Physiological response and transcription profiling analysis reveal the role of glutathione in H2S-induced chilling stress tolerance of cucumber seedlings

Journal Pre-proof Physiological Response and Transcription Profiling Analysis Reveal the Role of Glutathione in H2 S-induced Chilling Stress Tolerance of Cucumber Seedlings Fengjiao Liu, Xiaowei Zhang, Bingbing Cai, Dongyun Pan, Xin Fu, Huangai Bi, Xizhen Ai

PII:

S0168-9452(19)31536-5

DOI:

https://doi.org/10.1016/j.plantsci.2019.110363

Reference:

PSL 110363

To appear in:

Plant Science

Received Date:

5 November 2019

Revised Date:

25 November 2019

Accepted Date:

27 November 2019

Please cite this article as: Liu F, Zhang X, Cai B, Pan D, Fu X, Bi H, Ai X, Physiological Response and Transcription Profiling Analysis Reveal the Role of Glutathione in H2 S-induced Chilling Stress Tolerance of Cucumber Seedlings, Plant Science (2019), doi: https://doi.org/10.1016/j.plantsci.2019.110363

This is a PDF file of an article that has undergone enhancements after acceptance, such as the addition of a cover page and metadata, and formatting for readability, but it is not yet the definitive version of record. This version will undergo additional copyediting, typesetting and review before it is published in its final form, but we are providing this version to give early visibility of the article. Please note that, during the production process, errors may be discovered which could affect the content, and all legal disclaimers that apply to the journal pertain. © 2019 Published by Elsevier.

Physiological Response and Transcription Profiling Analysis Reveal the Role of Glutathione in H2S-induced Chilling Stress Tolerance of Cucumber Seedlings Fengjiao Liu, Xiaowei Zhang, Bingbing Cai, Dongyun Pan, Xin Fu, Huangai Bi*, Xizhen Ai* State Key Laboratory of Crop Biology/key laboratory of crop biology and genetic improvement of horticultural crops in huanghuai region/College of Horticulture Science and Engineering, Shandong Agricultural University, Tai’an, Shandong, 271018, P. R. China

ro of

Fengjiao Liu: [email protected] Xiaowei Zhang: [email protected]

-p

Bingbing Cai: [email protected]

Xin Fu: [email protected]

Xizhen Ai: [email protected] author.

na

*Corresponding

lP

Huangai Bi: [email protected]

re

Dongyun Pan: [email protected]

E-mail addresses: [email protected], (H. Bi), [email protected] (X. Ai).

ur

The two corresponding authors have contributed equally to this work.

Jo

Highlights 

Exogenous hydrogen sulfide (H2S) and reduced glutathione (GSH) significantly increased the chilling tolerance of cucumber seedlings.



GSH acts as a downstream signal of H2S-induced cucumber tolerance to chilling stress via regulating photosynthesis.



The transcriptome analysis showed that H2S could stimulate the mRNA level of key genes involved in glutathione metabolism under chilling stress.

Abstract Recent reports have uncovered the multifunctional role of H2S in the physiological response of plants to biotic and abiotic stress. Here, we studied whether NaHS (H2S donor) pretreatment could provoke the tolerance of cucumber (Cucumis sativus L.) seedlings subsequently exposed to chilling stress and whether glutathione was involved in this process. Results showed that cucumber seedlings sprayed with NaHS exhibited remarkably increased chilling tolerance, as evidenced by the observed plant tolerant phenotype, as well as the lower levels of electrolyte leakage (EL), malondialdehyde (MDA) content, hydrogen peroxide

ro of

(H2O2) content and RBOH mRNA abundance, compared with the control plants. In addition, NaHS treatment increased the endogenous content of the reduced glutathione (GSH) and the ratio of reduced / oxidized glutathione (GSH/GSSG), meanwhile, the higher net photosynthetic rate (Anet), the light-saturated CO2 assimilation rate (Asat), the photochemical

-p

efficiency (Fv/Fm) and the maximum photochemical efficiency of PSII in darkness (φPSII) as well as the mRNA levels and activities of the key photosynthetic enzymes (Rubisco, TK,

re

SBPase and FBAase) were observed in NaHS-treated seedlings under chilling stress, whereas this effect of NaHS was weakened by buthionine sulfoximine (BSO, an inhibitor of

lP

glutathione ) or 6-Aminonicotinamide (6-AN, a specific pentose inhibitor and thus inhibits the NADPH production), which preliminarily proved the interaction between H2S and GSH. Moreover, transcription profiling analysis revealed that the GSH-associated genes (GST Tau,

na

MAAI, APX, GR, GS and MDHAR) were significantly up-regulated in NaHS-treated cucumber seedlings, compared to the H2O-treated seedlings under chilling stress. Thus, novel results highlight the importance of glutathione as a downstream signal of H2S-induced plant

Jo

ur

tolerance to chilling stress.

Keywords: Chilling tolerance; Cucumber; Glutathione; Hydrogen sulfide; Signal

1. Introduction Hydrogen sulfide (H2S) is regarded as the third gas transmitter after nitric oxide (NO) and carbon monoxide (CO) [1-4]. In mammalian, H2S, catalyzed by cystathionine

gamma-lyase (CSE; EC4.4.1.1), has been proved to participate in regulating the neural activity, brain development, heart protection, vascular reconstruction and various pathophysiological changes. And during recent years, many studies also indicated that H2S was involved in the regulation of plant growth as well as the response to abiotic stresses, such as chilling [5-6], heat [7], drought [8], salt [9], heavy metal [10] etc. Moreover, H2S has been reported to interact with NO [11,12], Ca2+ [7], plant hormones abscisic acid (ABA) [8,13], indole-3-acetic acid (IAA) [14], and salicylic acid (SA) [15] when it plays its active role as a signal molecule in plants. Chilling stress often occurred, which lead to the decrease of quality

ro of

and yield of cold-sensitive plant species [16-18]. Exogenous H2S promoted the chilling tolerance of Vitis vinifera L., which was associated with increased superoxide dismutase (SOD) activity and mRNA abundance of ICE1 and CBF3 as well as decreased superoxide anion radical and MDA content [19]. Luo [20] found that the application of NaHS obviously

-p

increased the antioxidant ability and proline content of banana fruit during chilling storage.

re

As we have known, glutathione, a tripeptide (γ-glutamyl-cysteinyl-glycine), is an important antioxidant substance involved in the antioxidant system which can regulate H2O2

lP

content of plants under stress conditions. And it was proved that the reduced/oxidized glutathione (GSH/GSSG) ratio altered the redox state of the cells as a redox signaling in plants to respond to stress [21]. H2S fumigation resulted in a rapid accumulation of

na

water-soluble SH-compounds, and 39% of the possible absorbed H2S was converted into GSH in Spinacia oleracea shoots [22]. Moreover, Kimura [23] indicated that GSH was

ur

involved in H2S-induced oxidative stress tolerance and Xie [24] indicated NaHS increased total glutathione (T-GSH) content and the ratio of GSH/GSSG to delay PCD in wheat

Jo

aleurone layers. Meanwhile, it alleviated the decrease of GSH redox state affected by salt, osmotic and cold stress with levels of GSH being increased and GSSG being reduced [25]. According to the Nernst equation, not just the GSH/GSSG ratio but also the T-GSH helps to dictate the overall redox state of the cell [26]. Therefore, all these papers implied the possible interaction between GSH and H2S in response to various stresses. Cucumber (Cucumis sativus L.) plants routinely encounter chilling intensity (0-12.5 ℃) during the winter production in northern China. The chilling stress breaks the steady-state of

reactive oxygen species (ROS), causes lipid peroxidation, leads to the decrease of photosynthetic capacity, and finally compromises productivity and the quality of any surviving harvest [27,28]. Our previous study found that GSH and H2S participated in the regulation of the chilling stress of cucumber plants [29,30]. However, the physiological and molecular mechanisms of interaction between GSH and H2S during alleviating chilling stress remain unclear. Thus, in this work, we used Illumina sequencing technology to obtain new insight on the cross talk between H2S and GSH and further evidence highlighting the importance of GSH as a downstream signal of H2S-induced plant tolerance to chilling stress.

ro of

2. Materials and methods 2.1. Plant materials, growth condition and treatments

Cucumber (Cucumis sativus L. ‘Jinyou 35’) seeds were soaked in distilled water for 6 h,

-p

and then sowed on four layers of moist filter papers in trays with covers and germinated in dark at 28 °C for 24 h. The germinated seeds were sown in 8-cm diameter plastic pots filled

re

with the sterilized substrate (one plant per pot) in the solar-greenhouse with sunlight during the day (maximum of 800-1000 μmol·m-2·s-1 PFD) and 25-31 ℃/13-21 ℃ day/night

lP

temperature under a 13 h photoperiod.

The seedlings with two leaves were foliar sprayed with 1.0 mM sodium hydrosulfide hydrate (NaHS, an H2S donor), 5 mM reduced glutathione (GSH), 1mM buthionine

na

sulfoximine (BSO, an inhibitor of glutathione), 5mM 6-Aminonicotinamide (6-AN, a specific pentose inhibitor and thus inhibits the NADPH production), 1 mM BSO+1mM NaHS, 5 mM

ur

6-AN+1.0 mM NaHS and deionized water (H2O), respectively. 24 h later, half of the H2O treatments were maintained under normal conditions as the control and the other half and all the other seedlings were exposed to low temperatures (5 ℃) for 24 h, then the leaf samples

Jo

were taken from 3 plants (n = 3) for the following analysis. The leaf samples of seedlings treated with H2O, 1mM NaHS and 0.15 mM hypotaurine (HT, a specific scavenger of H2S) were taken from 3 plants (n = 3) for GSH-associated genes verification after 6 h chilling stress. 2.2. Measurement of EL and MDA content EL was conducted following the method described by Dong [29]. MDA content was determined by using the TBA colorimetric method [31].

2.3. Measurement and histochemical detection of H2O2 The H2O2 content was estimated in accordance with the instructions of specified in the H2O2 kit (A064-1, Nanjing Jiancheng Bioengineering Institute of China). According to the previous methods with minor modification [32], endogenous H2O2 was monitored using the H2O2-sensitive fluorescent probe 2’,7’-dichlorofluorescein diacetate (H2DCFDA). The leaf discs of the seedlings were incubated in 20 mM HEPES-NaOH buffer (pH 7.5) containing 25 μmol H2DCFDA for 30 min in dark (25 ℃) and then washed three times (15 min each time) with fresh HEPES buffer before images were visualized. Fluorescent signals were visualized using an inverted microscope with excitation at 488 nm and emission at 522 nm. The

ro of

3,3-diaminobenzidine (DAB) staining for H2O2 was conducted as described by Thordal-Christensen [33] with minor modification. The leaves were soaked in 1 mg·ml-1 DAB for 4 h under dark conditions. After rinsing with distilled water, the leaves were boiled in 90 % (v/v) ethanol at 70 ℃ to remove the pigments, and the H2O2 production was visualized

-p

in the form of reddish-brown coloration. For both staining methods, digital images were obtained via an inverted fluorescence microscope (Leica DMi8, Leica, Germany).

re

2.4. Determination of the glutathione content

The GSH and GSSG contents were determined by test kits (GSH-2-W and GSSG-2-W,

lP

Suzhou KeMing Bioengineering Institute, China). The total glutathione (T-GSH) content was calculated by subtracting GSH content plus GSSG content and then the ratio of GSH/GSSG

na

was calculated.

2.5. Determination of photosynthetic and fluorescence parameters

ur

The net CO2 assimilation rate of the second apical leaves were measured according to the method described previously [34] using a portable photosynthetic system (Ciras-3, PP Systems International, Hitchin, Hertfordshire, UK). Constant PFD (600 μmol·m-2·s-1 for Anet

Jo

and 1000 μmol·m-2·s-1 for Asat) and leaf temperature (25 ± 1 ℃) were maintained throughout all measurements.

At the end of the chilling stress, the whole seedlings with intact leaves for chlorophyll

fluorescence analysis were transferred to dark conditions for 45 min, then photochemical efficiency (Fv/Fm) and maximum photochemical efficiency of PSII in darkness (φPSII) were measured and visualized with a variable chlorophyll fluorescence imaging system (Imaging PAM, Walz) consisting of a CCD camera, LED lights and controlling unit connected to a PC

running a dedicated software (Imaging Win 2.3, Walz) [35]. 2.6. Detection the activities of the photosynthetic enzymes The Rubisco activity was performed as described in the instruction of the Rubisco kit (RUBPS-1-Y, Suzhou KeMing Bioengineering Institute, China). The TK and SBPase activity was determined by the enzyme-linked immunosorbent assay (ELISA) method using a Plant TK and SBPase ELISA Kit (NO.BYE97173 and NO.BYE97204, Shanghai Bangyi Biological Technology, China) according to the manufacturer's instructions. The FBA activity was also determined by the FBA kit (FDA-1-G, Suzhou KeMing Bioengineering Institute, China). The soluble protein content was determined by the BCA protein assay kit (BCAP-1-W, Suzhou

ro of

KeMing Bioengineering Institute, China)) for enzyme activity calculations. 2.7. RNA quantification and qualification

Cucumber seedlings with two leaves pre-treated with H2O and 1 mM NaHS were

-p

sampled for microarray analysis at 6 h after chilling stress. Total RNA for the transcriptome was obtained using Trizol reagent (Invitrogen, Carlsbad, CA, USA) and subsequently used for

re

mRNA purification and library construction with the TruseqTM RNA Sample Prep Kit (Illumina, San Diego, CA, USA) following the manufacturer’s instructions. Samples were

lP

sequenced on an Illumina NovaSeq 6000 (Illumina). Differentially expressed genes were identified using patterns from gene expression, and KOBAS software [36] to test the statistical enrichment of differential expression genes in KEGG pathways.

na

2.8. The Real-time quantitative PCR analysis

Total RNA from cucumber leaves was extracted using an RNA extraction kit (Trizol,

ur

Tiangen, Beijing, China) and reverse transcribed using the PrimeScript® RT Master Mix Perfect Real Time (TaKaRa, Dalian, China). Then the cDNA was used for mRNA abundances

Jo

analysis using the TransStart® TipTop Green qPCR SuperMix (Cwbio, Beijing, China), according to the manufacturer's instructions. The cucumber β-actin gene (Gene ID: Solyc11g005330) was used as an internal reference gene. Amplification was performed on the LightCycler® 480 II system (Roche, Penzberg, Germany). The primers for different genes in this experiment were shown in table 1. 2.9. Availability of supporting data The data discussed in this publication have been deposited in NCBI's Gene Expression

Omnibus and are accessible through SRA accession: PRJNA579777 (https: //www. ncbi. nlm. nih.gov/sra/PRJNA579777). 2.10. Statistical analysis The data are presented as the means ±1 standard deviation (SD) of three replicates. The treatment effects were analyzed using two-way ANOVA (DPS software). Duncan’s multiple range test (DMRT) was applied to compare significant differences between treatments.

3. Results

ro of

3.1. The effects of exogenous NaHS on chilling tolerance of cucumber seedlings Compared to control seedlings under normal temperature, chilling stress resulted in 18%, 38%, 32% and 242% of the increase in EL, MDA content, H2O2 content, and RBOH mRNA abundance, respectively, while exogenous application of NaHS significantly alleviated the

-p

injury of membrane lipid peroxidation (Table 2, Fig.1A). Moreover, the inverted microscope imaging of H2DCFDA (Fig.1B) and the DAB situ detection of H2O2 (Fig.1C) also showed

re

that chilling-induced H2O2 accumulation could be reduced by exogenous NaHS.

under chilling stress

lP

3.2. The effects of exogenous NaHS application on GSH regeneration of cucumber seedlings

As shown in Fig.2, the exogenous application of GSH dramatically increased the

na

endogenous contents of T-GSH, GSH, GSSG and GSH/GSSG ratio under chilling stress. And the T-GSH, GSH contents and the ratio of GSH and GSSG of BSO (an inhibitor of glutathione) and 6-AN (an inhibitor of NADPH production) -pretreated seedlings were

ur

notably lower than those of GSH-pretreated seedlings, suggesting that BSO and 6-AN could inhibit the accumulation of endogenous GSH under chilling stress. Intriguingly, exogenous

Jo

NaHS application also significantly increased the contents of GSH and GSH/GSSG ratio under chilling stress compared with H2O-pretreated seedlings. The positive effect of NaHS in GSH regeneration was depressed considerably by the application of BSO and 6-AN. These data suggest that GSH metabolism may be influenced by NaHS under chilling stress. 3.3. H2S-induced chilling tolerance is sensitive to the removal of GSH To explore whether NaHS-induced chilling tolerance was related to GSH, some chilling-sensitive parameters were further measured after 24 h low temperature stress. As

shown in Fig.3A, chilling caused visible foliar damage such as chlorosis and necrosis in cucumber seedlings. In compared with the H2O, the GSH- or NaHS-pretreated seedlings showed minor damage as evidenced by the unaided visual observations; however, the alleviation effect of NaHS in chilling injury was blocked by BSO and 6-AN. Meanwhile, BSO and 6-AN significantly decreased the scavenging effect to H2O2 of H2S-induced under chilling stress (Fig.3B, C), and RBOH mRNA abundance (Fig.3D) were in agreement with the variation trend of H2O2 content in all treatments under low temperature. Additionally, chilling-stressed plants exhibited significantly higher mRNA expression of ICE, which was one key sensitive gene to chilling, compared with control plants (Fig.3E).

ro of

And the application of NaHS and GSH could further improve low temperature-induced ICE mRNA abundance, whereas BSO and 6-AN significantly inhibited NaHS- induced ICE effect. The preliminary data above implied both exogenous NaHS and GSH promoted chilling tolerance of cucumber seedlings and NaHS-induced chilling tolerance was sensitive to the

-p

removal of GSH.

3.4. Exogenous NaHS and GSH application improved photosynthesis in cucumber seedlings

re

under chilling stress

To test the influence of exogenous NaHS and GSH on photosynthesis and whether GSH

lP

participated in the process of NaHS-regulated photosynthesis under low temperature stress, various photosynthesis-associated parameters were measured in this experiment. The data here showed that the Anet, Asat, Fv/Fm and ФPSII (Fig.4A-F) decreased significantly after 24

na

h chilling stress, while foliar spraying with GSH and NaHS obviously relieved the decrease of photosynthetic rate and photoinhibition caused by chilling. Similarly, we found that BSO and

ur

6-AN inhibited the promotion effect of NaHS on photosynthesis under chilling stress. To further explore the regulating mechanism of NaHS and GSH on photosynthesis

Jo

during chilling stress, we detected the activities of Rubisco, TK, SBPase and FBA as well as their mRNA abundances under low temperature. The results displayed that NaHS- or GSH -pretreated seedlings showed significantly higher activities of Rubisco, TK, SBPase and FBA compared with H2O-pretreated seedlings (Fig.5A-D) under chilling stress and application of BSO and 6-AN markedly repressed NaHS-induced improvement in activities of the key enzymes in Calvin-cycle, implying that NaHS and GSH up-regulated photosynthetic carbon assimilation capacity under chilling stress. GSH was also involved in NaHS-induced positive effect. In addition, the mRNA abundances of rbcL, rbcS, SBPase, TK and FBA in cucumber

seedlings showed a good agreement with the activities of Rubisco, TK, SBPase and FBA respectively, as well as the Anet and Asat under chilling stress (Fig.6A-E). 3.5. Analysis of transcript expression in Cucumber seedling in response to NaHS under low temperature To further confirm the possible signal pathways which were associated with the suppression of chilling-induced injury by NaHS, a microarray platform was used to measure the expression of genes in cucumber seedling sprayed with NaHS and H2O after 6 h low temperature treatment. Compared to H2O-pretreated seedlings, the application of NaHS

ro of

significantly up-regulated 397 genes and down-regulated 607 genes under chilling stress (Fig.7).

Then we mainly focused on the analysis of the up-regulated 397 genes of NaHS treatment, and found that approximately 13.92% of up-regulated genes were associated with

-p

GSH pathways (Fig.8A). Moreover, these up-regulated genes were enriched in 52 metabolic pathways through analyzing the KEGG metabolic pathways. And the significant enrichment

re

pathways (P-value＜0.05) of NaHS up-DEG was the glutathione metabolism compared to H2O-treatment (Fig.8B), which was in accordance with KEGG enrichment results.

lP

3.6. Transcript levels analysis of GSH-associated genes induced by NaHS under chilling stress

na

To further validate our transcriptome results, we chosen some key genes involved in GSH metabolism to quantitative real-time RT-PCR assays. The heat maps (Fig.9A) displayed the change level of GST Tau, MAAI, APX, GR, GS and MDHAR, which was up-regulated in

ur

NaHS-pretreated seedlings (≥1.5 fold), compared with H2O-pretreated seedlings after 6 h chilling stress in our transcriptome data. Then we further tested the mRNA abundance of GST

Jo

Tau, MAAI, APX, GR, GS and MDHAR in H2O-, NaHS- and HT-pretreatment seedlings after 6 h chilling stress with qRT-PCR, showing significantly higher in NaHS- pretreatment and lower or similar in HT-pretreatment, compared to H2O-pretreatment (Fig.9B). The results were highly consistent with the transcriptome data, suggesting confidence in the RNA-Seq data and exploring the downstream role of GSH in H2S-induced chilling tolerance of cucumber seedlings.

4. Discussion

H2S, which was produced from the desulfhydration of L-Cys catalyzed by L-Cys desulfhydrase DES1, that was first identified from Arabidopsis [37-39], is a novel gaseous signaling molecule in plants that regulates plant growth and developmental physiology, induces the cellular antioxidants of enzymatic and non-enzymatic origins to resist various environmental stresses [40]. In this study, we found that exogenous NaHS (H2S donor) notably alleviated chilling-induced injury in cucumber seedlings, as shown by significant lower EL, MDA and H2O2 content as well as the mRNA abundance of RBOH in NaHS-pretreated cucumber seedlings compared the H2O-pretreated seedlings after 24 h-chilling stress, which is similar to our previous results [30].

ro of

There is interaction between different signal molecules when they regulate the complicated physiological metabolism activity of plants. The results from the present investigation suggest that some hormones or signaling molecules are required during H2S exerts its positive effects on stress tolerance. The exogenous H2S application enhanced the

-p

tolerance of plants to oxidative stress throng promoting the activity of antioxidase as well as GSH and AsA content [14,41,42]. Cui [43] also reported that NaHS-mediated reestablishment of GSH homeostasis in Cd-stressed alfalfa seedling roots was also perturbed by BSO, which

re

was confirmed by the significant decreased GSH content and the ratio of GSH/GSSG, respect to Cd alone, indicating a requirement for GSH homeostasis in NaHS-mediated alleviation of

lP

Cd toxicity. Thus, it would be interesting to further test whether exogenous NaHS application spurred the GSH metabolism during chilling stress.

na

Glutathione of plants exists mostly in a reduced form (GSH), and also exists in a small proportion of an oxidized form (GSSG) [44]. Moreover, endogenous GSH level and GSH/GSSG ratio increased obviously under various abiotic stresses [42,29,45]. Furthermore,

ur

glutathione is necessary not only for maintaining the redox balance, but also generally for cell signalling pathways in interaction with other redox systems such as ascorbate or peroxides,

Jo

and other plant hormones, as well as protecting the optical system from oxidative damage [46]. Our data showed that 1.0 mM NaHS significantly improved the GSH content and GSH/GSSG, followed by increasing chilling tolerance of cucumber seedlings (Fig.2,3). NaHS-driven alleviation of ROS accumulation by chilling stress was significantly prevented by the application of γ-GCS inhibitor BSO and NADPH inhibitor 6-AN. Meanwhile, our results displayed that exogenous NaHS and GSH both significantly increased the Anet, Asat, Fv/Fm and ΦPSⅡ (Fig.4), activities and mRNA abundance of the key photosynthetic enzymes, including RuBCase, SBPase, FBA and TK under chilling stress (Fig.5,6), which was in

agreement with previous results [47,30,48], however, the positive effect of NaHS were also blocked by BSO and 6-AN. The statistics above showed exogenous H2S might induce chilling tolerance of cucumber seedlings by promoting glutathione production and maintaining glutathione reduction. To further provide evidence for the relationship between H2S and GSH, we detected the change of transcriptome level in cucumber seedlings pre-treated with H2O and NaHS under chilling stress. Not surprisingly, NaHS significantly up-regulated 397 genes which were mainly enriched in glutathione metabolism, cysteine and methionine metabolism (P-value＜ 0.05) through KEGG analysis (Fig.7,8). Previous studies have shown that enzymes involved

ro of

in the GSH metabolism may have vital roles in plant tolerance to environmental stress [49,50]. Here, especially the mRNA abundance of GST Tau, MAAI, APX, GR, GS and MDHAR involved in GSH metabolism, were significantly up-regulated by NaHS under chilling stress, which was the main reason for increased GSH content and GSH/GSSG ratio in

-p

NaHS-treatment.

re

5. Conclusion

In summary, NaHS significantly increased the chilling tolerance of cucumber seedlings,

lP

as shown by the decrease in stress-induced EL, MDA and H2O2 content, as well as the increase in photosynthetic carbon assimilation. Even more important, our results first demonstrated that H2S suppressed chilling injury of cucumber seedlings through cross-talk

na

with or directly regulating GSH metabolic pathway by stimulating the key genes mRNA level in GSH metabolism under low temperature stress.

ur

Author contributions

Fengjiao Liu performed most part of the experiment, analyzed the data and completed

Jo

the first draft. Xizhen Ai and Huangai Bi designed this work and edited the manuscript. Xiaowei Zhang, Bingbing Cai, Dongyun Pan and Xin Fu participated in this paper with Fengjiao Liu.

Funding information This work was supported by the National Science Foundation of China (31572170); Modern Agricultural Industry Technology System Construction Special Foundation of

Shandong Province (Contract No.SDAIT-05-10).

Conflict of interest

Jo

ur

na

lP

re

-p

ro of

All authors declare that they have no conflict of interest.

References [1] C. García-Mata, L. Lamattina, Hydrogen sulphide, a novel gasotransmitter involved in guard cell signalling, New Phytol. 188 (2010) 977-984. [2] M. Kajimura, R. Fukuda, R.M. Bateman, T. Yamamoto, M. Suematsu, Interactions of multiple gas-transducing systems: hallmarks and uncertainties of CO, NO, and H2S gas biology, Antioxid. Redox Sign. 13 (2010) 157-192. [3] B.H. Tan, P.T. Wong, J.S. Bian, Hydrogen sulfide: A novel signaling molecule in the central nervous system, Neurochem. Int. 56 (2010) 3-10.

ro of

[4] D. Li, L. Li, Z.W. Ge, J. Limwachiranon, Z.J. Ban, D.M. Yang, Z.S. Luo, Effects of hydrogen sulfide on yellowing and energy metabolism in broccoli, Postharvest Biol. Tec. 129 (2017) 136-142.

[5] L. Ma, L.M. Yang, J.J. Zhao, J.J. Wei, X.X. Kong, C.T. Wang, X.M. Zhang, Y.P. Yang, Comparative proteomic analysis reveals the role of hydrogen sulfide in the adaptation of the alpine plant

-p

Lamiophlomis rotata to altitude gradient in the Northern Tibetan Plateau, Planta 241 (2015) 887-906. [6] D. Li, J. Limwachiranon, L. Li, R.X. Du, Z.S. Luo, Involvement of energy metabolism to chilling

re

tolerance induced by hydrogen sulfide in cold-stored banana fruit, Food Chem. 208 (2016) 272-278. [7] Z.G. Li, M. Gong, H. Xie, L. Yang, J. Li, Hydrogen sulfide donor sodium hydrosulfide-induced heat tolerance in tobacco (Nicotiana tabacum L.) suspension cultured cells and involvement of Ca2+ and

lP

calmodulin, Plant Sci. 185-186 (2012) 185-189.

[8] Z.P. Jin, S.W. Xue, Y.A. Luo, B.H. Tian, H.H. Fang, H. Li, Y.X. Pei, Hydrogen sulfide interacting with

62 (2013) 41-46.

na

abscisic acid in stomatal regulation responses to drought stress in Arabidopsis, Plant Physiol. Bioch.

[9] Y.Q. Wang, L. Li, W.T. Cui, S. Xu, W.B. Shen, R. Wang, Hydrogen sulfide enhances alfalfa (Medicago

ur

sativa) tolerance against salinity during seed germination by nitric oxide pathway, Plant Soil. 351 (2012) 107-119.

[10] H.Y. He, Y.Q. Li, L.F. He, The central role of hydrogen sulfide in plant responses to toxic metal stress,

Jo

Ecotox. Environ. Safe. 157 (2018) 403-408.

[11] Z.G. Li, S.Z. Yang, W.B. Long, G.X. Yang, Z.Z. Shen, Hydrogen sulphide may be a novel downstream signal molecule in nitric oxide-induced heat tolerance of maize (Zea mays L.) seedlings, Plant Cell Environ. 36 (2013) 1564-1572. [12] S. Singh, V. Kumar, D. Kapoor, S. Kumar, S. Singh, D.S. Dhanjal, S. Datta, J. Samuel, D. Pinaki, S.Q. Wang, R. Prasad, J. Singh, Revealing on hydrogen sulfide and nitric oxide signals co-ordination for plant growth under stress conditions, Physiol. Plant. (2019).

[13] D. Scuffi, C. Álvarez, N. Laspina, C. Gotor, L. Lamattina, C. García-Mata, Hydrogen sulfide generated by l-cysteine desulfhydrase acts upstream of nitric oxide to modulate abscisic acid-dependent stomatal closure, Plant Physiol. 166 (2014) 2065-2076. [14] H. Zhang, J. Tang, X.P. Liu, Y. Wang, W. Yu, W.Y. Peng, F. Fang, D.F. Ma, Z.J. Wei, L.Y. Hu, Hydrogen sulfide promotes root organogenesis in Ipomoea batatas, Salix matsudana and Glycine max, J. Integr. Plant Biol. 51 (2009) 1086-1094. [15] Z.G. Li, L.R. Xie, X.J. Li, Hydrogen sulfide acts as a downstream signal molecule in salicylic acid-induced heat tolerance in maize (Zea mays L.) seedlings, J. Plant Physiol. 177 (2015) 121-127. [16] M.S. Aghdam, Z.S. Luo, A. Jannatizadeh, M. Sheikh-Assadi, Y. Sharafi, B. Farmani, J.R. Fard, F. Razavi, Employing exogenous melatonin applying confers chilling tolerance in tomato fruits by

ro of

upregulating ZAT2/6/12 giving rise to promoting endogenous polyamines, proline, and nitric oxide accumulation by triggering arginine pathway activity, Food Chem. 275 (2019) 549-556.

[17] D. Li, J. Limwachiranon. L. Li, R.X. Du, Z.S. Luo, Involvement of energy metabolism to chilling tolerance induced by hydrogen sulfide in cold-stored banana fruit, Food Chem. 208 (2016) 272-278.

-p

[18] Z.L. Liu, L. Li, Z.S. Luo, F.F. Zeng, L. Jiang, K.C. Tang, Effect of brassinolide on energy status and proline metabolism in postharvest bamboo shoot during chilling stress, Postharvest Biol. Tec. 111

re

(2016) 240-246.

[19] P.N. Fu, W.J. Wang, L.X. Hou, X. Liu, Hydrogen sulfide is involved in the chilling stress response in

lP

Vitis vinifera L, Acta Soc. Bot. Pol. 82 (2013) 295-302.

[20] Z.S. Luo, D.D. Li, R.X. Du, W.S. Mou, Hydrogen sulfide alleviates chilling injury of banana fruit by enhanced antioxidant system and proline content, Sci. Hortic. 183 (2015) 144-151.

na

[21] G. Kocsy, G. Galiba, C. Brunold, Role of glutathione in adaptation and signalling during chilling and cold acclimation in plants, Physiol. Plantarum 113 (2001) 158-164.

ur

[22] L.J.D. Kok, W. Bosma, F.M. Maas, P.J.C. Kuiper, The effect of short-term H2S fumigation on water -soluble sulphydryl and glutathione levels in spinach, Plant Cell Environ. 8 (1985) 189-194.

Jo

[23] Y. Kimura, Y.I. Goto, H. Kimura, Hydrogen sulfide increases glutathione production and suppresses oxidative stress in mitochondria, Antioxid. Redox Sign. 12 (2010) 1-13.

[24] Y.J. Xie, C. Zhang, D.W. Lai, Y. Sun, M.K. Samma, J. Zhang, W.B. Shen, Hydrogen sulfide delays GA-triggered programmed cell death in wheat aleurone layers by the modulation of glutathione homeostasis and heme oxygenase-1 expression, J. Plant Physiol. 171 (2014) 53-62. [25] H.T. Shi, T.T. Ye, Z.L. Chan, Exogenous application of hydrogen sulfide donor sodium hydrosulfide enhanced multiple abiotic stress tolerance in bermudagrass (Cynodon dactylon (L). Pers.), Plant Physiol. Bioch. 71 (2013) 226-234.

[26] F.Q. Schafer, G.R. Buettner, Redox environment of the cell as viewed through the redox state of the glutathione disulfide/glutathione couple, Free Radical Bio. Med. 30 (2001) 1191-1212. [27] R. Awasthi, K. Bhandari, H. Nayyar, Temperature stress and redox homeostasis in agricultural crops, Front. Environ. Sci. 3 (2015) 11. [28] D.J. Allen, D.R. Ort, Impacts of chilling temperatures on photosynthesis in warm-climate plants. Trends in Plant Sci. 6 (2001) 36-42. [29] X.B. Dong, H.G. Bi, G.X. Wu, X.Z. Ai, Drought-induced chilling tolerance in cucumber involves membrane stabilisation improved by antioxidant system, Int. J. Plant Prod. 7 (2013) 67-80. [30] C.F. Zhou, G.X. Wu, T. Li, H.G. Bi, Q.M. Li, X.Z. Ai, Effect of exogenous hydrogen sulfide on

ro of

photosynthesis and antioxidant system of cucumber leaves under low temperature in solar-greenhouse, Acta Hort. Sinica 43 (2016) 462-472.

[31] H.S. Li, Q. Sun, S.J. Zhao, W.H. Zhang, Principles and techniques of plant physiology and biochemistry experiment, Beijing: Higher Education Press, (2000) 260.

-p

[32] Y.D. Mei, H.T. Chen, W.B. Shen, W. Shen, L.Q. Huang, Hydrogen peroxide is involved in hydrogen sulfide-induced lateral root formation in tomato seedlings. BMC Plant Biol. 17 (2017) 162.

re

[33] H. Thordal-Christensen, Z.G. Zhang, Y.D. Wei, D.B. Collinge, Subcellular localization of H2O2 in plants. H2O2 accumulation in papillae and hypersensitive response during the barley-powdery mildew

lP

interaction, Plant J. 11 (1997) 1187-1194.

[34] H.G. Bi, P.P. Liu, Z.S. Jiang, X.Z. Ai, Overexpression of the rubisco activase gene improves growth and low temperature and weak light tolerance in Cucumis sativus, Physiol. Plantarum 161 (2017)

na

224-234.

[35] Y.L. Tian, P. Ungerer, H.Y. Zhang, A.V. Ruban, Direct impact of the sustained decline in the photosystem II efficiency upon plant productivity at different developmental stages, J. Plant Physiol.

ur

212 (2017) 45-53.

[36] X.Z. Mao, T. Cai, J.G. Olyarchuk, L.P. Wei, Automated genome annotation and pathway identification

Jo

using the KEGG Orthology (KO) as a controlled vocabulary, Bioinformatics 21 (2005) 3787-3793. [37] A. Riemenschneider, V. Nikiforova, R. Hoefgen, L.J.D. Kok, J. Papenbrock, Impact of elevated H2S on metabolite levels, activity of enzymes and expression of genes involved in cysteine metabolism, Plant Physiol. Bioch. 43 (2005a) 473-483.

[38] A. Riemenschneider, R. Wegele, A. Schmidt, J. Papenbrock, Isolation and characterization of a D-cysteine desulfhydrase protein from Arabidopsis thaliana, FEBS J. 272 (2005b) 1291-1304. [39] C. Álvarez, L. Calo, L.C. Romero, I. García, C. Gotor, An O-acetylserine (thiol) lyase homolog with L-cysteine desulfhydrase activity regulates cysteine homeostasis in Arabidopsis, Plant Physiol. 152

(2010) 656-669. [40] A. Banerjee, D.K. Tripathi, A. Roychoudhury, Hydrogen sulphide trapeze: Environmental stress amelioration and phytohormone crosstalk, Plant Physiol. Bioch. 132 (2018) 46-53. [41] H. Zhang, H. Jiao, C.X. Jiang, S.H. Wang, Z.J. Wei, Z.J. Luo, R.L. Jones, Hydrogen sulfide protects soybean seedlings against drought-induced oxidative stress, Acta. Physiol. Plant 32 (2010) 849-857. [42] G.X. Wu, D.D. Li, C.C. Su, S.N. Su, F.J. Liu, H.G. Bi, Hydrogen sulfide interacts with Ca2+ to enhance chilling tolerance of cucumber seedlings, Chin. J. Biochem. Mol. Biol. 33 (2017) 1037-1046. [43] W.T. Cui, H.P. Chen, K.K. Zhu, Q.J. Jin, Y.J. Xie J. Cui, Y. Xia, J. Zhang, W.B. Shen, Cadmium-induced hydrogen sulfide synthesis is involved in cadmium tolerance in Medicago sativa by

ro of

reestablishment of reduced (Homo) glutathione and reactive oxygen species homeostases, Plos one 9 (2014) e109669.

[44] R. Hell, Molecular physiology of plant sulfur metabolism, Planta 202 (1997) 138-148.

[45] M. Fatma, M. Asgher, A. Masood, N.A. Khan, Excess sulfur supplementation improves

-p

photosynthesis and growth in mustard under salt stress through increased production of glutathione, Environ. Exp. Bot. 107 (2014) 55-63.

re

[46] N. Rouhier, D.S. Lemaire, J.P. Jacquot, The role of glutathione in photosynthetic organisms: emerging functions for glutaredoxins and glutathionylation, Annu. Rev. Plant Biol. 59 (2008) 143-166.

lP

[47] L. Li, The protection of GSH to rice leaf from proteins carbonyl and regulation of photosynthesis during leaf growth, Nanjing Agricultural University, 2009. [48] B.B. Duan, The effects of exogenous hydrogen sulfide on rice photosythesis and its protective role

na

under high light stress, Nanjing Agricultural University, 2014. [49] C.H. Zhang, X.M. Yin, K.H. Gao, Y. Ge, W.D. Cheng, Non-protein thiols and glutathione S-transferase alleviate Cd stress and reduce root-to-shoot translocation of Cd in rice, J. Plant Nutr. Soil

ur

Sci. 176 (2013) 626-633.

[50] L. Halusková, K. Valentovicová, J. Huttová, I. Mistrík, L. Tamás, Effect of abiotic stresses on

Jo

glutathione peroxidase and glutathione S-transferase activity in barley root tips, Plant Physiol. Bioch. 47 (2009) 1069-1074.

Figure legends

ur

na

lP

re

-p

ro of

Fig.1 Effects of exogenous NaHS on H2O2 content of cucumber seedlings under chilling stress. (A) The phenotype of the seedling. (B) The inverted microscope imaging of H2DCFDA-dependent fluorescence. (C) DAB staining. Two leaves old seedlings were foliar sprayed with H2O or 1.0 mM NaHS. Then all NaHS- and half of H2O-pretreated seedlings were exposed to 5 ℃ for 24 h. The other half of H2O-pretreated seedlings under normal temperature (25 ℃/18 ℃) were as the control. All values shown are mean ± SD (n = 3).

Jo

Fig.2 Effects of different treatments on glutathione content of cucumber seedlings under chilling stress. (A) T-GSH content. (B) GSH content. (C) GSSG content. (D) GSH/GSSG ratio. Two leaves old seedlings grown in solar-greenhouse were foliar sprayed with H2O, 5 mM GSH, 1.0 mM NaHS, 1mM BSO, 5 mM 6-AN alone or their combinations. After 24 h, the half of H2O-pretreated seedlings under normal temperature (25 ℃/18 ℃) were as the control and all the other seedlings were exposed to 5 ℃ for 24 h. Data are mean values ± SD (n = 3). a, b, c, d and e indicate that the mean values are significantly different among the samples (P<0.05).

Jo

ur

na

lP

re

-p

ro of

Fig.3 Effects of different treatments on H2O2 content, RBOH and ICE mRNA abundance of cucumber seedlings under chilling stress. (A) The phenotype of cucumber seedling. (B) The inverted microscope imaging of H2DCFDA-dependent fluorescence. (C) H2O2 content. (D) RBOH mRNA abundance. (E) ICE mRNA abundance. Two leaves old seedlings grown in solar-greenhouse were foliar sprayed with H2O, 5 mM GSH, 1.0 mM NaHS, 1mM BSO, 5 mM 6-AN alone or their combinations. After 24 h, the half of H2O-pretreated seedlings under normal temperature (25 ℃/18 ℃) were as the control and all the other seedlings were exposed to 5 ℃ for 24 h. Data are mean values ± SD (n = 3). a, b, c, d, e and f indicate that the mean values are significantly different among the samples (P<0.05).

ro of -p re

Jo

ur

na

lP

Fig.4 Effects of different treatments on Anet, Asat, Fv/Fm and ΦPSⅡ of cucumber seedlings under low temperature. (A) Anet. (B) Asat. (C) Fv/Fm based on chlorophyll fluorescence data. (D) ΦPSⅡ based on chlorophyll fluorescence data. In (E, F), the false-color images of the Fv/Fm and ΦPSⅡ. Two leaves old seedlings grown in solar-greenhouse were foliar sprayed with H2O, 5 mM GSH, 1.0 mM NaHS, 1mM BSO, 5 mM 6-AN alone or their combinations. After 24 h, the half of H2O-pretreated seedlings under normal temperature (25 ℃/18 ℃) were as the control and all the other seedlings were exposed to 5 ℃ for 24 h. Data are mean values ± SD (n = 3). a, b, c, d, e and f indicate that the mean values are significantly different among the samples (P<0.05).

na

lP

re

-p

ro of

Fig.5 Effects of different treatments on the RuBPCase (A), TK (B), SBPase (C) and FBA (D) activities of cucumber seedlings. Two leaves old seedlings grown in solar-greenhouse were foliar sprayed with H2O, 5 mM GSH, 1.0 mM NaHS, 1mM BSO, 5 mM 6-AN alone or their combinations. After 24 h, the half of H2O-pretreated seedlings under normal temperature (25 ℃/18 ℃) were as the control and all the other seedlings were exposed to 5 ℃ for 24 h. Data are mean values ± SD (n = 3). a, b, c, d, e, f, g and h indicate that the mean values are significantly different among the samples (P<0.05).

Jo

ur

Fig.6 Effects of different treatments on the rbcL (A), rbcS (B), TK (C), SBPase (D) and FBA (E) mRNA abundance of cucumber seedlings. Two leaves old seedlings grown in solar-greenhouse were foliar sprayed with H2O, 5 mM GSH, 1.0 mM NaHS, 1mM BSO, 5 mM 6-AN alone or their combinations. After 24 h, the half of H2O-pretreated seedlings under normal temperature (25 ℃/18 ℃) were as the control and all the other seedlings were exposed to 5 ℃ for 24 h. Data are mean values ± SD (n = 3).a, b, c, d and e indicate that the mean values are significantly different among the samples (P<0.05).

ro of

ur

na

lP

re

-p

Fig.7 Gene Expression Comparisons. Number of DEGs (P value≤0.01 and fold-change≥2) between NaHS-treated and H2O-treated sample. Two leaves old seedlings grown in solar-greenhouse were foliar sprayed with 1.0 mM NaHS or H2O. After 24 h, the seedlings were exposed to 5 ℃ for 6 h.

Jo

Fig.8 The statistics of pathway classification and enrichment. (A) The up-DEG statistics of KEGG classification of on H2O vs NaHS. The vertical axis was the name of the KEGG pathway. The horizontal axis was the number of genes and the proportion of genes in total annotated genes. (B) The up-DEG statistics of pathway enrichment on H2O vs NaHS. The circle represents gene number of the KEGG pathway. The color of circle represents genes enrichment degree of the KEGG pathway. The figure displayed the top 20 pathways with the most minimum q values. Two leaves old seedlings grown in solar-greenhouse were foliar sprayed with 1.0 mM NaHS, or H2O. After 24 h, the seedlings were exposed to 5 ℃ for 6 h.

Jo

ur

na

lP

re

-p

ro of

Fig.9 Verification of RNA-seq results by qRT-PCR. Expression profiling of a few genes was performed using quantitative real time PCR. The relative abundance (Y-axis) was calculated using ΔΔCt method. (A) Hierarchical clustering analysis of transcriptome data. (B) The GST Tau, MAAI, APX, GR, GS and MDHAR mRNA abundance of cucumber seedlings. Two leaves old seedlings grown in solar-greenhouse were foliar sprayed with 1.0 mM NaHS, 0.15 mM HT or H2O. After 24 h, the seedlings were exposed to 5 ℃ for 6 h. Data are mean values ±  SD (n = 3). a, b and c indicate that the mean values are significantly different among the samples (P<0.05).

ro of

-p

re

lP

na

ur

Jo

Tables Table1 The primer sequences of real-time RT-PCR Primer names

Sequences (5’→3’)

ß-Actin

F: CCACGAAACTACTTACAACTCCATC R: GGGCTGTGATTTCCTTGCTC F: TTGCTGGGAAGAGTGGGT

RBOH

R: GCTCCAATACCAAGACCAAC F: CGCATCGAGTTGGCTCTGGTG

ICE rbcL

F: GCTATGGAATCGAGCCTGTTG

ro of

R: GTCCTCATCGCCGTTCATCTTCC R: CCAAATACATTACCCACAATGGAAG rbcS

F: CGCATTCATCAGGGTTATTGG

R: AAGAGTAGAACTTGGGGCTTGTAGG F: ACGATGAGGTCATGAAG

-p

TK

R: CCAGCAAGATGAAGCAG

F: GTGTCCTCCTCATACTTGGGTTG

re

SBPase

R: GAATGCTGGGAAGAAAGATTGG F: GCAGAGTGAGGAGGAAGCAAC

lP

FBA

R: CCAAACGAGAAAGATAACGACC F: TTGGTGGATGGATGAGTC

GST Tau

na

R: GGGTTTCCGTTGTGAAGA F: TGTGGATGGAGATGTTGTTA

MAAI

R: AGAGGCTGTATGCTTGAAG F: GTTGTTGCTGTGGAGATTAC

ur

APX

R: CATTGAGAACTGTGGAAGGT F: TCTTACACCTGTGGCTCTA

Jo

GR

R: CTTCATTACCGTCTTCTCTTG

MDHAR

F: GTTGTTGCTGTGGAGATTAC

GS

F: AACTATGCTGCTAACCACTT R: CTTGCTCTCCATTCCGATT R: CATTGAGAACTGTGGAAGGT

Table 2 Effects ofexogenous NaHS on Electrolyte leakage, MDA and H2O2 content, RBOH mRNA abundance of cucumber seedlings under chilling stress. Electrolyte

MDA content

H2O2 content

RBOH mRNA

leakage (%)

(nmol·g-1 FW)

( umol·g-1 FW）

Control

43.41 ± 0.79 c

5.91 ± 0.08 c

342.29 ± 8.69 c

1.02 ± 0.22 c

H2O

51.28 ± 1.59 a

8.17 ± 0.14 a

451.16 ± 16.48 a

3.49 ± 0.29 a

NaHS

46.56 ± 0.50 b

7.67 ± 0.06 b

428.07 ±17.84 b

2.15 ± 0.17 b

abundance

ro of

Treatments

Note: Two leaves old seedlings were foliar sprayed with 1.0 mM NaHS or H2O. Then all NaHS- and half of H2O-pretreated seedlings were exposed to 5 ℃ for 24 h. The other half of H2O-pretreated seedlings under normal temperature (25 ℃/18 ℃) were as the control. All

-p

values shown are mean ± SD (n = 3). a, b and c indicate that mean values are significantly

Jo

ur

na

lP

re

different among samples (P<0.05).