- Email: [email protected]
Pig has no uncoupling protein 1
Biochemical and Biophysical Research Communications xxx (2017) 1e6
Contents lists available at ScienceDirect
Biochemical and Biophysical Research Communications journal homepage: www.elsevier.com/locate/ybbrc
Pig has no uncoupling protein 1 Lianjie Hou a, Jia Shi a, Lingbo Cao a, Guli Xu a, Chingyuan Hu b, Chong Wang a, * a
National Engineering Research Center for Breeding Swine Industry, Guangdong Provincial Key Lab of Agro-Animal Genomics and Molecular Breeding, College of Animal Science, South China Agricultural University, Guangzhou, Guangdong, 510642, PR China b Department of Human Nutrition, Food and Animal Sciences, College of Tropical Agriculture and Human Resources, University of Hawaii at Manoa, 1955 East-West Road, AgSci. 415J, Honolulu, HI 96822, USA
a r t i c l e i n f o
a b s t r a c t
Article history: Received 16 April 2017 Accepted 22 April 2017 Available online xxx
Brown adipose tissue (BAT) is critical for mammal's survival in the cold environment. Uncoupling protein 1 (UCP1) is responsible for the non-shivering thermogenesis in the BAT. Pig is important economically as a meat-producing livestock. However, whether BAT or more precisely UCP1 protein exists in pig remains a controversy. The objective of this study was to ascertain whether pig has UCP1 protein. In this study, we used rapid amplification of cDNA ends (RACE) technique to obtain the UCP1 mRNA 30 end sequence, confirmed only exons 1 and 2 of the UCP1 gene are transcribed in the pig. Then we cloned the pig UCP1 gene exons 1 and 2, and expressed the UCP1 protein from the truncated pig gene using E. coli BL21. We used the expressed pig UCP1 protein as antigen for antibody production in a rabbit. We could not detect any UCP1 protein expression in different pig adipose tissues by the specific pig UCP1 antibody, while our antibody can detect the cloned pig UCP1 as well as the mice adipose UCP1 protein. This result shows although exons 1 and 2 of the pig UCP1 gene were transcribed but not translated in the pig adipose tissue. Furthermore, we detected no uncoupled respiration in the isolated pig adipocytes. Thus, these results unequivocally demonstrate that pig has no UCP1 protein. Our results have resolved the controversy of whether pigs have the brown adipose tissue. © 2017 Published by Elsevier Inc.
Keywords: Swine Brown adipose tissue UCP1 Uncoupling respiration
1. Introduction Mammals contain mainly two types of adipose tissues, white adipose tissue (WAT) and brown adipose tissue (BAT). WAT stores excess energy in the form of triglycerides when an animal's energy intake exceeds its energy expenditure. During starvation, WAT lipolysis provides energy to animals [1]. Brown adipose tissue contains multilocular fat droplets and many mitochondria, and is distinguished by its ability to dissipate energy in the form of heat [2]. BAT plays a significant role in newborns; they use this tissue for non-shivering thermogenesis to defend themselves against the cold environment [3]. BAT-dependent non-shivering thermogenesis is attributed to the uncoupling protein 1 (UCP1) [4e6]. UCP1 is a member of the of mitochondrial anion carrier proteins family and is a transmembrane protein with the size of approximately 35 KD. UCP1 disengages ATP synthesis from oxidative phosphorylation and dissipates energy as heat [7].
* Corresponding author. E-mail address: [email protected] (C. Wang).
Although BAT has been found in many mammals such as mice, human, goat, and dog [8e11]. However, whether brown adipose tissue exists in the pig is still a controversy. Brown adipocytes were found in different pig adipose tissues by microscopic and electron microscopic methods [12]. But this result was not supported by the immunoblotting study in another laboratory using the rabbit antirat UCP1 antibody [13]. The authors concluded that pigs have no brown adipose tissue, and all adipose tissues in the pig appear to be exclusively “white” [13]. More recently, Berg et al. (2006) determined the complete genome sequence of pig UCP1 gene by longrange PCR and genome walking. In this study, they found that exons 3 to 5 of the pig UCP1 gene were lost 20 million years ago; more than twenty pigs from different breeds of domestic pigs and wild boar were included in their study [14]. Thus, pig UCP1 gene contains only three exons: exons 1, 2 and 3, which are corresponding to the exons 1, 2 and 6 of the mouse UCP1 gene, respectively. By using a goat UCP1 antibody in their immunoblotting assay Mostyn et al. (2014) showed that UCP1 protein is present in pig adipose tissue and is responsive to postnatal leptin treatment [15]. However, Jastroch & Anderson (2015) believe the increased UCP1 protein in Mostyn's study (2014) may be explained by non-specific hybridization with other mitochondrial anion carrier proteins, such
http://dx.doi.org/10.1016/j.bbrc.2017.04.118 0006-291X/© 2017 Published by Elsevier Inc.
Please cite this article in press as: L. Hou, et al., Pig has no uncoupling protein 1, Biochemical and Biophysical Research Communications (2017), http://dx.doi.org/10.1016/j.bbrc.2017.04.118
2
L. Hou et al. / Biochemical and Biophysical Research Communications xxx (2017) 1e6
as UCP2 or UCP3 by the goat UCP1 antibody [16]. Berg et al. (2006) only examined the UCP1 gene at genome level; they did not measure the UCP1 protein. By contrast, Mostyn and his colleagues measured only UCP1 protein by a rabbit anti-goat UCP1 antibody; they did not study the UCP1 gene structure or its transcript. Therefore, in this study, we examined the UCP1 gene structure and determined whether pig UCP1 gene is being transcribed, translated and functional.
Table 2 Antibody validation profile.
2. Materials and methods
medium - DMEM/F12 (GIBCO, Grand Island, NY, USA) containing 15% fetal bovine serum (FBS, GIBCO), 100,000 units/L of penicillin sodium and 100 mg/L of streptomycin sulfate (GIBCO). And they were plated in 75 cm2 cell culture flasks. For plasmid transfection, primary adipocytes with 60% confluency were incubated with the plasmid for 6 h in the growth medium. Then the medium was replaced with new growth medium and cells were maintained in growth medium for an additional 24 h. Then the medium was replaced with new growth medium and cells were maintained in growth medium for an additional 12 h before adipogenic differentiation induction. Pre-adipocytes were induced to differentiation by the induction medium containing 10% FBS, 0.5 mM isobutylmethylxanthine, 0.25 mM dexamethasone, 1 mg/mL insulin, 1 nM T3 and 1 mM rosiglitazone for 48 h. Two days later, cells were switched to a different medium containing 10% FBS, 1 mg/mL insulin and 1 nM T3. Differentiated cells were used for gene expression and uncoupling respiration assays. All chemicals for cell culture were purchased from Sigma-Aldrich (St. Louis, Missouri, USA).
All animal use protocols were approved by the College of Animal Science, South China Agricultural University. All experiments were performed in accordance with relevant guidelines and regulations of ‘the instructive notions with respect to caring for laboratory animals’ issued by the Ministry of Science and Technology of the People's Republic of China. 2.1. Tissue sampling Male Landrace pigs (1 day and 7 days of age) were euthanized via intraperitoneal injection of pentobarbital sodium (40 mg/kg body weight) followed by exsanguinations. One gram of tissues from the fat pad in various locations, muscle, heart, liver, spleen, lung, and kidney were collected and stored at 80 C until assayed. 2.2. RNA extraction and PCR analysis Total RNAs were extracted from tissue or adipocytes using TRIzol reagent (Invitrogen, Carlsbad, CA, USA) according to the manufacturer's instructions. Then total RNAs (0.5 mg) were reverse transcribed to cDNA by PrimeScript™ RT Master Mix (TaKaRa, Otsu, Shiga, Japan) according to the manufacturer's instructions. General-PCR products were sequenced and blasted them with gene sequences deposit in NCBI to ensure the primers were specific. SYBR Green Real-time PCR Master Mix reagents (Toyobo Co., Ltd., Osaka, Japan) were used for real-time quantitative polymerase chain reaction (PCR), and PCR reactions were performed using a Mx3005p instrument (Stratagene, La Jolla, CA, USA). Relative expression of mRNAs was normalized to b-actin levels using the DDCt method. Primers were designed using Primer Premier 5 according to the pig gene sequence obtained from NCBI. Primers used for PCR in this study were shown in Table 1. 2.3. Cell culture The pig preadipocytes used in primary culture were isolated from the subcutaneous back and visceral fat pad of 1-day male Landrace pigs. Adipose tissue was dissected and finely minced after removing all visible connective tissues. Then the minced tissue was digested for 40 min at 37 C in isolation buffer (125 mM NaCl, 5 mM KCl, 1.3 mM CaCl2, 5 mM glucose, 100 mM HEPES, 4% BSA, 1.5 mg/ mL Collagenase B). Digested tissue was filtered through a 70 mm cell strainer to remove large pieces, and the flow-through was centrifuged for 10 min at 500 g to collect stromal-vascular fraction (SVF) cells in the pellet. The SVF cells were suspended in growth
Primary antibody
Clone
Company
Catalog No.
Dilution
UCP1 b-Actin Secondary antibody Goat Anti-rabbit IgG
Polyclonal Monoclonal Conjugate Used HRP
Bioss Bioss Company Bioss
bs-1925R bsm-33036 M Catalog No. bs-0295G
1:700 1:1000 Dilution 1:5000
2.4. Immunoblotting Homogenized tissues were lysed in RIPA buffer containing protease inhibitors (1 mM PMSF). These protein lysates were separated with SDS-PAGE and then electroblotted to polyvinylidene fluoride. Electrophoresis supplies were purchased from Bio-Rad (California, USA). The membranes were blocked for 2 h at room temperature and incubated with different antibodies overnight at 4 C, followed by incubation with horseradish peroxidaseconjugated secondary antibodies at room temperature for 1 h. The antibodies used in this study are listed in Table 2. 2.5. Preparation of pig UCP1 antibody Pig UCP1 gene exons 1 and 2 were cloned into pET-28a (þ) recombinant vector. Recombinant pET-28a (þ) vectors were transformed into E. coli BL21 (E. coli BL21-UCP1þ). Isopropyl-b-dthiogalactoside was used to induce E. coli BL21 to express truncated pig UCP1 protein (pig UCP1 protein). The pig UCP1 protein was purified by high-affinity Ni-NTA resin according to the manufacturer's instructions. We used the purified protein as antigen for antibody production. First, 1 mg antigen with Freund's complete adjuvant was injected into a 1.5 months old New Zealand rabbit. A second 1 mg antigen with Freund's incomplete adjuvant was injected four weeks later. One ml blood from the ear vein was collected every week to determine the UCP1 antibody titer in serum. At the eighth week, New Zealand rabbit was anesthetized via intraperitoneal injection of chloral hydrate (100 mg) followed
Table 1 Primers used for PCR analyses. Gene name
Forward primer sequence (50 -30 )
Reverse primer sequence (50 -30 )
Primer Primer Primer Primer
GGTCACCGCCAAAGTCCG GCTGGCAAAGAGAGAAGGG TCCTGCGAACAATCACTACTCT CGCACACCGCCAAAGTC
CAGCCCTCTGTAGTGCTTCATT TGGATGGTAACATAGAGGCTGA TCCTGCGAACAATCACTACTCT ATGCCAGTCACCAGAAGGAA
1 2 3 4
Please cite this article in press as: L. Hou, et al., Pig has no uncoupling protein 1, Biochemical and Biophysical Research Communications (2017), http://dx.doi.org/10.1016/j.bbrc.2017.04.118
L. Hou et al. / Biochemical and Biophysical Research Communications xxx (2017) 1e6
by blood collection. Purified UCP1 antibody was isolated from serum by Protein AeAgarose according to the manufacturer's instructions (Cwbiotech, Beijing, China). 2.6. Determination of cellular respiration The oxygen consumption rate of the pig adipocytes was determined by Oxygen Consumption/MitoMembrane Potential Dual Assay Kit according to the manufacturer's instructions (Cayman, Michigan, USA). 2.7. Statistical analysis All data are expressed as means ± standard error of the mean (S.E.M.). Significant differences between the control and treated groups were determined by Student's t-test (SPSS 18.0, Chicago, IL, USA). Differences were considered significant at the P<0.05 (*) and very significant at P<0.01 (**). 3. Results
3
3.2. Only exons 1 and 2 of the UCP1 gene are transcribed in pig adipose tissues Using pig adipose tissues cDNA as template, Primer pair 1 and primer pair 2 produced corresponding PCR products using cDNA as template, but primer pair 3 and primer pair 4 did not. When the antisense primers (R3 and R4) are matched to the exon 3 of UCP1 gene, while the sense primers (F4 and F3) matched to exons 1 and 2, cDNA template failed to produce any PCR products (Fig. 1B). These results imply that only exons 1 and 2 of UCP1 pseudogene were transcribed in the pig. So we used rapid amplification of cDNA ends (RACE) technique to obtain the UCP1 mRNA 30 end sequence (Fig. 1C). We sequenced the 30 RACE-PCR product and blasted it with Sus scrofa UCP1 pseudogene sequence on NCBI. As shown in Fig. 1D, the 30 RACE-PCR products contain only exons 1, 2 and a DNA region outside the exon 3. These results clearly demonstrated that only exons 1 and 2 of UCP1 gene are transcribed in pig adipose tissue.
3.3. Truncated pig UCP1 mRNA is not translated in pig different adipose tissues
3.1. Pig UCP1 gene contains only three exons Since whether UCP1 exists in pig has never been conclusively established, we first examined UCP1 gene structure and its transcript in the pig. We designed four pairs of primers based on pig UCP1 pseudogene sequence obtained from Berg’ research to determine the UCP1 gene structure and its transcript in pigs, and the primer locations on the UCP1 gene are shown in Fig. 1A. The four primer pairs produced four corresponding PCR products using genome DNA as template (Fig. 1B). We sequenced the PCR products and blasted them with Berg’ UCP1 pseudogene sequence; this result demonstrated pig UCP1 gene only contains three exons.
We know only two exons of the pig UCP1 gene are being transcribed as shown in Fig. 1, but we do not know whether they are being translated or not. Through the phylogenic tree, we can see that pig UCP1 gene has low homology with known mammals UCP1 gene (Fig. 2A). This bioinformatics analyses indicate speciesspecific UCP1 antibody is critical in determining the presence of UCP1 protein. Therefore we prepared a rabbit anti-pig UCP1 antibody so that we can accurately study UCP1 protein in pig adipose tissue. We first cloned pig UCP1 gene exons 1, 2 and constructed pET-28a(þ) recombinant vector (Fig. 2B). Then, recombinant pET28a(þ)-pig UCP1 vector was transformed into E. coli BL21 (E. coli
Fig. 1. Only exons 1 and 2 of the UCP1 gene are transcribed in pig adipose tissue. (A) Schematic showing for the location of primers on the UCP1 gene. (B) Agarose gel electrophoresis of PCR products of 4 pairs of primers as shown in Figure 1A. Using cDNA as template, only primers matching to exons 1 and 2 produced PCR products. For each primer pair, the left lane is the PCR product using genomic DNA as template and the right lane used adipose tissue cDNA as template. (C) 30 RACE-PCR result confirms pig UCP1 gene transcribes only exons 1 and 2. 30 RACE-PCR was used to detect 30 end sequence of pig UCP1 mRNA. cDNA are generated by using an Oligo-dT primer with a specific adaptor sequence to the primer 50 end. PCR amplifies 30 cDNA by primer F1 (Figure 1A), a known conserved region of UCP1 mRNA, and an anti-sense primer complementary to the specific adaptor sequence. GAPDH was used as positive control. (D) Blasted pig UCP1 gene mRNA 30 RACE-PCR product with pig UCP1 gene sequence.
Please cite this article in press as: L. Hou, et al., Pig has no uncoupling protein 1, Biochemical and Biophysical Research Communications (2017), http://dx.doi.org/10.1016/j.bbrc.2017.04.118
4
L. Hou et al. / Biochemical and Biophysical Research Communications xxx (2017) 1e6
Fig. 2. Purified pig UCP1 protein used for antibody preparation. (A) Pig UCP1 is relatively diverged from the gene in other species, such as goat, mice or human during evolution. The phylogenetic tree was drawn using MEGA6. (B) Cloned pig UCP1 gene exons 1 and 2 (about 300bp, the fourth lane), and construct pET-28a(þ) recombinant vector (the fifth and sixth lanes). Lanes 1e7 represent DL 10,000,pET-28a(þ), double digested pET-28a(þ), double digested pig UCP1 gene exon 1 and 2, pET-28a(þ) -pig UCP1 recombinant vector, double digested pET-28(þ) -pig UCP1 recombinant vector, DL 2000, respectively. (C) Purified pig UCP1 protein from E. coli BL21 carrying the recombinant pET-28a(þ) vector (E. coli BL21UCP1þ). Lanes 1e8 represent protein ladder, bacteria lysate, lysate flow-through, lysate flow-through second time, buffer B washed, buffer C washed, eluted the first time, eluted second time, respectively.
BL21(þ)-UCP1þ). E. coli BL21 expresses pig UCP1 protein in the presence of isopropyl-b-d-thiogalactoside. As shown in Fig. 2C, through high-affinity Ni-NTA resin, we isolated the cloned pig UCP1 protein (lane 7 and lane 8 in Fig. 2C), with molecular weight about 15KD. Then, we tested the specificity of UCP1 antibody by Western blot. We found our antibody can hybridize with mice UCP1 (about 35 KD) and cloned pig UCP1 (about 15 KD) expressed by E. coli BL21-UCP1þ (Fig. 3A). And as shown in Fig. 3A our antibody has no non-specific hybridization with other proteins with the molecular weight between 15 and 35 KD. We then used our antibody to examine UCP1 protein expression in different pig adipose tissues. As shown in Fig. 2B, we could not detect UCP1 protein in any of the pig adipose tissues we examined. These results unequivocally indicate that only the first two exons of the truncated UCP1 gene are transcribed, but neither is translated in the pig adipose tissues. 3.4. Pig adipocytes have no uncoupled respiration To further confirm that there is no UCP1 protein in the pig adipose tissues, we isolated the visceral and subcutaneous adipocytes
to examine the uncoupling respiration rate. As shown in Fig. 4B, mice BAT with functional UCP1 still have oxygen consumption in the presence of oligomycin (an ATP synthase inhibitor); but for the negative control, C2C12 cell line which has no UCP1, we did not detect any oxygen consumption in the presence of oligomycin (Fig. 4A). We also did not detect any oxygen consumption after treating pig subcutaneous and visceral adipocytes with oligomycin, which suggests pig adipose tissues do not have UCP1 (Fig. 4C and D). Since UCP1, the unique functional marker for brown adipose tissue, is not detected in pig adipose tissue, we conclude pig has no brown adipose tissue. 4. Discussion Increasing energy expenditure represents an efficient means for animal resistance to cold environment and combating obesity [17,18]. Increasing non-shivering thermogenic capacity through activating BAT or obtaining BAT-like characteristics in WAT might be an excellent strategy for piglets defending against the cold environment or treating obesity in human [19,20]. However, little is known about the mechanism of piglet's poor thermogenic ability.
Fig. 3. Pig has no UCP1 protein in adipose tissues. (A) Cloned pig UCP1 antibody hybridized with mice UCP1 protein (about 35 KD) and pig UCP1 (about 15 KD) expressed by E. coli BL21-UCP1þ. Immunoblotting tests the specificity of the UCP1 antibody. Lanes 1e3 represent E. coli BL21-UCP1þ, mice BAT, and perirenal pig fat, respectively. (B) Antibody against cloned pig UCP1 protein did not detect any proteins in various pig adipose tissues from 1-day or 7-day old pigs. Lanes 1e13 represent mice BAT, E. coli BL21-UCP1þ, inguinal fat, interscapular fat, epididymal fat, retroperitoneal fat, supraclavicular fat, perirenal fat, neck fat, liver, muscle, E. coli BL21-UCP1þ and mice BAT, respectively. Mice BAT and E. coli BL21UCP1þ are used as positive control for mice UCP1 (the top band) and pig UCP1 (the lower band), respectively.
Please cite this article in press as: L. Hou, et al., Pig has no uncoupling protein 1, Biochemical and Biophysical Research Communications (2017), http://dx.doi.org/10.1016/j.bbrc.2017.04.118
L. Hou et al. / Biochemical and Biophysical Research Communications xxx (2017) 1e6
5
Fig. 4. Pig adipocytes have no uncoupled respiration. (AeD) Continuous measurement of oxygen consumption in C2C12 (A), mice BAT (B), pig subcutaneous adipocytes (C) and pig visceral adipocytes D) were determined by Oxygen Consumption/MitoMembrane Potential Dual Assay Kit. The MitoXpress-Xtra probe phosphorescent lifetime signal increases as the oxygen concentration decrease. N ¼ 3, Values are mean ± S.E.M.
Our results clearly indicate pig has no brown adipose tissue. Therefore, we have identified an experimental model to study whether this genetic defect can be repaired. BAT is essential for mammals to maintain body temperature homeostasis in cold environment. BAT-dependent non-shivering thermogenesis depends on the UCP1 [21]. As far as we know, antibodies used in all UCP1 gene studies were generated using UCP1 protein either from mouse or goat as antigens. But, the mouse or goat UCP1 is highly homologous with pig UCP2 or UCP3, it is difficult to confirm UCP1 expression in pig adipose tissues using antibodies generated with mouse or goat UCP1 protein as antigens [13,15]. Also, attention was focused only on the 35 KD protein in previous studies with Western blots. Our study shows pig UCP1 gene contains only three exons, which is in agreement with the result of Berg et al. [14]. Also, only exons 1 and 2 of the UCP1 gene are transcribed in pig adipocytes, which means the molecular weight of pig UCP1 protein should be smaller than 35 KD. We did detect the cloned pig UCP1 protein, about 15 KD, in our Western blots. As a member of the mitochondrial anion carrier protein family, UCP1 protein is homologous with the other members of the large family, including its tripartite structure and amino acid sequences [22]. The UCP1 protein contains three topological areas. The first topological domain is about 100 amino acids at amino terminus involved in the binding of purine nucleotides. These residues are also found in the sister proteins UCP2 and UCP3. The other two topological areas are of particular interest since sequences of these two topological areas are fully conserved in all characterized species, but they are not found in any other mitochondrial anion carrier proteins. These sequences are in the middle of the central loop and the last part of the carboxyl terminus, about 200 amino acids [23,24]. The actual function of these conserved sequences is not entirely known yet, but the uniqueness and conservation of the last two topological domains of UCP1 indicate that they could be essential for UCP1 protein function. Therefore, specific antibodies should be preferably designed to react to these sequences.
However, our data show pig UCP1 protein has only about 100 amino acids located at the amino terminus of the intact UCP1 protein. We used these purified pig UCP1 protein as antigen for antibody production. Our results, using the cloned pig UCP1 antibody, clearly demonstrated UCP1 does not exist in the pig adipose tissues. Our antibody also detected a protein about 50 KD; a similarly sized protein was also detected in the study by Trayhurn et al. [13]. Since UCP1 is a member of the mitochondrial anion carrier protein family, the non-specific binding is likely attributed to its cross-hybridization with another member of the mitochondrial anion carrier protein family. In conclusion, from the DNA, mRNA, protein and functional levels we clearly show pigs have no UCP1. Thus, we have resolved the long-standing controversy of whether pigs have brown adipose tissues: they do not. Conflict of interest The authors declare no conflict of interest. Acknowledgements This work was supported by the National High Technology Research and Development Program 863 (#2013AA102502); the National Natural Science Foundation of China (#31372283); The Team Project of Guangdong Agricultural Bureau (#2016LM2148) and the Natural Fund Key Projects of Guangdong Province (#2015A030311006). C.H. is supported by the USDA National Institute of Food and Agriculture, Hatch project HAW-H2037, managed by the College of Tropical Agriculture and Human Resources, University of Hawaii at Manoa. Transparency document Transparency document related to this article can be found online at http://dx.doi.org/10.1016/j.bbrc.2017.04.118.
Please cite this article in press as: L. Hou, et al., Pig has no uncoupling protein 1, Biochemical and Biophysical Research Communications (2017), http://dx.doi.org/10.1016/j.bbrc.2017.04.118
6
L. Hou et al. / Biochemical and Biophysical Research Communications xxx (2017) 1e6
References [1] E.D. Rosen, B.M. Spiegelman, What we talk about when we talk about fat, Cell 156 (2014) 20e44. [2] V. Peirce, S. Carobbio, A. Vidal-Puig, The different shades of fat, Nature 510 (2014) 76e83. [3] G. Zhang, Q. Sun, C. Liu, Influencing factors of thermogenic adipose tissue activity, Front. Physiol. 7 (2016). [4] K.A. Virtanen, BAT thermogenesis: linking shivering to exercise, Cell Metab. 19 (2014) 352e354. [5] J. Wu, P. Cohen, B.M. Spiegelman, Adaptive thermogenesis in adipocytes: is beige the new brown? Genes & Dev. 27 (2013) 234e250. [6] S. Kajimura, P. Seale, B.M. Spiegelman, Transcriptional control of brown fat development, Cell Metab. 11 (2010) 257e262. [7] B. Cannon, J. Nedergaard, Brown adipose tissue: function and physiological significance, Physiol. Rev. 84 (2004) 277e359. [8] j. Wu, P. Bostrom, L.M. Sparks, L. Ye, J.H. Choi, A.-H. Giang, M. Khandekar, K.A. Virtanen, P. Nuutila, G. Schaart, K. Huang, H. Tu, W.D.v.M. Lichtenbelt, J. Hoeks, S. Enerbaeck, P. Schrauwen, B.M. Spiegelman, Beige adipocytes are a distinct type of thermogenic fat cell in mouse and human, Cell 150 (2012) 366e376. [9] S. Ojha, L. Robinson1, M. Yazdani1, Brown adipose tissue genes in pericardial adipose tissue of newborn sheep are downregulated by maternal nutrient restriction in late gestation, Basic Sci. Investigation 88 (2012). [10] M.E. Lidell, M.J. Betz, O.D. Leinhard, M. Heglind, L. Elander, M. Slawik, T. Mussack, D. Nilsson, T. Romu, P. Nuutila, K.A. Virtanen, F. Beuschlein, A. Persson, M. Borga, S. Enerback, Evidence for two types of brown adipose tissue in humans, Nat. Med. 19 (2013) 631e634. [11] A. Omachi, Y. Matsushita, K. Kimura, M. Saito, Role of uncoupling protein 1 in the anti-obesity effect of beta3-adrenergic agonist in the dog, Res. Vet. Sci. 85 (2008) 214e219. [12] M.J. Dauncey, F.B. Wooding, D.L. Ingram, Evidence for the presence of brown adipose tissue in the pig, Res. Vet. Sci. 31 (1981) 76e81.
[13] P. Trayhurn, N.J. Temple, J. Van Aerde, Evidence from immunoblotting studies on uncoupling protein that brown adipose tissue is not present in the domestic pig, Can. J. Physiol. Pharmacol. 67 (1989) 1480e1485. [14] F. Berg, U. Gustafson, L. Andersson, The uncoupling protein 1 gene (UCP1) is disrupted in the pig lineage: a genetic explanation for poor thermoregulation in piglets, PLos Genet. 2 (2006) 1178e1181. [15] A. Mostyn, L. Attig, T. Larcher, S. Dou, P. Chavatte-Palmer, M. Boukthir, A. Gertler, J. Djiane, M.E. Symonds, L. Abdennebi-Najar, UCP1 is present in porcine adipose tissue and is responsive to postnatal leptin, J. Endocrinol. 223 (2014) M31eM38. [16] M. Jastroch, L. Andersson, When pigs fly, UCP1 makes heat, Mol. Metab. 4 (2015) 359e362. [17] O. Boss, S.R. Farmer, Recruitment of brown adipose tissue as a therapy for obesity-associated diseases, Front. Endocrinol. (Lausanne) 3 (2012) 14. [18] A.L. Poher, J. Altirriba, C. Veyrat-Durebex, F. Rohner-Jeanrenaud, Brown adipose tissue activity as a target for the treatment of obesity/insulin resistance, Front. Physiol. 6 (2015) 4. [19] Y.H. Lee, Y.S. Jung, D. Choi, Recent advance in brown adipose physiology and its therapeutic potential, Exp. Mol. Med. 46 (2014) e78. [20] A. Fenzl, F.W. Kiefer, Brown adipose tissue and thermogenesis, Horm. Mol. Biol. Clin. Investig. 19 (2014) 25e37. [21] G. Argyropoulos, M.E. Harper, Uncoupling proteins and thermoregulation, J. Appl. Physiol. 92 (2002) 2187e2198. [22] J. Borecky, I.G. Maia, P. Arruda, Mitochondrial uncoupling proteins in mammals and plants, Biosci. Rep. 21 (2001) 201e212. [23] J. Nedergaard, V. Golozoubova, A. Matthias, A. Asadi, A. Jacobsson, B. Cannon, UCP1: the only protein able to mediate adaptive non-shivering thermogenesis and metabolic inefficiency, Biochim. Biophys. Acta 1504 (2001) 82e106. [24] K.S. Echtay, M. Bienengraeber, E. Winkler, M. Klingenberg, In the uncoupling protein (UCP-1) His-214 is involved in the regulation of purine nucleoside triphosphate but not diphosphate binding, J. Biol. Chem. 273 (1998) 24368e24374.
Please cite this article in press as: L. Hou, et al., Pig has no uncoupling protein 1, Biochemical and Biophysical Research Communications (2017), http://dx.doi.org/10.1016/j.bbrc.2017.04.118
Contents lists available at ScienceDirect
Biochemical and Biophysical Research Communications journal homepage: www.elsevier.com/locate/ybbrc
Pig has no uncoupling protein 1 Lianjie Hou a, Jia Shi a, Lingbo Cao a, Guli Xu a, Chingyuan Hu b, Chong Wang a, * a
National Engineering Research Center for Breeding Swine Industry, Guangdong Provincial Key Lab of Agro-Animal Genomics and Molecular Breeding, College of Animal Science, South China Agricultural University, Guangzhou, Guangdong, 510642, PR China b Department of Human Nutrition, Food and Animal Sciences, College of Tropical Agriculture and Human Resources, University of Hawaii at Manoa, 1955 East-West Road, AgSci. 415J, Honolulu, HI 96822, USA
a r t i c l e i n f o
a b s t r a c t
Article history: Received 16 April 2017 Accepted 22 April 2017 Available online xxx
Brown adipose tissue (BAT) is critical for mammal's survival in the cold environment. Uncoupling protein 1 (UCP1) is responsible for the non-shivering thermogenesis in the BAT. Pig is important economically as a meat-producing livestock. However, whether BAT or more precisely UCP1 protein exists in pig remains a controversy. The objective of this study was to ascertain whether pig has UCP1 protein. In this study, we used rapid amplification of cDNA ends (RACE) technique to obtain the UCP1 mRNA 30 end sequence, confirmed only exons 1 and 2 of the UCP1 gene are transcribed in the pig. Then we cloned the pig UCP1 gene exons 1 and 2, and expressed the UCP1 protein from the truncated pig gene using E. coli BL21. We used the expressed pig UCP1 protein as antigen for antibody production in a rabbit. We could not detect any UCP1 protein expression in different pig adipose tissues by the specific pig UCP1 antibody, while our antibody can detect the cloned pig UCP1 as well as the mice adipose UCP1 protein. This result shows although exons 1 and 2 of the pig UCP1 gene were transcribed but not translated in the pig adipose tissue. Furthermore, we detected no uncoupled respiration in the isolated pig adipocytes. Thus, these results unequivocally demonstrate that pig has no UCP1 protein. Our results have resolved the controversy of whether pigs have the brown adipose tissue. © 2017 Published by Elsevier Inc.
Keywords: Swine Brown adipose tissue UCP1 Uncoupling respiration
1. Introduction Mammals contain mainly two types of adipose tissues, white adipose tissue (WAT) and brown adipose tissue (BAT). WAT stores excess energy in the form of triglycerides when an animal's energy intake exceeds its energy expenditure. During starvation, WAT lipolysis provides energy to animals [1]. Brown adipose tissue contains multilocular fat droplets and many mitochondria, and is distinguished by its ability to dissipate energy in the form of heat [2]. BAT plays a significant role in newborns; they use this tissue for non-shivering thermogenesis to defend themselves against the cold environment [3]. BAT-dependent non-shivering thermogenesis is attributed to the uncoupling protein 1 (UCP1) [4e6]. UCP1 is a member of the of mitochondrial anion carrier proteins family and is a transmembrane protein with the size of approximately 35 KD. UCP1 disengages ATP synthesis from oxidative phosphorylation and dissipates energy as heat [7].
* Corresponding author. E-mail address: [email protected] (C. Wang).
Although BAT has been found in many mammals such as mice, human, goat, and dog [8e11]. However, whether brown adipose tissue exists in the pig is still a controversy. Brown adipocytes were found in different pig adipose tissues by microscopic and electron microscopic methods [12]. But this result was not supported by the immunoblotting study in another laboratory using the rabbit antirat UCP1 antibody [13]. The authors concluded that pigs have no brown adipose tissue, and all adipose tissues in the pig appear to be exclusively “white” [13]. More recently, Berg et al. (2006) determined the complete genome sequence of pig UCP1 gene by longrange PCR and genome walking. In this study, they found that exons 3 to 5 of the pig UCP1 gene were lost 20 million years ago; more than twenty pigs from different breeds of domestic pigs and wild boar were included in their study [14]. Thus, pig UCP1 gene contains only three exons: exons 1, 2 and 3, which are corresponding to the exons 1, 2 and 6 of the mouse UCP1 gene, respectively. By using a goat UCP1 antibody in their immunoblotting assay Mostyn et al. (2014) showed that UCP1 protein is present in pig adipose tissue and is responsive to postnatal leptin treatment [15]. However, Jastroch & Anderson (2015) believe the increased UCP1 protein in Mostyn's study (2014) may be explained by non-specific hybridization with other mitochondrial anion carrier proteins, such
http://dx.doi.org/10.1016/j.bbrc.2017.04.118 0006-291X/© 2017 Published by Elsevier Inc.
Please cite this article in press as: L. Hou, et al., Pig has no uncoupling protein 1, Biochemical and Biophysical Research Communications (2017), http://dx.doi.org/10.1016/j.bbrc.2017.04.118
2
L. Hou et al. / Biochemical and Biophysical Research Communications xxx (2017) 1e6
as UCP2 or UCP3 by the goat UCP1 antibody [16]. Berg et al. (2006) only examined the UCP1 gene at genome level; they did not measure the UCP1 protein. By contrast, Mostyn and his colleagues measured only UCP1 protein by a rabbit anti-goat UCP1 antibody; they did not study the UCP1 gene structure or its transcript. Therefore, in this study, we examined the UCP1 gene structure and determined whether pig UCP1 gene is being transcribed, translated and functional.
Table 2 Antibody validation profile.
2. Materials and methods
medium - DMEM/F12 (GIBCO, Grand Island, NY, USA) containing 15% fetal bovine serum (FBS, GIBCO), 100,000 units/L of penicillin sodium and 100 mg/L of streptomycin sulfate (GIBCO). And they were plated in 75 cm2 cell culture flasks. For plasmid transfection, primary adipocytes with 60% confluency were incubated with the plasmid for 6 h in the growth medium. Then the medium was replaced with new growth medium and cells were maintained in growth medium for an additional 24 h. Then the medium was replaced with new growth medium and cells were maintained in growth medium for an additional 12 h before adipogenic differentiation induction. Pre-adipocytes were induced to differentiation by the induction medium containing 10% FBS, 0.5 mM isobutylmethylxanthine, 0.25 mM dexamethasone, 1 mg/mL insulin, 1 nM T3 and 1 mM rosiglitazone for 48 h. Two days later, cells were switched to a different medium containing 10% FBS, 1 mg/mL insulin and 1 nM T3. Differentiated cells were used for gene expression and uncoupling respiration assays. All chemicals for cell culture were purchased from Sigma-Aldrich (St. Louis, Missouri, USA).
All animal use protocols were approved by the College of Animal Science, South China Agricultural University. All experiments were performed in accordance with relevant guidelines and regulations of ‘the instructive notions with respect to caring for laboratory animals’ issued by the Ministry of Science and Technology of the People's Republic of China. 2.1. Tissue sampling Male Landrace pigs (1 day and 7 days of age) were euthanized via intraperitoneal injection of pentobarbital sodium (40 mg/kg body weight) followed by exsanguinations. One gram of tissues from the fat pad in various locations, muscle, heart, liver, spleen, lung, and kidney were collected and stored at 80 C until assayed. 2.2. RNA extraction and PCR analysis Total RNAs were extracted from tissue or adipocytes using TRIzol reagent (Invitrogen, Carlsbad, CA, USA) according to the manufacturer's instructions. Then total RNAs (0.5 mg) were reverse transcribed to cDNA by PrimeScript™ RT Master Mix (TaKaRa, Otsu, Shiga, Japan) according to the manufacturer's instructions. General-PCR products were sequenced and blasted them with gene sequences deposit in NCBI to ensure the primers were specific. SYBR Green Real-time PCR Master Mix reagents (Toyobo Co., Ltd., Osaka, Japan) were used for real-time quantitative polymerase chain reaction (PCR), and PCR reactions were performed using a Mx3005p instrument (Stratagene, La Jolla, CA, USA). Relative expression of mRNAs was normalized to b-actin levels using the DDCt method. Primers were designed using Primer Premier 5 according to the pig gene sequence obtained from NCBI. Primers used for PCR in this study were shown in Table 1. 2.3. Cell culture The pig preadipocytes used in primary culture were isolated from the subcutaneous back and visceral fat pad of 1-day male Landrace pigs. Adipose tissue was dissected and finely minced after removing all visible connective tissues. Then the minced tissue was digested for 40 min at 37 C in isolation buffer (125 mM NaCl, 5 mM KCl, 1.3 mM CaCl2, 5 mM glucose, 100 mM HEPES, 4% BSA, 1.5 mg/ mL Collagenase B). Digested tissue was filtered through a 70 mm cell strainer to remove large pieces, and the flow-through was centrifuged for 10 min at 500 g to collect stromal-vascular fraction (SVF) cells in the pellet. The SVF cells were suspended in growth
Primary antibody
Clone
Company
Catalog No.
Dilution
UCP1 b-Actin Secondary antibody Goat Anti-rabbit IgG
Polyclonal Monoclonal Conjugate Used HRP
Bioss Bioss Company Bioss
bs-1925R bsm-33036 M Catalog No. bs-0295G
1:700 1:1000 Dilution 1:5000
2.4. Immunoblotting Homogenized tissues were lysed in RIPA buffer containing protease inhibitors (1 mM PMSF). These protein lysates were separated with SDS-PAGE and then electroblotted to polyvinylidene fluoride. Electrophoresis supplies were purchased from Bio-Rad (California, USA). The membranes were blocked for 2 h at room temperature and incubated with different antibodies overnight at 4 C, followed by incubation with horseradish peroxidaseconjugated secondary antibodies at room temperature for 1 h. The antibodies used in this study are listed in Table 2. 2.5. Preparation of pig UCP1 antibody Pig UCP1 gene exons 1 and 2 were cloned into pET-28a (þ) recombinant vector. Recombinant pET-28a (þ) vectors were transformed into E. coli BL21 (E. coli BL21-UCP1þ). Isopropyl-b-dthiogalactoside was used to induce E. coli BL21 to express truncated pig UCP1 protein (pig UCP1 protein). The pig UCP1 protein was purified by high-affinity Ni-NTA resin according to the manufacturer's instructions. We used the purified protein as antigen for antibody production. First, 1 mg antigen with Freund's complete adjuvant was injected into a 1.5 months old New Zealand rabbit. A second 1 mg antigen with Freund's incomplete adjuvant was injected four weeks later. One ml blood from the ear vein was collected every week to determine the UCP1 antibody titer in serum. At the eighth week, New Zealand rabbit was anesthetized via intraperitoneal injection of chloral hydrate (100 mg) followed
Table 1 Primers used for PCR analyses. Gene name
Forward primer sequence (50 -30 )
Reverse primer sequence (50 -30 )
Primer Primer Primer Primer
GGTCACCGCCAAAGTCCG GCTGGCAAAGAGAGAAGGG TCCTGCGAACAATCACTACTCT CGCACACCGCCAAAGTC
CAGCCCTCTGTAGTGCTTCATT TGGATGGTAACATAGAGGCTGA TCCTGCGAACAATCACTACTCT ATGCCAGTCACCAGAAGGAA
1 2 3 4
Please cite this article in press as: L. Hou, et al., Pig has no uncoupling protein 1, Biochemical and Biophysical Research Communications (2017), http://dx.doi.org/10.1016/j.bbrc.2017.04.118
L. Hou et al. / Biochemical and Biophysical Research Communications xxx (2017) 1e6
by blood collection. Purified UCP1 antibody was isolated from serum by Protein AeAgarose according to the manufacturer's instructions (Cwbiotech, Beijing, China). 2.6. Determination of cellular respiration The oxygen consumption rate of the pig adipocytes was determined by Oxygen Consumption/MitoMembrane Potential Dual Assay Kit according to the manufacturer's instructions (Cayman, Michigan, USA). 2.7. Statistical analysis All data are expressed as means ± standard error of the mean (S.E.M.). Significant differences between the control and treated groups were determined by Student's t-test (SPSS 18.0, Chicago, IL, USA). Differences were considered significant at the P<0.05 (*) and very significant at P<0.01 (**). 3. Results
3
3.2. Only exons 1 and 2 of the UCP1 gene are transcribed in pig adipose tissues Using pig adipose tissues cDNA as template, Primer pair 1 and primer pair 2 produced corresponding PCR products using cDNA as template, but primer pair 3 and primer pair 4 did not. When the antisense primers (R3 and R4) are matched to the exon 3 of UCP1 gene, while the sense primers (F4 and F3) matched to exons 1 and 2, cDNA template failed to produce any PCR products (Fig. 1B). These results imply that only exons 1 and 2 of UCP1 pseudogene were transcribed in the pig. So we used rapid amplification of cDNA ends (RACE) technique to obtain the UCP1 mRNA 30 end sequence (Fig. 1C). We sequenced the 30 RACE-PCR product and blasted it with Sus scrofa UCP1 pseudogene sequence on NCBI. As shown in Fig. 1D, the 30 RACE-PCR products contain only exons 1, 2 and a DNA region outside the exon 3. These results clearly demonstrated that only exons 1 and 2 of UCP1 gene are transcribed in pig adipose tissue.
3.3. Truncated pig UCP1 mRNA is not translated in pig different adipose tissues
3.1. Pig UCP1 gene contains only three exons Since whether UCP1 exists in pig has never been conclusively established, we first examined UCP1 gene structure and its transcript in the pig. We designed four pairs of primers based on pig UCP1 pseudogene sequence obtained from Berg’ research to determine the UCP1 gene structure and its transcript in pigs, and the primer locations on the UCP1 gene are shown in Fig. 1A. The four primer pairs produced four corresponding PCR products using genome DNA as template (Fig. 1B). We sequenced the PCR products and blasted them with Berg’ UCP1 pseudogene sequence; this result demonstrated pig UCP1 gene only contains three exons.
We know only two exons of the pig UCP1 gene are being transcribed as shown in Fig. 1, but we do not know whether they are being translated or not. Through the phylogenic tree, we can see that pig UCP1 gene has low homology with known mammals UCP1 gene (Fig. 2A). This bioinformatics analyses indicate speciesspecific UCP1 antibody is critical in determining the presence of UCP1 protein. Therefore we prepared a rabbit anti-pig UCP1 antibody so that we can accurately study UCP1 protein in pig adipose tissue. We first cloned pig UCP1 gene exons 1, 2 and constructed pET-28a(þ) recombinant vector (Fig. 2B). Then, recombinant pET28a(þ)-pig UCP1 vector was transformed into E. coli BL21 (E. coli
Fig. 1. Only exons 1 and 2 of the UCP1 gene are transcribed in pig adipose tissue. (A) Schematic showing for the location of primers on the UCP1 gene. (B) Agarose gel electrophoresis of PCR products of 4 pairs of primers as shown in Figure 1A. Using cDNA as template, only primers matching to exons 1 and 2 produced PCR products. For each primer pair, the left lane is the PCR product using genomic DNA as template and the right lane used adipose tissue cDNA as template. (C) 30 RACE-PCR result confirms pig UCP1 gene transcribes only exons 1 and 2. 30 RACE-PCR was used to detect 30 end sequence of pig UCP1 mRNA. cDNA are generated by using an Oligo-dT primer with a specific adaptor sequence to the primer 50 end. PCR amplifies 30 cDNA by primer F1 (Figure 1A), a known conserved region of UCP1 mRNA, and an anti-sense primer complementary to the specific adaptor sequence. GAPDH was used as positive control. (D) Blasted pig UCP1 gene mRNA 30 RACE-PCR product with pig UCP1 gene sequence.
Please cite this article in press as: L. Hou, et al., Pig has no uncoupling protein 1, Biochemical and Biophysical Research Communications (2017), http://dx.doi.org/10.1016/j.bbrc.2017.04.118
4
L. Hou et al. / Biochemical and Biophysical Research Communications xxx (2017) 1e6
Fig. 2. Purified pig UCP1 protein used for antibody preparation. (A) Pig UCP1 is relatively diverged from the gene in other species, such as goat, mice or human during evolution. The phylogenetic tree was drawn using MEGA6. (B) Cloned pig UCP1 gene exons 1 and 2 (about 300bp, the fourth lane), and construct pET-28a(þ) recombinant vector (the fifth and sixth lanes). Lanes 1e7 represent DL 10,000,pET-28a(þ), double digested pET-28a(þ), double digested pig UCP1 gene exon 1 and 2, pET-28a(þ) -pig UCP1 recombinant vector, double digested pET-28(þ) -pig UCP1 recombinant vector, DL 2000, respectively. (C) Purified pig UCP1 protein from E. coli BL21 carrying the recombinant pET-28a(þ) vector (E. coli BL21UCP1þ). Lanes 1e8 represent protein ladder, bacteria lysate, lysate flow-through, lysate flow-through second time, buffer B washed, buffer C washed, eluted the first time, eluted second time, respectively.
BL21(þ)-UCP1þ). E. coli BL21 expresses pig UCP1 protein in the presence of isopropyl-b-d-thiogalactoside. As shown in Fig. 2C, through high-affinity Ni-NTA resin, we isolated the cloned pig UCP1 protein (lane 7 and lane 8 in Fig. 2C), with molecular weight about 15KD. Then, we tested the specificity of UCP1 antibody by Western blot. We found our antibody can hybridize with mice UCP1 (about 35 KD) and cloned pig UCP1 (about 15 KD) expressed by E. coli BL21-UCP1þ (Fig. 3A). And as shown in Fig. 3A our antibody has no non-specific hybridization with other proteins with the molecular weight between 15 and 35 KD. We then used our antibody to examine UCP1 protein expression in different pig adipose tissues. As shown in Fig. 2B, we could not detect UCP1 protein in any of the pig adipose tissues we examined. These results unequivocally indicate that only the first two exons of the truncated UCP1 gene are transcribed, but neither is translated in the pig adipose tissues. 3.4. Pig adipocytes have no uncoupled respiration To further confirm that there is no UCP1 protein in the pig adipose tissues, we isolated the visceral and subcutaneous adipocytes
to examine the uncoupling respiration rate. As shown in Fig. 4B, mice BAT with functional UCP1 still have oxygen consumption in the presence of oligomycin (an ATP synthase inhibitor); but for the negative control, C2C12 cell line which has no UCP1, we did not detect any oxygen consumption in the presence of oligomycin (Fig. 4A). We also did not detect any oxygen consumption after treating pig subcutaneous and visceral adipocytes with oligomycin, which suggests pig adipose tissues do not have UCP1 (Fig. 4C and D). Since UCP1, the unique functional marker for brown adipose tissue, is not detected in pig adipose tissue, we conclude pig has no brown adipose tissue. 4. Discussion Increasing energy expenditure represents an efficient means for animal resistance to cold environment and combating obesity [17,18]. Increasing non-shivering thermogenic capacity through activating BAT or obtaining BAT-like characteristics in WAT might be an excellent strategy for piglets defending against the cold environment or treating obesity in human [19,20]. However, little is known about the mechanism of piglet's poor thermogenic ability.
Fig. 3. Pig has no UCP1 protein in adipose tissues. (A) Cloned pig UCP1 antibody hybridized with mice UCP1 protein (about 35 KD) and pig UCP1 (about 15 KD) expressed by E. coli BL21-UCP1þ. Immunoblotting tests the specificity of the UCP1 antibody. Lanes 1e3 represent E. coli BL21-UCP1þ, mice BAT, and perirenal pig fat, respectively. (B) Antibody against cloned pig UCP1 protein did not detect any proteins in various pig adipose tissues from 1-day or 7-day old pigs. Lanes 1e13 represent mice BAT, E. coli BL21-UCP1þ, inguinal fat, interscapular fat, epididymal fat, retroperitoneal fat, supraclavicular fat, perirenal fat, neck fat, liver, muscle, E. coli BL21-UCP1þ and mice BAT, respectively. Mice BAT and E. coli BL21UCP1þ are used as positive control for mice UCP1 (the top band) and pig UCP1 (the lower band), respectively.
Please cite this article in press as: L. Hou, et al., Pig has no uncoupling protein 1, Biochemical and Biophysical Research Communications (2017), http://dx.doi.org/10.1016/j.bbrc.2017.04.118
L. Hou et al. / Biochemical and Biophysical Research Communications xxx (2017) 1e6
5
Fig. 4. Pig adipocytes have no uncoupled respiration. (AeD) Continuous measurement of oxygen consumption in C2C12 (A), mice BAT (B), pig subcutaneous adipocytes (C) and pig visceral adipocytes D) were determined by Oxygen Consumption/MitoMembrane Potential Dual Assay Kit. The MitoXpress-Xtra probe phosphorescent lifetime signal increases as the oxygen concentration decrease. N ¼ 3, Values are mean ± S.E.M.
Our results clearly indicate pig has no brown adipose tissue. Therefore, we have identified an experimental model to study whether this genetic defect can be repaired. BAT is essential for mammals to maintain body temperature homeostasis in cold environment. BAT-dependent non-shivering thermogenesis depends on the UCP1 [21]. As far as we know, antibodies used in all UCP1 gene studies were generated using UCP1 protein either from mouse or goat as antigens. But, the mouse or goat UCP1 is highly homologous with pig UCP2 or UCP3, it is difficult to confirm UCP1 expression in pig adipose tissues using antibodies generated with mouse or goat UCP1 protein as antigens [13,15]. Also, attention was focused only on the 35 KD protein in previous studies with Western blots. Our study shows pig UCP1 gene contains only three exons, which is in agreement with the result of Berg et al. [14]. Also, only exons 1 and 2 of the UCP1 gene are transcribed in pig adipocytes, which means the molecular weight of pig UCP1 protein should be smaller than 35 KD. We did detect the cloned pig UCP1 protein, about 15 KD, in our Western blots. As a member of the mitochondrial anion carrier protein family, UCP1 protein is homologous with the other members of the large family, including its tripartite structure and amino acid sequences [22]. The UCP1 protein contains three topological areas. The first topological domain is about 100 amino acids at amino terminus involved in the binding of purine nucleotides. These residues are also found in the sister proteins UCP2 and UCP3. The other two topological areas are of particular interest since sequences of these two topological areas are fully conserved in all characterized species, but they are not found in any other mitochondrial anion carrier proteins. These sequences are in the middle of the central loop and the last part of the carboxyl terminus, about 200 amino acids [23,24]. The actual function of these conserved sequences is not entirely known yet, but the uniqueness and conservation of the last two topological domains of UCP1 indicate that they could be essential for UCP1 protein function. Therefore, specific antibodies should be preferably designed to react to these sequences.
However, our data show pig UCP1 protein has only about 100 amino acids located at the amino terminus of the intact UCP1 protein. We used these purified pig UCP1 protein as antigen for antibody production. Our results, using the cloned pig UCP1 antibody, clearly demonstrated UCP1 does not exist in the pig adipose tissues. Our antibody also detected a protein about 50 KD; a similarly sized protein was also detected in the study by Trayhurn et al. [13]. Since UCP1 is a member of the mitochondrial anion carrier protein family, the non-specific binding is likely attributed to its cross-hybridization with another member of the mitochondrial anion carrier protein family. In conclusion, from the DNA, mRNA, protein and functional levels we clearly show pigs have no UCP1. Thus, we have resolved the long-standing controversy of whether pigs have brown adipose tissues: they do not. Conflict of interest The authors declare no conflict of interest. Acknowledgements This work was supported by the National High Technology Research and Development Program 863 (#2013AA102502); the National Natural Science Foundation of China (#31372283); The Team Project of Guangdong Agricultural Bureau (#2016LM2148) and the Natural Fund Key Projects of Guangdong Province (#2015A030311006). C.H. is supported by the USDA National Institute of Food and Agriculture, Hatch project HAW-H2037, managed by the College of Tropical Agriculture and Human Resources, University of Hawaii at Manoa. Transparency document Transparency document related to this article can be found online at http://dx.doi.org/10.1016/j.bbrc.2017.04.118.
Please cite this article in press as: L. Hou, et al., Pig has no uncoupling protein 1, Biochemical and Biophysical Research Communications (2017), http://dx.doi.org/10.1016/j.bbrc.2017.04.118
6
L. Hou et al. / Biochemical and Biophysical Research Communications xxx (2017) 1e6
References [1] E.D. Rosen, B.M. Spiegelman, What we talk about when we talk about fat, Cell 156 (2014) 20e44. [2] V. Peirce, S. Carobbio, A. Vidal-Puig, The different shades of fat, Nature 510 (2014) 76e83. [3] G. Zhang, Q. Sun, C. Liu, Influencing factors of thermogenic adipose tissue activity, Front. Physiol. 7 (2016). [4] K.A. Virtanen, BAT thermogenesis: linking shivering to exercise, Cell Metab. 19 (2014) 352e354. [5] J. Wu, P. Cohen, B.M. Spiegelman, Adaptive thermogenesis in adipocytes: is beige the new brown? Genes & Dev. 27 (2013) 234e250. [6] S. Kajimura, P. Seale, B.M. Spiegelman, Transcriptional control of brown fat development, Cell Metab. 11 (2010) 257e262. [7] B. Cannon, J. Nedergaard, Brown adipose tissue: function and physiological significance, Physiol. Rev. 84 (2004) 277e359. [8] j. Wu, P. Bostrom, L.M. Sparks, L. Ye, J.H. Choi, A.-H. Giang, M. Khandekar, K.A. Virtanen, P. Nuutila, G. Schaart, K. Huang, H. Tu, W.D.v.M. Lichtenbelt, J. Hoeks, S. Enerbaeck, P. Schrauwen, B.M. Spiegelman, Beige adipocytes are a distinct type of thermogenic fat cell in mouse and human, Cell 150 (2012) 366e376. [9] S. Ojha, L. Robinson1, M. Yazdani1, Brown adipose tissue genes in pericardial adipose tissue of newborn sheep are downregulated by maternal nutrient restriction in late gestation, Basic Sci. Investigation 88 (2012). [10] M.E. Lidell, M.J. Betz, O.D. Leinhard, M. Heglind, L. Elander, M. Slawik, T. Mussack, D. Nilsson, T. Romu, P. Nuutila, K.A. Virtanen, F. Beuschlein, A. Persson, M. Borga, S. Enerback, Evidence for two types of brown adipose tissue in humans, Nat. Med. 19 (2013) 631e634. [11] A. Omachi, Y. Matsushita, K. Kimura, M. Saito, Role of uncoupling protein 1 in the anti-obesity effect of beta3-adrenergic agonist in the dog, Res. Vet. Sci. 85 (2008) 214e219. [12] M.J. Dauncey, F.B. Wooding, D.L. Ingram, Evidence for the presence of brown adipose tissue in the pig, Res. Vet. Sci. 31 (1981) 76e81.
[13] P. Trayhurn, N.J. Temple, J. Van Aerde, Evidence from immunoblotting studies on uncoupling protein that brown adipose tissue is not present in the domestic pig, Can. J. Physiol. Pharmacol. 67 (1989) 1480e1485. [14] F. Berg, U. Gustafson, L. Andersson, The uncoupling protein 1 gene (UCP1) is disrupted in the pig lineage: a genetic explanation for poor thermoregulation in piglets, PLos Genet. 2 (2006) 1178e1181. [15] A. Mostyn, L. Attig, T. Larcher, S. Dou, P. Chavatte-Palmer, M. Boukthir, A. Gertler, J. Djiane, M.E. Symonds, L. Abdennebi-Najar, UCP1 is present in porcine adipose tissue and is responsive to postnatal leptin, J. Endocrinol. 223 (2014) M31eM38. [16] M. Jastroch, L. Andersson, When pigs fly, UCP1 makes heat, Mol. Metab. 4 (2015) 359e362. [17] O. Boss, S.R. Farmer, Recruitment of brown adipose tissue as a therapy for obesity-associated diseases, Front. Endocrinol. (Lausanne) 3 (2012) 14. [18] A.L. Poher, J. Altirriba, C. Veyrat-Durebex, F. Rohner-Jeanrenaud, Brown adipose tissue activity as a target for the treatment of obesity/insulin resistance, Front. Physiol. 6 (2015) 4. [19] Y.H. Lee, Y.S. Jung, D. Choi, Recent advance in brown adipose physiology and its therapeutic potential, Exp. Mol. Med. 46 (2014) e78. [20] A. Fenzl, F.W. Kiefer, Brown adipose tissue and thermogenesis, Horm. Mol. Biol. Clin. Investig. 19 (2014) 25e37. [21] G. Argyropoulos, M.E. Harper, Uncoupling proteins and thermoregulation, J. Appl. Physiol. 92 (2002) 2187e2198. [22] J. Borecky, I.G. Maia, P. Arruda, Mitochondrial uncoupling proteins in mammals and plants, Biosci. Rep. 21 (2001) 201e212. [23] J. Nedergaard, V. Golozoubova, A. Matthias, A. Asadi, A. Jacobsson, B. Cannon, UCP1: the only protein able to mediate adaptive non-shivering thermogenesis and metabolic inefficiency, Biochim. Biophys. Acta 1504 (2001) 82e106. [24] K.S. Echtay, M. Bienengraeber, E. Winkler, M. Klingenberg, In the uncoupling protein (UCP-1) His-214 is involved in the regulation of purine nucleoside triphosphate but not diphosphate binding, J. Biol. Chem. 273 (1998) 24368e24374.
Please cite this article in press as: L. Hou, et al., Pig has no uncoupling protein 1, Biochemical and Biophysical Research Communications (2017), http://dx.doi.org/10.1016/j.bbrc.2017.04.118