Physiological and Molecular Response of Wheat Roots to Nitrate Supply in Seedling Stage

Agricultural Sciences in China

May 2011

2011, 10(5): 695-704

Physiological and Molecular Response of Wheat Roots to Nitrate Supply in Seedling Stage WANG Ping1, WANG Zhen-lin1, CAI Rui-guo1, 2, LI Yong1, CHEN Xiao-guang1 and YIN Yan-ping1 State Key Laboratory of Crop Biology/Shandong Key Laboratory of Crop Biology/Agronomy College, Shandong Agricultural University, Tai’an 271018, P.R.China 2 Agronomy Department, Hebei Normal University of Science and Technology, Changli 066600, P.R.China 1

Abstract The objective of this study was to understand the morphological, physiological, and molecular responses of wheat roots to nitrate supply at seedling stage. Two wheat genotypes, Jimai 22 and Shannong 15, were grown in Hoagland’s nutrient solution with different nitrate levels at seedling stage. Results indicated that the plant dry weight and N accumulation increased with the increase of nitrate supply. The number of axial root, total uptake area (TUA), and active uptake area (AUA) increased with more nitrate supply. Correlation analysis indicated that significant positive correlations existed between N accumulation and dry weight, N accumulation and AUA, and N accumulation and AUA/TUA. Although, the expressions of NRT2.1, NRT2.2, and NRT2.3 decreased with nitrate supply increased, the expressions of NRT1, NRT2.1, and NRT2.3 could maintain high level at N3 treatment. The free amino acid and NO3- content in shoot also increased with the increased nitrate application, but no significant difference was found in root among the treatments. These results implied that the increase of N uptake by nitrate supply was due to the morphological and physiological responses of wheat roots and the high expression level of TaNRT genes. Similarly, the contribution of morphological, physiological, and molecular parameters was different between two genotypes of wheat. Key words: wheat, root parameters, nitrate uptake, N metabolites, TaNRT expression

INTRODUCTION Nitrate (NO3-) availability is a limiting factor for plant growth in most agricultural systems. Until now, various mechanisms for N uptake have been investigated in plant (Zhang and Forde 2000; Forde 2002a, b; Malamy 2005; Walch et al. 2006). The first step of the N absorption pathway is the entry of NO3- into the cell, which is mediated by specific transporters. NO3- transport systems have traditionally been classified into two physiological groups: the low-affinity transport system (LATS) encoded by NRT1 gene family and the highReceived 5 July, 2010

affinity transport system (HATS) encoded by NRT2 gene family (Crawford and Glass 1998; Forde 2000). NO3transport systems are regulated by several possible signals, for example, root NO3-, root NH4+, and amino acids (Zhao et al. 2004; Cai et al. 2007; Yin et al. 2007). The second step is the reduction of NO3- to nitrite and the subsequent reduction of nitrite to ammonium that are catalyzed by the well-known enzymes NO3- reductase (NR) and nitrite reductase (NiR), respectively (Loudet et al. 2003). This primary assimilation mainly takes place in leaves, and ammonium produced by this process or by others (photorespiration or atmospheric N2 fixation) is then incorporated into organic molecules

Accepted 3 December, 2010

WANG Ping, Ph D, E-mail: [email protected]; Correspondence YIN yan-ping, Professor, Tel: +86-538-8242458, E-mail: [email protected], ypyinsdau@sina. com © 2011, CAAS. All rights reserved. Published by Elsevier Ltd. doi:10.1016/S1671-2927(11)60052-7

696

by the Gln synthetase (GS)/Glu synthase (GOGAT) pathway (Hirel et al. 2005). The N absorption is affected by root traits plasticity in many plants (Aerts and Chapin 2000; Hodge 2004). Limiting N supply may cause morphological changes in plant root, such as root length, root hair density, root hair length, and root diameter in Arabidopsis thaliana, maize, and wheat (Robinson 2001; Herrera et al. 2007; Miller et al. 2007; Niu et al. 2007; Zhang et al. 2007). Moreover, there are negative effects of N deficiency on the total uptake area (TUA), active uptake area (AUA), and root vigor significantly in wheat (Zhai et al. 2003; Zhang et al. 2006). In addition to physiological responses in the NO3- uptake system, root morphological plasticity plays an important part in N uptake (Aerts and Chapin 2000; Hodge 2004). NO3-, NH4+, and amino acids are not only major N metabolites, but also acts as signal for modulating plant metabolism and development (Crawford and Glass 1998). NO3- uptake is induced by NO3- provision (Forde et al. 2002a, b; Glass et al. 2003). The NRT2 expression is significantly increased by N resupply after a period of NO 3- deprivation and N absorption is synchronously up regulated in root (Siddiqi et al. 1990; Zhuo et al. 1999; Orsel et al. 2002; Okamoto et al. 2003). Whereas, N uptake and NRT2 transcript abundance are down regulated by amino compounds, especially Gln (Lejay et al. 1999; Vidmar et al. 2000). So far, a few reports have documented on the relationship among root morphological parameters, physiological parameters, and TaNRT genes expression, especially in comparison contribution to N absorption. In the present study, we compared the morphological, physiological, and molecular responses of wheat roots to nitrate supply at seedling stage. The objective of this study was to elucidate how the NO3- provision regulated the N absorption of wheat seedling. We hypothesize that the effect of NO3- provision on N absorption are primarily mediated through effects on root morphological parameters, physiological parameters, and TaNRT genes expression. Moreover, N metabolites regulate the N uptake through cycling from shoot to root. In this study, N accumulation (biomass×N concentration), root morphological parameters, physiological parameters, and TaNRT genes expression were analyzed to elucidate the relative significance in N uptake

WANG Ping et al.

at three N treatments. In addition, NO3- and free amino acid content were compared to assess the regulation of N metabolites in N uptake.

MATERIALS AND METHODS Plant materials and experimental design Two wheat genotypes, Shannong 15 (SN15) and Jimai 22 (JM22), were used in the experiment. Wheat seeds were first sterilized for 10 min in 2% H2O2, rinsed with deionized water, and then germinated for 5 d at 24°C on humid filter papers. Seedlings with removed endosperm were transferred to plastic tanks containing 5 L nutrient solution, which ingredients referred to Hoagland’s nutrient solution with some modifications. Containers and tops for hydroponic culture were opaque, to produce healthy roots and to discourage growth of algae. Three N levels, N1 (2 mmol L-1), N2 (5 mmol L-1), and N3 (10 mmol L-1), were set up. The solution was continuously aerated for 8 h everyday through rubber tubes connected to an air compressor, and the nutrient solution was renewed every 2 d. Plants were grown for 4 wk (from April 3 to May 1, 2009). The plants were set in a growth chamber under alternate 16 h of light at 20°C and 8 h of darkness at 15°C.

Morphology and physiology assays Plants were sampled after 4 wk and separated into root and shoot. Root was washed using deionized water and dried with filter paper. Root morphology and TUA and AUA were analyzed after sampling. Part of root and shoot were dried at 80°C in the oven to constant weight for measurement of dry weight, N content and free amino acid. Another part of the root and shoot were frozen in liquid N2 and then stored at -80°C for the analysis of expression of TaNRT and TaGS genes. Another part of shoot were frozen in liquid N2 and then stored at -40°C until assayed for enzyme activities and NO3- content. The number of axial root was counted for each plant. All dry plant samples were milled to determine N and free amino acid content. Total N concentrations were determined by the Kjeldahl method (He 1985) using a

© 2011, CAAS. All rights reserved. Published by Elsevier Ltd.

Physiological and Molecular Response of Wheat Roots to Nitrate Supply in Seedling Stage

NC analyzer (KDY-9820, Tongrun Ltd., China). Free amino acid were extracted and analyzed following the description of He (1985). The root TUA and AUA were measured using methylene blue staining, and detected using visible-ultraviolet spectrophotometer (TU-1901, Purkinje General Instrument Ltd., Beijing, China). To extract GS enzyme and soluble protein, 1 g of frozen shoots were ground to a precooled mortar and pestle with sand, and then homogenized in extraction buffer containing 50 mmol L-1 Tris-HCl (pH 8.0), 0.5 mmol L-1 EDTA, 2.0 mmol L -1 MgSO 4 ·7H 2 O, and 4.0 mmol L -1 DTT. The homogenates were centrifuged at 25 000×g for 20 min. The supernatant were used to assaye enzyme activity and soluble protein content (Li 2004). To extract NO3-, 0.5 g of fresh tissue samples were added to 20 mL deionized water and ground in mortar. The homogenates were centrifuged at 10 000×g for 10 min. The filtrate was measured for NO 3- using a continuous-flow auto analyzer (AA3, Bran+Luebbe Ltd., Germany) (Luo et al. 2006).

697

was synthesized by reverse transcription (RT) using M-MLV, following the recommended protocol of manufacturer. Semi-quantitative PCR and detection The gene specific primers were designed according to the cDNA sequences (Table 1). TaActin was used as an internal control in the relative semi-quantitative RT-polymerase chain reaction (RT-PCR). The PCR amplification was performed using Taq DNA polymerase (Tiangen, China). The PCR cycling conditions were as follows: an initial denaturation step at 95°C for 4 min, amplification for 25-40 cycles with 95°C for 30 s, 58°C for 40 s, and 72°C for 50 s, and a final extension step at 72°C for 10 min. The PCR products were electrophoresed on a 1.0% agarose gel and stained with ethidium bromide. The integrated density values of the bands from PCR product gels were analysed using Gel Imaging System (Tanon 2500, Tianneng Ltd., Shanghai, China).

Statistical analysis Analysis of the data was performed using DPS 7.0 (Date Processing System) software.

Semi quantitative RT-PCR RNA extraction and reverse transcription Total RNA was isolated using Trizol Reagent (Invitrogen, Carlsbad, CA, USA) from root or shoot according to the instructions of manufacturer. The concentration and purity of total RNA were determined by measuring the absorbance at 260 and 280 nm in a Biophotometer (Eppendorf, Hamburg, Germany). Equal amounts of 4 μg of total RNA were reverse transcribed into first-strand cDNA in 20 μL reaction mixtures. The first strand cDNA

RESULTS N demand of plant growth determined N uptake Both the shoot and total dry weights were significantly increased by NO3- supply (Table 2), which reached a peak at N2 treatment, and declined at N3 treatment. In two wheat genotypes, the change of trend of soluble

Table 1 Primer sets for PCR amplification Gene

Accession no.

TaNRT2.1

AF288688

TaNRT2.2

AF332214

TaNRT2.3

AY053452

TaNRT1

AY587264

TaGS1

DQ124211

TaGS2

DQ124212

Actin

Primer sequences for cDNA isolation (5´

3´)

ACAAGCTGCTTGTGGTGCTGTA GTGATGAACAGTAAAATTCTTAGGTG GGCTACCTCTCTGACCTTGGT CAGCCGATGTTCAGTACTTGT ATGTGGCGCTGTCTTTGGTGTT GTACGTGACGAACCGTACAATTCATA CACTGCATCCTTTCAATCCATAG GCGTCTGGAGACTCATCACAGAAAAAT CAACCCTGATGTTGCCAAG GTAGGCGGCGATGTGCT ATTTCGAAGCCAGTGGAG GCACTTGTGCAGTGACCTTG CAGCAACTGGGATGATATGG ATTTCGCTTTCAGCAGTGGT

Product size (bp) 472 636 466 348 508 253

© 2011, CAAS. All rights reserved. Published by Elsevier Ltd.

698

WANG Ping et al.

protein content was similar to that of shoot and total dry weights. The soluble protein content in JM22 increased by 16.33 and 12.76% at N2 and N3 treatments comparing with N1 treatment, respectively, while that in SN15 increased by 16.12 and 12.14% (Fig. 1). N accumulation was significantly increased by NO 3- provision (Table 2), which was also similar to that of dry weight in both wheat genotypes. We performed the correlation analysis to explore the relationship between dry weight

and N accumulation (Table 3). The results revealed significant positive correlation between dry weight and N accumulation (r=0.83*). Total N accumulation and total dry weight in JM22 were higher than that in SN15 at both N2 and N3 treatments (Table 2). These results suggested that there was a synchronous exaltation of the N accumulation and dry weight in two wheat genotypes. JM22 was more efficient in accumulation N than SN15 at both N2 and N3 treatments.

Table 2 The biomass and N accumulation of two genotypes affected by NO3- supply Genotype JM22

SN15

N treatment N1 N2 N3 N1 N2 N3

Shoot dry weight (mg/plant) 41.9 c 49.5 a 48.8 b 43.2 c 48.2 a 47.1 b

Total dry weight (mg/plant) 63.2 c 72.9 a 69.3 b 61.3 b 65.1 a 64.4 a

Total N accumulation (mg/plant) 2.37 c 3.04 a 2.78 b 2.55 b 2.83 a 2.69 b

Means within same column followed by different letters (a, b, and c) are significantly different between N treatments of same genotype (P<0.05). The same as below.

Fig. 1 Effect of NO 3- supply on the soluble protein content in shoot of two genotypes. Means within same column followed by a different letters are significantly different at P<0.05 level. The same as below.

positive correlations between the number of axial root and N accumulation (r=0.74*), and the number of axial root and dry weight (r=0.77*) (Table 3). We further investigated the physiological parameters of root in two wheat genotypes. Table 5 shows that TUA and AUA were dependent on NO3- supply increase. We observed 18.19% increase of TUA at N2 treatment and a maximum 50% increase at N3 treatment compared with N1 treatment in JM22, while 29.41 and 52.94% increase in SN15. AUA increased at N2 treatment, and reached the peak at N3 treatment in two wheat genotypes. No significant difference in TUA and AUA was observed between two wheat genotypes. Correlation analysis indicated significant positive correlations between N accumulation and AUA (r=0.60*), and N accumulation and AUA/TUA (r=0.85*) (Table 3).

Morphological and physiological responses of two genotypes to NO3- supply

TaNRT expression in different levels of NO3supply

The number of axial root increased significantly with NO3- supply increased in two wheat genotypes (Table 4). However, the maximum root length and ratio of root to shoot were higher at N1 treatment than at N2 and N3 treatments. The maximum root length and ratio of root to shoot in JM22 were higher than that in SN15 at three N treatments. Correlation analysis indicated significant

To explore different role of NRT1 and NRT2 in the N absorption, we examined their expression by RT-PCR. The results indicated that the expression of NRT1 significantly increased with more NO3- supply (Fig. 2). No significant difference was found in the expression level of NRT1 between two genotypes, while NRT2 of two genotypes showed quite different responses to NO3-

© 2011, CAAS. All rights reserved. Published by Elsevier Ltd.

Physiological and Molecular Response of Wheat Roots to Nitrate Supply in Seedling Stage

699

Table 3 Correlation coefficients between N accumulation and TUA (total uptake area), AUA (active uptake area), root number, and dry weight Item

N accumulation

Dry weight TUA AUA AUA/TUA Root biomass The number of axial root

Dry weight

0.83* 0.52 0.6* 0.85* 0.24 0.74*

0.49 0.56 0.79* 0.69 0.77*

TUA

TUA

0.99 ** 0.59 -0.07 0.56

0.69* -0.04 0.54

AUA/TUA

0.32 0.52

Root biomass

0.41

, P<0.05; , P<0.01.

*

**

Table 4 Plant morphology traits of the two genotypes affected by NO3- supply Genotype

N treatment

The number of axial root (root/plant)

N1 N2 N3 N1 N2 N3

6.56 c 7.56 a 6.78 b 6.25 c 6.75 b 7.22 a

JM22

SN15

Maximum root length (cm) 23.21 a 22.28 ab 20.21 b 20.17 a 19.34 a 18.76 b

Seedling height (cm)

Ratio of root to shoot

31.6 c 32.3 b 34.0 a 25.6 b 32.0 a 33.5 a

0.51 a 0.47 b 0.42 c 0.42 a 0.35 b 0.37 b

Table 5 Plant root physiological parameters of two genotypes affected by NO3- supply Genotype JM22

SN15

N treatment

TUA (m2/plant)

AUA (m 2/plant)

AUA/TUA

N1 N2 N3 N1 N2 N3

0.18 c 0.22 b 0.27 a 0.17 c 0.22 b 0.26 a

0.08 c 0.10 b 0.12 a 0.08 c 0.10 b 0.11 a

0.42 b 0.44 a 0.44 a 0.43 a 0.43 a 0.43 a

supply. NRT2.1, NRT2.2, and NRT2.3 expression levels reached the lowest at N3 treatment, but those patterns were distinct. NRT2.1 expression decreased at N2 treatment, and reached the lowest at N3 treatment with almost 23.77 and 16.10% decrease than N1 treatment in SN15 and JM22, respectively (Fig. 2). Similarly, NRT2.3 expression decreased at N2 treatment, and reached the lowest at N3 treatment with almost 26.21 and 27.14% decrease than N1 treatment in SN15 and JM22, respectively (Fig. 2). We observed a 66.97 and 72.87% decrease in NRT2.2 expression at N2 than N1 treatment in SN15 and JM22, respectively, and a maximum 81.4% decrease at N3 treatment in both SN15 and JM22. These results indicated that NRT2.1 and NRT2.3 expression level decreased slowly with NO3provision increase, while NRT2.2 expression level decreased rapidly. The expression level of NRT2.1 and NRT2.3 were higher in JM22 than that in SN15. However, no significant difference in the NRT2.2 expression level was observed between two wheat genotypes.

Fig. 2 Effects of NO3- supply on expression of TaNRT genes in root. A, expression of TaNRT genes in SN15. B, expression of TaNRT genes in JM22. The integrated density values of the bands from PCR product gels were analyzed, and take the expression of Actin as standard value (100). The other genes were delineated as the percentage of Actin. The columnar section embody the (N2N1)/N1×100% and (N3-N1)/N1×100% in two wheat genotypes root. Experiments were repeated three times using three different plants with similar results.

The feedback regulation of N metabolites to N uptake The NR activity increased with NO 3- supply in two wheat genotypes, however, no significant variance oc-

© 2011, CAAS. All rights reserved. Published by Elsevier Ltd.

700

curred between N2 and N3 treatments (Fig. 3). No significant difference was observed in the NR activity between two wheat genotypes. The GS activity in JM22 increased with NO 3- supply, but not in SN15. The expressions of TaGS2 and TaGS1 increased with NO 3- supply in two wheat genotypes, of which patterns were distinct (Fig. 4). The expressions of TaGS2

WANG Ping et al.

and TaGS1 in SN15 reached a peak at N3 treatment. The expression of TaGS1 in JM22 reached a peak at N3 treatment, while TaGS2 in JM22 reached a peak at N2 treatment, and declined at N3 treatment. The GS activity and the expression of TaGS2 and TaGS1 were higher in JM22 than in SN15 at three N treatments. We investigated the N metabolites (free amino acid

Fig. 3 Effects of NO3- on the activity of NR and GS in two wheat genotypes.

DISCUSSION Effects of N supply on the plant growth and N accumulation

Fig. 4 Effects of NO3- supply on the expression of GS genes in shoot.

and NO3-) content in shoot and root in two wheat genotypes (Figs. 5 and 6). The free amino acid and NO3content in shoot were lower at N1 than at N2 and N3 in two wheat genotypes, and there was no significant difference between N2 and N3 treatments (Figs. 5 and 6). The free amino acid content in shoot was higher in JM22 than that in SN15 at three N treatments, while the NO3- content in shoot was lower in JM22 than in SN15. However, no significant difference in the free amino acid and NO3- content in root was observed between genotypes or treatments.

N acquisition is determined by N demand for plant growth (Mi et al. 2008). N demand of the plant may be defined as the difference between organic N derived from current assimilation and the amount of N required to sustain an optimal growth rate (Imsande and Touraine 1994). In the present study, increase in NO3- supply promoted shoot growth of the two genotypes. So, the nitrogen absorption in root increased to meet the demands imposed by shoot growth (Fig. 1, Table 2). The conclusions were based on significant positive relationship between dry weight and N accumulation (r=0.83*) (Table 3). Again, this response was unequivocally with previous paper that shows N absorption was determined by plant growth demand (Cooper and Clarkson 1989). The increase of NO3- supply to JM22 was higher than that to SN15.

© 2011, CAAS. All rights reserved. Published by Elsevier Ltd.

Physiological and Molecular Response of Wheat Roots to Nitrate Supply in Seedling Stage

701

Fig. 5 Effects of NO3- supply on the amino acid content in two genotypes.

Fig. 6 Effects of NO3- supply on the shoot NO3- content in two genotypes.

Effects of NO3- supply on the mechanism of N uptake in root It had been shown previously that the difference in N uptake could be attributed to root parameters and/or NO3- transport activity in root (Liu et al. 2009). Plant has showed physiological and morphological plasticity of root traits to enhance the ability of N uptake (Aerts and Chapin 2000; Hodge 2004). However, a few reports have documented on the relationship among morphological and physiological parameters of root, and TaNRT genes expression, especially in comparison contribution to N absorption. In this experiment, morphological, physiological, and molecular parameters of root were studied. It was found that the number of axial root, TUA, AUA, and AUA /TUA played an important role in the N uptake (Tables 4 and 5). The conclu-

sions were based on significant positive relationship between N accumulation and AUA (r=0.60*), N accumulation and AUA/TUA (r=0.85*) (Table 3). It has previously been shown that NO3- provision may cause morphological or physiological changes of plant root (Zhai et al. 2003; Zhang et al. 2006, 2007). Previous reports showed that the root size did not play the primary role in the process of NO3- uptake under high N condition (Glass 2003; Chun et al. 2005). However, Liu et al. (2009) found that a larger root system and stronger response of root growth to N induction played an important role in the NO3- uptake. In the present study, the number of axial root and uptake area of root were important factors for NO3- uptake. These conclusions were based on significant positive relationships between N accumulation and the number of axial root (r=0.74*), AUA (r=0.60*), and AUA/TUA (r=0.85*)

© 2011, CAAS. All rights reserved. Published by Elsevier Ltd.

702

WANG Ping et al.

(Table 3). NO3- transporters were the executor which transported NO3- into root cells across the plasma membrane. Previous work on NO 3- transporters indicated that AtNRT2 expression was strongly correlated with root NO3- influx (Lejay et al. 1999), and was strongly influenced by environmental factors (Munos et al. 2004; Krouk et al. 2006; Miller et al. 2007). In the present study, the TaNRT genes were assessed through semiquantitative RT-PCR (Fig. 2). TaNRT1 expression was strongly induced by NO 3- provision. TaNRT2.1, TaNRT2.2, and TaNRT2.3 reached the highest expression levels at N1 treatment, and obviously decreased with NO3- supply increase. These results were similar to previous work that indicated the expression of AtNRT2.1 induced by NO3-, and repressed by high N status (Zhuo et al. 1999; Nazoa et al. 2003). NRT1 expression level increased with NO3- supply increase, but was still lower than NRT2.1 and NRT2.3 (Fig. 2). These results suggested that although the contribution of NRT1 became more and more important with NO3supply increase, the expression of NRT2.1 and NRT2.3 played more important role in NO3- uptake. No significant difference in TUA and AUA, and the expression of NRT2.2 was observed between two wheat genotypes. However, the maximum root length and the expression of NRT1, NRT2.1, and NRT2.2 were higher in JM22 than that in SN15 at three N treatments. The results indicated that the variance between two wheat genotypes was attributed to the difference in maximum root length and the expressions of NRT1, NRT2.1, and NRT2.2.

The results indicated that NO3- provision enhanced the N assimilation. However, there was no significant difference of the N metabolites in root at three N treatments. Inthapanya et al. (2000) reported large genotypic variation in both nutrient uptake and nutrient use efficiency. This work confirmed the difference in NO3absorption and accumulation between the two wheat genotypes. Dhugga and Waines (1989) demonstrated that N uptake was more important than N use as N supply increased. Genetic variability is known for NO3absorption which has been shown to be related to root traits (Kondo et al. 2003; Wang et al. 2004), and in present study it was shown by two wheat genotypes. Our results indicated that JM22 with higher ratio of root to shoot and expression level of NRT2.1 and NRT2.2 could absorb more NO3-. A lot of works have been done to investigate the changes in metabolite concentration and enzyme activities involved in N metabolism of plant development (Hirel et al. 2005; Uribelarrea et al. 2009). Matt et al. (2001) reported that the NR activity was different among the genotypes. Our results indicated that there was no significant difference in reducing NO3- to nitrite between two wheat genotyps, but the ability to assimilate ammonium into organic molecules in JM22 was higher than that in SN15. JM22 could make better use of the absorbed N within the plant. This conclusion matched with higher free amino acid content in JM22 than that in SN15. In future, we will study the difference in two wheat genotypes in the field experiments.

CONCLUSION Effects of NO supply on the N metabolites 3

NO and amino acid not only are major N metabolites, but also act as signal to modulate plant metabolism and development (Crawford and Glass 1998). In the present study, NR activity (Fig. 3), TaGS1 and TaGS2 expressions (Fig. 4) in two wheat genotypes increased with NO 3- provision increased. The GS activity in JM22 was increased with more NO3- provision. These data suggested that NO3- provision promoted N assimilation capacity. The free amino acid and NO3- content in shoot increased with NO3- provision increased (Fig. 5), while there was no significant difference in root (Fig. 6). 3

In conclusion, the increased N absorption induced by NO3- supply was due to (1) the increase in the number of axial root, (2) the enlargement of TUA and AUA of root, and (3) high expression level of NRT2.1 and NRT2.3 genes. Moreover, although NO3- supply promoted N assimilation capacity, the free amino acid and NO3- content in root had no significant difference at N treatments. The nitrate absorption and assimilation were higher in JM22 than that in SN15.

Acknowledgements This research was supported by the National Natural

© 2011, CAAS. All rights reserved. Published by Elsevier Ltd.

Physiological and Molecular Response of Wheat Roots to Nitrate Supply in Seedling Stage

Science Foundation of China (30871477), the National Basic Research Program of China (973 Program, 2009CB118602), and the National Department of Public Benefit Research Foundation, China (200803037).

References Aerts R, Chapin F S. 2000. The mineral nutrition of wild plants revisited: a re-evaluation of processes and patterns. Advances in Ecological Research, 30, 1-67. Cai C, Zhao X Q, Zhu Y G, Li B, Tong Y P, Li Z S. 2007. Regulation of the high-affinity nitrate transport system in wheat roots by exogenous abscisic acids and glutamine. Journal of Integrative Plant Biology, 49, 1719-1725. Chun L, Mi G H, Li J S, Chen F J, Zhang F S. 2005. Genetic analysis of maize root characteristics in response to low nitrogen stress. Plant and Soil, 276, 369-382. Cooper H D, Clarkson D T. 1989. Cycling of amino-nitrogen and other nutrients between shoots and roots in cereals - a possible mechanism integrating shoot and root in the regulation of nutrient uptake. Journal of Experimental Botany, 40, 753-762. Crawford N M, Glass A D M. 1998. Molecular and physiological aspects of nitrate uptake in plants. Trends in Plant Science, 3, 389-395. Dhugga K S, Waines J G. 1989. Analysis of nitrogen accumulation and use in bread and durum wheat. Crop Science, 29, 12321239. Forde B G. 2000. Nitrate transporters in plants: structure, function and regulation. Biochimica et Biophysica Acta, 1465, 219235. Forde B G. 2002a. Local and long-range signaling pathways regulating plant responses to nitrate. Annual Review of Plant Biology, 53, 203-224. Forde B G. 2002b. The role of long-distance signalling in plant responses to nitrate and other nutrients. Journal of Experimental Botany, 53, 39-43. Glass A D M. 2003. Nitrogen use efficiency of crop plants: physiological constraints upon nitrogen absorption. Plant Science, 22, 453-470. He Z F. 1985. Analysis Technology and Quality of Cereals and Oil. Agricultural Press, Beijing. (in Chinese) Herrera J M, Stamp P, Liedgens M. 2007. Interannual variability in root growth of spring wheat (Triticum aestivum L.) at low and high nitrogen supply. Europen Journal of Agronomy, 26, 317-326. Hirel B, Andrieu B, Valadier M H, Renard S, Quilleré I, Chelle M, Pommel B, Fournier C, Drouet J L. 2005. Physiology of maize II: identification of physiological markers representative of the nitrogen status of maize (Zea mays)

703

leaves during grain filling. Physiologia Plantarum, 124, 178188. Hodge A. 2004. The plastic plant: root responses to heterogeneous supplies of nutrients. New Phytologist, 162, 9-24. Imsande J, Touraine B. 1994. N demand and the regulation of nitrate uptake. Plant Physiology, 105, 3-7. Inthapanya P, Sipaseuth, Sihavong P, Sihathep V, Chanphengsay M, Fukai S, Basnayake J. 2000. Genotype differences in nutrient uptake and utilization for grain yield production of rained lowland rice under fertilized and non-fertilized conditions. Field Crops Research, 65, 57-68. Kondo M, Pablico P P, Aragones D V, Agbisit R, Abe J, Morita S, Courtois B. 2003. Genotype and environmental variations in root morphology in rice genotypes under upland field conditions. Plant and Soil, 255, 189-200. Krouk G, Tillard P, Gojon A. 2006. Regulation of the high-affinity NO 3- uptake system by NRT1.1-mediated NO 3 - demand signaling in Arabidopsis. Plant Physiology, 142, 1075-1086. Lejay L, Tillard P, Lepetit M, Olive F D, Filleur S, Daniel-Vedele F, Gojon A. 1999. Molecular and functional regulation of two NO3- uptake systems by N- and C-status of Arabidopsis plants. The Plant Journal, 18, 509-519. Li D Q. 2004. Technology of Physiology Experiment. China Science Technology Press, Beijing. (in Chinese) Liu J X, Chen F J, Olokhnuud C L, Glass A D M, Tong Y P, Zhang F S, Mi G H. 2009. Root size and nitrogen-uptake activity in two maize (Zea mays) inbred lines differing in nitrogen-use efficiency. Journal of Plant Nutrition and Soil Science, 172, 230-236. Loudet O, Chaillou S, Merigout P, Talbotec J, Daniel-Vedele F. 2003. Quantitative trait loci analysis of nitrogen use efficiency in Arabidopsis. Plant Physiology, 131, 345-358. Luo J K, Sun S B, Jia L J, Chen W, Shen Q R. 2006. The mechanism of nitrate accumulation in pakchoi [Brassica campestris L. ssp. chinensis (L.)]. Plant and Soil, 282, 291-300. Malamy J E. 2005. Intrinsic and environmental response pathways that regulate root system architecture. Plant, Cell and Environment, 28, 67-77. Matt P, Geiger M, Walch-Liu P, Engels C, Krapp A, Stitt M. 2001. The immediate cause of the diurnal changes of nitrogen metabolism in leaves of nitrate-replete tobacco: a major imbalance between the rate of nitrate reduction and the rates of nitrate uptake and ammonium metabolism during the first part of the light period. Plant, Cell and Environment, 24, 177-190. Mi G H, Chen F J, Zhang F S. 2008. Multiple signalling pathways control nitrogen-mediated root elongation in maize. Plant Signaling & Behavior, 3, 1030-1032. Miller A J, Fan X R, Orsel M, Smith S J, Wells D M. 2007. Nitrate transport and signalling. Journal of Experimental

© 2011, CAAS. All rights reserved. Published by Elsevier Ltd.

704

WANG Ping et al.

Botany, 22, 1-10. Munos S, Cazettes C, Fizames C, Gaymard F, Tillard P, Lepetit

pools in roots of barley. Plant Physiology, 123, 307-318. Walch-Liu P, Ivanov I I, Filleur S, Gan Y, Remans T, Forde B G.

M, Lejay L, Gojon A. 2004. Transcript profiling in the chl15 mutant of Arabidopsis reveals a role of the nitrate transporter

2006. Nitrogen regulation of root branching. Annals of Botany, 97, 875-881.

NRT1.1 in the regulation of another nitrate transporter NRT2.1. The Plant Cell, 16, 2433-2447.

Wang Y, Mi G H, Chen F J, Zhang J H, Zhang F S. 2004. Response of root morphology to nitrate supply and its

Nazoa P, Vidmar J J, Tranbarger T J, Mouline K, Damiani I, Tillard P, Zhuo D, Glass A D M, Touraine B. 2003. Regulation

contribution to nitrogen accumulation in maize. Journal of Plant Nutrition, 27, 2189-2202.

of the nitrate transporter gene AtNRT2.1 in Arabidopsis thaliana: responses to nitrate, amino acids and developmental

Yin L P, Li P, Wen B, Taylor D, Berry J O. 2007. Characterization and expression of a high-affinity nitrate system transporter

stage. Plant Molecular Biology, 52, 689-703. Niu J F, Chen F J, Mi G H, Li C J, Zhang F S. 2007. Transpiration

gene (TaNRT2.1) from wheat roots, and its evolutionary relationship to other NTR2 genes. Plant Science, 172, 621-

and nitrogen uptake and flow in two maize (Zea mays L.) inbred lines as affected by nitrogen supply. Annals of Botany,

631. Zhai B N, Sun C M, Wang J R, Li S X. 2003. Effects of nitrogen

99, 153-160. Okamoto M, Vidmar J J, Glass A D M. 2003. Regulation of

deficiency on the growth and development of winter wheat roots. Acta Agronomica Sinica, 11, 913-918. (in Chinese)

NRT1 and NRT2 gene families of Arabidopsis thaliana: responses to nitrate provision. Plant and Cell Physiology,

Zhang D Y, Zhang Y Q, Yang W D, Miao G Y. 2006. Biological response of roots in different spring wheat genotypes to low

44, 304-317. Orsel M, Filleur S, Fraisier V, Daniel-Vedele F. 2002. Nitrate

nitrogen stress. Acta Agronomica Sinica, 32, 1349-1354. (in Chinese)

transport in plants: which gene and which control? Journal of Experimental Boyany, 53, 825-833.

Zhang H M, Forde B G. 2000. Regulation of Arabidopsis root development by nitrate availability. Journal of Experimental

Robinson D. 2001. Root proliferation, nitrate inflow and their carbon costs during nitrogen capture by competing plants in

Botany, 51, 51-59. Zhang H M, Rong H L, Pilbeam D. 2007. Signalling mechanisms

patchy soil. Plant and Soil, 232, 41-50. Siddiqi M Y, Glass A D M, Ruth T J, Rufty Jr T W. 1990.

underlying the morphological responses of the root system to nitrogen in Arabidopsis thaliana. Journal of Experimental

Studies of the uptake of nitrate in barley: I. kinetics of 13NO3influx. Plant Physiology, 93, 1426-1432.

Botany, 19, 1-10. Zhao X Q, Li Y J, Liu J Z, Li B, Liu Q Y, Tong Y P, Li J Y, Li Z

Uribelarrea M, Crafts-Brandner S J, Below F E. 2009. Physiological N response of field-grown maize hybrids (Zea

S. 2004. Isolation and expression analysis of a high-affinity nitrate transporter TaNRT2.3 from roots of wheat. Acta

mays L.) with divergent yield potential and grain protein concentration. Plant and Soil, 316, 151-160.

Botanica Sinica, 46, 347-354. Zhuo D G, Okamoto M, Vidmar J, Glass A D M. 1999. Regulation

Vidmar J J, Zhuo D, Siddiqi M Y, Schjoerring J K, Touraine B, Glass A D M. 2000. Regulation of high-affinity nitrate

of putative high-affinity nitrate transporter (Nrt2;1At) in roots of Arabidopsis thaliana. The Plant Journal, 17, 563-

transporter genes and high-affinity nitrate influx by nitrogen

569. (Managing editor WANG Ning)

© 2011, CAAS. All rights reserved. Published by Elsevier Ltd.