Physicochemical changes in liver and Hsc70 expression in pikeperch Sander lucioperca under heat stress

Ecotoxicology and Environmental Safety 181 (2019) 130–137

Contents lists available at ScienceDirect

Ecotoxicology and Environmental Safety journal homepage: www.elsevier.com/locate/ecoenv

Physicochemical changes in liver and Hsc70 expression in pikeperch Sander lucioperca under heat stress

T

Caijuan Li1, Yunfeng Wang1, Guocheng Wang1, Yining Chen, Jinqiang Guo, Chenglong Pan, Enguang Liu, Qufei Ling∗ School of Biology and Basic Medical Sciences, Soochow University, 199 Renai Road, Suzhou, Jiangsu, China

A R T I C LE I N FO

A B S T R A C T

Keywords: Antioxidant defense Freshwater fish Heat stress Hsc70 expression Liver Pikeperch

The pikeperch Sander lucioperca is an economically important freshwater species that is currently threatened by higher summer temperatures caused by global warming. To clarify the physiological state of pikeperch reared under relatively high temperatures and to acquire valuable biomarkers to monitor heat stress in this species, 100 fish were subjected to five different temperature treatments, ranging from 23 °C (control) to 36 °C. The physiological and biochemical indexes of liver and blood were determined, and heat-shock cognate 70 kDa protein (Hsc70) mRNA expression profiles were analyzed. The results showed that the activities of superoxide dismutase, catalase, and glutathione peroxidase in heat-stressed pikeperch first increased and then decreased, exhibiting peaks at 34 °C, 28 °C, and 28 °C, respectively. The level of thiobarbituric acid-reactive substances (TBARS) in all experimental groups was significantly higher than that of the control. The numbers of red blood cells, the packed-cell volume, and the contents of hemoglobin were significantly higher in the 34 °C and 36 °C treatment groups. Under heat stress, the albumin, cholesterol, and triglycerides contents decreased with increasing temperatures. Real-time fluorescence-based quantitative RT-PCR showed that Hsc70 mRNA levels increased in all eight of the tested tissues under heat stress. Expression reached maximum levels at 34 °C in the muscle, heart and gill tissues, and at 36 °C in the other five tissues. These results demonstrate that several physiological and biochemical phenotypes, such as oxidative stress, antioxidant enzymes and molecular chaperones, could be important biomarkers of heat stress in pikeperch, and are potentially valuable to uncover the mechanisms of heat-stress responses in fish.

1. Introduction In recent decades, abnormal global climate changes and rising temperatures have caused widespread concern and are expected to have devastating effects on freshwater ecosystems (Dutta et al., 2018). Aquatic animals are profoundly affected by the environmental conditions of their habitats, and alterations to the aquatic environment, such as pollutants and acute temperature changes, can markedly affect the ability of organisms to resist physiological stress (Chang et al., 2001). As an important example of ectothermic animals, the physiological state of fishes is largely influenced by environmental temperatures, especially higher ambient temperatures in the context of global warming. Heat-stress responses in organisms affect their growth, general health, disease resistance, and reproduction (Prunet et al., 2011; Nakano et al., 2014). Furthermore, rises in average daily and summer temperatures have an impact during the lifetime of individual fish

(Basu et al., 2002). Studies on heat-shock responses in fish have primarily focused on model fish and marine species (Qian and Xue, 2016; Ho et al., 2018; Huang et al., 2018), with much less attention paid to heat stress in freshwater fishes, particularly large amount of fish living in shallow lakes and ponds. In fish, acute increases in temperature, also known as heat shock or heat stress, can increase the levels of mitochondrial-dependent reactive oxygen species (ROS) (Cheng et al., 2018), such as hydrogen peroxide (H2O2), hydroxyl radical (OH), and singlet oxygen (Yu et al., 2017). Excessive ROS could cause oxidative stress, leading to cellular injuries, including DNA damage, lipid peroxidation (LPO), and protein carbonylation (PC) (Madeira et al., 2013; He et al., 2015). Fortunately, organisms have evolved a variety of strategies to defend against the harmful effects of ROS. For aquatic animals, the elimination of oxygenfree radicals mainly depends on some small reductive molecules, including glutathione and ascorbic acid and a train of antioxidases such

∗

Corresponding author. E-mail address: [email protected] (Q. Ling). 1 These authors contributed equally to this work. https://doi.org/10.1016/j.ecoenv.2019.05.083 Received 18 January 2019; Received in revised form 28 May 2019; Accepted 30 May 2019 Available online 05 June 2019 0147-6513/ © 2019 Elsevier Inc. All rights reserved.

Ecotoxicology and Environmental Safety 181 (2019) 130–137

C. Li, et al.

blood was drawn from each fish for hematological analysis. Liver, brain, gills, heart, spleen, stomach, intestine, and muscle tissue were sampled and stored in liquid nitrogen until further analysis.

as superoxide catalase (CAT), glutathione peroxidase (GPX), and superoxide dismutase (SOD) (Livingstone, 2001; Lopes et al., 2001). These antioxidant enzymes are able to protect cells from ROS-induced damage by converting O2 to H2O2 (produced by SOD), converting H2O2 to water and oxygen (by CAT), or eliminating the products of lipid peroxidation (Basu et al., 2002). A recent study demonstrated that these enzymes play an important role in protection against ROS-induced oxidative stress in a marine mussel (Prego-Faraldo et al., 2017) and may provide valuable biomarkers to monitor the rearing environment (Prego-Faraldo et al., 2016). In addition to the antioxidant system, other important repair mechanisms, such as the induction of heat-shock proteins (Hsps), are also triggered to protect the structures and functions of an organism from heat stress. Hsps are essential components in the heat-stress response, and the upregulation of Hsps may help restore the structure of damaged proteins (Xu et al., 2018). Madeira et al. (2013) found that oxidative biomarkers were correlated with thermal stress (via Hsp70) in several species of estuarine fish. Furthermore, as an important member of the heat-shock protein 70 family (Boutet et al., 2003), heat-shock cognate 70 kDa (Hsc70) has also been proposed as a sensitive biomarker of different stimuli, including temperature (Dong et al., 2008), salinity (Hamer et al., 2004), heavy-metal exposure (Downs et al., 2001), and hypoxia (Mu et al., 2013) in fish. To our knowledge, research on heat-stress responses in fish have mainly focused on antioxidant enzymes or/and protective molecular chaperones, and less attention has been paid to blood physiological phenotypes under heat stress; therefore, it is valuable to investigate whether blood phenotypes are potential biomarkers. All of the heat-stress biomarkers mentioned above could be expected to vary with species, especially since fishes occupying different thermal niches have different mitochondrial performance (Hilton et al., 2010; Strobel et al., 2013). The pikeperch Sander lucioperca is known worldwide as a valuable aquaculture and sportfish species (Han et al., 2016); it may also play an important role in biomanipulation to reduce the amount of planktivores in shallow lakes (Wysujack et al., 2002). Pikeperch pond culture has developed on a large scale in China (Han et al., 2016), even though farmed pikeperch are vulnerable to environmental changes, such as elevated summer temperatures. To our knowledge, no studies have reported on heat stress in pikeperch. The present study aimed to screen dependable biomarkers as a measure of heat-induced stress in pikeperch. We evaluated the physiological and biochemical status of pikeperch liver under different intensities of temperature stress, and conducted molecular cloning and differential expression of Hsc70 in pikeperch liver. This study may establish a model of suitable biomarkers in a large-sized freshwater carnivorous fish, and simultaneously help to reveal mechanisms of the heat-stress response in cultivated pikeperch.

2.2. Enzymatic assays For the detection of enzyme activities, 0.30 g of liver tissue was homogenized after adding 3.0 mL of 10.0 mM of Tris buffer (pH 7.5), using an IKA® T 18 electric homogenizer (Germany). Centrifugations were done with a refrigerated centrifuge (Primo R, Germany) at 4 °C, and the supernatant was used for measuring the enzymatic activity. The Coomassie Brilliant Blue staining method was used to measure the protein contents contained in the above enzyme fluid. The activities of SOD, CAT, GPX, and H2O2 content, were gauged using a SOD, CAT, GPX, or H2O2 visible-light reagent kit (Nanjing Jiancheng Sci-Tech Co. Ltd., Nanjing), respectively. One unit of SOD activity was defined as the anount of enzyme that inhibited 50% SOD in 1 ml reaction liquid per second per milligram total protein. One unit of CAT activity was defined as the quantity of enzyme that needed to degrade 1 μmol H2O2 per milligram of total protein per second. One unit of GPX activity was defined as the quantity of enzyme that decreased 1 μmol L−1 GSH per minute per milligram total protein. Degree of lipid peroxidation was determined by thiobarbituric acid reactive substances (TBARS) assay using a malondialdehyde (MDA) assay kit (i.e. TBA method) (Nanjing Jiancheng Sci-Tech Co. Ltd., Nanjing). 2.3. Hematological analysis An Abbott CD-3700 fully automatic hematology analyzer (USA) was used to measure the numbers of red blood cells (RBC) and white blood cells (WBC), the content of Hb, and the packed-cell volume (PCV). Liver function was evaluated by measuring serum levels of albumin (ALB), globulin (GLB), alanine amino transferase (ALT), aspartate amino transferase (AST), high-density lipoprotein (HDL), low-density lipoprotein (LDL), cholesterol (CHOL), and triglyceride (TG). All biochemical assays were performed using an automatic clinical chemistry analyzer (Model 7070, Hitachi, Japan). 2.4. Cloning of full-length cDNA for Hsc70 Total RNA were extracted with RNAiso reagent (Takara Bio, Kyoto, Japan), following the manufacturer’s protocol. cDNA was synthesized using a PrimeScript 1st strand cDNA Synthesis Kit (Takara Bio, Tokyo, Japan), then stored at −20 °C until further analysis. Rapid amplification of cDNA ends (RACE) was used to obtain the full-length Hsc70 cDNA. Based on the partial sequence of Hsc70 acquired by pikeperch RNA-Seq (Accession no. SRP064697) (Table 1), the 5' and 3' RACE reactions were performed using the 5' RACE System for Rapid Amplification of cDNA Ends, version 2.0 (Invitrogen, Carlsbad, CA, USA) and the SMART™ RACE cDNA Amplification Kit (Clontech Laboratories, Palo Alto, CA, USA), respectively. PCR products were purified with the

2. Materials and methods 2.1. Experimental material Experimental pikeperch (body weight 107 ± 5 g, total length 22.3 ± 3 cm) were acquired from Suzhou Shajiabang East Lake Modern Fishery Science and Technology Development Co. Ltd., China. One hundred healthy juvenile pikeperch were equally distributed among five 150-L tanks and reared at a water temperature of 23 °C. Dissolved oxygen and pH were maintained at 7.0 ± 0.5 mg l−1 and 8.0 ± 0.3, respectively. After one week’s acclimatization to laboratory conditions, individuals were subjected to one of five temperature treatments: 23 °C (control group), 28 °C, 32 °C, 34 °C and 36 °C. These temperatures were achieved with gradual increases of 1 °C per hour, from 23 °C, and once the treatment temperature was reached, the individuals were kept at this temperature for 2 h. Next, pikeperch individuals per parallel experiment were captured and anaesthetized in 35 mg/L of tricaine methanesulfonate (MS 222, Sigma, USA), and 1.5 mL of caudal venous

Table 1 The primers used for cDNA cloning and mRNA expression of Hsc70 of pikeperch. Primer number

Sequence (5′–3′)

Primer name

P1 P2 P3 P4 P5 P6 P7 P8

TCTGGCTGATGTCCTTCTTG TTTCCTCTTGAACTCCTCCA CGATGAGCGTGCTTACTTCTCCAACC CGTTGATGTCTTCGCCCCAGGTCTC AGGACTTGCTGCTGCTGGATGT TCTGCTTGGTAGGAATGGTGGTGTT CCGCCAAGTACGACGACATCAA CGCCGTTGAAGTCTGTGGACAC

5′- RACE-F1 5′- RACE-F2 3′- RACE-F1 3′- RACE-F2 hsc70F hsc70R GAPDHF GAPDHR

P1–P4 are used in Hsc70 cloning, and P5–P8 are used in qRT-PCR. 131

Ecotoxicology and Environmental Safety 181 (2019) 130–137

C. Li, et al.

Fig. 1. Biochemical indexes in the liver of pikeperch under heat stress (23 °C represents the control temperature, and 28 °C, 32 °C, 34 °C, 36 °C are treatment temperatures). A. SOD activity B.CAT activity C. GPX activity D. TBARS E. H2O2. Data are expressed as mean ± standard deviation (n = 3). Different lowercase letters indicate significant differences at different temperatures (P < 0.05).

E.Z.N.A.® Gel Extraction Kit (Omega), and ligated into pMD18-T vector (Takara, Japan), then propagated in DH5α-competent Escherichia coli cells (Tiangen, Beijing, China), following the manufacturer’s instructions. The positive clones were sequenced by Shanghai Sangon Biological Engineering Technology & Services Co., Ltd. (Shanghai, China).

fluorescence-based RT-PCR assays were conducted using the reverse transcription cDNA as template. qRT-PCR assays (25 μL) were carried out and each tissue was run in triplicate. The primers used are listed in Table 1. The qRT-PCR protocol was as follows: 95 °C for 30 s; 40 cycles of 95 °C for 10 s, 60 °C for 10 s; followed by a melting curve program (65–95 °C, with a heating rate of 0.5 °C/s). The relative amount of Hsc70 mRNA was calculated using the 2−ΔΔCT method (Livak and Schmittgen, 2001).

2.5. Hsc70 mRNA expression under heat stress The mRNA expression of Hsc70 in the control group and experimental groups was measured by qRT-PCR on the Applied Biosystems 7500 Fast Real-Time PCR System (Applied Biosystems, USA), utilizing AceQ qPCR SYBR Green Master Mix (Vazyme, China) according to the manufacturer’s instructions. The tested tissues comprised gill, liver, muscle, heart, intestine, spleen, stomach, and brain. Real-time

2.6. Data analysis Differences between groups were analyzed by one-way ANOVA with post-hoc Duncan’s multiple comparison test. All statistical analyses were performed using SPSS 21.0, and P-values less than 0.05 were 132

Ecotoxicology and Environmental Safety 181 (2019) 130–137

C. Li, et al.

Table 2 Changes of blood physiological and biochemical indices in pikeperch under heat stress (23 °C represents the control temperature, and 28 °C, 32 °C, 34 °C, 36 °C are treatment temperatures). Indices

RBC (1012 L) WBC (109·L﹣1) Hb (g/100 mL) PCV (%) AST (U·L﹣1) ALT (U·L﹣1) ALB (g·L﹣1) GLB (g·L﹣1) CHO (mmol·mL﹣1) TG (mmol·mL﹣1) HDL (mmol·mL﹣1) LDL (mmol·mL﹣1)

Temperature（°C） 23

28

32

34

36

1.6 ± 0.12a 178 ± 4.16a 9.72 ± 0.56a 41.87 ± 2.93a 51.00 ± 9.64a 19.67 ± 3.06a 15.20 ± 0.70a 21.17 ± 0.93a 10.57 ± 0.26a 8.30 ± 0.85a 7.03 ± 0.14a 1.84 ± 0.02a

1.68 ± 0.03a 180 ± 2.80a 9.67 ± 0.29a 42.60 ± 1.24a 269.60 ± 27.47b 162.33 ± 9.45b 14.10 ± 0.30b 22.60 ± 0.30a 8.59 ± 0.46b 6.20 ± 0.49b 7.00 ± 0.19a 1.89 ± 0.11a

1.65 ± 0.08a 208 ± 4.17b 9.79 ± 0.72a 44.74 ± 2.49a 346.30 ± 21.03c 118.60 ± 14.57c 11.03 ± 0.42c 24.97 ± 0.47b 7.60 ± 0.29c 4.00 ± 0.50c 6.64 ± 0.09a 2.02 ± 0.08a

1.94 ± 0.42b 209 ± 3.42b 12.96 ± 1.02b 57.35 ± 2.93b 62.30 ± 14.74a 23.33 ± 6.81a 10.80 ± 1.00c 27.10 ± 0.87c 6.00 ± 0.35d 3.27 ± 0.29c 5.75 ± 0.15b 3.96 ± 0.13b

2.42 ± 0.14b 220 ± 1.95b 12.63 ± 0.73b 60.53 ± 3.64b 56.00 ± 6.56a 17.33 ± 1.53a 9.27 ± 0.06d 30.97 ± 1.56d 4.30 ± 0.49e 3.37 ± 0.40c 5.76 ± 0.24b 4.12 ± 0.08b

Data are expressed as mean ± standard deviation (n = 3). Different lowercase letters indicate significant differences in different temperatures (P < 0.05). RBC and WBC represents the numbers of red blood cells and white blood cells, respectively. PCV represents the packed-cell volume. ALB means the content of albumin, and GLB is for globulin. ALT and AST represent the activity of alanine amino transferase and aspartate amino transferase, respectively. HDL and LDL means the density of high-density lipoprotein and the low-density lipoprotein, CHOL is for cholesterol content, and TG means triglyceride content.

ANZ03174.1) is 2,208 bp and contains an 83 bp 5′-UTR, a 172 bp 3′UTR (including a poly-A tail), and a 1,953 bp ORF encoding a polypeptide of 650 amino acids (Fig. 2). Among the amino acid residues, 79 were positively charged (Arg and Lys), while 96 were negatively charged (Asp and Glu). Thus, pikeperch Hsc70 protein is predicted to be negatively charged. The pikeperch Hsc70 protein sequence contains three DnaK motifs, namely DLGTT-S-V (aa 10–18), IFDLGGGTFDVSIL (aa 197–210) and IVLVGGSTRIPKIQK (aa 334–348), a cytosolic Hsp70 EEVD motif (aa 647–650), and three C-terminal tetrapeptide (GGMP) sequences (aa 615–618, aa 619–622, and aa 627–630) (Fig. 2).

considered significant for all tests. 3. Results 3.1. Activities of antioxidant enzymes in pikeperch liver There were significant increases of SOD, CAT, and GPX activities in all treatment groups as compared with the control group (P < 0.05), except for GPX activity in the 36 °C treatment group. Changes in SOD, CAT, and GPX activities showed a similar trend, whereby the activity first increased and then decreased with an increasing temperature. SOD activity reached the highest level in the 34 °C group, and was 4.24-fold greater than that of the control group (23 °C). Heat stress caused increases in CAT activity in liver, ranging from 1.7- to 3.5-fold that of the control group, and was greatest in the 28 °C group. GPX activity in liver was also highest (5.84-fold that of the control group) in the 28 °C group. In addition, values of TBARS in all treatment groups and H2O2 level in groups above 28°Cwere significantly higher in all treatment groups as compared with the control group (P < 0.05) (Fig. 1).

3.4. Expression of Hsc70 mRNA in pikeperch Investigation of the pikeperch Hsc70 expression level indicated that Hsc70 was expressed in all eight tissues examined. In the control group, the highest and lowest levels of Hsc70 expression were detected in the liver and muscle, respectively. Under heat stress, the Hsc70 mRNA Expression level had significantly increased in all tissues tested. For example, Hsc70 was upregulated significantly in liver at 36 °C (4.69fold that of the control group) (Fig. 3A). In muscle, heart and gills, its expression increased significantly with elevated temperatures, all peaking in the 34 °C group, and were 1.88-, 2.52-, and 3.18-fold that of the control group, respectively (Fig. 3B). mRNA expression levels of Hsc70 in liver, brain, spleen, stomach, and intestine all increased in response to heat stress, and in all tissues the highest levels were reached at 36 °C (Fig. 3).

3.2. Hematological parameters of pikeperch liver Compared with the control group, there were no significant differences in the numbers of RBC, the contents of Hb, and the PCV in the 28 °C and 32 °C groups, while the three indices all showed significant increases in the 34 °C and 36 °C groups (P < 0.05). Except for the 28 °C group, a significant rise in the numbers of WBC and the contents of GLB were observed in all other. Treatment groups (P < 0.05) (Table 2), while the contents of ALB decreased significantly with increasing temperatures. Compared with the control group, the contents of ALT and AST in the 28 °C and 32 °C groups increased significantly (P < 0.05), then decreased to levels without significant differences in the 34°Cand 36 °C groups. Under heat stress, the contents of CHOL and TG decreased significantly with increasing temperatures (P < 0.05). Compared with the control group, the HDL contents decreased with increasing heat stress, with significant increases observed in the 34 °C and 36 °C groups (P < 0.05). The LDL contents increased with increasing temperatures, and significant differences were observed in the 34 °C and 36 °C groups as compared with the control group (P < 0.05) (Table 2).

4. Discussion The antioxidant enzymes are the first intracellular defense against oxidative stress and they regulate redox-dependent signaling, which is indispensable for innate immunity (Selvaraj et al., 2012). SOD is considered to play a key role in the first step of the enzymatic antioxidative defense system (Yu et al., 2017). CAT and GPX have the ability to eliminate H2O2, which helps to counteract the influence of oxidative stress, and GSH-Px can convert H2O2 even at a low concentration (Duan et al., 2015). The increased rates of mitochondrial respiration caused by stress would enhance the formation of ROS, and increase the induction of SOD, CAT and GSH-Px at translational and transcriptional levels against oxidative damage (Pavlović et al., 2010; Wang et al., 2012). So, the present study detected significant increases in SOD, CAT, and GPX activities in pikeperch liver up to temperatures of 34 °C, 28 °C and 28 °C, respectively. However, it was found that antioxidant enzyme activity decreased in the fish when the temperature reached the critical

3.3. cDNA cloning and sequence analysis of Hsc70 of pikeperch The full-length sequence of Hsc70 (GenBank accession no. 133

Ecotoxicology and Environmental Safety 181 (2019) 130–137

C. Li, et al.

Fig. 2. Amino acid sequence and full cDNA sequence of HSC70 of pikeperch. Signature sequences of the HSC70 family are shown in boxes. Start codon ATG and stop codon TAA are indicated in bold and underline.

as H2O2 scavenging (Lin and Shiau, 2005). In addition, the excessive ROS under redundant stress could damage DNA and break protein structures in the organism, which might degrade the antioxidant enzymes (Xu et al., 2018). Lipid peroxidation is considered a clear sign of the deleterious effects of H2O2 (Liau et al., 2016). Malondialdehyde (MDA) or TBARS are formed as a byproduct of lipid peroxidation caused by oxidative stress, which indirectly reflects the degree of oxidative stress (Oakes and Kraak, 2003). The TBARS assay used in the present study measures

thermal maximum (CTMax) (Madeira et al., 2013). We proposed that the decrease of SOD, CAT and GPX activities with treatment temperatures above 34 °C, 28 °C and 28 °C, respectively, implies excessive oxidative stress in pikeperch. For SOD, the excess production of superoxide or their transformation to H2O2 may cause oxidation of the cysteine in SOD, which then deactivates it (Dimitrova et al., 1994). As regards CAT, the competitive inhibition caused by increased activity of GPX and other peroxidases might contribute to a decline in CAT activity, because they protect the organism from oxidative damage in the same manner 134

Ecotoxicology and Environmental Safety 181 (2019) 130–137

C. Li, et al.

Blood is an important part of the immune system, and changes in blood parameters can be used to assess the physiological health of fish (Li et al., 2010). One interesting blood parameter is the numbers of WBCs, which are involved in cellular immunity (Ellis, 1997). In this study, increases in the numbers of WBCs suggest that heat stress affected the immune function in the pikeperch. CHOL and TG, important to lipid metabolism in fish, are important in resisting external stress (Montero et al., 1999). A previous study found that hypoxia inhibited lipid metabolism in tilapia and reduced serum free fatty acid levels, which then led to the inhibition of CHOL and TG synthesis (Vianen et al., 2002). In this study, the concentrations of CHOL and TG both decreased in line with increasing treatment temperatures, suggesting that high temperatures inhibit the lipid metabolism of pikeperch. As a carrier of nutrients, ALB provides energy to the body while participating in maintaining plasma colloid osmotic pressure. In this study, the ALB in blood decreased significantly as the treatment temperature increased. The consumption of ALB was speculated to meet the higher energy requirements of the body under acute temperature stress (Zhang et al., 2015). GLB is mainly involved in non-specific immunity. The non-specific immunity of fish will increase under acute temperature stress (Qiang et al., 2012), causing the level of GLB in the blood to rise rapidly to maintain homeostasis. In our results, serum ALB content continued to decrease, while secretion of GLB increased, under acute high-temperature stress, consistent with the results of a previous study on half-smooth tongue-sole Cynoglossus semilaevis (Sun et al., 2010). Hsps are reported to have an important relationship with environmental stress in fish liver (Currie and Tufts, 1997). The members of the Hsp70 family protein express under both normal and stressful conditions (Waagner et al., 2010). Similar to tissue-specific expression features in zebrafish and carp (Santacruz et al., 1997; Ali et al., 2003), Hsc70 experienced ubiquitous expression in all eight tested tissues in the present study. Under normal conditions, the greatest expression of Hsc70 was shown in pikeperch liver, in accordance with that found in swordtails (Li and Fu, 2013). Many researchers have thought that Hsc70 expression does not change or else alters very slightly in response to external stimuli (Ali et al., 2003; Ramaglia et al., 2004; Yabu et al., 2011). Deane et al. (2004) found that Hsc70 in a black seabream fibroblast cell line was expressed 2-fold higher than control levels under acute heat shock. As far as we know, Hsc70 mRNA levels were also found to increase in Fundulus heteroclitus under heat stress (Fangue et al., 2006) and in seabream under Vibrio alginolyticus infection (Deane et al., 2004). Therefore, we speculate that the expression patterns of Hsc70 depend on the species and the stress patterns. In this study, under heat stress, the expression of Hsc70 mRNA significantly increased in all eight tested tissues of pikeperch (P < 0.05).

Fig. 3. Expression patterns of Hsc70 mRNA in pikeperch tissues under heat stress (23 °C represents the control temperature, and 28 °C, 32 °C, 34 °C, 36 °C are treatment temperatures). A. liver, brain, spleen, stomach, and B. intestine, muscle, heart, gill. Values are expressed as mean ± standard deviation (n = 3). Different lowercase letters indicate significant differences at different temperatures (P < 0.05).

MDA present in the sample, as well as MDA generated from lipid hydroperoxides by the hydrolytic conditions of the reaction (Trevisan, 2001). In this study, the TBARS of pikeperch liver increased with an increasing water temperature, in agreement with MDA variations observed in liver of Pacific cod under high temperatures (Wang et al., 2012). Additionally, changes in the activities of ALT and AST in serum often directly reflect cell damage in specific organs, because the two aminotransferases are present in mitochondria and can be released into the serum as a result of tissue damage and organ dysfunction (Liu et al., 2007). Therefore, the increased activities of ALT and AST in the 28 °C and 32 °C treatment groups in this study indicate that the ALT and AST activities in pikeperch plasma could be used for aquatic biomonitoring (Vutukuru et al., 2007). Furthermore, we speculate that the decreased activities of AST and ALT in groups reared in water above 32 °C, and the decreased TBARS in the 36 °C group, may be due to dysfunction of the liver tissue and respiratory disorders (unpublished data) caused by excessive heat stress. Hematological parameters such as RBC, Hb, and PCV are extensively used to evaluate the toxic stress of environmental contaminants. Hb is the main oxygen-carrying protein in RBC, and affects the transport capacity of blood oxygen and the numbers and function of RBCs (Zimmerman et al., 2017; Bao et al., 2018). PCV is the percentage of RBCs in whole blood, and an increase in the PCV can intensify the numbers and functioning of RBCs (Bao et al., 2018). The pikeperch is an ectothermic animal and its metabolism is highly temperature-dependent (Cherkasov et al., 2006). Therefore, we propose that the observed increases in PCV and RBCs are combined with increased amounts of Hb to satisfy a higher oxygen demand needed for higher metabolic requirements under heat stress.

5. Conclusions Heat stress significantly affected the physiological and biochemical activities of pikeperch. Our results showed that heat stress elevated the levels of ROS, then caused antioxidant defenses and an immune response. Pikeperch appeared cable of protecting itself from oxidative damage by autogenously physiological and biochemical regulation, including antioxidant defense, elevated metabolism, and protective mechanisms such as Hsc70 expression. However, once the heat stress surpasses the maximum regulation ability, the pikeperch suffered serious damage to the liver, and the conditions even led to death. Notably, the present study examined physicochemical changes in the liver and Hsc70 expression of pikeperch under different levels heat stress. The results demonstrated that several physiological and biochemical indices, including blood parameters such as WBC and ALB, antioxidant enzymes, and Hsc70 expression, could be important biomarkers of heat stress in pikeperch. This study also enhances our general understanding of the mechanisms of how fish may respond to heat stress.

135

Ecotoxicology and Environmental Safety 181 (2019) 130–137

C. Li, et al.

(Hsc70) gene from swordtail fish (Xiphophorus helleri). Chin. J. Oceanol. Limnol. 31 (4), 821–829. Lin, Y.H., Shiau, S.Y., 2005. Dietary selenium requirements of juvenile grouper, Epinephelus malabaricus. Aquaculture 250 (1–2), 356–363. Liu, S.M., Zang, X.N., Liu, B., Zhang, X.C., Arunakumara, K.K.I.U., Zhang, X.Q., Liang, B., 2007. Effect of growth hormone transgenic synechocystis on growth, feed efficiency, muscle composition, haematology and histology of turbot (Scophthalmus maximus L.). Aquacult. Res. 38 (12), 1283–1292. Livak, K.J., Schmittgen, T.D., 2001. Analysis of relative gene expression data using realtime quantitative PCR and the 2(-Delta Delta C(T)) method. Methods 25 (4), 402–408. Livingstone, D.R., 2001. Contaminant-stimulated reactive oxygen species production and oxidative damage in aquatic organisms. Mar. Pollut. Bull. 42 (8), 656–666. Li, Z.H., Li, P., Randak, T., 2010. Ecotoxocological effects of short-term exposure to a human pharmaceutical Verapamil in juvenile rainbow trout (Oncorhynchus mykiss). Comp. Biochem. Physiol. C. 152 (3), 385–391. Lopes, P.A., Pinheiro, T., Santos, M.C., Da, L.M.M., Collares-Pereira, M.J., Viegas-Crespo, A.M., 2001. Response of antioxidant enzymes in freshwater fish populations (Leuciscus alburnoides complex) to inorganic pollutants exposure. Sci. Total Environ. 280 (1), 153–163. Madeira, D., Narciso, L., Cabral, H.N., Vinagre, C., Diniz, M.S., 2013. Influence of temperature in thermal and oxidative stress responses in estuarine fish. Comp. Biochem. Physiol. Mol. Integr. Physiol. 166 (2), 237–243. Montero, D., Izquierdo, M.S., Tort, L., Robaina, L., Vergara, J.M., 1999. High stocking density produces crowding stress altering some physiological and biochemical parameters in gilthead seabream, Sparus aurata, juveniles. Fish Physiol. Biochem. 20 (1), 53–60. Mu, W.J., Wen, H.S., Li, J.F., He, F., 2013. Cloning and expression analysis of a HSP70 gene from Korean rockfish (Sebastes schlegeli). Fish Shellfish Immunol. 35 (4), 1111–1121. Nakano, T., Kameda, M., Shoji, Y., Hayashi, S., Yamaguchi, T., Sato, M., 2014. Effect of severe environmental thermal stress on redox state in salmon. Redox Biol. 2, 772–776. Oakes, K.D., Kraak, G.J.V.D., 2003. Utility of the TBARS assay in detecting oxidative stress in white sucker (Catostomus commersoni) populations exposed to pulp mill effluent. Aquat. Toxicol. 63 (4), 447–463. Pavlović, S.Z., Borković, M.S.S., Radovanović, T.B., Perendija, B.R., Despotović, S.G., Gavrić, J.P., Saicić, Z.S., 2010. Seasonal variations of the activity of antioxidant defense enzymes in the red mullet (Mullus barbatus l.) from the adriatic sea. Mar. Drugs 8 (3), 413–428. Prego-Faraldo, M.V., Méndez, J., Laffon, B., Valdiglesias, V., 2016. Cellular and molecular biomarkers for assessing the harmful effects of marine toxins in bivalve mollusks. Environ. Res. J. 10, 3. Prego-Faraldo, M.V., Vieira, L.R., Eirin-Lopez, J.M., Méndez, J., Guilhermino, L., 2017. Transcriptional and biochemical analysis of antioxidant enzymes in the mussel, Mytilus galloprovincialis, during experimental exposures to the toxic dinoflagellate, Prorocentrum lima. Mar. Environ. Res. 129, 304–315. Prunet, P., Øverli, Ø., Douxfils, J., Bernardini, G., Baron, D., 2011. Fish welfare and genomics. Fish Physiol. Biochem. 38 (1), 43–60. Qian, B.Y., Xue, L.Y., 2016. Liver transcriptome sequencing and de novo annotation of the large yellow croaker (Larimichthy crocea) under heat and cold stress. Mar. Genom. 25, 95–102. Qiang, J., Yang, H., Wang, H., Xu, P., He, J., 2012. The effect of acute temperature stress on biochemical indices and expression of liver Hsp70 mRNA in GIFT Nile tilapia juveniles (Oreochromis niloticus). Oceanol. Limnol. Sinica 43 (5), 943–953. Ramaglia, V., Harapa, G.M., White, N., Buck, L.T., 2004. Bacterial infection and tissuespecific Hsp72, -73 and -90 expression in western painted turtles. Comp. Biochem. Physiol., C 138 (2), 139–148. Santacruz, H., Vriz, S., Angelier, N., 1997. Molecular characterization of a heat shock cognate cdna of zebrafish, Hsc70, and developmental expression of the corresponding transcripts. Dev. Genet. 21 (3), 223–233. Selvaraj, V., Yeager-Armstead, M., Murray, E., 2012. Protective and antioxidant role of selenium on arsenic trioxide-induced oxidative stress and genotoxicity in the fish hepatoma cell line plhc-1. Environ. Toxicol. Chem. 185 (1), 116–123. Strobel, A., Graeve, M., Poertner, H.O., Mark, F.C., 2013. Mitochondrial acclimation capacities to ocean warming and acidification are limited in the antarctic Nototheniid fish, Notothenia rossii and Lepidonotothen squamifrons. PLoS One 8 (7), e68865. Sun, X.L., Xing, K.Z., Chen, C.X., Wang, Q.K., Yu, X.Q., Hu, J.C., 2010. The effects of acute temperature stress on blood parameters in half-smooth tongue-sole (Cynoglossus semilaevis). Fish. Sci. 29 (7), 387–392. Trevisan, M., 2001. Correlates of markers of oxidative status in the general population. Am. J. Epidemiol. 154 (4), 348–356. Vianen, G.J., Obels, P.P., van den Thillart, G.E., Zaagsma, J., 2002. Beta-adrenoceptors mediate inhibition of lipolysis in adipocytes of tilapia (Oreochromis mossambicus). Am. J. Physiol. Endocrinol. Metab. 282 (2), 318–325. Vutukuru, S.S., Pauleena, J.S., Rao, J.V., Anjaneyulu, Y., 2007. Architectural changes in the gill morphology of the freshwater fish, Esomus danricus as potential biomarkers of copper toxicity using automated video tracking system. Environ. Bioindic. 2 (1), 3–14. Waagner, D., Heckmann, L.H., Malmendal, A., Nielsen, N.C., Holmstrup, M., Bayley, M., 2010. Hsp70 expression and metabolite composition in response to short-term thermal changes in Folsomia candida (Collembola). Comp. Biochem. Physiol. Mol. Integr. Physiol. 157 (2), 177–183. Wang, D.L., Zuo, D., Wang, L.M., Sun, T., Wang, Q., Zhao, Y.L., 2012a. Effects of white spot syndrome virus infection on immuno-enzyme activities and ultrastructure in gills of Cherax quadricarinatus. Fish Shellfish Immunol. 32 (5), 645–650.

Acknowledgements This work was financially supported by the Aquatic Three Project of Jiangsu Province (Y2017-37), the Scientific Fund of Jiangsu Province (BY2015039-10), and the Priority Academic Program Development of Jiangsu Higher Education Institutions. Cynthia Kulongowski, with the Edanz Group (www.edanzediting.com/ac), edited a draft of this manuscript. References Ali, K.S., Dorgai, L., Abrahám, M., Hermesz, E., 2003. Tissue-and stressor-specific differential expression of two Hsc70 genes in carp. Biochem. Biophys. Res. Commun. 307 (3), 503–509. Bao, J.W., Qiang, J., Tao, Y.F., Li, H.X., He, J., Xu, P., Chen, D.J., 2018. Responses of blood biochemistry, fatty acid composition and expression of micrornas to heat stress in genetically improved farmed tilapia (Oreochromis niloticus). J. Therm. Biol. 73, 91–97. Basu, N., Todgham, A.E., Ackerman, P.A., Bibeau, M.R., Nakano, K., Schulte, P.M., Iwama, G.K., 2002. Heat shock protein genes and their functional significance in fish. Gene 295 (2), 173–183. Boutet, I., Tanguy, A., Rousseau, S., Auffret, M., Moraga, D., 2003. Molecular identification and expression of heat shock cognate 70 (Hsc70) and heat shock protein 70 (Hsp70) genes in the pacific oyster Crassostrea gigas. Cell Stress Chaperones 8 (1), 76–85. Chang, Y.J., Hur, J.W., Lim, H.K., Lee, J.K., 2001. Stress in olive flounder (Paralichthys olivaceus) and fat cod ( Hexagrammos otakii ) by the sudden drop and rise of water temperature. Korean J. Fish. Aquat. Sci. 34, 91–97. Cheng, C.H., Guo, Z.X., Luo, S.W., Wang, A.L., 2018. Effects of high temperature on biochemical parameters, oxidative stress, DNA damage and apoptosis of pufferfish (Takifugu obscurus). Ecotoxicol. Environ. Saf. 150, 190–198. Cherkasov, A.S., Biswas, P.K., Ridings, D.M., Ringwood, A.H., Sokolova, I.M., 2006. Effects of acclimation temperature and cadmium exposure on cellular energy budgets in the marine mollusk crassostrea virginica: linking cellular and mitochondrial responses. J. Exp. Biol. 209 (7), 1274–1284. Currie, S., Tufts, B.L., 1997. Synthesis of stress protein 70 (Hsp70) in rainbow trout (Oncorhynchus mykiss) red blood cells. J. Exp. Biol. 200 (3), 607–614. Deane, E.E., Li, J., Woo, N.Y.S., 2004. Modulated heat shock protein expression during pathogenic vibrio alginolyticus stress of sea bream. Dis. Aquat. Org. 62 (3), 205–215. Dimitrova, StM., Tishinova, V., Velcheva, V., 1994. Combined effect of zinc and lead on the hepatic superoxide dismutase-catalase system in carp (Cyprinus carpio). Comp. Biochem. Physiol. C. 108 (1), 43–46. Dong, Y.W., Dong, S.L., Meng, X.L., 2008. Effects of thermal and osmotic stress on growth, osmoregulation and Hsp70 in sea cucumber (Apostichopus japonicus Selenka). Aquaculture 276 (1–4), 179–186. Downs, C.A., Fauth, J.E., Woodley, C.M., 2001. Assessing the health of grass shrimp (Palaeomonetes pugio) exposed to natural and anthropogenic stressors: a molecular biomarker system. Mar. Biotechnol. 3 (4), 380–397. Duan, Y.F., Zhang, J.S., Dong, H.B., Wang, Y., Liu, Q.S., Li, H., 2015. Oxidative stress response of the black tiger shrimp penaeus monodon to vibrio parahaemolyticus challenge. Fish Shellfish Immunol. 46 (2), 354–365. Dutta, S.M., Mustafi, S.B., Raha, S., Chakraborty, S.K., 2018. Biomonitoring role of some cellular markers during heat stress-induced changes in highly representative fresh water mollusc, bellamya bengalensis : implication in climate change and biological adaptation. Ecotoxicol. Environ. Saf. 157, 482–490. Ellis, A.E., 1997. The leucocytes of fish: a review. J. Fish Biol. 11, 453–491. Fangue, N.A., Hofmeister, M., Schulte, P.M., 2006. Intraspecific variation in thermal tolerance and heat shock protein gene expression in common killifish, Fundulus heteroclitus. J. Exp. Biol. 209 (15), 2859–2872. Hamer, B., Hamer, D.P., Müller, W.E.G., Batel, R., 2004. Stress-70 proteins in marine mussel Mytilus galloprovincialis as biomarkers of environmental pollution: a field study. Environ. Int. 30 (7), 873–882. Han, X.F., Ling, Q.F., Li, C.J., Wang, G.C., Xu, Z.C., Lu, G.Q., 2016. Characterization of pikeperch (Sander lucioperca) transcriptome and development of SSR markers. Biochem. Syst. Ecol. 66, 188–195. He, J., Qiang, J., Yang, H., Xu, P., Zhu, Z., Yang, R., 2015. Changes in the fatty acid composition and regulation of antioxidant enzymes and physiology of juvenilegenetically improved farmed tilapia Oreochromis niloticus (L.), subjected to short-term low temperature stress. J. Therm. Biol. 53, 90–97. Hilton, Z., Clements, K.D., Hickey, A.J.R., 2010. Temperature sensitivity of cardiac mitochondria in intertidal and subtidal triplefin fishes. J. Comp. Physiol. B 180 (7), 979–990. Ho, T.N., Paul, G.V., Chen, Y.H., Hsu, T., 2019. Heat stress upregulates G-T mismatch binding activities in zebrafish (Danio rerio) embryos preexposed and nonexposed to a sublethal level of cadmium (Cd). Chemosphere 218, 179–188. Huang, J.Q., Li, Y.J., Ma, F., Kang, Y.J., Liu, Z., Wang, J.F., 2018. Identification and characterization of micrornas in the liver of rainbow trout in response to heat stress by high-throughput sequencing. Gene 679, 274–281. Liau, L.L., Suzana, M., Azurah, A.G.N., Chua, K.H., 2016. Hydrogen peroxide induces acute injury and up-regulates inflammatory gene expression in hepatocytes: an in vitro model. Sains Malays. 45, 451–458. Li, N.Q., Fu, X.Z., 2013. Molecular cloning and expression of a heat-shock cognate 70

136

Ecotoxicology and Environmental Safety 181 (2019) 130–137

C. Li, et al.

Yu, H.B., Deng, W., Zhang, D.D., Gao, Y., Yang, Z., Shi, X.C., Sun, J., Zhou, J.S., Hong, J., 2017. Antioxidant defenses of Onychostoma macrolepis in response to thermal stress: insight from mrna expression and activity of superoxide dismutase and catalase. Fish Shellfish Immunol. 66, 50–61. Zhang, Y.C., Wen, H.S., Li, L.M., Feng, Q.C., 2015. Effect of acute temperature stress on serum cortisol and hematological physiology of gestated Sebastes schlegelii. J. Fish. China 39 (12), 1872–1882. Zimmerman, R., Tsai, A.G., Salazar, V.B.Y., Cabrales, P., Hofmann, A., Meier, J., Shander, A., Spahn, D.R., Friedman, J.M., Tartakovsky, D.M., Intaglietta, M., 2017. Posttransfusion increase of hematocrit per se does not improve circulatory oxygen delivery due to increased blood viscosity. Anesth. Analg. 124 (5), 1547–1554.

Wang, W., Jiang, Z.Q., Meng, F.Q., Li, Y., Wang, Z.Y., 2012b. The effects of sharply changes in temperature on survival and indices of physiology and biochemistry in Pacific cod Gadus macrocephalus. Fish. Sci. 31 (8), 463–466. Wysujack, K., Kasprzak, P., Laude, U., Mehner, T., 2002. Management of a pikeperch stock in a long-term biomanipulated stratified lake: efficient predation vs. low recruitment. Hydrobiologia 479 (1–3), 169–180. Xu, D.X., Zhou, S., Sun, L., 2018. Rna-seq based transcriptional analysis reveals dynamic genes expression profiles and immune-associated regulation under heat stress in, Apostichopus japonicus. Fish Shellfish Immunol. 78, 169–176. Yabu, T., Imamura, S., Mohammed, M.S., Touhata, K., Minami, T., Terayama, M., Yamashita, M., 2011. Differential gene expression of Hsc70/Hsp70 in yellowtail cells in response to chaperone-mediated autophagy. FEBS J. 278 (4), 673–685.

137