Phylogeography and evolution of infectious hematopoietic necrosis virus in China

Molecular Phylogenetics and Evolution 131 (2019) 19–28

Contents lists available at ScienceDirect

Molecular Phylogenetics and Evolution journal homepage: www.elsevier.com/locate/ympev

Phylogeography and evolution of infectious hematopoietic necrosis virus in China

T

Liming Xua, Jingzhuang Zhaoa, Miao Liua, Gael Kurathb, Rachel B. Breytab,c, Guangming Rena, ⁎ Jiasheng Yina, Hongbai Liua, Tongyan Lua, a

Heilongjiang River Fishery Research Institute Chinese Academy of Fishery Sciences, Harbin 150070, PR China Western Fisheries Research Center, U.S. Geological Survey, 6505 NE 65th Street, Seattle, WA 98115, USA c University of Washington, School of Aquatic and Fishery Sciences, Seattle, WA 98195, USA b

A R T I C LE I N FO

A B S T R A C T

Keywords: Chinese fish virus Virus genotype Infectious hematopoietic necrosis virus IHNV Molecular epidemiology Rhabdovirus

Infectious hematopoietic necrosis virus (IHNV) is a well-known rhabdoviral pathogen of salmonid fish. In this study, a comprehensive analysis of 40 IHNV viruses isolated from thirteen fish farms in nine geographically dispersed Chinese provinces during 2012 to 2017 is presented. Identity of nucleotide and amino acid sequences among all the complete glycoprotein (G) genes from Chinese isolates was 98.0–100% and 96.7–100%, respectively. Coalescent phylogenetic analyses revealed that all the Chinese IHN virus characterized in this study were in a monophyletic clade that had a most recent common ancestor with the J Nagano (JN) subgroup within the J genogroup of IHNV. Within the Chinese IHNV clade isolates obtained over successive years from the same salmon fish farm clustered in strongly supported subclades, suggesting maintenance and diversification of virus over time within individual farms. There was also evidence for regional virus transmission within provinces, and some cases of longer distance transmission between distant provinces, such as Gansu and Yunnan. The data demonstrated that IHNV has evolved into a new subgroup in salmon farm environments in China, and IHNV isolates are undergoing molecular evolution within fish farms. We suggest that Chinese IHNV comprises a separate JC subgroup within the J genogroup of IHNV.

1. Introduction Infectious hematopoietic necrosis virus (IHNV) is a rhabdovirus that causes an acute, systemic disease (IHN) in salmonid fish and also occurs in asymptomatic fish hosts (Bootland and Leong, 2011). IHNV possesses a non-segmented, negative-sense, single-stranded RNA molecule of approximately 11 kb, that contains six genes in the order 3′ -N-P-M-GNV-L-5′, encoding the nucleocapsid protein (N), the phosphoprotein (P), the matrix protein (M), the glycoprotein (G), the non-virion protein (NV), and the polymerase protein (L) (Bootland and Leong, 2011; Kurath, 2012). As one of the most important viral diseases in aquaculture facilities, outbreaks of IHN result in losses approaching 100% depending on the species and size of the fish, the virus strain and environmental conditions (Dixon et al., 2016; LaPatra, 1998; Wolf, 1988). The first reported epidemics of IHNV occurred in juvenile sockeye salmon (Oncorhynchus nerka) in fish hatcheries in Western North America during the 1950s (Guenther et al., 1959; Rucker et al., 1953; Wingfield et al., 1969). IHNV was inadvertantly introduced to Japan in

⁎

infected kokanee salmon (fresh water form of O. nerka) imported to Hokkaido from North America in 1971 (Nishizawa et al., 2006), and the virus subsequently became established in Japanese aquaculture, including rainbow trout (O. mykiss). IHNV was also introduced to Europe, where it was first recorded in rainbow trout in France and Italy in 1987 (Baudin-Laurencin, 1987; Bovo et al., 1987). In Korea, the first outbreaks of IHN were recorded in hatcheries for juvenile rainbow trout and masu salmon (O. masou) in 1991 (Park et al., 1993). In China, the first outbreak of IHN was recorded in 1985, in hatcheries for juvenile rainbow trout in Liaoning Province (Niu and Zhao, 1988). The G, N and NV genes have been used for analyses of IHNV evolution, diversity and phylogenetic relationships worldwide (Ahmadivand et al., 2017; Enzmann et al., 2005; Jia et al., 2014; Kurath et al., 2003; Nichol et al., 1995; Troyer et al., 2000). Molecular epidemiology and phylogenetic studies of IHNV have been performed previously on viruses isolated from fish samples worldwide. This has identified five global genogroups of IHNV, reviewed in Kurath (2012). Genogroups U, M, and L occur in North America (Kurath et al., 2003),

Corresponding author. E-mail addresses: [email protected] (L. Xu), [email protected] (M. Liu), [email protected] (G. Kurath), [email protected] (R.B. Breyta), [email protected] (G. Ren), [email protected] (J. Yin), [email protected] (T. Lu). https://doi.org/10.1016/j.ympev.2018.10.030 Received 10 April 2018; Received in revised form 7 October 2018 Available online 25 October 2018 1055-7903/ © 2018 Elsevier Inc. All rights reserved.

Molecular Phylogenetics and Evolution 131 (2019) 19–28

L. Xu et al.

filtered suspensions of fish tissue homogenates at final dilutions of 1:100 and 1:1000, and incubated at 15 °C. The supernatants of monolayers that showed a cytopathic effect (CPE) after incubation periods of 2–4 days were frozen at −80 °C. Viruses were identified as IHNV by PCR using primers, designed on the basis of the entire IHNV sequence deposited at GenBank database under accession no. JX649101, as forward primer 5′ CATAGAAATAAAACAAGAGAGACTC 3′ (5037–5061 nt) and reverse primer 5′ CCTCGTATTGTGTTTCGGAAATCT 3′ (5838–5861 nt). Viruses identified as being IHNV are classified taxonomically in the fish virus species Salmonid novirhabdovirus (2016 release Virus Taxonomy, International Committee on Taxonomy of Viruses). All cytopathic agents were also tested by PCR to detect two other fish viruses, viral hemorrhagic septicemia virus (VHSV, forward primer 5′ ACCTGTTCGACCAGCTTCTT 3′ and reverse primer 5′ CACA GTCACCTCGCATGATT 3′) and infectious pancreatic necrosis virus (IPNV, forward primer 5′ CAAGGCAACCGCAACYTACT 3′ and reverse primer 5′ ATKGCAGCTGTGCACCTCAT 3′) as in a previous study (Kolodziejek et al., 2008).

and the U genogroup has also been observed in Japan prior to 1982 (Nishizawa et al., 2006), and in Russia since 2000 (Rudakova et al., 2007). The E genogroup is significantly prevalent as two subgroups, E1 and E2, in European regions (Abbadi et al., 2016; Bellec et al., 2017; Cieslak et al., 2017; Enzmann et al., 2010; Enzmann et al., 2005). The J genogroup was first reported from salmonid fish farming regions in Japan, where it evolved from a U genogroup ancestor and diverged further to into two subgroups, J Nagano (JN) and J Shizuoka (JS) (Nishizawa et al., 2006). In Korea both JN and JS subgroup IHNV isolates have been detected (Kim et al., 2007; Park et al., 1993). Characterization of IHNV from China so far includes analyses of complete genome sequences for the Ch20101008 (Jia et al., 2014) and HLJ09 (Wang et al., 2016) isolates from Northeast China, and partial glycoprotein (G) gene sequences for one IHNV isolate from Southwest China (Yu et al., 2014) and a set of 50 IHNV isolates from 7 Chinese provinces (Jia et al., 2018). In these reports phylogenetic analyses of partial or complete G gene sequences indicate that Chinese IHNV isolates form a strongly supported monophyletic clade within the J genogroup, most closely related to the JN subgroup (Jia et al., 2018, 2014; Yu et al., 2014). IHN virus is currently endemic throughout nearly all salmonid fish farms in China, with a range including northeast, northwest, southwest, and middle regions of China. Within this geographical area the main host is rainbow trout. The aim of the current work is to present a highresolution picture of IHNV genetic diversity, phylogeny, and epidemiology in China, with an emphasis on virus isolated from individual fish farms over successive years. The 40 IHN virus isolates characterized in this study were obtained from thirteen fish farms from nine provinces in China during 2012–2017. We have used sequence analysis of the complete glycoprotein (G) gene open reading frame (ORF) to characterize the evolutionary and epidemiological patterns of IHNV from throughout the salmonid fish producing regions of China.

2.2. Forty IHNV isolates selected for sequence analysis The primary dataset is forty newly described isolates, with names that begin with letters to indicate the province of origin as HLJ (Heilongjiang), LN (Liaoning), SD (Shandong), XJ (Xinjiang), GS (Gansu), YN (Yunnan), BJ (Beijing), QH (Qinghai), or SC (Sichuan), respectively. This is followed by numbers that indicate the year of isolation, with additional characters as needed to distinguish multiple isolates from the same province in the same year. This dataset of new Chinese IHN virus isolates characterized here are listed in Table 2. An exception to this naming convention was the isolate designated Sn1203, which was previously described after isolation from fish in Shandong province in 2012 (Xu et al., 2014). Three of these G gene sequences from viruses isolated in 2012 and 2013 (Sn1203, LN-12, YN-13) were submitted to GenBank in 2013 and have been included in a previous phylogenetic analysis of Chinese IHNV by Jia et al. (2014).

2. Methods 2.1. Sample collection and virus isolation

2.3. Amplification of the IHNV glycoprotein gene

The occurrence and distribution of IHNV infections in China was monitored during the years 2012 to 2017 by examining diseased fish, mainly juvenile rainbow trout, from fish farms in nine Chinese provinces (Table 1). Fish were collected by the authors or by farm staff and transported on ice to the Fish Disease Laboratory at the Heilongjiang River Fishery Research Institute of Chinese Fishery Research Sciences, in Heilongjiang province. Pooled samples of whole juvenile fish less than 2 g (approximately 4 cm long), or pooled hematopoietic tissues (kidney, spleen, and liver) from larger fish, were homogenized in buffer and IHNV isolation attempts were carried out using the Epithelioma papulosum cyprini (EPC) cell line (Fijan et al., 1983). Monolayers grown on 6-well cell culture plates at 25 °C were inoculated with 0.22 µm

Total RNA was extracted from the cell culture supernatant using the SV Total RNA Isolation System (Promega, U.S.A.) following manufacturer’s instructions and then stored at −80 °C. cDNA synthesis and PCR were carried out in a single step by using the OneStep RT-PCR kit (TaKaRa, Japan) according to the manufacturer’s recommendations. Primers for the G gene ORF, Gf (2941–2965) (5′AAAAATGGCACTTTT GTGCTTTGAG 3′) and Gr (4526–4550) (5′ GTGAGGAAGTGAAGATTG AGGTCCT 3′), were designed based on a genome nucleotide sequence of the HLJ-09 strain of IHNV (accession number JX649101). The annealing temperature of 50 °C was used for 25 PCR cycles. Each reaction contained 0.8 μM (final concentration) of each of the primers and 10 μl volume of RNA extract in a final reaction volume of 50 µl. All amplifications were performed in a GeneAmp PCR System 2400 thermal cycler (Perkin-Elmer). After amplification was confirmed by gel electrophoresis and ethidium bromide staining, DNA was extracted directly from remaining volume of the PCR reaction that had not been run on the gel by using PCR purification kit (TIANGEN, China) according to the manufacturer’s instructions. Triplicate PCR products originating from independent RT reactions were sequenced for each isolate, and there was no sequence heterogeneity among the triplicate PCR sequences for each isolate.

Table 1 Passive Surveillance for IHNV in Chinese salmonid fish from 2012 to 2017. Province

# IHNV positive farms/# farms tested

# IHNV positive samples/# samples tested

Year(s) IHNV positive

Heilongjiang Liaoning Shandong Xinjiang Gansu Yunnan Beijing Qinghai Sichuan Jilin Total

1/1 2/2 3/4 1/3 3/3 1/1 3/4 1/1 1/2 0/1 16/22 (72.7%)

35/60 21/26 5/6 4/8 12/20 3/6 5/8 3/4 1/2 0/2 89/142 (62.7%)

2012–2017 2012–2017 2012–2014 2012–2014, 2016 2012, 2014, 2015 2013–2015 2013–2015 2015–2017 2015 / 2012–2017

2.4. Sequence alignment and analysis The 1527 nt open reading frame encoding the IHNV G protein was identified and verified using DNASIS software (Hitachi Software Engineering Co., Ltd.), and flanking sequences including primer regions were trimmed. Alignments were checked by hand to confirm that no 20

Molecular Phylogenetics and Evolution 131 (2019) 19–28

L. Xu et al.

Table 2 Chinese IHN virus isolates characterized in this study. Isolate name

Chinese Province

Farm Sitea

Isolation Year

Fish Host

HLJ12 HLJ13 HLJ14 HLJ15 HLJ1601 HLJ1602 HLJ1701 HLJ1702 HLJ1703 LN12 LN13 LN14 LN15 LN16 LN14dd LN15dd Sn1203 SD13a SD14a XJ12a XJ13a XJ14a XJ16a GS13 GS1201 GS1202 GS1402 GS15 YN13 YN14 YN15 BJ1401 BJ1402 BJ13 BJ14 BJ15 QH15 QH16 QH17 SC15

Heilongjiang Heilongjiang Heilongjiang Heilongjiang Heilongjiang Heilongjiang Heilongjiang Heilongjiang Heilongjiang Liaoning Liaoning Liaoning Liaoning Liaoning Liaoning Liaoning Shandong Shandong Shandong Xinjiang Xinjiang Xinjiang Xinjiang Gansu Gansu Gansu Gansu Gansu Yunnan Yunnan Yunnan Beijing Beijing Beijing Beijing Beijing Qinghai Qinghai Qinghai Sichuan

A A A A A A A A A B B B B B C C D D D E E E E F H H H H I I I J K M M M L L L N

2012 2013 2014 2015 2016 2016 2017 2017 2017 2012 2013 2014 2015 2016 2014 2015 2012 2013 2014 2012 2013 2014 2016 2013 2012 2012 2014 2015 2013 2014 2015 2014 2014 2013 2014 2015 2015 2016 2017 2015

Masu Rb Tr At Sal Rb Tr Masu Brook Tr Rb Tr-g Rb Tr Masu Chinook RbTr-t Rb Tr RbTr-t RbTr-t Rb Tr Rb Tr Rb Tr Rb Tr Rb Tr Rb Tr Rb Tr Rb Tr Rb Tr Rb Tr Rb Tr Rb Tr Brook Tr Rb Tr Rb Tr Rb Tr Rb Tr Rb Tr Brook Tr Rb Tr Rb Tr Rb Tr RbTr-t RbTr-tc RbTr-tc Rb Tr

b

Host Size ave., (g)

Mortality %

3 4 5 10 0.8 0.5 2 3 2 1000 100 6 750 50 6 50 4 3 3 3 5 2 2 5 1000 3 1 10 2 3 2 4 3 4 5 10 50 50 8 3

90 90 85 60 95 92 75 82 80 30 80 90 90 55 80 75 95 92 90 90 85 92 89 90 93 87 93 62 95 90 92 80 50 90 86 50 68 65 70 78

a

Farm sites are indicated as random letters. Host abbreviations, common names, and Latin names are as follows: Masu, masu salmon, Oncorhynchus masou masou; Rb Tr, rainbow trout, O. mykiss; At Sal, Atlantic salmon, Salmo salar; Brook Tr, brook trout, Salvelinus fontinalis; Rb Tr-g, golden rainbow trout, O. mykiss; Chinook, Chinook salmon, O. tshawytscha; Rb Tr-t, triploid rainbow trout, O. mykiss. c Co-infection with infectious pancreatic necrosis virus, IPNV. b

and two more basal older isolates; 5 E genogroup isolates from Europe; 5 M genogroup isolates from North America; 5 L genogroup isolates from North America; and 10 U genogroup isolates including 6 from North America and 4 from Asia (Supplementary Table S1). The 81 sequences were aligned using the Clustal X software and alignments were manually inspected to confirm absence of artefactual gaps. Aligned sequences were analyzed using the BEAST software suite, v1.8.4 (Drummond et al., 2012) run through the CIPRES science gateway (Miller et al., 2010), as previously described (Breyta et al., 2013). Briefly, a constant population size coalescent prior was used and dated taxa were used with a relaxed uncorrelated lognormal molecular clock prior and CTMC rate reference with an initial value of 1 e−4. The strict clock could be rejected because the 95%HPD interval of clock rate variance statistics did not span zero, as in (Breyta et al., 2013). The Hasegawa et al. (1985) substitution model, with gamma + invariant sites was indicated by Modeltest (implemented in Datamonkey.org) and produced a better posterior and AICM value when compared with more heavily parameterized models (assessed in Tracer v1.6). Three independent analyses of 10 million generations were performed, combined, and after burn-in removed, an annotated maximum clade credibility tree was drawn using FigTree v1.4.2. The discrete state of province of origin for the subset of 42 Chinese

artefactual gaps were introduced. Lasergene software (DNAStar, Inc., USA) was used to translate and conduct multiple alignments of the sequences, as well as to determine the percentage identities and similarity scores. To analyze the percentage identities and similarity scores, both nucleotide and amino acid sequences were aligned using the default options in Clustal W. Analyses of single nucleotide polymorphisms (SNPs) were done by manual visual inspection of the Clustal W alignment. All 40 sequences were submitted to GenBank as accession numbers MH170309-MH170346, KF871192, KC660147.

2.5. Phylogenetic analysis Phylogenetic studies were performed with the nucleotide sequence of the full G gene open reading frame (ORF), which is 1527 nt in length, starting with translation initiation codon ATG and including the termination codon. Coalescent phylogenetic analysis was done with the G ORF sequences from 40 Chinese IHNV isolates presented here, and from previously reported Chinese isolates HLJ-09 (Wang et al., 2016), and Ch20101008 (Jia et al., 2014). The analysis also included 39 reference sequences from isolates selected to represent the five global IHNV genogroups, with an emphasis on isolates from Asia: 14 J genogroup isolates from Japan and Korea including 6 JN subgroup, 6 JS subgroup, 21

Molecular Phylogenetics and Evolution 131 (2019) 19–28

L. Xu et al.

obtained, and at the other 9 sites multiple virus isolates, ranging from 2 to 9 per site, were collected over successive years (Fig. 1, Table 2). The distribution of isolates across the 5 years of surveillance was reasonably balanced with 6–10 isolates per year for 2012 through 2015, and then 5 from 2016 and 4 from 2017. The majority of the virus isolates (32/40, 80%) came from rainbow trout (O. mykiss, RbTr, triploid RbTr or golden RbTr in Table 2), and there were 1–3 isolates from each of four other host species: 3 from Masu salmon (O. masou), 1 from Atlantic salmon (Salmo salar), 3 from brook trout (Salvelinus fontinalis), and 1 from Chinook salmon (O. tshawytscha). The majority of isolates (32/40, 80%) were from small fish in early juvenile life stages, ranging 0.5–10 g in size. However, there were also 5 isolates from larger juvenile fish at 50–100 g, and 3 isolates from very large fish 750–1000 g in size. One of the large fish samples came from 1000 g Chinook salmon that experienced 30% mortality, but all other samples were from populations that experienced 50–95% mortality (Table 2).

IHNV was used to perform ancestral state reconstruction to infer the most probable province location of internal and root nodes. The discrete state partition was tested with both symmetric and asymmetric state change models and a strict clock, using the CTMC clock rate prior and a gamma distributed prior for the state transition rates. The symmetric model performed better than the asymmetric model, as assessed via posterior and AICM in Tracer v1.6. 3. Results 3.1. Prevalence of IHNV in Chinese fish farms during 2012–2017 During six years of passive surveillance, meaning all samples were submitted for testing due to observations consistent with IHN disease, virology was conducted on 142 fish samples from a total of 22 fish farms in 10 provinces of China (Table 1). The prevalence of IHNV was high, with 72.7% of all farms, and 62.7% of all samples testing positive for virus. Virus was detected in 9 out of the 10 provinces, and in four provinces more than one farm was found positive, indicating overall high prevalence. In the same samples there was no detection of the fish rhabdovirus VHSV, and only one detection of the fish birnavirus IPNV, which occurred as a co-infection with IHNV.

3.3. Glycoprotein (G) gene ORF sequences The G gene ORF sequences of the 40 Chinese IHNV isolates analyzed here were all 1527 nt long and began with the ATG translation initiation codon. Thirty-eight of them ended with a TAA termination codon, and one, Sn1203, ended with TGA. All encoded one long contiguous ORF. These 40 G ORF sequences were combined with two G ORF sequences from earlier Chinese IHNV isolates described previously as HLJ-09 (Wang et al., 2017) and Ch20101008 (Jia et al., 2014) to create a comprehensive data set of sequences from 42 Chinese IHNV isolates collected between 2009 and 2017. IHNV strain HLJ-09 was collected from rainbow trout at farm site A in Heilongjiang province in 2009, and Ch20101008 was from cultured brook trout in Jilin province in 2010. Among the 42 sequences there were 34 different full G ORF sequences, comprising different haplotypes. Six of these haplotypes were found in more than one virus isolate. Identical G ORF sequence haplotypes were found in four isolates collected from farm site H in Gansu province between 2012 and 2015 (GS-1201, GS-1202, GS-1402, and

3.2. Features of 40 IHNV isolates characterized by sequencing The 40 IHNV isolates characterized further by sequence analysis all originated from fish experiencing clinical disease with mortality in Chinese salmonid fish farms between 2012 and 2017. As detailed in Fig. 1 and Table 2, they came from 9 different provinces including Heilongjiang (HJ), Liaoning (LN), Shandong (SD), Xinjiang (XJ), Gansu (GS), Yunnan (YN), Beijing (BJ), Qinghai (QH), and Sichuan (SC). They represented a total of 13 salmonid fish farm sites (designated A through N), distributed as one farm site in each of 6 provinces (HLJ, SD, XJ, YN, QH, and SC), and 2–3 farm sites in each of the other three provinces (LN, GS, BJ). At 4 of the 13 farm sites a single IHNV isolate was

Fig. 1. Map of collection sites for Chinese IHNV. Red labels show thirteen fish farms (A-N) and the number of IHNV isolates from each farm analyzed here. 22

Molecular Phylogenetics and Evolution 131 (2019) 19–28

L. Xu et al.

Table 3 Genetic Diversity of Chinese IHNV within farms and provinces, and with global IHNV and other rhabdovirus species. Level of diversity analyzed

a) Within Chinese IHNV Diversity among all Chinese IHNV (with refs HLJ-09, Ch20101008) Diversity within farm sites

Diversity within provinces

Fig. 2. Distribution of single nucleotide polymorphisms along G gene open reading frame (ORF) of 42 Chinese IHNV isolates. Frequency of each single nucleotide polymorphism (SNP) is shown as the number of Chinese IHNV isolates, out of 42 total, that differ from the consensus sequence at each site along the 1527 nt G gene ORF. SNPs indicated in red are associated with the clade containing the YN, GS, and SD isolates in the phylogenetic analysis (see text).

b) Compared with global IHNVb Chinese IHNV × 14 genogroup J Chinese IHNV × 10 genogroup U Chinese IHNV × 5 genogroup M Chinese IHNV × 5 genogroup E Chinese IHNV × 5 genogroup L

GS-15). There were also five pairs of isolates with identical G ORF haplotypes; HLJ-1701 and HLJ-1703 from rainbow trout and masu salmon, respectively, at Heilongjiang farm site A in 2017; LN-14dd and LN-15dd from farm site C in Liaoning province in 2014 and 2015; BJ1401 and BJ-1402 from farms J and K in Beijing province in 2014; QH15 and QH-16 from Qinghai province farm L in 2016 and 2017; and HLJ-09 and Ch20101008, which were from different fish species in farms in Heilongjiang and Jilin provinces in 2009 and 2010, respectively. Thus 4 of these 6 identical haplotypes were detected in fish from the same farm in either the same year or successive years, 1 was from nearby farms in Beijing in the same year, and 1 was from farms in adjacent provinces Heilongjiang and Jilin in two successive years. The 42 Chinese IHNV G ORF sequences aligned efficiently without insertions or deletions. A total of 427 single nucleotide polymorphisms (SNPs) were detected relative to the consensus sequence, with variation observed at 109 of the 1527 nt positions (7.3%). SNP variation was distributed broadly throughout the sequence length as shown in Fig. 2. Residue substitution analysis for G sequences of the Chinese IHNV combined with J genogroup isolates from Japan and Korea revealed highest frequencies for A-to-G and C-to-T nucleotide substitutions. Genetic diversity assessed as pairwise nt identities for the entire Chinese IHNV data set of 42 sequences ranged from 98.0 to 100.00% (Table 3a). Amino acid sequences translated from these nt sequences had 96.7–100.00% identity. Within-farm virus genetic diversity was assessed as pairwise nucleotide sequence identity levels for viruses within each of the 9 fish farms that had more than one virus isolate. As shown in Table 3a, isolates from the same farm ranged from 98.2 to 100% in nt identity, and 97.2–100% in amino acid identity. Similarly, within-province diversity was calculated for the 3 provinces that had more than one farm site (LN, BJ, GS), ranging from 98.9 to 100% nt identity, and 98.6–100% amino acid identity (Table 3a). Comparison of Chinese IHNV G sequences with G sequences from IHNV outside of China revealed the highest identity levels with the Asian J genogroup (93.6–97.6% nt identity), followed by the U genogroup, and lower levels ranging from 92.6 to 94.7% for the M, E, and L genogroups (Table 3b). In comparison with sequences of viruses in other rhabdovirus species, Chinese IHNV G sequences were closest to those of hirame virus and then viral hemorrhagic septicemia virus, which are both within the same Novirhabdovirus genus as IHNV (Table 3c). Lower nt identity of 36.7–37.1% nt was found with spring viremia of carp virus, which is in a different fish rhabdovirus genus, and

Province a, farm site(s), n# isolates

Range of Pairwise % nt identity

Range of Pairwise % aa identity

all 9 and Jilin, sites A-O, n42

98.0–100

96.7–100

HLJ site A, n9 LN site B, n5 LN site C, n2 SD site D, n3 XJ site E, n4 GS site H, n4 YN site I, n3 BJ site M, n3 QH site L, n3 LN (B, C), n7 GS (F, H), n5 BJ (J, K, M), n5

98.2–100 99.7–99.9 100 99.3–99.9 99.5–99.9 100 99.8–99.9 98.9–99.5 98.6–100 99.7–100 99.8–100 98.9–100

97.2–100 99.2–100 100 99.2–99.8 99.2–100 100 99.4–99.8 98.6–99.4 98.0–100 99.2–100 99.6–100 98.6–100

na

93.6–97.6

93.0–97.6

na

92.8–95.9

91.0–94.6

na

93.2–94.7

92.3–94.3

na

92.6–94.7

91.7–93.5

na

93.2–94.4

93.1–91.1

52.7–53.0 69.9–70.7 36.7–37.1 39.2–40.0 38.1–38.3

40.4–41.0 73.0–73.9 19.2–20.0 16.3–16.9 16.3–17.1

c) Compared with other rhabdovirusesc Chinese IHNV × VHSV na Chinese IHNV × HIRRV na Chinese IHNV × SVCV na Chinese IHNV × VSV na Chinese IHNV × Rabies virus na

a Province abbreviations and farm sites A-N are as shown in Table 1, reference strain HLJ-09 was from farm site A in Heilongjiang province, reference strain Ch20101008 was from a farm (designated here site O) in Jilin province. b Global IHNV sequences are those used in phylogenetic analysis as defined in methods. c VHSV, viral hemorrhagic septicemia virus, GenBank LN876860; HIRRV, hirame rhabdovirus, AB103462; SVCV, spring viremia of carp virus, KX911973; VSV, vesicular stomatitis virus JF795517; Rabies virus, M38452. na indicates not applicable.

similarly low nt identities of 38.1–40.0% were found for the mammalian rhabdoviruses vesicular stomatitis virus and rabies virus.

3.4. Coalescent phylogenetic analysis reveals a monophyletic Chinese IHNV clade with spatial patterns of within-farm, within-province, and longdistance virus transmission A coalescent phylogenetic tree estimating evolutionary relationships among the 42 Chinese IHNV isolates and 39 global reference IHNV isolates showed resolution of the previously established U, M, L, E, and J genogroups as well separated clades with strong node support (Fig. 3 and Supplementary Fig. S1). All 42 Chinese IHNV clustered as a monophyletic clade with a strongly supported posterior probability (pp) of 1.0 (Fig. 3, node labeled v). The Chinese IHNV clade is most closely related to the JN subgroup (pp 1.0), within the J genogroup that also contains IHNV from Japan and Korea. Within the Chinese IHNV clade the 9 farms that had multiple isolates in the data set showed clustering of those isolates on terminal branch nodes, and 8 of these 9 within-farm clusters were strongly supported with pp values of 0.82–1.0 (Figs. 3 and 4). These within-farm 23

Molecular Phylogenetics and Evolution 131 (2019) 19–28

L. Xu et al.

Fig. 3. Coalescent phylogenetic analysis of 42 Chinese IHNV isolates and 39 global IHNV reference isolates, based on sequences of the complete 1527 nt G gene ORF. Posterior probability support values are shown to right of nodes. Reference genogroups shown as triangles contain multiple IHNV isolates: E, 5 from Europe; M, 4 from North America; L, 5 from North America; U, 5 from North America and 5 from Japan.

including only the Chinese isolates (described below). For the lower portion of the Chinese IHNV clade in Fig. 3 the internal nodes basal to the terminal clusters for HLJ, QH, and XJ isolates had poor support and thus did not provide inference regarding their order of descent from the original ancestral node of the entire Chinese IHNV clade. The mean evolutionary rate estimated from Chinese and reference taxa was 4.11e−4 substitutions/site/year, while that estimated from Chinese taxa only was 6.12e−4 substitutions/site/year. Since the uncorrelated relaxed clock was an appropriate clock model to use for this data (the 95% HPD of neither the standard deviation nor the covariance of the uncorrelated relaxed clock spanned zero), different branches within the monophyletic Chinese clade varied from 1.89e−4 to 8.52e−4 substitutions/site/year. Both the highest and lowest estimates of evolutionary rate were found on either external branches or the immediate ancestor of external branches. Internal nodes were estimated to be closer to the average rate.

clusters accounted for 30 of the 33 isolates from farms that had more than one isolate. There were 3 exceptions to the clustering of isolates within farms (asterisks in Figs. 3 and 4). These included 2 of the 9 isolates from farm A: isolate HLJ-09 was basal to the farm A subclade and had no strongly supported ancestral nodes all the way back to the ancestral node for the whole Chinese clade; and the most recent farm A isolate, HLJ-1702, was linked closely with isolates from Liaoning farms B and C (pp 0.98). The third exception was isolate QH-17 from Qinhai farm L, which grouped strongly with isolates from farms J, K, M and N, in Beijing and Sichuan (pp 1.0) rather than with the other 2 isolates from farm L that were linked in a terminal cluster (pp 1.0). In addition to this general pattern of within-farm terminal clustering there were some well supported ancestral nodes that linked farms within provinces (Figs. 3 and 4). This was evident for farms B and C within Liaoning (pp 1.0) and farms J, K, and M in Beijing (pp 1.0). Isolates from Gansu farms F and H also fell as most closely related neighbors but without strong node support (pp 0.6). In the internal structure of the Chinese IHNV clade there were also several strongly supported ancestral nodes with pp values between 0.87 and 1.0 that provided inference into the deeper evolutionary pathway of IHNV in China. These included four strong internal nodes toward the top of the tree in Fig. 3 that can be followed along the tree backbone in a basal direction, starting with a node that links isolates from Gansu and Yunnan (node z in Fig. 3, pp1.0). Continuing leftward along the tree backbone, isolates from Gansu and Yunnan were next linked with those from Shandong (node y in Fig. 3, pp 0.92), and this larger group was then linked with Liaoning isolates (node x in Fig. 3, pp 0.98). Manual inspection of the aligned sequences revealed that these groupings were the result of multiple shared SNPs dispersed along the G sequence (Fig. 2, red symbols). There was also a deeper node linking all of these isolates with those from Beijing and Sichuan (node w in Fig. 3, pp 0.87), but this node was not supported in an alternative analysis

3.5. Ancestral reconstruction of the province of origin for Chinese IHNV Based on the strong spatial patterns observed in the coalescent phylogenetic analysis (Figs. 3 and 4) a reconstruction analysis was conducted to infer the most likely geographic location for ancestral viruses represented by internal nodes of the Chinese IHNV clade. We focused only on Chinese IHNV and used geographic province in China as the trait of interest, so we first generated a new coalescent phylogenetic analysis using only sequences from the 42 Chinese isolates. Topography of the new tree was very similar to that of the Chinese clade within the larger tree with reference sequences, showing the exact same within-farm terminal clustering, and similar pp support for most internal nodes. An exception was that the subclade containing isolates from Beijing, Sichuan, and QH17 (pp 0.99 in Fig. 3) was no longer basal to the Liaoning, Shandong, Yunnan, and Gansu subclades (i.e. node w 24

Molecular Phylogenetics and Evolution 131 (2019) 19–28

L. Xu et al.

Fig. 4. Terminal clustering of Chinese IHNV within farms and provinces. Clades with pp support > 0.7 are shown in boxes (farms, # isolates and pp value) or brackets (provinces, pp value). Isolates not in terminal clusters with pp > 0.7 are labeled with province, farm (in parentheses) and # isolates per farm for farms with more than one isolate. Three isolates that are exceptions to farm clustering have an asterisk.

Fig. 5. Spatial ancestral state reconstruction inferring location (province in China) of viruses at ancestral nodes in a coalescent phylogenetic tree of 42 Chinese IHNV. Posterior probability support values are shown to right of ancestral nodes described in text.

25

Molecular Phylogenetics and Evolution 131 (2019) 19–28

L. Xu et al.

and 8–11 years prior to 2017, respectively, thus occurring in approximately 1998, 2001, and 2008. For farms that clustered within provinces, the estimated date for the common ancestor of Gansu farms H and F was approximately 2010, and the common ancestor for Liaoning farms B and C was in 2009. The ancestral node for Beijing farms M, J, and K, which also includes isolates QH17 and SC15, was somewhat older, estimated as 2000 and 2005. A similar age was found for the common ancestor of the more recent HLJ farm A isolates with HLJ09 and Ch20101008, estimated as 1999 and 2006. Among the within-farm terminal clusters Heilongjiang farm A, Liaoning farm B, Xinjiang farm E, Beijing farm M, and Shandong farm D had slightly older common ancestors with estimates ranging from 2005 to 2010, while Gansu farm H, Yunnan farm I, Liaoning farm C, and Qinghai farm L had more recent ancestors ranging from 2010 to 2014 (Table 4).

was not present, Fig. 5). Results of the spatial ancestral reconstruction indicated the province of Heilongjiang as the most likely location of the virus at the basal node for the entire Chinese IHNV clade (Fig. 5, node v). In the upper portion of the tree nodes x, y, and z were observed, and indicated sequential movement of the virus from Heilongjiang to Shandong, then Gansu, and then Yunnan, although the Shandong step in this path was less well supported than the other steps. Direct independent movements of virus from Heilongjiang to Liaoning, Xinjiang and Beijing were also indicated in the tree, with strong support for subsequent movement from Beijing to Sichuan. The tree also shows movement of virus from Heilongjiang to Jilin and Qinghai, but with relatively poor resolution of the order of movement into those two provinces due to low node support. Finally, the analysis also showed strong support for the movement of virus from Beijing to Qinghai as the source of the QH17 isolate that was an exception to the terminal clustering of virus at Qinghai farm L. Strength of the support for geographic location of each node is shown in Fig. S2.

3.7. Lack of correlations with host species or fish size Although the majority of the Chinese IHNV isolates came from fish at early juvenile life stages there were also 5 isolates from larger juveniles that weighed 50–100 g, and 3 from very large fish weighing 750–1000 g. These isolates from larger fish originated from 4 farms within 3 provinces, and thus were dispersed in the tree within the terminal within-farm subclades for Gansu farm H, Liaoning farms B and C, and Qinghai farm L (Fig. 5). The Liaoning farms had an unusually high proportion of isolates from larger fish as well as some from small fish, and the Qinghai farm had two isolates that were both from larger juvenile fish. Beyond these within-farm observations there was no indication that isolates from larger fish were clustered in the tree. With regard to host species there were 9 Chinese IHNV isolates from fish hosts other than rainbow trout (O. mykiss) that originated from 5 different provinces and were dispersed in the tree (Fig. 5). Five of these were from Heilongjiang farm A and fell within the farm A terminal cluster, including 3 from masu salmon (HLJ12, HLJ1601, and HLJ1703), one from Atlantic salmon (HLJ14), and one from Brook trout (HLJ1602). The other 4 non-rainbow trout isolates included 3 from brook trout that originated in Gansu, Beijing, and Jilin provinces (GS1402, BJ1402, and Ch20101008), and one from Chinook salmon in

3.6. Dates of evolutionary divergence of Chinese IHNV The two coalescent phylogenetic analyses of the Chinese IHNV isolates provided similar estimates for the age of the ancestral node for all Chinese IHNV (node v in Figs. 3 and 5). In the first tree that included global reference sequences the monophyletic node for the 42 Chinese IHNV isolates had an age (time to most recent common ancestor, tmrca) of 28.9 years, with a 95% highest posterior density (HPD) of 20.0–39.3. In the second tree that included only the 42 Chinese IHNV isolates the same node had an estimated tmrca mean of 21.7 years, and a 95% HPD of 12.3–35.4 years. Since these estimates are relative to the most recent isolates in the tree (2017), these estimates correspond to mean dates of 1989 and 1995, respectively, within a range from 1978 to 1997 for the first tree, or 1982–2005 for the second tree. In general pp node support was slightly higher in the larger phylogenetic analysis that included reference sequences, and node ages were all longer relative to estimates from the analysis of only the Chinese IHNV (Table 4). Considering values from both trees, divergence dates for internal nodes x, y, and z were approximately 17–22, 14–18,

Table 4 Estimated dates of divergence at ancestral nodes in two phylogenetic analyses of Chinese IHNV isolates (corresponding to Figs. 3 and 5). Node

Groups: province (farm, # isolates)

Node support, ppa

Mean TMRCAsa

Dates of TMRCAsa

v x

All China, n42 Liaoning (B5, C2) HLJ1702 (A1) Shandong (D3) Yunnan (I3), Gansu (F1, H4) Shandong (D3) Yunnan (I3), Gansu (F1, H4) Yunnan (I3), Gansu (F1, H4) Gansu (F1, H4) Liaoning (B4, C2) LN + HLJ17 Beijing (M3, K1, J1) + QH17 + SC15 HLJ (A9) + Ch20102008 + QH(L2), no HLJ17 Gansu farm (H4) Yunnan (I3) Shandong (D3) Liaoning (B5) Liaoning (C2) Beijing (M3) Xingjiang (E4) Qinghai (L2), no QH17 Heilongjiang (A8), no HLJ09, HLJ17

1.0, 1.0 0.98, 0.48

28.9, 21.7 22.0, 16.5

1989, 1995 1995, 2000

0.92, 0.72

17.5, 14.1

1999, 2003

1.0, 1.0

10.8, 7.5

2006, 2009

0.6, 0.54 1.0, 1.0 0.98, 0.82 1.0, 0.99 0.28, 0.42 0.27, 0.26 1.0, 1.0 1.0, 1.0 0.92, na 0.92, 0.98 0.82, 0.71 1.0, 1.0 1.0, 1.0 1.0, 1.0

8.2, 6.3 9.3, 6.8 16.3, 12.5 16.9, 11.6 18.3, 11.0 6.9, 5.7 5.8, 4.6 10.3, 8.9 7.5, na 4.5, 3.4 11.5, 8.4 10.6, 6.6 3.1, 2.5 11.2, 6.6

2009, 2008, 2001, 2000, 1999, 2010, 2010, 2007, 2009, 2012, 2005, 2006, 2014, 2006,

y

z GS LN LN+ BJ+ HLJ+ farm H farm I farm D farm B farm C farm M farm E farm L farm A

2011 2010 2004 2005 2006 2011 2012 2008 na 2014 2009 2010 2014 2010

Posterior probability node support and age estimates are shown as the two values, with the first from the coalescent phylogenetic analysis of 42 Chinese IHNV with 39 global reference IHNV (Fig. 3), followed by values for analogous nodes from tree of only 42 Chinese IHNV (Fig. 5). 26

Molecular Phylogenetics and Evolution 131 (2019) 19–28

L. Xu et al.

evolution of the virus in China. However, Chinese IHNV is relatively low in genetic diversity, with at most 2.0% nt diversity (98–100% nt identity) in the G gene sequences analyzed here. This is substantially lower than the diversity of G gene sequences from the JN and JS subgroups of the J genogroup in Japan, which had 3.5% and 6.3% nt diversity reported in 2009 (Mochizuki et al., 2009). It may be that evolution of IHNV in China has been relatively slow because the ancestral JN virus imported into China was derived after the adaptation of Japanese IHNV to higher virulence during the 1980s, and the selection regime provided by conditions in Chinese rainbow trout aquaculture may be similar to that in Japanese aquaculture, so the virus did not have to adapt. The rate of evolution estimated for the Chinese IHNV clade was extremely variable among internal and external branches, possibly due to different levels of genetic isolation versus continued importation of viruses into different farms or provinces, or to the paucity of sampled taxa from early years of IHNV evolution within China. The fact that all Chinese IHNV form a monophyletic clade within the J genogroup (Fig. 3) suggests that there may have been a single successful introduction of IHNV into China, and that the majority of IHNV currently circulating in China has evolved within China rather than being continually introduced from outside sources. The Chinese IHNV clade is most closely related to the JN subgroup, which was originally described within the J genogroup in Japan (Mochizuki et al., 2009), so the original source of IHNV in China was most likely importation of rainbow trout eggs or fry from Japan, as previously suggested (Jia et al., 2014; Yu et al., 2014). Although IHNV in the JN subgroup is also found in Korea, this is not a likely source because the first IHN outbreak in Korea was in 1991, which is after IHNV was detected in China in 1985. The spatial, temporal, and host traits of the 40 IHNV isolates analyzed here allowed us to investigate several aspects of the genetic diversity, epidemiology, and evolution of IHNV within China. Our phylogenetic analysis revealed a strong signal of within-farm maintenance and diversification of virus, even over the relatively short year span analyzed here. This was observed as clustering of isolates from the same individual farm with strong phylogenetic support, observed for 8 of 9 individual farms that had more than one virus isolate in this data set. This pattern suggests that much of the virus in the salmonid fish farms sampled in this study comes from within-farm transmission sources, rather than repeated introduction from outside sources. This persistence of virus within farms over time suggests that increased biosecurity efforts are needed to break chains of virus transmission and reduce the frequency and severity of IHN disease. There was also some evidence of within-province virus transmission between farms, observed as strongly supported subclades (pp 1.0) containing isolates from farm sites B and C in Liaoning, or farm sites J, K, and M in Beijing. In contrast to these indications of local virus traffic between farms, the phylogeny also revealed strongly supported internal nodes that grouped isolates from farms H and F in Gansu with farm I in Yunnan (Fig. 4). This relationship was strongly supported despite the large distance between these two provinces (Fig. 1). Following this grouping farther into the tree it was then linked with isolates from Shandong farm D (pp 1.0), again representing great geographic distance. This geographic dispersion of the virus into distant provinces suggests some mechanism of long distance virus transmission has also occurred in China. These larger transmission links are supported by the ancestral state reconstruction, with dating of ancestral nodes, suggesting a path of virus movement from Heilongjiang to Shandong in approximately 1999–2003, then to Gansu in 2006–2009, and then to Yunnan in 2010–2012. This step-wise pattern reflects the chronological order of events in the development of rainbow trout aquaculture, which began in Heilongjiang, and then developed in Shandong, Gansu, and then Yunnan. These indications of long distance virus traffic may reveal transmission routes that can be interrupted once they are recognized. The ancestral state reconstruction also suggests Heilongjiang as the

Liaoning (Ch20102008). Thus the phylogenetic analysis showed no pattern of clustering based on host species or fish size, and the placement of virus isolates from larger fish or different fish hosts followed the general within-farm spatial patterns of their sites of origin. 4. Discussion In China IHNV causes a heavy disease burden on aquaculture of rainbow trout and other salmonid fish, frequently causing disease outbreaks with high levels of mortality. Results of passive surveillance reported here for 22 fish farms in 10 provinces during 2012–2017 confirmed that IHNV occurs widely throughout China, at higher prevalence than previously reported (Jia et al., 2014). Although the first IHN outbreak in China occurred in 1985 (Niu and Zhao, 1988) there are no historic virus isolates available for genetic characterization, and the earliest IHNV isolates available for genetic analysis were obtained in 2009–2013. Therefore at present there are very few published phylogenetic studies of Chinese IHN virus, mostly presenting a relatively small number of Chinese IHNV isolates (Jia et al., 2014; Wang et al., 2016; Yu et al., 2014). However, recently a broad phylogenetic study analyzing partial G gene sequences (the 303 nt midG region) of 50 Chinese IHNV isolates obtained from 7 provinces during the years 2010 to 2014 has been reported (Jia et al., 2018). In the work presented here our systematic phylogenetic analysis of Chinese IHNV strains was based on complete G gene sequences, as in other previous studies (Bellec et al., 2017; Cieslak et al., 2017). Our analysis of 40 Chinese IHNV isolates collected from 13 fish farms in 9 provinces between 2012 and 2017 expands on these previous genetic studies, confirming that Chinese IHNV comprise a monophyletic clade that is most closely related to the JN subgroup, within the J genogroup of IHNV. In the current understanding of global IHNV evolution the virus was originally endemic in North America, where it diverged into three major genogroups designated U, M, and L (Kurath et al., 2003). The U genogroup is naturally host-specific to sockeye salmon (O. nerka), and historical and genetic evidence suggests that the M genogroup was derived from a U genogroup ancestor by a host jump into rainbow trout (Troyer and Kurath, 2003; Troyer et al., 2000). Subsequently M virus adapted to high virulence in rainbow trout and an ancestral M virus was inadvertently imported into Europe in the 1980s, with subsequent divergence of the E genogroup in European rainbow trout aquaculture (Enzmann et al., 2005). The first IHN outbreak in Asia occurred in Japan in 1971 and was associated with importation of sockeye salmon eggs from Alaska (Kimura and Yoshimizu, 1991; Yoshimizu, 1996). Later genetic typing showed that this original virus was in the sockeyespecific U genogroup, but as IHNV became established in Japanese aquaculture the virus again jumped into rainbow trout, and adapted further to higher virulence in larger rainbow trout during the 1980s, creating the J genogroup (Mochizuki et al., 2009; Nishizawa et al., 2006). Rainbow trout are not native to China, and the earliest known source of rainbow trout in China was 50,000 fertilized eggs that were obtained as a gift from the king of North Korea in 1959. Some of these eggs were held and reared in farm A in Heilongjiang province, which is an experimental fish culture facility that is the earliest cold-water fish farm in China. Methods of trout aquaculture for China were developed at this facility, and it was the source of rainbow trout that were widely distributed to other fish growing regions as trout aquaculture developed in the 1980s. There is no record of IHNV or IHN-like disease prior to the 1985 epidemic, which occurred at farm A in juvenile fish hatched from eggs produced at the facility. In the following two years there were additional IHN outbreaks at farm A, and also at farm B in Liaoning, all in very young juvenile rainbow trout hatched from eggs imported from Japan. Assuming these early disease outbreak reports represent the first introduction(s) of IHNV into China, the data presented here on Chinese IHNV from 2009 to 2017 is the product of approximately 30 years of 27

Molecular Phylogenetics and Evolution 131 (2019) 19–28

L. Xu et al.

most likely ancestral source of the original virus in China. This is consistent with known history of the earliest disease outbreak in China, which occurred at farm A, and the major role of Heilongjiang in development of trout aquaculture in China. As we expand our knowledge of IHNV diversity in China is it apparent in all phylogenetic analyses that Chinese IHNV are within the J genogroup of IHNV and form a subgroup that is separate from the previously identified JS and JN subgroups found in Japan and Korea. We suggest that the monophyletic clade of Chinese IHNV within the J genogroup could be designated as the JC subgroup of the J genogroup. Declarations of interest None.

disease. U S Fish Wildl. Serv. Spec. Sci. Rep. Fish 296, 1–10. Hasegawa, M., Kishino, H., Yano, T., 1985. Dating of the human-ape splitting by a molecular clock of mitochondrial DNA. J. Mol. Evol. 22, 160–174. Jia, P., Breyta, R., Li, Q., Qian, X., Wu, B., Zheng, W., Wen, Z.Q., Liu, Y., Kurath, G., Hua, Q.Y., Jin, N.Y., Liu, H., 2018. Insight into infectious hematopoietic necrosis virus (IHNV) in Chinese rainbow trout aquaculture from virus isolated from 7 provinces in 2010–2014. Aquaculture 196, 239–246. Jia, P., Zheng, X.C., Shi, X.J., Kan, S.F., Wang, J.J., He, J.Q., Zheng, W., Yu, L., Lan, W.S., Hua, Q.Y., Liu, H., Jin, N.Y., 2014. Determination of the complete genome sequence of infectious hematopoietic necrosis virus (IHNV) Ch20101008 and viral molecular evolution in China. Infect., Genet. Evolut.: J. Mol. Epidemiol. Evolut. Genet. Infect. Dis. 27, 418–431. Kim, W.S., Oh, M.J., Nishizawa, T., Park, J.W., Kurath, G., Yoshimizu, M., 2007. Genotyping of Korean isolates of infectious hematopoietic necrosis virus (IHNV) based on the glycoprotein gene. Arch. Virol. 152, 2119–2124. Kimura, T., Yoshimizu, M., 1991. Viral diseases of fish in Japan. Annu. Rev. Fish Dis. 1, 67–82. Kolodziejek, J., Schachner, O., Durrwald, R., Latif, M., Nowotny, N., 2008. “Mid-G” region sequences of the glycoprotein gene of Austrian infectious hematopoietic necrosis virus isolates form two lineages within European isolates and are distinct from American and Asian lineages. J. Clin. Microbiol. 46, 22–30. Kurath, G., 2012. Molecular epidemiology and evolution of Novirhabdoviruses. In: Dietzgen, R., Kuzmin, I. (Eds.), Rhabdoviruses: Molecular Taxonomy, Evolution, Genomics, Ecology, Cytopathology, and Control. Horizon Scientific Press. Kurath, G., Garver, K.A., Troyer, R.M., Emmenegger, E.J., Einer-Jensen, K., Anderson, E.D., 2003. Phylogeography of infectious haematopoietic necrosis virus in North America. J. General Virol. 84, 803–814. LaPatra, S.E., 1998. Factors affecting pathogenicity of infectious hematopoietic necrosis virus (IHNV) for salmonid fish. J. Aquat. Animal Health 10, 121–131. Miller, M.A., Pfeiffer, W., Schwartz, T., 2010. Creating the CIPRES Science Gateway for Inference of Large Phylogenetic Trees. Gateway Computing Environments Workshop 14, pp. 1–8. Mochizuki, M., Kim, H.J., Nishizawa, T., Yoshimizu, M., 2009. irulence change of infectious hematopoietic necrosis virus against rainbow trout Oncorhynchus mykiss and viral molecular evolution. Fish Pathol. 44, 159–165. Nichol, S.T., Rowe, J.E., Winton, J.R., 1995. Molecular epizootiology and evolution of the glycoprotein and non-virion protein genes of infectious hematopoietic necrosis virus, a fish rhabdovirus. Virus Res. 38, 159–173. Nishizawa, T., Kinoshita, S., Kim, W.S., Higashi, S., Yoshimizu, M., 2006. Nucleotide diversity of Japanese isolates of infectious hematopoietic necrosis virus (IHNV) based on the glycoprotein gene. Dis. Aquatic Organ. 71, 267–272. Niu, L.Q., Zhao, Z.Z., 1988. The epidemiological IHN and IPN of rainbow trout in northeast China. J. Fish. Sci. China 12, 327–332. Park, M.A., Sohn, S.G., Lee, S.D., Chun, S.K., Park, J.W., Fryer, J.L., Hah, Y.C., 1993. Infectious haematopoietic necrosis virus from salmonids cultured in Korea. J. Fish Dis. 16. Rucker, R.R., Whipple, W.J., Parvin, J.R., Evans, C.A., 1953. A contagious disease of salmon possibly of virus origin. U S Fish Wildl. Serv. Fish Bull. 54, 35–46. Rudakova, S.L., Kurath, G., Bochkova, E.V., 2007. Occurrence and genetic typing of infectious hematopoietic necrosis virus in Kamchatka, Russia. Dis. Aquatic Organ. 75, 1–11. Troyer, R.M., Kurath, G., 2003. Molecular epidemiology of infectious hematopoietic necrosis virus reveals complex virus traffic and evolution within southern Idaho aquaculture. Dis. Aquatic Organ. 55, 175–185. Troyer, R.M., LaPatra, S.E., Kurath, G., 2000. Genetic analyses reveal unusually high diversity of infectious haematopoietic necrosis virus in rainbow trout aquaculture. J. General Virol. 81, 2823–2832. Wang, C., Zhao, L.L., Li, Y.J., Tang, L.J., Qiao, X.Y., Jiang, Y.P., Liu, M., 2016. Analysis of the genome sequence of infectious hematopoietic necrosis virus HLJ-09 in China. Virus Genes 52, 29–37. Wingfield, W.H., Fryer, J.L., Pilcher, K.S., 1969. Properties of the sockeye salmon virus (Oregon strain). In: Proceedings of the Society for Experimental Biology and Medicine. Society for Experimental Biology and Medicine 130, pp. 1055–1059. Wolf, K., 1988. Fish Viruses and Fish Viral Diseases. Cornell University Press, Ithaca, pp. 83–114. Xu, L.M., Liu, M., Zhao, J.Z., Cao, Y.S., Yin, J.S., Liu, H.B., Lu, T., 2014. Epitope mapping of the infectious hematopoietic necrosis virus glycoprotein by flow cytometry. Biotechnol. Lett. 36, 2109–2116. Yoshimizu, M., 1996. Disease problems of salmonid fish in Japan caused by international trade. Revue scientifique et technique 15, 533–549. Yu, Z.H., Deng, M.L., Geng, Y., Zhou, Y., Wang, K.Y., Chen, D.F., Zhong, Z.J., Peng, X., Huang, X.L., 2014. An outbreak of infectious haematopoietic necrosis virus (IHNV) infection in cultured rainbow trout (Oncorhynchus mykiss) in Southwest China. Aquac. Res. 47, 2355–2362.

Acknowledgements We are deeply grateful to the reviewers for their helpful comments and advice in improving our manuscript. This study was supported by Central-Level Non-profit Scientific Research Institutes Special Funds (2018GH16) and (2018HY-ZD0303), Natural Science Foundation of Heilongjiang Province (C201462). Use of any trade, firm, or product names is for descriptive purposes only and does not imply endorsement by the U.S. Government. Appendix A. Supplementary material Supplementary data to this article can be found online at https:// doi.org/10.1016/j.ympev.2018.10.030. References Abbadi, M., Fusaro, A., Ceolin, C., Casarotto, C., Quartesan, R., Dalla Pozza, M., Cattoli, G., Toffan, A., Holmes, E.C., Panzarin, V., 2016. Molecular evolution and phylogeography of co-circulating IHNV and VHSV in Italy. Front. Microbiol. 7, 1306. Ahmadivand, S., Soltani, M., Mardani, K., Shokrpoor, S., Hassanzadeh, R., Ahmadpoor, M., Rahmati-Holasoo, H., Meshkini, S., 2017. Infectious hematopoietic necrosis virus (IHNV) outbreak in farmed rainbow trout in Iran: viral isolation, pathological findings, molecular confirmation, and genetic analysis. Virus Res. 229, 17–23. Baudin-Laurencin, F., 1987. IHN in France. Eur. Assoc. Fish Pathol. 7, 104. Bellec, L., Louboutin, L., Cabon, J., Castric, J., Cozien, J., Thiery, R., Morin, T., 2017. Molecular evolution and phylogeography of infectious hematopoietic necrosis virus with a focus on its presence in France over the last 30 years. J. General Virol. Bootland, L.M., Leong, J.C., 2011. Infectious hematopoietic necrosis virus. In: Fish Diseases and Disorders. CAB International, Wallingford, UK, pp. 66–109. Bovo, G., Giorgetti, G., Jørgensen, P.E.V., Olesen, N.J., 1987. Infectious hematopoietic necrosis: first detection in Italy. Bull. Eur. Ass. Fish Pathol. 7, 124. Breyta, R., Jones, A., Stewart, B., Brunson, R., Thomas, J., Kerwin, J., Bertolini, J., Mumford, S., Patterson, C., Kurath, G., 2013. Emergence of MD type infectious hematopoietic necrosis virus in Washington State coastal steelhead trout. Dis. Aquatic Organ. 104, 179–195. Cieslak, M., Wahli, T., Diserens, N., Haenen, O.L.M., Schutze, H., 2017. Phylogeny of the infectious hematopoietic necrosis virus in European aquaculture. PloS one 12, e0184490. Dixon, P., Paley, R., Alegria-Moran, R., Oidtmann, B., 2016. Epidemiological characteristics of infectious hematopoietic necrosis virus (IHNV): a review. Vet. Res. 47, 63. Drummond, A.J., Suchard, M.A., Xie, D., Rambaut, A., 2012. Bayesian hylogenetics with BEAUti and the BEAST 1.7. Mol. Biol. Evol. 29, 1969–1973. Enzmann, P.J., Castric, J., Bovo, G., Thiery, R., Fichtner, D., Schutze, H., Wahli, T., 2010. Evolution of infectious hematopoietic necrosis virus (IHNV), a fish rhabdovirus, in Europe over 20 years: implications for control. Dis. Aquatic Organ. 89, 9–15. Enzmann, P.J., Kurath, G., Fichtner, D., Bergmann, S.M., 2005. Infectious hematopoietic necrosis virus: monophyletic origin of European isolates from North American genogroup M. Dis. Aquatic Organ. 66, 187–195. Fijan, N., Sulimanovic̆, D., Bearzotti, M., Muzinic̆, D., Zwillenberg, L.O., Chilmonczyk, S., Vautherot, J.F., De Kinkelin, P., 1983. Some properties of the epithelioma papulosum cyprini (EPC) cell line from carp Cyprinus carpio. Ann. Virol. (Paris) 134, 207–220. Guenther, R.W., Watson, S.W., Rucker, R.R., 1959. Etiology of sockeye salmon “virus”

28