Physiological response of Kluyveromyces marxianus during oxidative and osmotic stress

G Model

ARTICLE IN PRESS

PRBI-10959; No. of Pages 9

Process Biochemistry xxx (2017) xxx–xxx

Contents lists available at ScienceDirect

Process Biochemistry journal homepage: www.elsevier.com/locate/procbio

Physiological response of Kluyveromyces marxianus during oxidative and osmotic stress Priyanka Saini, Arun Beniwal, Shilpa Vij ∗ Dairy Microbiology Division, National Dairy Research Institute, Karnal, 132001, India

a r t i c l e

i n f o

Article history: Received 28 November 2016 Received in revised form 7 February 2017 Available online xxx Keywords: Oxidative stress Osmotic stress Kluyveromyces marxianus Lactose Glutathione

a b s t r a c t In industrial fermentations, yeast cells encounter various stresses that affect the cell growth and productivity, and therefore, cells need to respond immediately to the surrounding environment. The present study helps in understanding the response of fermentative Kluyveromyces marxianus toward two stresses found during the fermentation of cheese whey: oxidative stress and osmotic stress. In this article, we demonstrated that K. marxianus cells were more resistant to oxidative and osmotic stress than Saccharomyces cerevisiae strains. Stationary-phase cells of both yeast strains showed more viability and higher glutathione production than cells in the exponential phase. K. marxianus showed high glutathione level (6.8 ± 0.25 ␮g/mg protein) and high intracellular glycerol (2.2 ± 0.14 g/g CDW) in 150 g/L lactose, which then decreased. In addition, expression analysis was performed, and genes involved in glutathione biosynthesis and glycerol synthesis were upregulated in the presence of oxidative and osmotic stress, indicating the effect of stress protectants at the transcriptional level. We also present preliminary data regarding the use of TRX and GSH as molecular markers of oxidative and osmotic stress in K. marxianus. © 2017 Elsevier Ltd. All rights reserved.

1. Introduction Fermentation has been widely used for thousands of years as a successful and economical resource to conserve the quality and safety of foods. In the group of fermenting microorganisms, yeasts are widely used and play a role in both conventional and modern biotechnological processes, e.g., biofuel production. Yeast cells are vigorously exposed to many stresses such as osmotic, oxidative, thermal, ethanol and starvation stress during industrial applications. These stresses impair the strain’s growth and metabolism, which drastically affects ethanol production [1,2]. Therefore, the yeast’s ability to produce ethanol is dependent on the tolerance of a strain to ethanol and temperature and suitable physiological characteristics [3]. The yeast Kluyveromyces marxianus is favored over other yeasts as it possesses characteristics that are advantageous for biotechnology applications including the capacity to assimilate key sugars, namely lactose and inulin; rapid growth rate, with typical generation times of approximately 70 min; and thermotolerance, with the ability to grow in temperatures up to 52 ◦ C [4]. K. marxianus, as a dairy yeast, utilizes lactose as its source of carbon for growth and production of various valuable products such as ethanol, enzymes,

∗ Corresponding author. E-mail address: [email protected] (S. Vij).

and food ingredients [5]. Increase in the concentration of lactose in whey as the substrate will help in increasing the ethanol yield, but higher lactose concentration also presents sugar stress to K. marxianus. Some yeast cells acquire an inherent protective mechanism to control the level of reactive oxygen species (ROS), e.g., antioxidative enzymes such as superoxide dismutase, catalase (CAT), and glutathione reductase (GR) and intracellular nonenzyme molecules such as glutathione (GSH) [6]. GSH, a tripeptide (␥-glutamylcysteinylglycine), was first discovered in the ethanolic extracts of yeast. GSH is important because of the redox-active sulfhydryl moiety of its cysteine residue, which also acts as a free radical scavenger. Therefore, GSH (reduced) is involved in the oxidative stress response by reacting with an oxidative agent such as H2 O2 , resulting in glutathione disulfide GSSG (oxidized form). Intracellular GSH cycles include the interconversion of the reduced (GSH) and the oxidized forms (GSSG), generating a redox couple that examine and regulates the redox status of the cell [7]. GSH plays crucial role in the growth of eukaryotic cells. In addition, the levels of GSH are important for the appropriate functioning of cells under stress conditions [8]. GSH also plays an important part in yeast stress response to NaCl in Saccharomyces cerevisiae [9]. Fermentations with high sugar concentrations may cause sluggish fermentations or reduction in yeast growth [10]. In hyperosmotic stress response, glycerol is the primary compatible solute produced and accumulates to favor the cell adaptation during osmotic stress. Increased glycerol concentration inside the cells

http://dx.doi.org/10.1016/j.procbio.2017.03.001 1359-5113/© 2017 Elsevier Ltd. All rights reserved.

Please cite this article in press as: P. Saini, et al., Physiological response of Kluyveromyces marxianus during oxidative and osmotic stress, Process Biochem (2017), http://dx.doi.org/10.1016/j.procbio.2017.03.001

G Model PRBI-10959; No. of Pages 9

ARTICLE IN PRESS P. Saini et al. / Process Biochemistry xxx (2017) xxx–xxx

2

alters the membrane permeability. In S. cerevisiae, glycerol synthesis is encoded by duplicating the genes GPD (glycerol-3-P dehydrogenase) and GPP (glycerol-3-phosphatase) [11,12]. GPD1 has an important role in osmoadaptation as cells subjected to high osmolarity show increased GPD1 gene expression, which leads to glycerol accumulation. Tolerances toward high oxidative and osmotic stresses are important characteristics of microorganisms in industrial fermentations. The mechanism that protects K. marxianus cells from ROS during whey fermentation is unknown and therefore is a major part of our study. In the present study, we measured the resistance of the fermentative strain of K. marxianus to two different stress conditions. We also analyzed the cell viability under oxidative stress and the correlation of oxidative stress with GSH. The comparative stress protective roles of GSH and glycerol in whey-based media have not been much explored in yeast strains K. marxianus and S. cerevisiae which we tried to measure. Therefore, we investigated the role of GSH and glycerol in protecting yeast cells against oxidative (H2 O2 ) and osmotic stress (concentrated whey). Furthermore, we measured the gene expression levels of various marker genes during oxidative and osmotic stress.

2. Materials and methods 2.1. Materials Ellman’s reagent [5,5 -dithiobis-(2-nitrobenzoic acid), DTNB], reduced GSH, GR, KPE buffer (0.1 M potassium phosphate buffer with 5 mM EDTA disodium salt), NADPH, ethylenediaminetetraacetic acid (EDTA), bovine serum albumin, phosphate-buffered saline, phenyl methyl sulfonyl fluoride (PMSF), and all general chemicals suitable for study were purchased from Sigma-Aldrich (St Louis, USA). Hydrogen peroxide (H2 O2 ) was obtained from S.D. Fine-Chem. Ltd (Mumbai, India). Cheese whey was collected from Experimental Dairy Plant, NDRI, Karnal, India.

2.2. Yeast strains, media, and growth conditions K. marxianus MTCC 1389 (ATCC64884) and S. cerevisiae MTCC 170 were procured from the Microbial Type Culture Collection (MTCC), Chandigarh, India, and S. cerevisiae CEN.PK2 wild-type (MATa; his3D1; leu2-3 112; ura3-52; trp1-289; MAL2-8c; SUC2) strain was kindly provided by Euroscarf (Germany). All the yeast strains were stable in haploid form and cultivated in a YPD medium (yeast extract 10 g/L, bacteriological peptone 20 g/L, and glucose 20 g/L). The cultures were incubated at 30 ◦ C for 24 h, maintained at 4 ◦ C on agar slants, and subcultured fortnightly. The yeast strains were collected and finally added to 50% glycerol solution and maintained at −80 ◦ C.

2.3. Effect of oxidative stress on yeast viability during different growth phases K. marxianus and S. cerevisiae strains were grown in 250-mL Erlenmeyer flasks in a YPD medium (100 mL) up to 72 h at 30 ◦ C and 100 rpm, and the yeast cells were collected at 12, 24, 48, and 72 h of incubation. Cells of OD600 0.8 (corresponding to 1 × 107 cells/mL) were inoculated in a fresh YPD medium containing 0, 5, 10, 20 and 50 mM of H2 O2 . After 2 h of incubation, the yeast cells were collected and colony forming units (CFU/mL) were determined. Plates were prepared in triplicates. Tolerance was calculated as the percentage of viable cells that survived during stress [13].

2.4. Evaluation of the cell resistance to lactose in cheese whey The deproteinized cheese whey was used as media containing 50 g/L lactose. The lactose was further concentrated up to 200 g/L using reverse osmosis and was used to measure the GSH content in the yeast cells. Standard YPD containing yeast extract (1% w/v), peptone (2% w/v), and dextrose were used as a control media. The Erlenmeyer flasks containing 100 mL of cheese whey for K. marxianus and hydrolyzed whey for S. cerevisiae were inoculated with cells (approximately 1 × 107 cells/mL) separately. The flasks were incubated at 30 ◦ C and 100 rpm for 2 h; samples were obtained for further analysis. 2.5. Preparation of cell-free extracts After the treatment of the yeast strains K. marxianus MTCC 1389, S. cerevisiae MTCC 170, and S. cerevisiae CEN.PK2 with H2 O2 and lactose for 2 h, the treated and nontreated (control) cell suspensions (1.0 mL) were collected. The pellet of each sample was washed three times with ice-cold water by centrifugation at 1000 × g for 3 min at 4 ◦ C. The cell pellets were lysed by adding 0.5 mL of lysis buffer (50 mM Tris-Cl, 150 mM NaCl, 50 mM EDTA, pH 7.2, 50 mMPMSF) and approximately 0.5 g of glass beads (diameter, 425–600 ␮m; obtained from Sigma) according to the method described by Abegg et al. [14]. The cells were lysed by vortexing for 3 min with 1-min intervals for cooling on ice. The samples were again centrifuged for 10 min at 8000 × g to remove cellular debris and beads. The supernatant was collected for GSH and protein estimation. 2.6. Glutathione content estimation Total intracellular GSH was determined by the DTNB–GSH disulfide GSSG reductase recycling method. KPE buffer, DTNB, NADPH, and GR reagents were prepared according to Rahman et al. [15]. GSH standard was prepared using 100 ␮L of standard. A volume of 700 ␮L of KPE buffer was added to a 1-mL quartz cuvette containing 100 ␮L of the samples. Equal volumes of DTNB and GR were mixed, and 120 ␮L of this mixture was added to a cuvette. The mixture was allowed to stand for 30 s for the conversion of GSSG to GSH. Then, 60 ␮L of NADPH was added to the cuvette. Parafilm was used to invert the cuvette for mixing, and the absorbance was read at 412 nm in a UV spectrophotometer (Shimadzu UV-1800). 2.7. Depletion of glutathione For GSH depletion, yeast cells were incubated for 1 h in YPD medium containing 1 mM 1-chloro-2,4-dinitrobenzene (CDNB) [16]. Samples were collected for GSH estimation. 2.8. Lipid peroxidation determination by TBARS method Lipid peroxidation was quantified by the estimation of thiobarbituric acid reactive substances (TBARS). TBARS was determined by the method of Steels [17]. Yeast strains were subjected to different concentrations of H2 O2 . The collected samples were pelleted at 2000 × g for 2 min, and the pellets were washed with distilled water. After washing, the cells were lysed using equal volume of glass beads (0–5 mm diameter) and vortexing for six periods of 20 s. After vortex mixing, the cells were placed on ice. Samples were centrifuged at 2000 × g for 3 min, and 0.1 M EDTA and 0.6 mL of 1% (w/v) thiobarbituric acid in 0.05 M NaOH was added to the supernatant. The reaction mixture was incubated for 15 min in a boiling water bath. After cooling, the absorbance was measured using a Shimadzu UV-1240 spectrophotometer against a reference solution comprising 1 mL of TBA reagent, with the sample replaced by the

Please cite this article in press as: P. Saini, et al., Physiological response of Kluyveromyces marxianus during oxidative and osmotic stress, Process Biochem (2017), http://dx.doi.org/10.1016/j.procbio.2017.03.001

G Model PRBI-10959; No. of Pages 9

ARTICLE IN PRESS P. Saini et al. / Process Biochemistry xxx (2017) xxx–xxx

3

Table 1 Primers used for gene expression analysis under stress conditions in qRT-PCR. Gene

Forward primer

Reverse primer

GAPDH (Glyceraldehyde 3-phosphate dehydrogenase) TEF1 (Translation elongation factor-1) GSH (Glutathione) GR (Glutathione reductase) HSP12 (Heat shock protein) TRX2 (thioredoxin-encoding gene) GPD1 (glycerol-3-phosphate dehydrogenase,)

GAACATCGAAGTTGTCGCCATCAA TGGGTAAGGAAAAGTCTCACGTTAACG CCATAGGCCTGAACTCCACT TCAGAAGCATACCACATGACCTTCTTA AGGATTTCGGTGACAAGGTC TCTGCTGCTGAATTCGAAAAGGC ACCTACCGGGTATCAAGCTG

ATGATCAAAGCCTTACCGTCGTGG TCTCTTTCAGCCTTTAACTTGTCCAAAAC AACATGACAGAAACGGACCA CATTACGATTATCTAGTTATTGGTGGTG GTTTGGCCTACACCCTTGTT TGGCACTTCGTCAACATCAACCT TCAGCATCCTTAGCAGCATC

same volume of distilled deionized water. Results were expressed as ␮mol malondialdehyde per mg protein.

2.9. Glycerol estimation K. marxianus and S. cerevisiae cells were exposed to cheese whey with different lactose concentrations. After 1 h of incubation, 1 mL of sample was collected and pelleted. To estimate extracellular glycerol, the supernatant was collected to determine glycerol and other metabolite contents. For intracellular glycerol, cell pellets were washed with distilled water and then glycerol was extracted from the cells by boiling the cells in sterile distilled water for 10 min. Cell extract was cleared by centrifugation. The supernatant was used to measure glycerol by high-performance liquid chromatography (SHIMADZUTM LC20) equipped with an SCX column (TOSOHTM ). An isocratic condition was obtained using 5 mM H2 SO4 as the mobile phase at a flow rate of 0.8 mL/min using a refractive index detector (SHIMADZUTM ). For S. cerevisiae strains, hydrolyzed lactose was used to compare glycerol production between S. cerevisiae and K. marxianus cells.

2.10. Gene expression analysis The expression levels of genes responsible for osmotic and oxidative stress were determined using real-time PCR (RT-PCR) (C1000 TouchTM thermal cycler Bio-Rad); Table 1 enlists the primers used in this study. Total RNA was extracted from treated and untreated yeast samples under oxidative and osmotic stress (Zymo Research, USA). RNA concentration was determined by measuring absorbance at 260 nm. Using agarose gel electrophoresis, the purity and quality of the RNA were checked. To remove DNA contamination, the sample was treated with DNase, and cDNA was synthesized using a reverse transcriptase kit (Fermentas Inc., Burlington, Canada). A mastermix containing a proofreading Taq polymerase, dNTPs, reaction buffer, and SYBR GreenTM was used according to Nardi et al. [18]. Optimized reactions were performed with 25-␮L reaction mixture containing 200 nM of each primer, 1 × iQ SYBR GreenTM mix, and 2 ␮L of cDNA. Housekeeping genes, namely GAPDH (glyceraldehyde-3-phosphate dehydrogenase) and translational elongation factor EF-1␣ (TEF1) genes, were used. The qRT-PCR efficiencies (E) were calculated according to the following equation: E = (10[−1/slope] − 1 × 100) [19]. Gene expression was represented as 2−DCt using the method described by Livak and Schmittgen [20]. All the experiments of RT-PCR were conducted using two biological repetitions. Results were calculated with the overall standard deviation.

2.11. Protein estimation Total protein contents were determined in cell-free extracts by the Lowry method [21]. Bovine serum albumin was used as a standard.

2.12. Biomass measurement For cell biomass, culture samples were filtered through 0.45mm pore size pre-weighed filter. After media removal, the filters were washed once with demineralized water, dried at 80 ◦ C for 24 h, and weighed. Biomass was calculated in mg/mL using a precision balance (AW220, Shimadzu, Japan). 2.13. Statistical analysis The yeast cultivations were performed in triplicate. The results for cell viability, growth rate, GSH content in reduced form, and biomass are presented as mean ± S.D. of three independent measurements. Data obtained from all the experiments was subjected to statistical analysis using ANOVA to compare the significance of differences. A value of p < 0.05 was considered statistically significant. 3. Results and discussion A number of studies have reported the response of S. cerevisiae during oxidative stress, whereas very limited information is available regarding K. marxianus. K. marxianus offer advantages over S. cerevisiae as it possesses an ability to ferment various sugars at elevated temperature. Moreover, K. marxianus can produce ethanol from whey even at a temperature of 45 ◦ C, a temperature which is highly restrictive for S. cerevisiae. K. marxianus may serve as a good model for the analysis of oxidative stress response because the fermentation metabolism in this yeast differs considerably compared to that in S. cerevisiae. Recently, González-Siso et al. [22] reported that there is a huge difference between the genes of respiratory, oxidative, and carbohydrate metabolism among S. cerevisiae and Kluyveromyces lactis (a sister species of K. marxianus). Among the various stresses encountered by the yeast K. marxianus during the fermentation of cheese whey into ethanol, the major stresses include osmotic, oxidative, and heat stress and ethanol inhibition. Understanding the physiological response of K. marxianus and S. cerevisiae under these multiple stresses will be helpful in generating the desired robust strain for the efficient fermentation of ethanol from whey. Therefore, in the present study, the effect of oxidative and osmotic stress during fermentation was determined in K. marxianus. 3.1. Resistance of yeast to H2 O2 stress Oxidative stress generated during whey fermentation has a deteriorating effect on K. marxianus yeast cells. Moreover, the strain used in the industrial process of whey fermentation should have a desired antioxidant potential. K. marxianus is a lactose-assimilating yeast that can ferment whey lactose and produce ethanol. Fermentation media containing high sugar (lactose) concentration causes the generation of free radicals by actively metabolizing yeast cells, and this induces oxidative stress. One of the important parameters during whey fermentation is to maintain a viable number of K. marxianus cells that can be used in further runs of fermenta-

Please cite this article in press as: P. Saini, et al., Physiological response of Kluyveromyces marxianus during oxidative and osmotic stress, Process Biochem (2017), http://dx.doi.org/10.1016/j.procbio.2017.03.001

G Model PRBI-10959; No. of Pages 9 4

ARTICLE IN PRESS P. Saini et al. / Process Biochemistry xxx (2017) xxx–xxx

Fig. 1. Percentage viability after an oxidative stress event using H2 O2 at different concentrations (0, 5, 10, 20, and 50 mM) at different stages of growth. A. K. marxianus MTCC 1389, B. S. cerevisiae MTCC 170, C. S. cerevisiae CEN.PK2. The results represent the mean ± SD of at least three independent experiments. Significant difference was observed in the viability in the exponential and stationary phase of all the strains (results at p < 0.05).

tion [22]. Therefore, the production of ethanol during fermentation should not be at the expense of viable yeast cells. Thus, the cell viability of K. marxianus was determined during the oxidative process and was further compared with that of laboratory (CEN.PK2) and industrial (MTCC 170) strains of S. cerevisiae. The effect of oxidative stress on K. marxianus MTCC 1389, S. cerevisiae MTCC 170, and S. cerevisiae CEN.PK2 in different growth phases (12, 24, 48, and 72 h) was determined by measuring their viability after the oxidant was added. Different concentrations of hydrogen peroxide were used for the generation of oxidative stress. All the yeast strains showed almost 100% viability when no oxidant was present in the medium. Fig. 1A shows that in the case of K. marxianus, treatment with 50 mM H2 O2 was lethal for exponentially growing cell, and no survivability was observed in 12- and 24-h cells. However, the effect of the oxidant H2 O2 was less during the stationary phase (48 and 72 h), and more than 20% cell viability was detected at 48 and 72 h cells when treated with 50 mM H2 O2 . The reason for the higher viability in the stationary phase than in the exponential phase may be because the stationary-phase cells were stressed by a lack of nutrients and build-up of toxic metabolites and were set apart in ways that allow maintaining their viability for prolonged periods without further nutrients. Further, because of carbon starvation in the stationary phase, yeast cells induce

various stress responses to allow the survival of the cell population. Proteins synthesized by stationary-phase cells are implicated in maintaining the viability during stress conditions. Moreover, DNA/protein ratio also increases during the stationary phase of the cells. A similar trend of increased viability in stationary-phase cells was also observed in cells exposed to 5, 10, and 20 mM H2 O2 . Moreover, it was noticed that the maximum cell viability was observed at 5 mM H2 O2 and significantly decreased with increasing concentrations of H2 O2 , i.e., 10, 20, and 50 mM. The effect of H2 O2 stress was dose dependent in both S. cerevisiae strains, and viability was observed only up to 10 mM H2 O2. Fig. 1B represents two-fold increases in viability in stationary-phase cells of MTCC 170 strain compared to cells in the exponential phase. Among S. cerevisiae strains, the MTCC 170 strain was more resistant to H2 O2 than S. cerevisiae CEN.PK2 strain. Nearly 40% stationaryphase cells of MTCC 170 were viable at 10 mM H2 O2 compared to the 13% of the CEN.PK2 strain(Fig. 1C). Exponential-phase cells (mainly 12 h) were more sensitive to oxidative stress in both the strains. The result obtained during the viability assay in S. cerevisiae in agreement with those reported by other authors. The results suggest that the industrial ethanol-producing strain MTCC 170 is more robust than S. cerevisiae CEN.PK2 (laboratory strain) and possesses a stronger antioxidant system. While comparing K. marxianus and S. cerevisiae strains, the results obtained from the survivability study suggest that K. marxianus MTCC 1389 is more resistant toward higher H2 O2 concentration (50 mM), which is comparably lethal for S. cerevisiae strains. To estimate resistance to oxidative stress, viability has been used as a key parameter by various authors [23]. Moreover, our results are in agreement with those reported by Pinheiro et al. [24] who reported that K. marxianus CBS 7894 strain when treated with 50 mM H2 O2 maintained more than 50% survivability. Furthermore, results from a previous study suggest that S. cerevisiae grown in YPD medium is highly sensitive to hydrogen peroxide (5 mM H2 O2 ) and only 18% survivability was reported. Recently, Spencer et al. [25] found that the yeast Pichia stipitis exhibited a greater tolerance than S. cerevisiae, which was inhibited at 5 mM H2 O2 . Comparing Fig. 1A, B and C, we conclude that the stationary-phase cells of K. marxianus were more than the stationary-phase cells of S. cerevisiae strains, and the tolerance toward H2 O2 stress seems to be yeast specific. Hence, on the basis of cell viability, K. marxianus strain was more resistant to oxidative stress by H2 O2 than S. cerevisiae. Moreover, stress-tolerant K. marxianus strain may be preferred industrially over S. cerevisiae strains for concentrated whey fermentation as the former can cope better than S. cerevisiae strains during oxidative stress (induced by H2 O2 ). 3.2. Effect of H2 O2 on the glutathione level Fermentation increases the level of oxidative stress in yeast cells, and to corroborate with our oxidative stress data, the levels of GSH was measured and compared in both S. cerevisiae and K. marxianus. GSH acts as a scavenger of ROS as high levels ROS may affect many cellular functions by damaging proteins, lipids, and DNA [26]. The observed viability during H2 O2 treatment may be due to GSH as it plays a significant role in many metabolic activities; a decline in the GSH content may be responsible for decreased cell survivability because of the inactivation of various essential proteins [27]. Therefore, in this study, we determined the role of GSH in K. marxianus MTCC 1389 strain and compared it with that of S. cerevisiae (MTCC 170 and CEN.PK2) as reference strains under oxidative stress (Fig. 2A). All yeast strains were exposed to different concentrations of H2 O2 , and following the treatment, the GSH concentration was determined. In both S. cerevisiae strains, the highest GSH concentration was found at 5 mM H2 O2 . Subsequently, with an increase in the concentration of the oxidant, the GSH concen-

Please cite this article in press as: P. Saini, et al., Physiological response of Kluyveromyces marxianus during oxidative and osmotic stress, Process Biochem (2017), http://dx.doi.org/10.1016/j.procbio.2017.03.001

G Model PRBI-10959; No. of Pages 9

ARTICLE IN PRESS P. Saini et al. / Process Biochemistry xxx (2017) xxx–xxx

5

at 20 mM H2 O2 , and this level may be responsible for the observed viability at 50 mM H2 O2 . Moreover, an increase in the total GSH concentration in K. marxianus allows this yeast to further withstand different stress conditions observed during fermentation. Fig. 2B represents the GSH:GSSG ratio in different yeast strains, confirming the GSH’s role in maintaining the redox homeostasis in H2 O2 -stressed cells. The growth cycle of the yeast cells starts from the log phase and then enters into true stationary phase because of diauxic shift. Because of this shift, the cells encounter limited nutrients, slow growth rate, no cell division, and slow metabolic rate. Moreover, some components such as glycogen, trehalose, and GSH are synthesized and accumulated in the cells during that phase, and cells become more resistant to stress [28]. Recently, Ilyas and Rehman [29] also reported that stressed cells produced more GSH than unstressed cells. Furthermore, the role of GSH during oxidative stress was confirmed by depleting the intracellular GSH using CDNB. We found that 70% GSH content was abolished when all the three strains were treated with CDNB (1 mM). Fig. 2C represents the effect of 1 mM CDNB. It was observed that cells become very sensitive toward H2 O2 after treatment with CDNB. Between the two S. cerevisiae strains, S. cerevisiae CEN.PK2 was more sensitive toward induced oxidative stress than the MTCC 170 strain after CDNB treatment. An important observation during this experiment was that K. marxianus MTCC 1389 cells become much more sensitive than both S. cerevisiae strains in the presence of CDNB. Ninety-five percent of the MTCC 1389 cells were killed on YPD media containing 10 mM H2 O2 , although we observed during our previous experiment that this strain was tolerant up to 50 mM H2 O2 . Thus, we conclude that GSH plays a major protective role in K. marxianus during oxidative stress in comparison with that in S. cerevisiae. From these experiments, we speculated that the GSH concentration inside K. marxianus cells may act as an important factor that provides resistance against oxidative stress and makes the yeast strain robust. 3.3. Effect of H2 O2 on lipid peroxidation of K. marxianus

Fig. 2. Effect of oxidative stress (H2 O2 ) on different yeast strains A. total glutathione (GSH + 2GSSG) level B. GSH/GSSG ratio and its comparison in yeast strains C. Survivability of yeast strains when treated with 1 mM CDNB and when cells were not treated with any chemicals (control). Data are means from three independent experiments ± SD. Differences in the total glutathione between K. marxianus and S. cerevisiae strains were significant (two-way ANOVA, p < 0.05).

tration decreased. However, we found that in K. marxianus, the maximum GSH concentration was observed at 10 mM H2 O2. At this concentration, K. marxianus showed a total GSH concentration (GSH + 2GSSG) of 6.3 ± 0.24 ␮g/mg protein, and at 20 mM, it decreased to 3.7 ± 0.24 ␮g/mg protein. S. cerevisiae MTCC 170 and S. cerevisiae CEN.PK2 showed GSH concentration of 2.5 ± 0.14 and 1.9 ± 0.76 ␮g/mg protein at 10 mM H2 O2 , respectively. As the level of H2 O2 increased to 50 mM, no cell survivability was observed in both S. cerevisiae strains, and therefore, GSH was not detected. In contrast to S. cerevisiae, K. marxianus showed survivability up to 50 mM H2 O2 ; therefore, GSH concentration was also measured up to 50 mM H2 O2 concentration. Surprisingly, at 50 mM H2 O2 , the total GSH was higher (4.1 ± 0.11 ␮g/mg protein) than that observed

When oxidative stress is generated during whey fermentation, there is an imbalance of ROS in K. marxianus cells. Among the various components that are susceptible to damage by free radicals, a major one is lipids (peroxidation of unsaturated fatty acids in the membrane). Lipid peroxidation affects the cellular functions of the cell factory by directing a major attack of hydroxyl radicals on phospholipids and triglycerides. Thus, we measured the lipid peroxidation. In this study, the cells of K. marxianus and S. cerevisiae strains were subjected to H2 O2 stress, and then TBARS was measured, which identified malonadialdehyde formation in cells with and without stress (control) as shown in (Table 2). TBARS assay is used to measure lipid oxidation and lipid damage. A marked increase in the level of TBARS was found with an increase in the H2 O2 concentration. Furthermore, under control conditions, TBARS level was low in yeast cells. In K. marxianus and S. cerevisiae strains, there was a two-fold elevation in TBARS in 10 mM H2 O2 -stressed cells compared to the control cells (without treated). As the H2 O2 concentration was increased, in S. cerevisiae strains, TBARS also increased, and lipid peroxidation was high. In all strains, at lower doses of H2 O2 (5 and 10 mM), the GSH content was the highest, which may be involved in peroxide reduction. However, the higher dose of H2 O2 resulted in the reduction of GSH level, which leads to increases lipid peroxidation. Saharan et al. [2] also reported that GSH protects the cells against lipid peroxidation. Similar reports suggest that the more unsaturation of the membrane lipids, the higher the level of cell damage. Therefore, from our observation, it seems that the effect of H2 O2 on the lipid peroxidation of K. marxianus and S. cerevisiae is similar. Hence, we conclude that K. marxianus and S. cerevisiae strains subjected to oxidative stress

Please cite this article in press as: P. Saini, et al., Physiological response of Kluyveromyces marxianus during oxidative and osmotic stress, Process Biochem (2017), http://dx.doi.org/10.1016/j.procbio.2017.03.001

G Model PRBI-10959; No. of Pages 9

ARTICLE IN PRESS P. Saini et al. / Process Biochemistry xxx (2017) xxx–xxx

6

Table 2 Effect of oxidative stress (H2 O2 ) on the lipid peroxidation of K. marxianus and S. cerevisiae strains. H2 O2 stress

Control (No H2 O2 ) 5 mM 10 mM 20 mM 50 mM

TBARS (␮mol/mg protein) K. marxianus MTCC 1389

S. cerevisiae MTCC 170

S. cerevisiae CEN.PK2

5.2 ± 0.05 7.8 ± 0.09 10.3 ± 0.08 14.5 ± 0.12 16.9 ± 0.17

6.6 ± 0.13 8.2 ± 0.15 12.5 ± 0.03 – –

6.8 ± 0.11 8.9 ± 0.09 14.7 ± 0.06 – –

The results represent mean ± SD of three independent experiments.

may share a common mechanism for oxygen-derived free radical synthesis, which leads to membrane lipid damage. 3.4. Effect of lactose on the glutathione content in cheese whey K. marxianus is widely used for the production of ethanol from whey lactose. Cheese whey medium needs to be concentrated for obtaining a high ethanol titer from the lactose-rich whey. However, higher lactose concentration in cheese whey also triggers the osmotic stress in K. marxianus. To the best of our knowledge, there have been no reports measuring the stress response of K. marxianus in its natural substrate, the cheese whey medium. However, in the case of K. lactis (sister species of K. marxianus), the expression levels of genes related to oxidative stress and GSH metabolism were increased when grown in natural cheese whey media rather than the synthetic media [30]. Considering that K. lactis is a respiratory yeast in contrast to the fermentative K. marxianus MTCC 1389 strain, we tried to measure the role of GSH in wild-type K. marxianus. Therefore, in the present study, the GSH concentrations were measured in K. marxianus strain grown in cheese whey and synthetic media containing lactose as a carbon source. However, hydrolyzed cheese whey medium was used for cultivation as S. cerevisiae cannot utilize the lactose present in the whey directly, whereas K. marxianus can hydrolyze the lactose by producing intracellular enzyme ␤-galactosidase. The variations in the total cellular GSH levels during growth at different lactose concentration (50, 100, 150, and 200 g/L) were monitored in K. marxianus strain. According to the results, K. marxianus MTCC 1389 strain was found to contain elevated levels of total GSH (GSH + 2GSSG) in the cheese whey media compared to that in the synthetic media (control in Fig. 3). For K. marxianus strain, the concentration of total GSH was 1.5-fold higher in the cheese whey medium than in the synthetic medium. Furthermore, the GSH level (6.8 ± 0.25 ␮g/mg protein) in the cells increased up to 150 g/L lactose concentration, and thereafter, a decline in GSH level was observed with increasing concentrations of lactose (Fig. 3). However, in both S. cerevisiae strains, no significant increase was observed in the production of GSH (3.7 ± 0.26 and 3.5 ± 0.14 ␮g/mg protein in S. cerevisiae MTCC 170 and CEN.PK2, respectively) in the presence of hydrolyzed lactose (150 g/L). Therefore, when comparing all the strains for GSH production using whey, it was found that K. marxianus MTCC 1389 cells showed a higher production than both S. cerevisiae strains. Therefore, it seems that GSH plays a pivotal role in K. marxianus up to a certain sugar concentration in the cheese whey media. Furthermore, it is known that the type of sugar metabolism in the yeast cell is associated with its response to oxidative stress provoked by ROS generation [31,32]. Erasmus et al. [33] reported that the genes related to the GSH pathway, glutathione peroxidase, and glutathione transferase increased 2–3-folds when yeast cells were exposed to sugar stress. Recently, an in silico analysis by Koleva et al. [32] revealed that sugar utilization influences the activity of yeast glutathione synthetases and transferases. The exact mechanism has not been revealed, but higher concentration of lactose in whey in combination with other factors may impart

Fig. 3. Effect of osmotic stress (lactose) on total glutathione (GSH + 2GSSG) level in K. marxianus and S. cerevisiae strains. Data are means from three independent experiments ± SD. Differences in the total glutathione between K. marxianus and S. cerevisiae strains were significant (two-way ANOVA, p < 0.05).

some kind of stress that may be involved with the increased GSH concentration in the cheese whey media [32]. 3.5. Effect of lactose on glycerol accumulation in cheese whey K. marxianus responds to the increased osmolarity of the cheese whey medium by accumulating glycerol as a protective solute. The osmotic pressure in the fermenter with high sugar concentration was found to increase. The osmotic response by K. marxianus is of great importance from an industrial point of view as the whey used during the production of ethanol needs to be concentrated and exerts a higher level of osmotic stress. In the present study, when yeast cells were cultured in lactose-rich whey with different concentrations of lactose, glycerol was found to be accumulated inside K. marxianus cells, which protected the cells from osmotic stress. At a lactose concentration of 150 g/L, K. marxianus cells produced high amounts of intracellular glycerol (2.2 ± 0.14 g/g CDW), whereas at lower concentrations of lactose, the cells produced low glycerol content (Fig. 4A). This higher glycerol concentration indicated the osmotic adjustment of K. marxianus cells at 150 g/L lactose concentration. In both the strains of S. cerevisiae, intracellular glycerol accumulation was comparatively lower than in K. marxianus cells. Similarly, in S. cerevisiae cells, glycerol production was higher using 150 g/L lactose than at lower concentrations of lactose. In 150 g/L hydrolyzed whey, both S. cerevisiae strains produced comparable intracellular glycerol (1.8 ± 0.14 and 1.7 ± 0.15 g/CDW in MTCC 170 and CEN.PK2, respectively) as shown in Fig. 4B and C. In a study, Petrovska et al. [34] described that S. cerevisiae strain

Please cite this article in press as: P. Saini, et al., Physiological response of Kluyveromyces marxianus during oxidative and osmotic stress, Process Biochem (2017), http://dx.doi.org/10.1016/j.procbio.2017.03.001

G Model PRBI-10959; No. of Pages 9

ARTICLE IN PRESS P. Saini et al. / Process Biochemistry xxx (2017) xxx–xxx

Fig. 4. Glycerol production under different lactose concentrations. A. K. marxianus in whey and B. S. cerevisiae MTCC 170 C. S. cerevisiae CEN.PK2 in hydrolysed whey. Data are means from three independent experiments ± SD.

produces a glycerol content of 3.6 g/L when cultivated in glucose media with 150 g/L glucose, similar to the present study, in which S. cerevisiae strains produced extracellular glycerol content of 3.4 g/L when cultivated in hydrolyzed lactose with 150 g/L lactose. Therefore, it seems that in both K. marxianus and S. cerevisiae, glycerol plays a general protective role in cells exposed to concentrated cheese whey. 3.6. Gene expression analysis under oxidative and osmotic stress In the present study, we reported the response of K. marxianus toward oxidative and osmotic stress. The response of wild-type K. marxianus affects the fermentation process and is important from an industrial point of view. It might be possible that the ability of K. marxianus to respond and resist the multiple stresses determines the fermentation properties during cultivation on cheese whey. S. cerevisiae MTCC 170 was only used as a reference standard strain for comparison with K. marxianus MTCC 1389.

7

The response to oxidative stress in yeast strain is governed by the expression of certain transcription factors: Msn2p/Msn4p and Yap proteins. We measured the expression levels of HSP12 (heat shock protein) and TRX2 (thioredoxin-encoding gene) representing each group. The expression level of the HSP12 gene is dependent on Msn2p/Msn4p, whereas those of TRX2 are mediated by Yap proteins [35]. Moreover, we measured the expression levels of GSH1 (␥-glutamylcysteine synthetase) and GR genes to understand the role of GSH during oxidative stress. A concentration of 10 mM H2 O2 was used for generating oxidative stress, and Fig. 5A shows the expression levels of HSP12 and TRX2. Analysis of the TRX2 gene showed that its expression levels increased during H2 O2 stress in K. marxianus. The two-fold higher expression of TRX-2 in K. marxianus compared to that in S. cerevisiae shows that this thioredoxin may be one of the key antioxidants that plays a major role against oxidative stress. S. cerevisiae showed two-fold elevated expression levels of the HSP12 gene than K. marxianus strain. To the best of our knowledge, there are no reports regarding the gene expression analysis of thioredoxin during oxidative stress in thermotolerant K. marxianus. However, Blanco et al. [36] reported that the TRXR and CTT genes in K. lactis were upregulated during oxidative stress and hypoxic conditions. In addition, to examine the role of the GSH genes in activating a response toward oxidative stress, the expression levels of the GSH1 and GR genes were measured. It was found that in K. marxianus cells, the expression level of GSH1 increased five-fold, whereas that of GR increased only 3.3-fold. Fig. 5B represents the expression levels of the GSH1 and GR genes. Analysis of GSH mRNA levels showed that the induction in S. cerevisiae is very low compared to that in K. marxianus. The upregulation of these genes might explain their role during oxidative stress as a defensive response in K. marxianus and represents a crucial part in preventing cell death because of changing redox balance. The transcription reprograming occurring because of this response causes a necessary change in the protein level to return the changed redox status of K. marxianus to the normal state. Four genes (GSH1, GR, GPD1, and HSP12) were selected for expression analysis during osmotic stress because in most of the cases, the situations prevailing during fermentation on synthetic media differ from those present in natural cheese whey medium. Therefore, the gene expression response during osmotic stress in K. marxianus was analyzed after direct cultivation in concentrated cheese whey (150 g/L), which represents osmotic stress in the natural environment. For the gene expression analysis, samples corresponding to 1 h were taken. Two genes GPD1 (glycerol-3-phosphate dehydrogenase) and HSP12 (heat shock proteins) regulated by the HOG pathway were analyzed [36,34]. As S. cerevisiae cannot utilize lactose but can ferment its hydrolyzed product glucose and galactose, S. cerevisiae gene expression was analyzed in hydrolyzed whey. Fig. 5C shows the increased expression levels of the HSP12 gene in S. cerevisiae. A 3.3-fold increase in the expression levels was observed in S. cerevisiae compared with the 2.6-fold increase in K. marxianus. Moreover, for GPD1, a 4.2-fold increase in gene expression levels was observed in K. marxianus, whereas only 3.2-fold increase was observed in S. cerevisiae. Therefore, in this experiment measuring the osmotic response in natural cheese whey containing a higher sugar concentration, K. marxianus strain showed higher expression of the GPD1 gene. Gene expression analysis of the GSH1 and GR genes was also found to be elevated in K. marxianus under lactose stress compared to those in S. cerevisiae. Activation of the GSH1 gene indicates that apart from being present in oxidative stress, the GSH1 gene also plays a major role in the process involved during osmotic stress response. From the analysis of the results of gene expression, we conclude that GPD and GSH1 can be used as marker indicators of osmotic stress in K. marxianus. Our gene expression study results are in agreement with those reported by other authors.

Please cite this article in press as: P. Saini, et al., Physiological response of Kluyveromyces marxianus during oxidative and osmotic stress, Process Biochem (2017), http://dx.doi.org/10.1016/j.procbio.2017.03.001

G Model PRBI-10959; No. of Pages 9 8

ARTICLE IN PRESS P. Saini et al. / Process Biochemistry xxx (2017) xxx–xxx

Fig. 5. Relative gene expression levels under oxidative and osmotic stress conditions in both K. marxianus and S. cerevisiae strains. A. Expression of HSP12 and TRX2 genes in the presence of H2 O2 (1 h). B. Expression of GSH and GR genes in the presence of H2 O2 (1 h). C. Expression of GPD1 and HSP12 genes under osmotic stress (whey with 150 g/L lactose). D. Expression of GSH and GR genes under osmotic stress (whey with 150 g/L lactose). Nonstressed cells were taken as control. Error bars show standard deviations, including two technical repetitions for three independent experiments. Relative normalized fold expression was calculated by the Ct method using TEF1 as reference gene. Values represent means ± SD. *p < 0.05; **p < 0.01; ***p < 0.001. The analyses were repeated at least three times in three independent experiments.

In this work, it was determined that GSH plays a remarkable characteristic role in K. marxianus MTCC 1389 during the oxidative stress; K. marxianus MTCC 1389 was found to be more resistant toward H2 O2 stress than S. cerevisiae. The results also suggest that the stationary-phase cells of K. marxianus were more resistant to oxidative stress than the exponential-phase cells. During the stationary phase, K. marxianus showed high stability at various oxidation levels. Furthermore, the cell’s ability to be resistant and maintain the oxidation levels allow K. marxianus cells to survive for a long period of time. Hence, we can conclude that in K. marxianus, GSH as an antioxidant plays a significant role in maintaining the redox homeostasis in ethanol and during oxidative stress, favoring tolerance to the stress state. The ability to survive under stress conditions indicates that GSH and other factors are important for stress tolerance and long-term stability. Moreover, our approach provided a new insight into the physiological response of K. marxianus during oxidative and osmotic stress. Our analysis indicates that K. marxianus strain MTCC 1389 is a more resistant and robust strain than S. cerevisiae CEN.PK2 and S. cerevisiae MTCC 170 strain.

Therefore, using stress-tolerant strains of K. marxianus might be helpful in future for improving lactose fermentation that produce not only potable ethanol but also alternative products such as whey wines and distilled drinks.

Conflicts of interest The authors disclose no potential conflicts of interest.

Acknowledgments The authors thank the ICAR-National Dairy Research Institute, Karnal, and the National Fund for Basic, Strategic and Frontier Application Research in Agriculture (NFBSFARA), ICAR, INDIA, for providing the necessary support to conduct this research work. The authors also thank Euroscarf, Germany, for providing S. cerevisiae CEN.PK2 strain.

Please cite this article in press as: P. Saini, et al., Physiological response of Kluyveromyces marxianus during oxidative and osmotic stress, Process Biochem (2017), http://dx.doi.org/10.1016/j.procbio.2017.03.001

G Model PRBI-10959; No. of Pages 9

ARTICLE IN PRESS P. Saini et al. / Process Biochemistry xxx (2017) xxx–xxx

References [1] S. Hohmann, Osmotic stress signaling and osmoadaptation in yeasts, Microbiol. Mol. Biol. Rev. 66 (2010) 300–372. [2] R.K. Saharan, S. Kanwal, S.C. Sharma, Role of glutathione in ethanol stress tolerance in yeast Pachysolen tannophilus, Biochem. Biophys. Res. Commun. 397 (2010) 307–310. [3] C.S. Souza, D. Thomaz, E.R. Cides, Genetic and physiological alterations occurring in a yeast population continuously propagated at increasing temperatures with cell recycling, World J. Microbiol. Biotechnol. 23 (2007) 1667–1677. [4] G.G. Fonseca, E. Heinzle, C. Wittmann, The yeast Kluyveromyces marxianus and its biotechnological potential, Appl. Microbiol. Biotechnol. 79 (2008) 339–354. [5] A. Kokkiligadda, A. Beniwal, P. Saini, S. Vij, Utilization of cheese whey using synergistic immobilization of ␤-galactosidase and Saccharomyces cerevisiae cells in dual matrices, Appl. Biochem. Biotechnol. 179 (2016) 1469–1484. [6] F. Lu, Y. Wang, D. Bai, L. Du, Adaptive response of Saccharomyces cerevisiae to hyperosmotic and oxidative stress, Process Biochem. 40 (11) (2005) 3614–3618. [7] H. Østergaard, C. Tachibana, J.R. Winther, Monitoring disulfide bond formation in the eukaryotic cytosol, J. Cell Biol. 166 (3) (2004) 337–345. [8] A.K. Bachhawat, D. Ganguli, J. Kaur, N. Kasturia, A. Thakur, H. Kaur, A. Yadav, Glutathione Production in Yeast In Yeast Biotechnology: Diversity and Applications, Springer, Netherlands, 2009, pp. 259–280. [9] P. Jamnik, P. Medved, P. Raspor, Increased glutathione content in yeast Saccharomyces cerevisiae exposed to NaCl, Ann. Microbiol. 56 (2006) 175–178. [10] F.W. Bai, L.J. Chen, W.A. Anderson, M. Moo-Young, Parameter oscillations in a very high gravity medium continuous ethanol fermentation and their attenuation on a multistage packed column bioreactor system, Biotechnol. Bioeng. 88 (5) (2004) 558–566. [11] P. Eriksson, L. André, R. Ansell, A. Blomberg, L. Adler, Cloning and characterization of GPD2, a second gene encoding sn-glycerol 3-phosphate dehydrogenase (NAD+) in Saccharomyces cerevisiae, and its comparison with GPD1, Mol. Microbiol. 17 (1) (1995) 95–107. [12] A.K. Påhlman, K. Granath, R. Ansell, S. Hohmann, L. Adler, The yeast glycerol 3-phosphatases Gpp1p and Gpp2p are required for glycerol biosynthesis and differentially involved in the cellular responses to osmotic: anaerobic, and oxidative stress, J. Biol. Chem. 276 (5) (2001) 3555–3563. [13] M.A. Abegg, P.V.G. Alabarse, A. Casanova, Response to oxidative stress in eight pathogenic yeast species of the genus Candida, Mycopathologia 170 (2010) 11–20. [14] M.A. Abegg, P.V.G. Alabarse, A.K. Schüller, Glutathione levels in and total antioxidant capacity of Candida sp: cells exposed to oxidative stress caused by hydrogen peroxide, Rev. Soc. Bras. Med. Trop. 45 (2012) 620–626. [15] I. Rahman, A. Kode, S.K. Biswas, Assay for quantitative determination of glutathione and glutathione disulfide levels using enzymatic recycling method, Nat. Protoc. 1 (2006) 3159–3165. [16] S. Izawa, Y. Inoue, A. Kimura, Oxidative stress response in yeast: effect of glutathione on adaptation to hydrogen peroxide stress in Saccharomyces cerevisiae, FEBS Lett. 368 (1) (1995) 73–76. [17] E.L. Steels, R.P. Learmonth, K. Watson, Stress tolerance and membrane lipid unsaturation in Saccharomyces cerevisiae grown aerobically or anaerobically, Microbiology 140 (3) (1994) 569–576.

9

[18] T. Nardi, F. Remize, H. Alexandre, Adaptation of yeasts Saccharomyces cerevisiae and Brettanomyces bruxellensis to winemaking conditions: a comparative study of stress genes expression, Appl. Microbiol. Biotechnol. 88 (4) (2010) 925–937. [19] M.W. Pfaffl, A new mathematical model for relative quantification in real-time RT–PCR, Nucleic Acids Res. 29 (9) (2001), e45–e45. [20] K.J. Livak, T.D. Schmittgen, Analysis of relative gene expression data using real-time quantitative PCR and the 2- CT method, Methods 25 (4) (2001) 402–408. [21] O.H. Lowry, N.J. Rosebrough, A.L. Farr, Protein measurement with the Folin phenol reagent, J. Biol. Chem. 193 (1951) 265–275. [22] M.I. González-Siso, A. García-Leiro, N. Tarrío, M.E. Cerdán, Sugar metabolism, redox balance and oxidative stress response in the respiratory yeast Kluyveromyces lactis, Microb. Cell Fact. 8 (1) (2009) 1. [23] M. Arellano-Plaza, A. Gschaedler-Mathis, R. Noriega-Cisneros, Respiratory capacity of the Kluyveromyces marxianus yeast isolated from the mezcal process during oxidative stress, World J. Microbiol. Biotechnol. 29 (2013) 1279–1287. [24] R. Pinheiro, I. Belo, M. Mota, Oxidative stress response of Kluyveromyces marxianus to hydrogen peroxide: paraquat and pressure, Appl. Microbiol. Biotechnol. 58 (6) (2002) 842–847. [25] J. Spencer, T.G. Phister, K.A. Smart, D. Greetham, Tolerance of pentose utilising yeast to hydrogen peroxide-induced oxidative stress, BMC Res. Notes 7 (1) (2014) 1. [26] H.R. López-Mirabal, J.R. Winther, Redox characteristics of the eukaryotic cytosol, Biochem. Biophys. Acta-Mol. Cell Res. 1783 (2008) 629–640. [27] F.U. Rui-Yan, C. Jian, Yin Li, The function of the glutathione/glutathione peroxidase system in the oxidative stress resistance systems of microbial cells, Chin. J. Biotechnol. 23 (2007) 770–775. [28] L. Cyrne, L. Martins, L. Fernandes, Regulation of antioxidant enzymes gene expression in the yeast Saccharomyces cerevisiae during stationary phase, Free Radic. Biol. Med. 34 (2003) 385–393. [29] S. Ilyas, A. Rehman, Oxidative stress, glutathione level and antioxidant response to heavy metals in multi-resistant pathogen, Candida tropicalis, Environ. Monit. Assess. 187 (2015) 1–7. [30] M. Becerra, M.I. González-Siso, M.E. Cerdán, A transcriptome analysis of Kluyveromyces lactis growing in cheese whey, Int. Dairy J. 16 (3) (2006) 207–214. [31] M.I. González-Siso, A. García-Leiro, N. Tarrío, Sugar metabolism, redox balance and oxidative stress response in the respiratory yeast Kluyveromyces lactis, Microb. Cell Fact. 8 (2009) 46. [32] D.I. Koleva, V.Y. Petrova, T.S. Nedeva, Sugar utilization influences yeast glutathione synthetases and transferases: in silico analysis, Biotechnol. Biotechnol. Equip. 25 (2011) 125–132. [33] D.J. Erasmus, G.K. Merwe, H.J. Vuuren, Genome-wide expression analyses: metabolic adaptation of Saccharomyces cerevisiae to high sugar stress, FEMS Yeast Res. 3 (2003) 375–399. [34] B. Petrovska, E. Winkelhausen, S. Kuzmanova, Glycerol production by yeasts under osmotic and sulfite stress, Can. J. Microbiol. 45 (8) (1999) 695–699. [35] J. Gao, W. Yuan, Y. Li, R. Xiang, S. Hou, S. Zhong, F. Bai, Transcriptional analysis of Kluyveromyces marxianus for ethanol production from inulin using consolidated bioprocessing technology, Biotechnol. Biofuels 8 (1) (2015) 1. ˜ [36] M. Blanco, L. Núnez, N. Tarrío, E. Canto, M. Becerra, M.I. González-Siso, M.E. Cerdán, An approach to the hypoxic and oxidative stress responses in Kluyveromyces lactis by analysis of mRNA levels, FEMS Yeast Res. 7 (5) (2007) 702–714.

Please cite this article in press as: P. Saini, et al., Physiological response of Kluyveromyces marxianus during oxidative and osmotic stress, Process Biochem (2017), http://dx.doi.org/10.1016/j.procbio.2017.03.001