of

160

V. Manzanilla, A. Bruneau / Molecular Phylogenetics and Evolution 65 (2012) 149–162

these two groups together. In this phylogenetic analysis, we are missing nuclear or plastid sequences for six genera generally placed in the tribe Caesalpinieae (Polhill, 1994; Lewis, 2005), four of which rarely or never have been included in a molecular analysis because of lack of or poor quality of material (Stenodrepanum, Sympetalandra, Lophocarpinia, and Orphanodendron; Table 1). In the combined analyses, some groups are better supported and several have better resolved intergeneric relationships. However, the positions of certain taxa differ between the nuclear and plastid analyses. The nuclear topology suggests that Pterogyne belongs to the Cassia clade as also suggested by the morphological analyses of Herendeen et al. (2003a), whereas previous plastid DNA analyses had shown Pterogyne as sister to the Caesalpinia clade, albeit with weak support values (Haston et al., 2003; Bruneau et al., 2008). This uncertainty may be attributed to the low variability of the chloroplast genome. The long branch in Pterogyne is notable for all molecular markers (i.e., Bruneau et al. (2008) for the chloroplast markers; Fig. 1 for SUSY), indicating a rapid evolutionary rate for this monospecific genus, which is presently unexplained. The phylogeny obtained in previous molecular and morphological studies considered the Umtiza group to be a clade (Herendeen et al., 2003a, 2003b; Bruneau et al., 2008), but in our analyses this clade is not supported (Fig. 2). The combined morphological and molecular analyses of Herendeen et al. (2003a) also suggest that Tachigali is sister to the Caesalpinieae grade with the exception of the Umtiza grade but all molecular analyses to date suggest a nested position within the Caesalpinieae grade. We infer the position of the genus Dinizia to be within the caesalpinioids, as previously suggested (Luckow et al., 2000; Wojciechowski et al., 2004; Bruneau et al., 2008), and excluding this genus, our analyses support the monophyly of subfamily Mimosoideae (with very limited sampling). Conversely, our analyses suggest for the first time that the morphologically distinct monospecific West African genus Chidlowia, generally considered a member of the Caesalpinioideae (Lewis, 2005), might best be placed in the Mimosoideae. The Dimorphandra Group B grade contains genera that are morphologically similar to some of the Mimosoideae, bringing into question the taxonomic delimitation and the evolution of the Caesalpinioideae, and in particular of the Caesalpinieae grade. For example, should we include these caesalpinioid lineages (Dimorphandra Group B grade) within the Mimosoideae as early diverging genera of mimosoids? Or should we include the whole Caesalpinieae grade within the Mimosoideae? In summary, what is the distinction between Caesalpinieae and Mimosoideae genera? The SUSY duplication event is a good molecular synapomorphy that indicates a common evolutionary history for the Caesalpinieae grade and the Mimosoideae. This could be used to argue the Caesalpinieae grade should be part of one large subfamily Mimosoideae, in which the Caesalpinieae clades would represent different tribes. Alternatively, the Mimosoideae could include the Dimorphandra Group B grade genera with perhaps some other closely related clades of the Caesalpinieae grade (i.e., Dimorphandra Group A, Peltophorum, Tachigali clades). Each clade would be defined as a tribe of Mimosoideae and the remaining Caesalpinideae grade lineages could be defined as distinct subfamilies of the Leguminosae. Of course, this alternative increases the number of subfamilies and the taxonomic complexity of the family. Future phylogenetic developments may help to delimit the transition between the Caesalpinieae grade and the Mimosoideae, with more extensive species-level sampling of the Dimorphandra Group and early diverging lineages of mimosoids in order to better understand which caesalpinioid genera are sister to the Mimosoideae. The addition of numerous nuclear markers in the phylogeny of the legumes appears to be ideal to resolve these intergeneric phylogenies. However, we need a better understanding of nuclear genome evolution of the caesalpinioids to obtain additional single copy nuclear markers (Cronk et al., 2006). The genomic project on Chamaecrista fasciculata may help identify useful nuclear loci (Sing-

er et al., 2009; Cannon et al., 2010). To understand the evolution of the legumes, the addition of morphological data appears to be crucial to resolve the taxonomic dilemma surrounding the delimitation of the Caesalpinieae grade and of the subfamily Mimosoideae. Acknowledgments The authors thank Marielle Babineau, Marjorie Mercure and Sébastien Renaud for laboratory assistance and members of the A. Bruneau and L. Brouillet labs, as well as Annie Archambault, Simon Joly and two reviewers for comments on the manuscript. We kindly acknowledge the Réseau Québécois de Calcul Haute Performance (RQCHP) for providing computational facilities. This project was funded by grants from the Natural Sciences and Engineering Research Council (Canada) and National Science Foundation (USA) DEB-9527673. References Altekar, G., Dwarkadas, S., Huelsenbeck, J.P., Ronquist, F., 2004. Parallel Metropolis coupled Markov chain Monte Carlo for Bayesian phylogenetic inference. Bioinformatics 20, 407–415. Altschul, S.F., Madden, T.L., Schäffer, A.A., Zhang, J., Zhang, Z., Miller, W., Lipman, D.J., 1997. Gapped BLAST and PSI-BLAST: a new generation of protein database search programs. Nucl. Acids Res. 25, 389–402. Arai, M., Mori, H., Imaseki, H., 1992. Expression of the gene for sucrose synthase during growth of mung bean seedlings. Plant Cell Physiol. 33, 503–506. Archambault, A., Bruneau, A., 2004. Phylogenetic utility of the LEAFY/FLORICAULA gene in the Caesalpinioideae (Leguminosae): gene duplication and a novel insertion. Syst. Bot. 29, 609–626. Baier, M.C., Barsch, A., Küster, H., Hohnjec, N., 2007. Antisense repression of the Medicago truncatula nodule-enhanced sucrose synthase leads to a handicapped nitrogen fixation mirrored by specific alterations in the symbiotic transcriptome and metabolome. Plant Physiol. 145, 1600–1618. Banks, H., Klitgaard, B.B., Lewis, G.P., Crane, P.R., Bruneau, A., 2003. Pollen and the systematics of tribes Caesalpinieae and Cassieae (Caesalpinioideae: Leguminosae). In: Klitgaard, B., Bruneau, A. (Eds.), Advances in Legume Systematics, Part 10. Royal Botanic Gardens, Kew, pp. 95–122. Bruneau, A., Forest, F., Herendeen, P.S., Klitgaard, B.B., Lewis, G.P., 2001. Phylogenetic relationships in the Caesalpinioideae (Leguminosae) as inferred from chloroplast trnL intron sequences. Syst. Bot. 26, 487–514. Bruneau, A., Mercure, M., Lewis, G.P., Herendeen, P.S., 2008. Phylogenetic patterns and diversification in the caesalpinioid legumes. Botany 86, 697–718. Cannon, S.B., Ilut, D., Farmer, A.D., Maki, S.L., May, G.D., Singer, S.R., Doyle, J.J., 2010. Polyploidy did not predate the evolution of nodulation in all legumes. PLoS ONE 5, e11630. Chappill, J.A., 1995. Cladistic analysis of the Leguminosae: the development of an explicit phylogenetic hypothesis. In: Polhill, R.M., Raven, P.H. (Eds.), Advances in Legume Systematics, Part 7. Royal Botanic Gardens, Kew, pp. 1–9. Chapman, M.A., Chang, J., Weisman, D., Kesseli, R.V., Burke, J.M., 2007. Universal markers for comparative mapping and phylogenetic analysis in the Asteraceae (Compositae). Theor. Appl. Genet. 115, 747–755. Choi, H.-K., Kim, D., Uhm, T., Limpens, E., Lim, H., Mun, J.-H., Kalo, P., Penmetsa, R.V., Seres, A., Kulikova, O., Roe, B.A., Bisseling, T., Kiss, G.B., Cook, D.R., 2004. A sequence-based genetic map of Medicago truncatula and comparison of marker colinearity with M. sativa. Genetics 166, 1463–1502. Choi, H.-K., Luckow, M.A., Doyle, J., Cook, D.R., 2006. Development of nuclear genederived molecular markers linked to legume genetic maps. Mol. Genet. Genom. 276, 56–70. Citerne, H.L., Luo, D., Pennington, R.T., Coen, E., Cronk, Q.C.B., 2003. A phylogenomic investigation of CYCLOIDEA-Like TCP genes in the Leguminosae. Plant Physiol. 131, 1042–1053. Craig, J., Barratt, P., Tatge, H., Dejardin, A., Handley, L., Gardner, C.D., Barber, L., Wang, T., Hedley, C., Martin, C., Smith, A.M., 1999. Mutations at the rug4 locus alter the carbon and nitrogen metabolism of pea plants through an effect on sucrose synthase. Plant J. 17, 353-36. Cronk, Q., Ojeda, I., Pennington, R.T., 2006. Legume comparative genomics: progress in phylogenetics and phylogenomics. Curr. Opin. Plant Biol. 9, 99–103. Delgado-Salinas, A., Bibler, R., Lavin, M., 2006. Phylogeny of the genus Phaseolus (Leguminosae): a recent diversification in an ancient landscape. Syst. Bot. 31, 779–791. Doyle, J.J., 1994. Phylogeny of the legume family: an approach to understanding the origins of nodulation. Ann. Rev. Ecol. Syst. 25, 325–349. Doyle, J.J., 2011. Phylogenetic perspectives on the origins of nodulation. Mol. Plant– Microbe Interact. 24, 1289–1295. Doyle, J.J., Doyle, J.L., Ballenger, J.A., Dickson, E.E., Kajita, T., Ohashi, H., 1997. A phylogeny of the chloroplast gene rbcL in the Leguminosae: taxonomic correlations and insights into the evolution of nodulation. Am. J. Bot. 84, 541– 554.

V. Manzanilla, A. Bruneau / Molecular Phylogenetics and Evolution 65 (2012) 149–162 Doyle, J.J., Chappill, J.A., Bailey, C.D., Kajita, T., 2000. Towards a comprehensive phylogeny of legumes: evidence from rbcL sequences and non-molecular data. In: Herendeen, P.S., Bruneau, A. (Eds.), Advances in Legume Systematics, Part 9. Royal Botanic Gardens, Kew, pp. 1–20. Doyle, J.J., Luckow, M.A., 2003. The rest of the iceberg. Legume diversity and evolution in a phylogenetic context. Plant Physiol. 131, 900–910. Du Puy, D.J., Phillipson, P.B., Rabevohitra, R., 1995. The genus Delonix (Leguminosae: Caesalpinioideae: Caesalpinieae) in Madagascar. Kew. Bull. 50, 445–475. Ellison, N.W., Liston, A., Steiner, J.J., Williams, W.M., Taylor, N.L., 2006. Molecular phylogenetics of the clover genus (Trifolium–Leguminosae). Mol. Phylogenet. Evol. 39, 688–705. Engels, W., 2005. Amplify 3. . Hall, T.A., 1999. Bioedit: a user-friendly biological sequence alignment editor and analysis program for Windows 95/98/NT. Nucl. Acids Symp. Ser. 41, 95–98. Haston, E.M., Lewis, G.P., Hawkins, J.A., 2003. A phylogenetic investigation of the Peltophorum group (Caesalpinieae: Leguminosae). In: Klitgaard, B., Bruneau, A. (Eds.), Advances in Legume Systematics, Part 10. Royal Botanic Gardens, Kew, pp. 149–159. Haston, E.M., Lewis, G.P., Hawkins, J.A., 2005. A phylogenetic reappraisal of the Peltophorum group (Caesalpinieae: Leguminosae) based on the chloroplast trnL–F, rbcL and rps16 sequence data. Am. J. Bot. 92, 1359–1371. Heim, U., Weber, H., Baumlein, H., Wobus, U., 1993. A sucrose-synthase gene of Vicia faba L.: expression pattern in developing seeds in relation to starch synthesis and metabolic regulation. Planta 191, 394–401. Herdenberger, F., Pillay, D.T., Steinmetz, A., 1990. Sequence of the trnH gene and the inverted repeat structure deletion site of the broad bean chloroplast genome. Nucl. Acids Res. 18, 1297. Herendeen, P.S., Lewis, G.P., Bruneau, A., 2003a. Phylogenetic relationships in caesalpinioid legumes: a preliminary analysis based on morphological and molecular data. In: Klitgaard, B., Bruneau, A. (Eds.), Advances in Legume Systematics, Part 10. Royal Botanic Gardens, Kew, pp. 37–62. Herendeen, P.S., Lewis, G.P., Bruneau, A., 2003b. Floral morphology in caesalpinioid legumes: testing the monophyly of the ‘‘Umtiza Clade’’. Int. J. Plant Sci. 164, 393–407. Hohnjec, N., Becker, J.D., Puhler, A., Perlick, A.M., Kuster, H., 1999. Genomic organization and expression properties of the MtSucS1 gene, which encodes a nodule-enhanced sucrose synthase in the model legume Medicago truncatula. Mol. Gen. Genet. 261, 514–522. Horst, I., Welham, T., Kelly, S., Kaneko, T., Sato, S., Tabata, S., Parniske, M., Wang, T.L., 2007. TILLING mutants of Lotus japonicus reveal that nitrogen assimilation and fixation can occur in the absence of nodule-enhanced sucrose synthase. Plant Physiol. 144, 806–820. Hu, J.M., Lavin, M., Wojciechowski, M.F., Sanderson, M.J., 2000. Phylogenetic systematics of the tribe Millettieae (Leguminosae) based on chloroplast trnK/ matK sequences and its implications for evolutionary patterns in Papilionoideae. Am. J. Bot. 87, 418–430. Huelsenbeck, J.P., Ronquist, F., 2001. MRBAYES: Bayesian inference of phylogenetic trees. Bioinformatics 17, 754–755. James, D., Schmidt, A.-M., 2004. Use of an intron region of a chloroplast tRNA gene (trnL) as a target for PCR identification of specific food crops including sources of potential allergens. Food Res. Int. 37, 395–402. Jobb, G., von Haeseler, A., Strimmer, K., 2004. TREEFINDER: a powerful graphical analysis environment for molecular phylogenetics. BMC Evol. Biol. 4, 18. Jobson, R.W., Luckow, M., 2007. Phylogenetic study of the genus Piptadenia (Mimosoideae: Leguminosae) using plastid trnL-F and trnK/matK sequence data. Syst. Bot. 32, 569–575. Joly, S., Starr, J.R., Lewis, W.H., Bruneau, A., 2006. Polyploid and hybrid evolution in roses east of the Rocky Mountains. Am. J. Bot. 93, 412–425. Kajita, T., Ohashi, H., Tateishi, Y., Bailey, D.C., Doyle, J.J., 2001. rbcL and legume phylogeny, with particular reference to Phaseoleae, Millettieae, and allies. Syst. Bot. 26, 515–536. Käss, E., Wink, M., 1996. Molecular evolution of the leguminosae: phylogeny of the three subfamilies based on rbcL-sequences. Biochem. Syst. Ecol. 24, 365–378. Kass, R.E., Raftery, A.E., 1995. Bayes factors. J. Am. Stat. Assoc. 90, 773–795. Lavin, M., Eshbaugh, E., Hu, J.-M., Mathews, S., Sharrock, R.A., 1998. Monophyletic subgroups of the tribe Millettieae (Leguminosae) as revealed by phytochrome nucleotide sequence data. Am. J. Bot. 85, 412–433. Lavin, M., Herendeen, P.S., Wojciechowski, M.F., 2005. Evolutionary rates analysis of leguminosae implicates a rapid diversification of lineages during the tertiary. Syst. Biol. 54, 575–594. Lewis, G.P., 1998. Caesalpinia: A Revision of the Poincianella–Erythrostemon Group. Royal Botanic Gardens, Kew. Lewis, G.P., 2005. Caesalpinioideae. In: Lewis, G., Schrire, B., Mackinder, B., Lock, M. (Eds.), Legumes of the World. Royal Botanic Gardens, Kew, pp. 127–161. Lewis, G.P., Schrire, B.D., 1995. A reappraisal of the Caesalpinia group (Caesalpinioideae: Caesalpinieae) using phylogenetic analysis. In: Crisp, M.D., Doyle, J.J. (Eds.), Advances in Legume Systematics, Part 7. Royal Botanic Gardens, Kew, pp. 41–52. Lewis, G., Schrire, B., Mackinder, B., Lock, M. (Eds.), 2005. Legumes of the World. Royal Botanic Gardens, Kew. Luckow, M., White, P.J., Bruneau, A., 2000. Relationships among the basal genera of the Mimosoid Legumes. In: Herendeen, P.S., Bruneau, A. (Eds.), Advances in Legume Systematics, Part 9. Royal Botanic Gardens, Kew, pp. 165–171. Luckow, M., Miller, J.T., Murphy, D.J., Livshultz, T., 2003. A phylogenetic analysis of the Mimosoideae (Leguminosae) based on chloroplast DNA sequence data. In:

161

Klitgaard, B., Bruneau, A. (Eds.), Advances in Legume Systematics, Part 10. Royal Botanic Gardens, Kew, pp. 197–211. Lynch, M., Conery, J.S., 2000. The evolutionary fate and consequences of duplicate genes. Science 290, 1151–1155. Manzanilla, V., 2009. Une phylogénie du grade des Caesalpinieae inférée à partir de marqueurs nucléaires et chloroplastiques. Master’s Thesis. Université de Montréal, Montréal, pp. 1–65. Marazzi, B., Endress, P.K., Queiroz, L.P.d., Conti, E., 2006. Phylogenetic relationships within Senna (Leguminosae, Cassiinae) based on three chloroplast DNA regions: patterns in the evolution of floral symmetry and extrafloral nectaries. Am. J. Bot. 93, 288–303. Marshall, D.C., Simon, C., Buckley, T.R., 2006. Accurate branch length estimation in partitioned Bayesian analyses requires accommodation of among-partition rate variation and attention to branch length priors. Syst. Biol. 55, 993–1003. Moore, R.C., Purugganan, M.D., 2005. The evolutionary dynamics of plant duplicate genes. Curr. Opin. Plant Biol. 8, 122–128. Müller, K., 2005. SeqState: primer design and sequence statistics for phylogenetic DNA datasets. Appl. Bioinform. 4, 65–69. Nylander, J.A.A., Ronquist, F., Huelsenbeck, J.P., Nieves-Aldrey, J.L., 2004. Bayesian phylogenetic analysis of combined data. Syst. Biol. 53, 47–67. Pettigrew, C.J., Watson, L., 1977. On the classification of Caesalpinioideae. Taxon 26, 57–64. Polhill, R.M., 1994. Classification of the Leguminosae. In: Bisby, F.A., Harborne, J.B. (Ed.), Phytochemical Dictionary of the Leguminosae. Chapman and Hall, New York, pp. 25–57. Polhill, R.M., Raven, P.H., Stirton, C.H., 1981. Evolution and systematics of the Leguminosae. In: Polhill, R.M., Raven, P.H. (Eds.), Advances in Legumes Systematics, Part 1. Royal Botanic Gardens, Kew, pp. 1–26. Polhill, R.M., Vidal, J.E., 1981. Caesalpinieae. In: Polhill, R.M., Raven, P.H. (Eds.), Advances in Legumes Systematics, Part 1. Royal Botanic Gardens, Kew, pp. 81– 96. Posada, D., 2008. JModelTest: phylogenetic model averaging. Mol. Biol. Evol. 25, 1253–1256. Rambaut, A., Drummond, A.J., 2007. Tracer v1.4. . Ree, R.H., Citerne, H.L., Lavin, M., Cronk, Q.C.B., 2004. Heterogeneous selection on legcyc paralogs in relation to flower morphology and the phylogeny of Lupinus (Leguminosae). Mol. Phylogenet. Evol. 21, 321–331. Ronquist, F., Huelsenbeck, J.P., 2003. MrBayes 3: Bayesian phylogenetic inference under mixed models. Bioinformatics 19, 1572–1574. Scherson, R.A., Choi, H.K., Cook, D.R., Sanderson, M.J., 2005. Phylogenetics of New World Astragalus: screening of novel nuclear loci for the reconstruction of phylogenies at low taxonomic levels. Brittonia 57, 354–366. Silvente, S., Camas, A., Lara, M., 2003. Heterogeneityof sucrose synthase genes in bean (Phaseolus vulgaris L.): evidence for a nodule-enhanced sucrose synthase gene. J. Exp. Bot. 54, 749–755. Simpson, B.B., Miao, B.-M., 1997. The circumscription of Hoffmannseggia (Fabaceae, Caesalpinioideae, Caesalpinieae) and its allies using morphological and cpDNA restriction site data. Plant Syst. Evol. 205, 157–178. Simpson, B.B., Larkin, L.L., Weeks, A., 2003. Progress towards resolving relationships of the Caesalpinia group (Caesalpinieae: Caesalpinioideae: Leguminosae). In: Klitgaard, B., Bruneau, A. (Eds.), Advances in Legume Systematics, Part 10. Royal Botanic Gardens, Kew, pp. 123–148. Simpson, B.B., Lewis, G.P., 2003. New combinations in Pomaria (Caesalpinioideae: Leguminosae). Kew. Bull. 58, 175–184. Simpson, B.B., Tate, J.A., Weeks, A., 2004. Phylogeny and character evolution of Hoffmannseggia (Caesalpinieae: Caesalpinioideae: Leguminosae). Syst. Bot. 29, 933–946. Simpson, B.B., Ulibarri, E.A., 2006. A synopsis of the genus Hoffmannseggia (Leguminosae). Lundellia 9, 7–33. Singer, S.R., Maki, S.L., Farmer, A.D., Ilut, D., May, G.D., Cannon, S.B., Doyle, J.J., 2009. Venturing beyond beans and peas: what can we learn from Chamaecrista? Plant Physiol. 151, 1041–1047. Sprent, J.I., 2001. Nodulation in Legumes. Royal Botanic Gardens, Kew, London. Sprent, J.I., 2009. Legume Nodulation: A Global Perspective. Wiley-Blackwell, West Sussex, UK, pp. 3–7. Steele, K.P., Wojciechowski, M.F., 2003. Phylogenetic analyses of tribes Trifolieae and Vicieae, based on sequences of the plastid gene matK (Papilionoideae: Leguminosae). In: Klitgaard, B., Bruneau, A. (Eds.), Advances in Legume Systematics, Part 10. Royal Botanic Gardens, Kew, pp. 355–370. Steele, P.R., Guisinger-Bellian, M., Linder, C.R., Jansen, R.K., 2008. Phylogenetic utility of 141 low-copy nuclear regions in taxa at different taxonomic levels in two distantly related families of rosids. Mol. Phylogenet. Evol. 48, 1013–1026. Takemiya, A., Kinoshita, T., Asanuma, M., Shimazaki, K., 2006. Protein phosphatase 1 positively regulates stomatal opening in response to blue light in Vicia faba. Proc. Natl. Acad. Sci. USA 103, 13549–13554. Thompson, J.D., Gibson, T.J., Plewniak, F., Jeanmougin, F., Higgins, D.G., 1997. The CLUSTAL_X windows interface: flexible strategies for multiple sequence alignment aided by quality analysis tools. Nucl. Acids Res. 25, 4876–4882. Tun, Y.T., Yamaguchi, Y., 2007. Phylogenetic relationship of wild and cultivated Vigna (Subgenus Ceratotropis, Fabaceae) from Myanmar based on sequence variations in non-coding regions of trnT-F. Breed Sci. 57, 271–280. Vissi, E., Toth, E.C., Kovacs, I., Magyar, Z., Horvath, G.V., Bagossi, P., Gergely, P., Dudits, D., Dombradi, V., 1998. Protein phosphatase 1 catalytic subunit isoforms from alfalfa: biochemical characterization and cDNA cloning. Arch. Biochem. Biophys. 360, 206–214.

162

V. Manzanilla, A. Bruneau / Molecular Phylogenetics and Evolution 65 (2012) 149–162

Wilgenbusch, J.C., Warren, D.L., Swofford, D.L., 2004. AWTY: A System for Graphical Exploration of MCMC Convergence in Bayesian Phylogenetic Inference. . Wojciechowski, M.F., Lavin, M., Sanderson, M.J., 2004. A phylogeny of legumes (Leguminosae) based on analysis of the plastid matK gene resolves many wellsupported subclades within the family. Am. J. Bot. 91, 1846–1862. Xia, X., Xie, Z., 2001. DAMBE: software package for data analysis in molecular biology and evolution. J. Hered. 92, 371–373. Xia, X., Xie, Z., Salemi, M., Chen, L., Wang, Y., 2003. An index of substitution saturation and its application. Mol. Phylogenet. Evol. 26, 1–7.

Yang, Z., 2006. Computational Molecular Evolution. Oxford Series in Ecology and Evolution, Oxford, 357 pp. Yang, Z., 2007. PAML 4: phylogenetic analysis by maximum likelihood. Mol. Biol. Evol. 24, 1586–1591. Yu, J.K., La Rota, M., Kantety, R.V., Sorrells, M.E., 2004. EST derived SSR markers for comparative mapping in wheat and rice. Mol. Genet. Genom. 271, 742–751. Zhang, X.Q., Verma, D.P.S., Patil, S., Arredondo-Peter, R., Miao, G.H., Kuismanen, R., Klucas, R.V., Chollet, R., 1997. The electronic plant gene register. Plant Physiol. 115, 1729–1731.