Physiological interactions between the hypothalamic-pituitary-gonadal axis and spleen in rams actively immunized against GnRH

International Immunopharmacology 38 (2016) 275–283

Contents lists available at ScienceDirect

International Immunopharmacology journal homepage: www.elsevier.com/locate/intimp

Physiological interactions between the hypothalamic-pituitary-gonadal axis and spleen in rams actively immunized against GnRH Xingfa Han a, Xiaohua Ren a, Yu Zeng b, Yuqin Zhou a, TianZeng Song c, Xiaohan Cao a, Xiaogang Du a, Fengyan Meng a, Yao Tan a, Yacheng Liu a, Jing Feng c, Mingxing Chu d, Xianyin Zeng a,⁎ a

Isotope Research Lab, Sichuan Agricultural University, Ya'an 625014, People's Republic of China College of Animal Science, Sichuan Agricultural University, Chengdu Campus, Chengdu, Sichuan 611130, People's Republic of China Institute of Animal Science, Tibet Academy of Agricultural and Animal Husbandry Science, Lhasa 850009, People's Republic of China d Key Laboratory of Farm Animal Genetic Resources and Germplasm Innovation of Ministry of Agriculture, Institute of Animal Science, Chinese Academy of Agricultural Sciences, Beijing 100193, People's Republic of China b c

a r t i c l e

i n f o

Article history: Received 1 April 2016 Received in revised form 9 June 2016 Accepted 14 June 2016 Available online xxxx Keywords: Reproductive axis Spleen Immunocastration GnRH Immune cytokines Ram

a b s t r a c t Hypothalamic-pituitary-gonadal (HPG) axis is strongly implicated in the regulation of immune system. The objective was to determine the effects of immunocastration on splenic reproduction- and immunity-related gene expressions, and serum cytokine profiles in rams. Forty rams were randomly allocated into three groups: control (n = 14); surgically castrated (n = 13); or immunized (n = 13) against 100 μg D-Lys6-GnRH-tandem-dimer peptide conjugated to ovalbumin in Specol adjuvant at 6 months of age (with a booster 2 months later). Blood samples (for hormone and immune cytokine profiles) were collected at 1-month intervals until rams were slaughtered (10 months). Compared to intact controls, anti-GnRH immunization reduced (P b 0.05) serum concentrations of LH, FSH, and testosterone. Reduced testosterone abrogated its inhibitor feedback effect on the synthesis of GnRH in spleen, as evidenced by increased (P b 0.05) protein content and mRNA expressions of GnRH, and simultaneously decreased (P b 0.05) mRNA expressions of androgen receptor in spleen. In parallel with the increased GnRH production in spleen, the mRNA expressions of interleukin (IL)-2, IL-4, IL-6 and tumor necrosis factor alpha (TNF-α) as well as lymphocyte marker CD4, CD8 and CD19 molecules were increased (P b 0.05) in spleen. Consistently, serum concentrations of IL-2, IL-4, IL-6, TNF-α were increased (P b 0.05) in rams following immunization. Similarly, deprivation of testosterone by surgical castration also increased (P b 0.05) GnRH and thus immune cytokine expressions in spleen. Collectively, our data suggested that immunocastration increased GnRH production in spleen by abrogating the inhibitory feedback effects from testosterone, consequently improving the immune markers of spleen and serum immune cytokines in rams. © 2016 Elsevier B.V. All rights reserved.

1. Introduction A number of observations support the concept that there exists an important physiological interaction between the hypothalamic-pituitarygonadal (HPG) axis and immune system, and it could be confirmed that hormones secreted by the HPG axis play important roles in the communication and regulation of the cells of the immune system [1]. Among them, sex steroids have been intensively investigated and established to play a significant role in the regulation of immune function based on the following facts: i) the immune responses and circulating immune cytokine profiles are altered by gonadectomy and sex steroid hormone replacement [2–4]; ii) Sex steroid receptors, including both androgen and estrogen receptors were observed to be expressed in spleen, thymus and peripheral immune cells [5–7], supporting the roles ⁎ Corresponding author. E-mail address: [email protected] (X. Zeng).

http://dx.doi.org/10.1016/j.intimp.2016.06.011 1567-5769/© 2016 Elsevier B.V. All rights reserved.

of sex steroids in immune system development and modulation; iii) sexual dimorphic immune responses are well established in vertebrates. Females generally exhibit more-robust antibody and cell-mediated immune responses to antigens and, are more likely than male individuals to produce autoreactive antibodies of pathogenic potential [8,9]. The sexual dimorphism of immune functions in vertebrates is believed to be the consequence of sex steroids. Evidence from clinical observations and experimental models has demonstrated that androgens act to inhibit immune responses, whereas estrogens stimulate immune responses [8,9]. GnRH, which is the central master of HPG axis, is also strongly implicated in the development and modulation of immune system [9]. Both GnRH and GnRH receptor were verified to express in spleen, thymus and peripheral lymphocytes [1,10], implicating that GnRH may modulate immune system through endocrine and/or local autocrine/paracrine pathways. Indeed, treatment of human lymphocytes in vitro with GnRH analogues [11] or GnRH antagonist [12], or administration

276

X. Han et al. / International Immunopharmacology 38 (2016) 275–283

of GnRH-deficient mice in vivo with GnRH [13] all indicate that GnRH per se has an immune-stimulatory effect on immune function. Moreover, Studies in mice shown that the effect of GnRH in the modulation of immune function was independent of steroid hormone levels [14]. On the contrary, the immunomodulatory actions of sex steroids on immune system were reported to be mediated via GnRH, as both androgens and estrogens exerted no effects in B lymphocyte immunity in the absence of GnRH [13]. Therefore, it appears that GnRH is the interface between reproductive-neuroendocrine axis and immune system. Active immunization of animals against GnRH (also called immunocastration) neutralizes endogenous GnRH and causes loss of both pituitary LH, FSH and gonadal steroids, and terminates gametogenesis, which has been applied as an animal friendly alternative to surgical castrations in animal husbandry [15,16]. In GnRH-immunized animals, the neuroendocrine function of HPG axis is blocked in short or long time [17]. Whether the disrupted neuroendocrine function of HPG axis has an effect on immune system of GnRH-immunized animals is largely unknown. Most recently, using a rat model, two studies have focused on the effects of immunocastration on the interaction between HPG axis and thymus [18,19]. However, as for the largest secondary and most important immune organ, spleen, which contains about one-fourth of the body's lymphocytes and initiates immune responses to bloodborne antigens [20], currently there are no reports of the effects of immunocastration on the interaction between HPG axis and spleen. Tibetan sheep farming is the most important animal husbandry in Tibetan plateau, contributing to the majority of meat and leather related income. During farming, Tibetan rams are usually castrated to reduce aggressive behaviors, control unwanted breeding, assist in fattening and avoid meat taint. Undesirably, surgical castration causes health problems and production setbacks, and most importantly some Tibetan farmers refuse to surgically castrate animals due to religious beliefs. Therefore, there is an urgent need for alternative methods. Accordingly, we conducted GnRH vaccination researches in Tibetan rams and demonstrated that immunocastration could as an effective alternative to surgical castration for Tibetan rams [15]. However, Tibetan plateau possesses an extremely harsh natural environment which has profound effects on animal survival [21]. Moreover, there is very limited access to medical care. Therefore, before its massive practical applications, further evaluations on its effects on immune function should be conducted. Accordingly, the present study was aimed to explore whether reproductive hormones participate in the bidirectional regulation of reproduction and splenic immune function in Tibetan rams. Specifically, we quantified gene expressions of GnRH, reproductive hormone receptors, immune cell-specific marker molecules and immune cytokines in spleen as well as serum concentrations of immune cytokines, so as to clarify the effects of immunocastration on immune function of Tibetan rams.

2.2. Sampling Blood samples (5 mL) were taken from the anterior vena cava vein on the first day of the study and every 1-month thereafter until the end of the study. Blood samples were centrifuged at 2000 × g for 15 min at 4 °C and sera stored at −20 °C pending analyses of antibody, hormone and immune cytokine concentrations. At the age of 10 months (i.e., 4 months after the primary vaccination), all rams were slaughtered. Both testes were excised, weighed as a pair after the removal of the epididymides, and then length and width were measured with vernier calipers. Testis volume was calculated [v = 4π (width / 2)2 (length / 2) / 4] and recorded as an average of both testes. The hypothalamus and spleen were removed immediately after slaughter. Hypothalamic arcuate nucleus (ARC) and preoptic area (POA) were cut and dissected out as previously described [23]. Briefly, after collecting median eminence, hypothalamus blocks were cut into three coronal slices (4 mm thick) using external landmarks on the base of the brain. The most rostral slice contained the POA and the caudal slice encompassed the ARC were collected. Hypothalamic ARC, POA, median eminence and spleen were frozen immediately in liquid nitrogen after collection and then stored at −80 °C pending further use. 2.3. Serum anti-GnRH antibody titers Serum anti-GnRH titers were determined by an RIA as our previous descriptions [15]. Namely, GnRH was labeled with 125I using the chloramine T method. Mouse anti-sheep gamma globulin was used as the second antibody (1:20 dilution). Antibody titers were expressed as percentage binding of 125I-GnRH at 1:1000 dilution of serum. 2.4. Serum reproductive hormone profiles Serum testosterone, LH and FSH concentrations were assayed exactly as our previously described [15]. Serum 17β-estradiol concentrations were determined using commercial kits for sheep (ELISA), according to the manufacturer's instructions (Cusabio Biotech CO., Ltd., Wuhan, China). Briefly, the microtiter plate has been pre-coated with goatanti-rabbit antibodies. Standards and samples (50 μL) were incubated together with antibody specific for 17β-estradiol, and horseradish peroxidase (HRP)-conjugated 17β-estradiol at 37 °C for 1 h. Thereafter, wells were decanted and washed five times with washing buffer. A substrate (3, 3′, 5, 5′-tetramethylbenzidine,TMB) for HRP enzyme was then added to the wells and plates were incubated for an additional 15 min before the reaction was stopped with sulfuric acid (2 M) and absorbance read at 450 nm with an ELISA plate reader (Tecan Sunrise, Tecan, Switzerland). The amount of 17β-estradiol was determined using a standard curve relating the intensity of the color (OD) to standards. All samples were measured in duplicate. The detection limit for 17β-estradiol was 40 pg/mL, with intra- and inter-assay CVs b 15%. 2.5. Serum immune cytokine profiles

2. Materials and methods 2.1. Animals and immunization regime A total of 40 healthy Tibetan rams were selected from flocks in Tibet Academy of Agricultural and Animal Husbandry pasture at age about 6 months, with average body weight of 17.05 ± 1.93 kg. 13 of rams were actively immunized against GnRH with a GnRH vaccine reported early [22], at age of 6 months followed by a booster vaccination 2 months later. Each vaccination, the vaccine (2 mL) was given subcutaneous at two sites in the neck. Whereas 14 intact males and 13 castrated rams (surgically castrated 2 weeks before the start of the experiment) were used as controls. All rams were slaughtered at age of 10 months. All procedures involving rams were approved by the Sichuan Agricultural University Animal Care and Use Committee.

Serum concentrations of interleukin (IL) -2, IL-4, IL-6, tumor necrosis factor alpha (TNF-α) and interferon gamma (IFN-γ) were determined using commercial kits for sheep (ELISA), according to the manufacturer's instructions (Cusabio Biotech CO., Ltd., Wuhan, China). Briefly, aliquot of sera was pipetted into plates pre-coated with target cytokine-specific antibodies. Following incubation, wells were decanted and washed with washing buffer. Then a biotin-conjugated antibody specific to target cytokines was added to the wells. After washing, biotin-conjugated HRP was added to the wells. Following incubation and washing, a substrate (TMB) for HRP enzyme was added to the wells. The plates were incubated for an additional 15 min before the reaction was stopped with sulfuric acid (2 M) and absorbance was read at 450 nm with an ELISA plate reader (Tecan Sunrise, Tecan, Switzerland). The amount of cytokine was determined using a standard curve relating

X. Han et al. / International Immunopharmacology 38 (2016) 275–283

the intensity of the color (OD) to the concentration of standards. All samples were measured in duplicate, the mean value was used in all analysis. The sensitivity of the assays for IL-2, IL-4, IL-6, TNF-α and IFN-γ were 7.81 pg/mL, 1.56 pg/mL, 2 pg/mL, 3.125 pg/mL and 2.5 pg/mL, respectively. Intra- and inter-assay CVs for both IL-2 and IL-4 were b8% and 10%, respectively, for IL-6, TNF-α and IFN-γ were b 10%. . 2.6. GnRH content in hypothalamic median eminence and spleen GnRH in the hypothalamic median eminence and spleen was extracted as described previously [24]. Briefly, the hypothalamic median eminence and spleen were homogenized in 0.2 M acetic acid and incubated at 100 °C for 5 min. After cooling on ice, the homogenate was centrifuged at 12, 000 × g for 30 min. The resulting supernatant was collected and assayed using commercial kits for sheep (ELISA), according to the manufacturer's instructions (Cusabio Biotech CO., Ltd., Wuhan, China). The sensitivity of the assays was 16 pg/mL, with both intra- and inter-assay CVs b 15%. All samples measured in duplicate. 2.7. Quantitative analysis of mRNA expressions Total RNA was isolated from the hypothalamic ARC and POA, and spleen using TRIzol reagent (Invitrogen Co., Carlsbad, CA, USA), according to the manufacturer's instructions. Quantitative and qualitative analyses of isolated RNA were assessed from the ratio of absorbance at 260 and 280 nm and agarose gel electrophoresis. First-strand cDNA (40 ng total RNA) was reverse-transcribed using PrimeScript® RT reagent kit with gDNA Eraser (TaKaRa Bio, Co. Ltd., Dalian, China). Then the cDNA was used as template, and quantitative PCR (qPCR) was

277

performed in triplicate on CFX96 Real Time PCR detection system (Bio Rad, Hercules, CA, USA) with SYBR® greenII. All reactions (10 uL) contained the same amount of cDNA, 500 nmol/L each of forward and reverse primers, and 2XSYBR® premix Taq™ (TaKaRa Bio Co. Ltd). The primer sequences of target and reference genes are listed (Table 1). The PCR cycling conditions were: initial denaturation at 95 °C (1 min), following by 40 cycles of denaturation at 95 °C (5 s), annealing at 58.5–61.0 °C (25 s; Table 1) and a final melting curve analysis to monitor purity of the PCR product. The cycle threshold value was analyzed (CFX96 detection system) and transformed to a relative quantity using a standard curve method. Relative gene expression levels were normalized to β-actin. Outcomes were expressed as fold changes relative to average mRNA levels of genes in intact control groups. 2.8. Statistical analyses Data were analyzed with the Statistical Analysis System, Version 9.2 (SAS institute, Cary, NC, USA). Effects of treatment group on testes weight and volume, spleen weight, tissue GnRH concentrations, and gene expression levels in the hypothalamus and spleen were evaluated by one-way ANOVA using a General Linear Models (GLM) procedure. When applicable, multiple comparisons were performed by Duncan's method. Treatment effects on serum concentrations of anti-GnRH antibodies, testosterone, 17β-estradiol, LH, FSH, IL-2, IL-4, IL-6, TNF-α and IFN-γ were analyzed with a MIXED procedure; the model included the fixed effects of treatment, sampling occasion, and their interaction, and the random effect of ram within treatment. As serum analyses were performed repeatedly, sampling occasion was analyzed with a repeated statement in the mixed procedure (using various alternatives for the covariance structure; the model with the smallest Akaike's

Table 1 Primer sequences of body tissue genes. Gene

Genbank accession No.

Primer sequence (5′-3′)

Amplification length (bp)

Annealing temperature (°C)

GnRH

U02517

150

60

GnRH-R

L22215

197

61

AR

XM_004022146

101

60

ER-α

X98010.1

120

61

Kiss-1

JQ716394

GPR54

JQ812137

LH-R

L36329

FSH-R

L36115

CD4

NM_001129902

CD8

XM_004007263.1

CD19

XM_004020862.1

IL-2

AF215687.1

IL-4

NM_001009313.2

IL-6

NM_001009392.1

TNF-α

EF446377.1

IFN-γ

X52640.1

β-actin

U39357

F: TGGAGGAAAGAGAAATGCTAAGA R: AGACTTTCCAGAGCTGCCTTC F: AGCTGCCTCTTCATCATCCC R: GGCGTCCAGCAGACAGTAAA F:AATGAGTACCGCATGCACAA R: AATTCCTGGGGTGTGATTTG F: CTGCACCAGATCCAAGCCAA R: GTAGTTATACACGGCGGGCT F: ATGAACGTGCTGCTTTCCCG R: GCGCCATGTTTTCCAAGGTC F: CTGGTTGGTGCCGCTCTTCT R: ACCGTCCGCATCTGCTTGT F: ATGGTTTCTGCTCACCCAAG R: TCACGTTTCCCATAATGGCT F: CTTGCCAGCTGTTCACAAGA R: CTCATCGAGTTGGTTCCAT F: TCTTGCCGTCAGAGTTCATCCA R: CCTGCGGTGCCAGCATTTA F:CACCCTGAGAAACTTCCGCC R:GGCAAGAAGACAGGCACGAAG F: TCTGCCTGACTTCCCTGGTG R: TGTTTCCGTACTGGCTGTTGG F:CTTGTCTTGCATTGCACTAACTCTT R:TAGCAGCAATGACTTCACTTCTTTC F:CAAAGAACGCAACTGAGAAGGAA R: GCTGAGATTCCTGTCAAGTCCG F:GGATGCTTCCAATCTGGGTTC R: CATGACAGTTTCCTGATTTCCCTC F: GGTAGCCCACGTTGTAGCCA R: CCTGAAGAGGACCTGCGAGTAG F: ATTCAGAGCCAAATTGTCTCCTTC R: GTTTCTCAGAGCTGCCGTTCA F: TCTGGCACCACACCTTCTAC R: GGTCATCTTCTCACGGTTGG

79

59.5

102

60

138

60

190

58.5

122

60

102

60

147

60

100

60

116

60

126

60

160

60

133

61

107

60

GnRH, gonadotropin-releasing hormone; GnRH-R, gonadotropin-releasing hormone receptor; AR, androgen receptor; ER-α, estrogen alpha receptor; kiss-1, kisspetin encoded gene; GPR54, kisspeptin receptor; LH-R, luteinizing hormone receptor; FSH-R, follicle stimulating releasing hormone receptor; CD4, CD4 molecule; CD8, CD8 molecule; CD19, CD19 molecule; IL-2, interleukin 2; IL-4, interleukin 4; IL-6, interleukin 6; TNF-α, tumor necrosis factor; IFN-γ, interferon-γ; β-actin, beta actin.

278

X. Han et al. / International Immunopharmacology 38 (2016) 275–283

structure was Variance Components, whereas for serum IL-6, TNF-α and IFN-γ concentrations, it was heterogeneous autoregressive of order 1. Serum concentrations of anti-GnRH antibodies, testosterone, LH and FSH were log-transformed to normalize their distributions, back-transformed means without further correction were reported. All values were expressed as mean ± SD and statistical significance was defined as P b 0.05. 3. Results 3.1. Antibody titers a–c Bars with different superscripts are different from each other within a time point (P b 0.05). Anti-GnRH antibodies in all 13 immunized animals were nondetectable at the beginning of the study (Fig. 1A). In immunized rams, antibody titers increased sharply after vaccination, differed within 1 month after primary immunization (P b 0.001), and reached a plateau (57.36% binding) at 1 month after the booster immunization, and thereafter remained high until the end of the study. Antibodies were consistently undetectable in intact controls.

3.2. Testes weight, volume and spleen weight at slaughter Compared to control rams, immunization against GnRH reduced testes weight and volume (Table 2). At slaughter, testes in immunized rams were reduced to 71.40 and 71.25% of the weight and volume of controls, respectively (P b 0.01). Both immunization against GnRH and surgical castration tended to increase spleen weight, but there was no significant difference between only two of the three groups (P N 0.05, Table 2). 3.3. Serum reproductive profiles

Fig. 1. Mean (±SD) serum antibody titers (% binding of 125I-GnRH at a 1:1000 dilution, (A), testosterone (B) and 17β-estradiol (C) in rams immunized with 100 μg D-Lys6GnRH tandem dimer conjugated to ovalbumin, in control (n = 14), GnRH-immunized (n = 13) and surgically castrated rams (n = 13). Antibody titer and testosterone were detected by RIA, and 17β-estradiol was detected by ELISA. Arrows indicate primary vaccination and subsequent booster.

Information Criterion [AIC] was chosen]. For serum anti-GnRH antibody, testosterone and LH concentrations, it was autoregressive of order 1; for serum concentrations of 17β-estradiol, IL-2, IL-4, the covariance

Mean serum concentrations of testosterone (Fig. 1B) and 17βestradiol (Fig. 1C) were affected by immunization, time, and their interaction (P b 0.001). For serum concentrations of testosterone and 17β-estradiol, there were no significant differences between intact controls and immunized males before treatment (P N 0.05). Serum concentrations of testosterone and 17β-estradiol in intact male rams both increased (P b 0.05) with age during the first 2 months of the experiment, and then remained relatively high. Compared to intact controls, serum testosterone and 17β-estradiol concentrations in immunized rams were both decreased after the primary immunization, differed (P b 0.01) at 2 months after the primary immunization, and sharply decreased (P b 0.01) after the booster immunization and thereafter remained low until the end of the experiment. Serum concentrations of testosterone and 17β-estradiol in surgical castrates decreased markedly after surgical castration (P b 0.01) and then remained at nearly non-detectable levels throughout the experimental period. Serum LH (Fig. 2A) and of FSH (Fig. 2B) were affected by immunization, time and their interaction (P b 0.001). There were no differences in

Table 2 Testes weight, volume, GnRH content in hypothalamic median eminence and spleen, and spleen weight of rams at slaughter. End points Testes Weight (g) Volume (cm3) GnRH content Hypothalamic median eminence (pg/mg) Spleen (pg/mg) Spleen weight (g)

Intact controls (n = 14)

Immunocastrates (n = 13)

56.80 ± 16.65b 54.60 ± 14.86b

40.55 ± 8.81a 38.90 ± 9.44a

345.94 ± 46.16b 78.78 ± 12.65 a 43.61 ± 1.47

282.36 ± 36.65a 92.29 ± 10.66b 44.84 ± 2.54

GnRH content in hypothalamic median eminence was detected by RIA using tissue homogenate. a–b Within a row, means without a common superscript differed (P b 0.01).

Surgical castrates (n = 13) – – 270.31 ± 29.30a 94.92 ± 7.64b 44.39 ± 2.13

X. Han et al. / International Immunopharmacology 38 (2016) 275–283

279

Fig. 2. Mean (±SD) serum LH (A) and FSH (B) concentrations in control (n = 14), GnRHimmunized (n = 13) and surgically castrated rams (n = 13). LH and FSH were detected by ELISA. Arrows indicate primary vaccination and subsequent booster.

serum LH and FSH concentrations between immunized rams and intact controls on the first day of the experiment (P N 0.01). Compared to intact controls, serum concentrations of LH and FSH in immunized rams were slowly decreased after the primary immunization, and reached statistical difference at 2 months after the primary immunization (P b 0.05). Thereafter, values for both were sharply decreased (P b 0.01) after the booster immunization, and then remained low until the end of the study. In surgical castrates, serum concentrations of both LH and FSH were increased after surgical castration and then remained consistently higher (P b 0.05) than those of intact controls over the experimental period. a–c Bars with different superscripts are different from each other within a time point (P b 0.05).

3.4. Serum cytokine profiles Serum concentrations of IL-2 , IL-4, IL-6 (Fig. 3A, B, C) and TNF-α (Fig. 4A) were affected by immunization, time, and their interaction (P b 0.001). Compared to intact controls, serum concentrations of IL-2, IL-4 and IL-6 in surgically castrated rams were increased (P b 0.05) after castration, and maintained consistently higher than those in intact controls through the whole experimental period (P b 0.05). There were no differences in serum concentrations of IL-2, IL-4, IL-6 and TNF-α at the initial of experiment between intact controls and immunized rams (P N 0.05). However, serum concentrations of the four cytokines in immunized rams were gradually increased (P N 0.05) following the primary immunization, and substantially increased (P b 0.05) after the booster immunization. At slaughter, serum concentrations of the four cytokines in immunized rams were all increased to comparative levels of surgical castrates (P N 0.05). While for serum IFN-γ (Fig. 4B) profile, it was not affected by either experimental treatment or time, or their interaction (P N 0.05).

Fig. 3. Mean (±SD) serum IL-2 (A), IL-4 (B) and IL-6 (C) concentrations in control (n = 14), GnRH-immunized (n = 13) and surgically castrated rams (n = 13). IL-2, IL-4 and IL-6 were detected by ELISA. Arrows indicate primary vaccination and subsequent booster. a–cBars with different superscripts are different from each other within a time point (P b 0.05).

3.5. GnRH content in hypothalamic median eminence and spleen GnRH content in hypothalamic median eminence and spleen was shown in Table 2. Compared to intact controls (345.94 ± 46.16 pg/mg), GnRH content in hypothalamic median eminence of immunized rams (282.36 ± 36.65 pg/mg) and surgical castrates (270.31 ± 29.30 pg/mg) was substantially decreased at slaughter (P b 0.01). In contrast, GnRH content in spleen of immunized rams (92.29 ± 10.66 pg/mg) and surgical castrates (94.92 ± 7.64 pg/mg) was markedly increased (P b 0.01) at slaughter compared to intact controls (78.78 ± 12.65 pg/mg). While there was no significant difference in GnRH content between immunized and surgically castrated rams in either hypothalamic median eminence or spleen (P N 0.05).

3.6. mRNA expressions The mRNA expressions for reproduction-related genes in the spleen are shown (Fig. 5A). Compared to intact controls, active immunization against GnRH up-regulated (P b 0.05) mRNA expressions of GnRH and GnRH receptor (GnRH-R), but down-regulated (P b 0.05) androgen receptor (AR) in spleen. Consistently, surgical castration also up-regulated

280

X. Han et al. / International Immunopharmacology 38 (2016) 275–283

Fig. 4. Mean (±SD) serum TNF-α (A), and IFN-γ (B) concentrations in control (n = 14), GnRH-immunized (n = 13) and surgically castrated rams (n = 13). TNF-α and IFN-γ were detected by ELISA. Arrows indicate primary vaccination and subsequent booster. a– b Bars with different superscripts are different from each other within a time point (P b 0.05).

(P b 0.05) mRNA expressions of GnRH and GnRH-R, and down-regulated (P b 0.05) AR in the spleen, respectively. However, mRNA expressions of ER-α in spleen were not affected by either immunization or surgical castration (P N 0.05). The mRNA for LH-R and FSH-R in spleen were detected by real-time fluorescent quantitative PCR, their expression levels in three groups were extremely low to below the detectable limit of realtime quantitative PCR. The mRNA expressions for immunity-related genes in the spleen are shown (Fig. 5B). Compared to intact controls, both active immunization against GnRH and surgical castration up-regulated (P b 0.05) mRNA expressions of immune cytokines including IL-2, IL-4, IL-6 and TNF-α, and lymphocyte cell markers CD4, CD8 and B cell marker CD19 in spleen of rams. However, mRNA expressions of IFN-γ in spleen were not affected by either immunization or surgical castration (P N 0.05). To confirm active immunization against GnRH and surgical castration on the synthesis of GnRH in the hypothalamus, mRNA expressions of GnRH synthesis-related genes in the arcuate nucleus (ARC) and preoptic area (POA) of hypothalamus were quantified and shown in Fig. 6A and B. Compared to intact controls, both active immunization against GnRH and surgical castration down-regulated (P b 0.05) mRNA expressions of androgen receptor (AR), estrogen alpha receptor (ERα), kisspeptin encoded gene (kiss-1), kisspeptin receptor (GPR54), and GnRH in POA of the hypothalamus. Similarly, both active immunization against GnRH and surgical castration also down-regulated (P b 0.05) mRNA expressions of these genes in ARC, excepting ER-α in immunized rams. Especially, in ARC, mRNA expressions of kiss-1 and GnRH in immunized rams were lower than in surgically castrated rams (P b 0.05). 4. Discussion The hypothalamic-pituitary-gonadal axis has been reported to be strongly implicated in the modulation of immune system. In the present study, we specifically investigated the effects of immunocastration on

Fig. 5. Mean ± SD effects of active immunization against GnRH on mRNA expression of reproduction-related (A) and immunity-related (B) genes in spleen of control (n = 14), GnRH-immunized (n = 13) and surgically castrated rams (n = 13). GnRH, gonadotropin-releasing hormone;GnRH-R, gonadotropin-releasing hormone receptor; AR, androgen receptor; ER-α, estrogen alpha receptor; CD4, CD4 molecule; CD8, CD8 molecule; CD19, CD19 molecule; IL-2, interleukin 2; IL-4, interleukin 4; IL-6, interleukin 6; TNF-α, tumor necrosis factor; IFN-γ, interferon-γ. a–cMeans without a common superscript differed (P b 0.05).

the interaction between reproductive-neuroendocrine axis and spleen, and serum immune cytokine profiles. In consistent with previous studies [15,25], active immunization against GnRH of rams in the present study resulted in high antibodies, and resultantly markedly lowered pituitary secretion of LH, FSH, decreased serum levels of testosterone,17βestradiol, LH and FSH, and caused atrophy of testes. Opposite to the changes of serum profiles of reproductive hormones, serum profiles of immune cytokines including IL-2, IL-4, IL-6 and TNF-α, as well as their mRNA expressions in spleen were significantly increased following immunization. Moreover, the mRNA expressions for lymphocyte markers, including T cell marker CD4 and CD8, and B cell marker CD 19 were significantly increased in spleen, also suggesting that B and T cells were increased or activated in spleen by anti-GnRH immunization. Indeed, the spleen weight in immunized rams at slaughter was also tended to be increased compared to that of intact controls. Similarly, surgical castration of rams in the present study also increased the production of these immune cytokines as well as the mRNA expressions of B and T lymphocyte markers in spleen. In coincidence with our results, surgical castration of other male rodent animals, such as goats [26], mice [27,28], siberian hamsters [29] and rats [30] was also reported to increase serum immune cytokine and lymphocyte concentrations, as well as the production of immune cytokines and the proliferation of lymphocyte cells by spleen. The presence of IL-2 is necessary for proliferation and function of T helper, T cytotoxic, B and NK cells [31]. And TNF-α promotes cellular immunity to fight viruses and other intracellular microbes, whereas IL-4 and IL-6 are necessary for the proliferation of B cells and function of humoral immunity [31,32]. The increased production of these immune cytokines suggested that immunocastration and surgical castration could enhance both cell- and humoral-mediated immune functions in rams,

X. Han et al. / International Immunopharmacology 38 (2016) 275–283

Fig. 6. Mean ± SD effects of active immunization against GnRH on mRNA expression of GnRH synthesis associated genes in hypothalamic arcuate nucleus (ARC, A) and preoptic area (POA, B) of control (n = 14), GnRH-immunized (n = 13) and surgically castrated rams (n = 13). AR, androgen receptor; ER-α, estrogen alpha receptor; GnRH, gonadotropin-releasing hormone;GnRH-R, gonadotropin-releasing hormone receptor; kiss-1, kisspeptin encoded gene; GPR54, kisspeptin receptor. a–cMeans without a common superscript differed (P b 0.05).

as suggested previously [28]. Given the consistent changes in immune parameters of spleen between immunocastrated males and surgical castrates, it seemed that the enhanced splenic lymphocyte proliferation/activation and immune cytokine production in rams caused by immunocastration, were associated with the deprivation of sex steroids. Indeed, evidence from clinical observations and experimental models has demonstrated that sex steroids play important roles in the modulation of immune function; specifically in males, testosterone acts to inhibit lymphocyte cell proliferation and immune cytokine production [3,8]. In the present study, the protein content and mRNA expressions of GnRH as well as mRNA expressions of GnRH receptor in the spleen were significantly increased following immunization, implicating GnRH synthesis and GnRH/GnRH receptor signaling pathways were significantly increased in spleen by immunocastration. To our knowledge, this was the first report that immunocastration increased GnRH and GnRH receptor expressions in spleen. In agreement with our results, studies in male rats also reported that immunocastration increased GnRH concentrations and GnRH receptor mRNA expressions in another important immune organ, thymus [18]. Besides, the increased production of immune cytokines as well as B and T lymphocyte markers in the spleen of surgically castrated rams were also parallel with the increased GnRH and GnRH receptor expression in spleen. GnRH exerts a stimulatory action on immune function; in rodents it has been demonstrated that GnRH exerts stimulatory effects on cytokine production, on B and T lymphocyte proliferation and serum IgG levels [13,33]. Accordingly, we inferred that the increased production of immune cytokines as well as B and T lymphocyte proliferation/activation in spleen was directly associated with the increased GnRH production in spleen; whereas the effects of sex steroids on spleen immune function were possibly

281

indirect and mediated by their feedback effects on GnRH expression in spleen. In support of our speculation, studies in male mice reported that sex steroids exerted no effects on lymphocyte immunity in the deficiency of GnRH [13]. It is well known that GnRH synthesis in the hypothalamus is extremely sensitive to the feedback regulation of sex steroids. As both androgen and estrogen receptor were verified to be expressed in spleen [5–7], thus it is possible that sex steroids also operate feedback regulation on GnRH synthesis in spleen. In the present study, the mRNA expressions of AR in spleen were substantially decreased in both immunocastrated and surgically castrated rams. Consistently, the increased expressions of GnRH and GnRH receptor in thymus of rats caused by immunocastration, were also concomitant with the reduced protein concentrations and mRNAs of AR in thymus [18]. Moreover, previous studies have demonstrated that androgens act to suppress GnRH synthesis in immune cells [34], and elimination of such suppressive effects from androgens by surgical castration could stimulate GnRH synthesis in immune cells [10]. Therefore, we suggested that reduced expressions of androgen receptor together with the depleted androgens abolished their inhibitory effects on GnRH synthesis in spleen, consequently resulting in increased GnRH synthesis in spleen. Opposite to androgens, estrogens in rodents were reported to increase GnRH and GnRH receptor expression in spleen [35] and exert a stimulative effect on immune function [8]. In the present study, we found that the mRNA expressions of estrogen alpha receptor (ER-α) in spleen were not changed by either immunocastration or surgical castration, suggesting that ER-α gene expression in spleen seemed not to be affected by sex steroids. Previous studies indicate that there is a multiple promoter system that controls ER-α gene expression in a tissue-specific manner [36]. Therefore, it is possible that ER-α gene in spleen utilizes a distinct promoter which is not been affected by sex steroids. Additionally, 17β-estradiol per se was very low in peripheral circulation in males and was further substantially reduced after immunocastration. Finally and most importantly, in males, it is testosterone that plays a major role as sex hormones. Therefore, it seemed that 17β-estradiol might play little roles in regulating GnRH synthesis as well as the immune function of spleen in male animals (at least in rams). Taken together, our results suggested that deprivation of sex steroids (mainly testosterone) by immunocastration in rams increased GnRH/GnRH receptor singling pathways in spleen, which ultimately enhanced its immune function. GnRH is mainly synthesized and released from the hypothalamus. Therefore, the source of GnRH from the hypothalamus may affect the immune function of spleen through endocrine pathways. Moreover, GnRH released from the hypothalamus in immunocastrated males would be neutralized by GnRH specific antibodies regardless of the increase or decrease of its production by the hypothalamus, whereas it is totally different in the surgically castrated counterparts. Given those, we determined GnRH synthesis in the hypothalamus. In consistent with our previous studies [24,37] and others [19,38] in rats, both immunocastration and surgical castration significantly reduced GnRH synthesis in the hypothalamus of rams, as both mRNA expressions of GnRH in the hypothalamus ARC and POA, as well as GnRH content in hypothalamic median eminence were markedly decreased. Reduced GnRH production from the hypothalamus would result in reduced immune functions if it could modulate immune system through endocrine pathways. However, the reduced GnRH from the hypothalamus would not as expected to reduce serum immune cytokine concentrations as well as spleen immune markers in either immunocastrated rams or surgically castrated males. Furthermore, GnRH concentrations per se are low in the portal system and are further diluted and metabolized in peripheral circulation [39]. Therefore, it appeared to be unlikely that GnRH released from the hypothalamus could exert a significant action in extra pituitary sites, especially in the situation of reduced GnRH production from the hypothalamus. Taken together, we suggested that the enhanced immune function in spleen as well as immune cytokines in serum was mainly associated with GnRH locally produced in the spleen, acting via autocrine/paracrine pathways.

282

X. Han et al. / International Immunopharmacology 38 (2016) 275–283

Fig 7. Model of how immunological and surgical castration affects immune function of spleen. GnRH plays important roles in the bidirectional regulation of both reproductive and spleen. The production and release of GnRH from the hypothalamus stimulate pituitary to secrete gonadotropins (LH and FSH), which subsequently orchestrate testis to produce steroidal hormones, e.g. testosterone. Excepting in hypothalamus, GnRH is also biosynthesized in spleen. The production of GnRH in both hypothalamus and spleen seems to be regulated by testosterone through feedback mechanisms. In particular, this feedback effect is mediated by kisspeptins (encoded by kiss-1 gene) in hypothalamus. However, somewhat unexpectedly, it seems that the normal synthesis of GnRH in hypothalamus but not in spleen, requires a minimum amount of testosterone. Thus, long-term deficiency of testosterone would decrease GnRH production in hypothalamus but not in spleen. As a result, GnRH production was increased in spleen but reduced in hypothalamus after long-term deficiency of testosterone caused by both immunological and surgical castration. Increased production of GnRH in spleen was associated with the augmented splenic immune cytokine production through autocrine/paracrine methanisms, thus enhancing immune markers of spleen in rams. GnRH, gonadotropin-releasing hormone; GnRH-R, gonadotropin-releasing hormone receptor; AR, androgen receptor; kiss-1, kisspetin encoded gene; IL-2, interleukin 2; IL-4, interleukin 4; IL-6, interleukin 6; TNF-α, tumor necrosis factor.

Interestingly, in the present study GnRH synthesis in the hypothalamus and spleen shown a difference in response to the deficiency of sex steroids. In hypothalamus, GnRH synthesis is mainly controlled by sex steroids via feedback mechanisms [40]. The decreased sex steroids after surgical or immunological castration, therefore, would be expected to increase GnRH synthesis in the hypothalamus. Since that did not occur in the present study, we suggested that the normal synthesis of hypothalamic GnRH possibly requires a minimum concentration of sex steroids. Indeed, it was reported that the removal of sex steroids by surgical castration in adult rats decreased hypothalamic GnRH synthesis, and that this decrease was prevented by exogenous testosterone replacement [38,41]. However, it was noteworthy that a longer interval from surgical castration to testosterone replacement did not restore synthesis of hypothalamic GnRH [41]. Therefore, it appeared that prolonged intervals of steroid deprivation were detrimental, possibly by altering or disrupting certain up-stream networks that control hypothalamic GnRH. Recently, growing literature has demonstrated that GnRH neurons do not contain steroid receptors and the actions of sex steroids on hypothalamic GnRH are mediated by the kisspeptin neurons, which express steroid receptors [40]. In sheep, kisspeptin neurons are mainly distributed in hypothalamic ARC and POA [23,42]. In the present study, the mRNA expressions of kisspeptin (kiss1), kisspeptin receptor (GPR54) and androgen receptor (AR) encoded genes in both ARC and POA, and the mRNA expressions of estrogen alpha receptor (ER-α) in POA were significantly decreased by immunization, as was in agreement with our previous studies in entire hypothalamus of rats [24]. Kisspeptin-GPR54 system has been identified as an up-stream gatekeeper of GnRH signaling in the hypothalamus [40,42]. The downregulation of these gene expressions further supported our speculation that long-term deprivation of sex steroids could alter or disrupt upstream networks that tightly control GnRH synthesis in the hypothalamus. In contrast, in spleen, sex steroids especially androgens seemed to only exert suppressive actions on GnRH synthesis without any

detrimental effects in long-term deprivation of sex steroids. Therefore, the mechanisms of sex steroids in the regulation of GnRH might be tissue-specific. Perhaps, unlike in the hypothalamus, in spleen there are no such complex intermediate factors that mediate the feedback actions of sex steroids in the regulation of GnRH. The exact mechanisms of sex steroids in the regulation of GnRH synthesis in the spleen are unknown and deserve further investigation. With regard to LH and FSH, it appeared that both of them exerted no direct actions on immune function of spleen. Because, we nearly could not detect the expression of either LH receptor or FSH receptor in spleen, using real-time fluorescent quantitative PCR. However, whether LH and FSH can modulate immune system through regulating other factors deserve further investigations. Our results suggest that there exists a compensatory mechanism between reproduction and immunity in Tibetan rams. Possibly, because both reproduction and immunity are energy-demanding processes, energy used for reproduction is now saved to use in immunity. This compensatory mechanism is supposedly important for the survival of animals, especially in hard environmental conditions and hard seasons. In conclusion, our data suggested that active immunization against GnRH increased GnRH/GnRH receptor signaling pathways in spleen by abrogating the inhibitory feedback effects from androgens (especially testosterone), which ultimately resulted in the enhanced immune markers of spleen in rams (Fig. 7). And LH and FSH seemed to have no direct actions in the regulation of immune functions of spleen.

Acknowledgements This work was supported in part by two-side support plan of Sichuan Agricultural University (00770107), Sichuan Agricultural University Excellent Doctoral Dissertation Program (YB2014004), Natural Science Foundation Project of Tibet Science and Technology Department and

X. Han et al. / International Immunopharmacology 38 (2016) 275–283

the Agricultural Science and Technology Innovation Program of China (ASTIP-IAS13). Xingfa Han and Xiaohua Ren contributed equally to this work. References [1] F. Tanriverdi, L.F. Silveira, G.S. MacColl, P.M. Bouloux, The hypothalamic-pituitarygonadal axis: immune function and autoimmunity, J. Endocrinol. 176 (2003) 293–304. [2] Kaushalendra, C. Haldar, Correlation between peripheral melatonin and general immune status of domestic goat, Capra hircus: a seasonal and sex dependent variation, Small Rumin. Res. 107 (2012) 147–156. [3] S. Ghosh, A.K. Singh, C. Haldar, Seasonal modulation of immunity by melatonin and gonadal steroids in a short day breeder goat Capra hircus, Theriogenology 82 (2014) 1121–1130. [4] C.J. Malkin, P.J. Pugh, R.D. Jones, D. Kapoor, K.S. Channer, T.H. Jones, The effect of testosterone replacement on endogenous inflammatory cytokines and lipid profiles in hypogonadal men, J. Clin. Endocrinol. Metab. 89 (2004) 3313–3318. [5] D.A. Dart, J. Waxman, E.O. Aboagye, C.L. Bevan, Visualising androgen receptor activity in male and female mice, PLoS One 8 (2013), e71694. [6] C.L. Butts, Y.L. Jones, J.K. Lim, C.E. Salter, E. Belyavskaya, E.M. Sternberg, Tissue expression of steroid hormone receptors is associated with differential immune responsiveness, Brain Behav. Immun. 25 (2011) 1000–1007. [7] T.S. Samy, M.G. Schwacha, W.G. Cioffi, K. Bland, I.H. Chaudry, Androgen and estrogen receptors in splenic T lymphocytes: effects of flutamide and trauma-hemorrhage, Shock 14 (2000) 465–470. [8] A. Trigunaite, J. Dimo, T.N. Jørgensen, Suppressive effects of androgens on the immune system, Cell. Immunol. 294 (2015) 87–94. [9] S. Sakiani, N.J. Olsen, W.J. Kovacs, Gonadal steroids and humoral immunity, Nat. Rev. Endocrinol. 9 (2013) 56–62. [10] N. Azad, N.V. Emanuele, M.M. Halloran, J. Tentler, M.R. Kelley, Presence of luteinizing hormone-releasing hormone (LHRH) mRNA in rat spleen lymphocytes, Endocrinology 128 (1991) 1679–1681. [11] S.N. Umathe, P.V. Dixit, M.M. Wanjari, M.P. Ullewar, Leuprolide–a GnRH agonist– prevents restraint stress-induced immunosuppression via sex steroid-independent peripheral mechanism in mice, Int. Immunopharmacol. 8 (2008) 71–79. [12] F. Tanriverdi, D. Gonzalez-Martinez, L.F. Silveira, Y. Hu, G.S. Maccoll, P. Travers, et al., Expression of gonadotropin-releasing hormone type-I (GnRH-I) and type-II (GnRHII) in human peripheral blood mononuclear cells (PMBCs) and regulation of Blymphoblastoid cell proliferation by GnRH-I and GnRH-II, Exp. Clin. Endocrinol. Diabetes 112 (2004) 587–594. [13] J.D. Jacobson, M.A. Ansari, Immunomodulatory actions of gonadal steroids may be mediated by gonadotropin-releasing hormone, Endocrinology 145 (2004) 330–336. [14] L.V. Rao, R.P. Cleveland, R.J. Kimmel, K.M. Ataya, Gonadotropin-releasing hormone agonist influences absolute levels of lymphocyte subsets in vivo in male mice, Immunol. Cell Biol. 74 (1996) 134–143. [15] X. Han, L. Gu, C. Xia, J. Feng, X. Cao, X. Du, et al., Effect of immunization against GnRH on hypothalamic and testicular function in rams, Theriogenology 83 (2015) 642–649. [16] C. Brunius, G. Zamaratskaia, K. Andersson, G. Chen, M. Norrby, A. Madej, et al., Early immunocastration of male pigs with Improvac(®) - effect on boar taint, hormones and reproductive organs, Vaccine 29 (2011) 9514–9520. [17] D.L. Thompson, Immunization against GnRH in male species (comparative aspects), Anim. Reprod. Sci. 60-61 (2000) 459–469. [18] S. Su, F. Fang, Y. Liu, Y. Li, C. Ren, Y. Zhang, et al., The compensatory expression of reproductive hormone receptors in the thymus of the male rat following active immunization against GnRH, Gen. Comp. Endocrinol. 185 (2013) 57–66. [19] S. Su, X. Sun, X. Zhou, F. Fang, Y. Li, Effects of GnRH immunization on the reproductive axis and thymulin, J. Endocrinol. 226 (2015) 93–102. [20] M.F. Cesta, Normal structure, function, and histology of the spleen, Toxicol. Pathol. 34 (2006) 455–465.

283

[21] J. Su, Z. Wang, Studies on the population energetics of plateau zokor: average daily metabolic rate and burrowing metabolic rate, Acta. Theriol. Sin. 12 (1992) 200–206. [22] H.B. Oonk, J.A. Turkstra, W.M. Schaaper, J.H. Erkens, M.H. Schuitemaker-de Weerd, A. van Nes, et al., New GnRH-like peptide construct to optimize efficient immunocastration of male pigs by immunoneutralization of GnRH, Vaccine 16 (1998) 1074–1082. [23] M. Bellingham, P.A. Fowler, M.R. Amezaga, S.M. Rhind, C. Cotinot, B. Mandon-Pepin, et al., Exposure to a complex cocktail of environmental endocrine-disrupting compounds disturbs the kisspeptin/GPR54 system in ovine hypothalamus and pituitary gland, Environ. Health Perspect. 117 (2009) 1556–1562. [24] X.F. Han, X.H. Cao, J. Tang, X.G. Du, X.Y. Zeng, Active immunization against GnRH reduces the synthesis of GnRH in male rats, Theriogenology 80 (2013) 1109–1116. [25] O. Gökdal, O. Atay, H. Ulker, S. Kayaardi, M. Kanter, M.D. DeAvila, et al., The effects of immunological castration against GnRH with recombinant OL protein (ovalbuminLHRH-7) on carcass and meat quality characteristics, histological appearance of testes and pituitary gland in Kıvırcık male lambs, Meat Sci. 86 (2010) 692–698. [26] Kaushalendra, C. Haldar, Correlation between peripheral melatonin and general immune status of domestic goat, Capra hircus: a seasonal and sex dependent variation, Small Rumin. Res. 107 (2012) 147–156. [27] J.S. Sutherland, G.L. Goldberg, M.V. Hammett, A.P. Uldrich, S.P. Berzins, T.S. Heng, et al., Activation of thymic regeneration in mice and humans following androgen blockade, J. Immunol. 175 (2005) 2741–2753. [28] S.M. Viselli, S. Stanziale, K. Shults, W.J. Kovacs, N.J. Olsen, Castration alters peripheral immune function in normal male mice, Immunology 84 (1995) 337–342. [29] B.J. Prendergast, S.R. Baillie, F.S. Dhabhar, Gonadal hormone-dependent and -independent regulation of immune function by photoperiod in Siberian hamsters, Am. J. Phys. Regul. Integr. Comp. Phys. 294 (2008) R384–R392. [30] J. Alexander, W.H. Stimson, Sex hormones and the course of parasitic infection, Parasitol. Today 4 (1988) 189–193. [31] A. Bhatia, H.K. Sekhon, G. Kaur, Sex hormones and immune dimorphism, Sci. World J. 2014 (2014) 159150. [32] T.R. Mosmann, H. Cherwinski, M.W. Bond, et al., Two types of murine helper T cell clones I. Definition according to profiles of lymphokine activities and secreted proteins, J. Immunol. 136 (1986) 2348–2356. [33] N. Tarcic, H. Ovadia, D.W. Weiss, J. Weidenfeld, Restraint stress-induced thymic involution and cell apoptosis are dependent on endogenous glucocorticoids, J. Neuroimmunol. 82 (1998) 40–46. [34] N. Azad, N. La Paglia, K.A. Jurgens, L. Kirsteins, N.V. Emanuele, M.R. Kelley, et al., Immunoactivation enhances the concentration of luteinizing hormone-releasing hormone peptide and its gene expression in human peripheral T-lymphocytes, Endocrinology 133 (1993) 215–223. [35] B. Marchetti, F. Gallo, Z. Farinella, C. Tirolo, N. Testa, C. Romeo, et al., Luteinizing hormone-releasing hormone is a primary signaling molecule in the neuroimmune network, Ann. N. Y. Acad. Sci. 840 (1998) 205–248. [36] X. Liu, H1. Shi, Regulation of estrogen receptor α expression in the hypothalamus by sex steroids: implication in the regulation of energy homeostasis, Int. J. Endocrinol. 2015 (2015) 949085. [37] X.F. Han, J.L. Li, X.H. Cao, X.G. Du, F.Y. Meng, X.Y. Zeng, Surgical castration but not immuncastration is associated with reduced hypothalamic GnIH and GHRH/GH/ IGF-I axis function in male rats, Theriogenology (2016) (in press). [38] S.H. Shin, C. Howitt, J.V. Milligan, A paradoxical castration effect on LH-RH levels in male rat hypothalamus and serum, Life Sci. 14 (1974) 2491–2496. [39] S.C. Sealfon, S.C. Laws, J.C. Wu, B. Gillo, W.L. Miller, Hormonal regulation of gonadotropin-releasing hormone receptors and messenger RNA activity in ovine pituitary culture, Mol. Endocrinol. 4 (1990) 1980–1987. [40] D.1. García-Galiano, L. Pinilla, M. Tena-Sempere, Sex steroids and the control of the Kiss1 system: developmental roles and major regulatory actions, J. Neuroendocrinol. 24 (2012) 22–33. [41] P.S. Kalra, Stimulation of hypothalamic LHRH levels and release by gonadal steroids, J. Ster. Biochem. 23 (1985) 725–731. [42] J.T. Smith, Sex steroid control of hypothalamic Kiss1 expression in sheep and rodents: comparative aspects, Peptides 30 (2009) 94–102.